Previous Article | Next Article ![]()
Molecular and Cellular Biology, October 1999, p. 6754-6764, Vol. 19, No. 10
Laboratory of Cellular and Molecular Biology,
Received 23 February 1999/Returned for modification 10 May
1999/Accepted 23 June 1999
Fibroblast growth factor receptors (FGFRs) are membrane-spanning
tyrosine kinases that have been implicated in a variety of biological
processes including mitogenesis, cell migration, development, and
differentiation. We identified a unique isoform of FGFR2 expressed as a
diffuse band with an unusually large molecular mass. This receptor is
modified by glycosaminoglycan at a Ser residue located immediately N
terminal to the acidic box, a stretch of acidic amino acids. The acidic
box and the glycosaminoglycan modification site are encoded by an
alternative exon of the FGFR2 gene. The acidic box appears
to play an important role in glycosaminoglycan modification, and the
presence of this domain is required for modification by heparan sulfate
glycosaminoglycan. Moreover, the presence of the first
immunoglobulin-like domain encoded by another alternative exon
abrogated the modification. The high-affinity receptor with heparan
sulfate modification enhanced receptor autophosphorylation, substrate
phosphorylation, and ternary complex factor-independent gene
expression. It also sustained mitogen-activated protein kinase activity
and increased eventual DNA synthesis, a long-term response to
fibroblast growth factor stimulation, at physiological ligand concentrations. We propose a novel regulation mechanism of FGFR2 signal
transduction through glycosaminoglycan modification.
Various types of growth factors bind
to heparin and heparan sulfate. It has been suggested that fibroblast
growth factors (FGFs) are stored and protected from proteolytic
degradation in the extracellular matrix and on the cell surface by
interaction with heparan sulfate proteoglycans, which thereby serve as
a reservoir of the growth factors (9, 26, 30, 33, 44, 45).
Heparan sulfate proteoglycans not only play such a modulatory role but are involved in the binding of FGF to its high-affinity receptors as an
essential component. Thornton et al. (42) demonstrated that
heparin potentiates the mitogenic activity of crude preparations of
FGF-1. Further studies of the interaction of FGF-1 with heparin suggested that the potentiation of mitogenic activity is caused by the
ability of heparin to increase the affinity of FGF-1 for its receptor
(35). It has recently been shown that free heparin or
heparan sulfate glycosaminoglycan (HSGAG) is required for high-affinity binding of FGF-2 to FGF receptor (FGFR) 1 expressed in heparan sulfate-deficient CHO cells (50). Based on these findings, a dual-receptor model has been proposed, in which a complex composed of a
classical protein-type receptor and a low-affinity
glycosaminoglycan-type receptor mediates the cellular responses to FGF
(15).
The FGF family of growth factors currently consists of 15 members:
FGF-1 (acidic FGF [aFGF]), FGF-2 (basic FGF), FGF-3 (INT-2), FGF-4
(HST; kaposi-FGF), FGF-5, FGF-6 (HST-2), FGF-7 (keratinocyte growth
factor [KGF]), FGF-8 (AIGF), FGF-9 (GAF), FGF-10, FGF-11 (FHF-1),
FGF-12 (FHF-2), FGF-13 (FHF-3), FGF-14 (FHF-4), and FGF-15 (1, 37,
47). FGFs have been shown to function as mitogens, angiogenic
factors, neurotrophic factors, oncogenes, motogens, and key factors for
several developmental processes. FGFs show differential binding to
FGFRs (28). FGFRs are members of a transmembrane tyrosine
kinase receptor superfamily. Four distinct FGFR genes, FGFR1, FGFR2, FGFR3, and
FGFR4, have been identified. A variety of isoforms are
generated by alternative splicing of these FGFR genes, which
contributes to the functional diversity of this receptor family
(13). While the extracellular domain of FGFRs determines ligand-binding specificity (24), the C-terminal domain
regulates the basal activity of the receptor (20). The
extracellular domain is composed of two or three immunoglobulin
(Ig)-like loops. In FGFR1 and FGFR2, Ig-2 and Ig-3 loops have been
shown to bind FGF-1 and FGF-2, respectively. The KGF receptor, an
isoform of FGFR2 generated by alternative splicing, binds KGF/FGF-7 at
its Ig-3 loop and FGF-1 at its Ig-2 loop, but not FGF-2. The KGF
receptor is referred to here as FGFR2-K, while FGFR2, which binds FGF-1 and FGF-2 with high affinity but not KGF/FGF-7, is designated FGFR2-B
to distinguish it from the KGF receptor. FGFR2-B and FGFR2-K differ
only in the second half of their Ig-3 domains, which are encoded by
alternative exons (13, 24). While both Ig-2 and Ig-3 loops
play major roles in FGF binding, no growth factors are known to bind to
the Ig-1 loop. In addition to these Ig domains, both the FGFR2-B and
FGFR2-K isoforms have variants containing or lacking an acidic box, a
domain consisting of a stretch of acidic amino acids, and surrounding
sequences in their ligand-binding domains. The functional significance
of the acidic box in FGFRs was not known.
We report here the identification of a unique isoform of FGFR2 which
exhibited a diffuse band with a much larger molecular mass than other
isoforms. This receptor was modified by glycosaminoglycans, and the
modification was regulated by alternative splicing of the receptor mRNA
that encodes the Ig-1 loop and the acidic domain. Moreover, we show
that both the HSGAG moiety and the receptor core protein are required
for high-affinity binding of FGF-1 and for enhanced and sustained
signal transduction. Thus, this receptor exhibits characteristics of a
dual-receptor system consisting of a cell surface heparin-like molecule
and FGFR tyrosine kinase in a single molecule.
Engineering of FGFR2 cDNA constructs.
A rat FGFR2-B isoform
containing two Ig loops and an acidic domain has been designated WT
(21) and used to construct FGFR2-B variants. A rat FGFR2-K
isoform (41) was used to construct FGFR2-K variants.
Deletions and mutations were created by three steps of PCR. The vector
used for expression of all the constructs was pCEV27 (25).
In the first step, a forward primer containing the sequence 5' to the
BamHI site of pCEV27 (5'-GGATCATTTAGGTGACACTAT-3') and a reverse primer containing the desired deletion or mutation (primer 1R [described below]) were used. The second step utilized a
forward primer containing the desired deletion or mutation (primer 2F
[described below]) and a reverse primer containing the sequence downstream of the BamHI site of FGFR2
(5'-TTCAGCCATGACTACT-3'). The third step employed the
forward primer of the first step and the reverse primer of the second
step with equal amounts of the products from the first and second steps
as a template. PCRs were 35 cycles of 1 min at 95°C, 2 min at 55°C,
and 2 min at 72°C. The products of these three steps were digested
with BamHI and ligated with the BamHI-digested
original construct containing pCEV27 and a part of FGFR2. The
orientations of FGFR2 variants in the vector were determined by several
restriction enzyme digestions. The nucleotide sequences of the final
products were confirmed by DNA sequencing. The following FGFR2-B and
FGFR2-K constructs were generated and designated as shown in Fig.
1: 3 Loop, FGFR2 with three Ig domains
and an acidic domain; WT, FGFR2 with two Ig domains (Ig-2 and -3) and
the acidic domain with an acidic box (a short stretch of acidic amino
acids [Fig. 1]) and a normal Ser-Ser-Gly amino acid sequence at the N
terminus of the acidic box; Reporter assays.
CHO-Ki cells in a 10-cm-diameter plate were
transiently cotransfected with 5 µg of FGFR2-K cDNA ( Detection of c-fos mRNA expression.
A mutant
CHO-Ki cell line carrying the pgsA-745 mutation, which is
deficient in glycosaminoglycan modification initiation, was provided by
J. D. Esko and designated CHO-745 (8). CHO-745 cells
were stably transfected with pCEV27 expression vector alone or a
construct containing the FGFR2-K isoform with two Ig domains ( Affinity-labeling of FGFR2 with 125I-FGF-1.
Affinity labeling was performed as described previously
(32). Cells were incubated at 4°C for 3.5 h with 10 ng of 125I-FGF-1/ml in the presence or absence of an excess
amount of unlabeled FGF-1 (R&D Systems Inc., Minneapolis, Minn.) in 1 ml of NIH Eagle's no. 2 medium (without bicarbonate) containing 20 mM
HEPES, pH 7.3, 0.3% bovine serum albumin, 0.5 mM MgSO4,
and 1 mM CaCl2. FGF receptors were then cross-linked with
radiolabeled ligand by exposing the cells to 0.3 mM disuccinimidyl
suberate (Pierce Chemical Co., Rockford, Ill.) in cold HEPES-buffered
saline (HBS) for 20 min, and the reaction was terminated by adding 250 µl of quenching buffer containing 10 mM Tris-HCl, pH 7.5, 200 mM
glycine, and 2 mM EDTA. After the reaction medium was aspirated, the
cells were washed three times in cold HBS and harvested in HBS
containing 1 mM phenylmethylsulfonyl fluoride (Pierce), 1 mM
N-ethylmaleimide, 0.1 mM EDTA, 10 µg of antipain/ml, 10 µg of pepstatin/ml, 10 µg of leupeptin/ml, and 10 µg of
aprotinin/ml (Calbiochem, San Diego, Calif.). The cells were separated
from the buffer by centrifugation and solubilized in 60 µl of cold
lysis buffer containing 10 mM Tris-HCl, pH 7.4, 0.25% Nonidet P-40
(Pierce), and the protease inhibitor mixture. Samples were boiled and
fractionated under reducing conditions in a discontinuous Laemmli
buffer system (18) by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) with an SDS-7% polyacrylamide
resolving gel and a 3% stacking gel. The gels were fixed and stained
with 0.13% Coomassie blue R-250 in 45% methanol, 45% water, and 10%
acetic acid overnight, destained with several changes of the same
solution, dried under vacuum, and then exposed to a PhosphorImager
screen overnight for autoradiography.
Immunoblotting of FGFR2 and phosphotyrosine.
NIH 3T3 cells
were stably transfected with various FGFR2 cDNA constructs or the
expression vector alone (pCEV27), and the transfected cells were
selected with G-418 as described previously (25). For
detection, NIH 3T3 or CHO-Ki cells transfected with the FGFR2-B or
FGFR2-K cDNA construct in pCEV27 expression vector were plated on
100-mm-diameter plates, incubated with FGF-1 or the vehicle alone, and
lysed in 300 µl of lysis buffer after the cells became 90 to 95%
confluent. The lysis buffer contained 20 mM Tris-HCl, pH 7.5, 150 mM
NaCl, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, 10 mM
sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium vanadate, 1 mM
phenylmethylsulfonyl fluoride, 10 µg of aprotinin/ml, and 10 µg of
leupeptin/ml. The lysate was mixed well and centrifuged at 14,000 rpm
for 10 min at 4°C in an Eppendorf S417C microcentrifuge. The
supernatant was separated, and its protein concentration was
determined. For immunoprecipitation, the supernatant containing 1 mg or
500 µg of protein was incubated with an anti-FGFR2 antibody (SA571;
1:100), a rabbit polyclonal antibody raised against the intracellular
domain of FGFR2, or 10 ml of agarose-conjugated anti-phosphotyrosine
monoclonal antibody (no. 16-101C; UBI) at 4°C for 2 h. For
immunoprecipitation of FGFR2, the mixture incubated with an anti-FGFR2
antibody was then incubated with 40 µl of GammaBind G-plus
(Pharmacia) at 4°C for 1 h with constant rotation. The GammaBind
G-plus immune complex or agarose-conjugated immune complex was washed
with 1 ml of lysis buffer three times by mixing them, centrifuging at
14,000 rpm for 2 to 3 min in an Eppendorf S417C microcentrifuge, and
aspirating the supernatant. The final pellet was resuspended in 2×
sample buffer, and the supernatant was boiled and fractionated by
discontinuous SDS-7% PAGE under reducing conditions. The fractionated
protein was electroblotted onto Immobilon P. FGFR2-B or FGFR2-K was
detected by autoradiography after the membrane was sequentially
incubated with a 1:500 dilution of the anti-FGFR2 antibody and a
1:1,000 dilution of 125I-protein A as described previously
(21) or by using ECL Western blotting detection reagents
(Amersham) after incubating the membrane with a 1:500 dilution of the
anti-FGFR2 antibody and a 1:2,000 dilution of horseradish
peroxidase-linked anti-rabbit Ig antibody (NIF824; Amersham) according
to the manufacturer's instructions. Phosphotyrosine was detected with
ECL Western blotting detection reagents after incubating with a 1:2,000
dilution of anti-phosphotyrosine monoclonal antibody (no. 05-321; UBI)
and a 1:2,000 dilution of horseradish peroxidase-linked anti-mouse Ig
antibody (Amersham). Whenever necessary, the same blotted membrane was
reprobed with other antibodies after the antibodies used for the first
detection were removed with 0.5 M glycine buffer (pH 2.5) and 0.05%
Tween 20.
Heparitinase and/or chondroitinase ABC digestion.
Cell
lysates from affinity-labeling samples were diluted at least 50-fold in
a 0.1 M Tris acetate buffer and treated with heparitinase (code 100703;
lot no. E95601; Seikagaku America, Rockville, Md.) and/or
chondroitinase ABC (code 100332; lot no. KE95702; Seikagaku America)
(final concentration, 10 mIU/ml) in 0.1 M Tris acetate buffer, pH 7.3, at 37°C for 1 h. In the case of treatment with heparitinase
alone, shark cartilage chondroitin sulfate (catalog no. 2307;
Calbiochem) was added to a final concentration of 50 µg/ml to protect
the samples from digestion by chondroitinases possibly contaminating
the heparitinase preparation. The enzyme-digested samples were dialyzed
against water overnight at 4°C and concentrated under vacuum before
being loaded onto a gel.
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Acidic Domain and First Immunoglobulin-Like Loop of
Fibroblast Growth Factor Receptor 2 Modulate Downstream Signaling
through Glycosaminoglycan Modification
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
A, FGFR2 with two Ig domains and the
acidic domain lacking the acidic box; ASG, FGFR2 with two Ig domains
and the acidic domain containing a mutated Ala-Ser-Gly sequence at the
N terminus of the acidic box; SAG, FGFR2 with two Ig domains and the
acidic domain, containing a mutated Ser-Ala-Gly sequence at the
N-terminus of the acidic box; and
AD, an FGFR2 isoform without the
acidic domain. The primers 1R and 2F for each construct are listed
below in a 5'-3' orientation. Primers 1R: 3 Loop,
ATCTGTGTCGTCCTCGTCATC (template, three-loop FGFR2-K);
A,
GTCTTCGGAGCTTCCAGATGAGATGGCATC; ASG,
CGTCATCTCCAGATGCGATGGCATCTTCTGG; SAG,
CGTCATCTCCAGCTGAGATGGCATC; and
AD,
TACGGTGCTCTTTCTGGTTCTAAAGTGGT. Primers 2F: 3 Loop,
CACAGATGCCATCTCATC;
A,
ATCTCATCTGGAAGCTCCGAAGACTTTGTC; ASG,
CCAGAAGATGCCATCGCATCTGGAGATGACG; SAG,
GATGCCATCTCAGCTGGAGATGACG; and
AD,
CACTTTAGAACCAGAAAGAGCACCGTACTGG.

View larger version (19K):
[in a new window]
FIG. 1.
FGFR2 constructs used in the present studies. The
transmembrane and intracellular domains are the same in all of the
constructs and the same as those of the clones previously reported
(41). FGFR2-B and FGFR2-K contain different sequences only
in the second half of the Ig-3 loop, which is shown by thick arcs. SSG,
ASG, or SAG is the amino acid sequence immediately N-terminal to the
acidic box. SSG represents the wild type sequence, while the other two
were generated by localized mutagenesis. The thick lines at the ends of
the N termini represent the common sequence including the signal
peptide. TM, transmembrane domain; A, acidic box; AD, acidic domain (an
amino acid sequence that is encoded by an exon and contains both SSG
and the acidic box).
AD type or WT
type) in pCEV27 and 3.5 µg of a reporter plasmid containing three
tandem copies of SRE.mutL and the luciferase-coding sequence as
described previously (23) by using 35 µl of Lipofectamine
(Life Technologies)/plate. SRE.mutL is the minimal serum response
factor (SRF)-binding site of the c-fos promoter lacking a
ternary complex factor (TCF) binding site (12). The cells
were plated in 24-well plates 24 h after transfection and kept in
a medium containing 2% fetal bovine serum. Twenty-four hours after the
cells were plated, they were exposed to 10 ng of FGF-1/ml for various
periods, washed with phosphate-buffered saline, and lysed in cell
culture lysis buffer (Promega) (200 µl/well). Luciferase activity was
determined with a Lumat LB 9501 luminometer (Berthold) with automatic
injection. For each sample, 20 µl of lysate and 100 µl of
luciferase substrate (Promega) were used. The values were normalized
for both protein content in each lysate and induction by 10% fetal
calf serum, which was regarded as maximal stimulation, in each
transfectant. The data were analyzed statistically by analysis of
variance (ANOVA) with StatView software (Abacus Concepts, Inc.).
AD
[Fig. 1]) as described previously (41). CHO-745
transfectants were maintained in Ham's F-12 medium supplemented with
10% fetal bovine serum and 450 µg of G418/ml. The cells were first
plated in the same medium in six-well plates for time course studies of
c-fos mRNA expression, and the medium was changed overnight to Ham's F-12 containing 3% fetal bovine serum. The cells were stimulated by FGF-1 (final concentration, 10 ng/ml) for the indicated period in the presence (final concentration, 0.1, 1, or 10 µg/ml) or
absence of heparin. The stimulation by FGF-1 was terminated by lysing
the cells, and total RNA was extracted by using RNA STAT-60 (TEL-TEST
B, Inc., Friendswood, Tex.) according to the company's protocol. Total
RNA (10 µg) was fractionated by 1% formaldehyde agarose gel, and
Northern blotting analysis was performed by conventional methods
(34). The DNA probes used for detecting c-fos and
cyclophilin mRNAs were kind gifts from T. Curran (5) and
P. E. Danielson (7), respectively. A PhosphorImager
(Molecular Dynamics) was used for autoradiography, and the image was
imported into NIH Image software for quantitative analysis of band intensities.
Analysis of MAP kinase activation.
For detecting
extracellular signal-regulated kinase (ERK) mitogen-activated protein
(MAP) kinase, NIH 3T3 cells were cultured in 6-well plates 3 days
before the experiments and incubated in serum-free medium for 24 h. The cells were exposed to 10 ng of FGF-1/ml for the periods
indicated and lysed in the same lysis buffer used for
immunoprecipitation of FGFR2. The cell lysates (50 µg of protein)
were fractionated by discontinuous SDS-12.5% PAGE under reducing
conditions and blotted onto Immobilon-P (Millipore) membrane. For
protein, either rabbit anti-phosphorylated ERK MAP kinase polyclonal
antibody (
-phosMAPK), which recognizes tyrosine 204-phosphorylated
MAP kinase, or rabbit anti-MAP kinase polyclonal antibody (
-MAPK)
was used as the first antibody, followed by an alkaline
phosphatase-conjugated anti-rabbit IgG according to the manufacturer's
instructions (PhosphoPlus MAPK antibody kit [catalog no. 9100]; New
England Biolabs) Chemiluminescence was detected after the addition of a
substrate of alkaline phosphatase (CDP-Star).
Induction of DNA synthesis. DNA synthesis was measured as reported previously (31). Ninety-six-well microtiter plates (no. 3596; Falcon) were precoated with human fibronectin (Collaborative Research) at 1 µg/cm2 prior to being seeded with NIH 3T3 cells. The cells were incubated without serum for 48 h before samples were added. Incorporation of [3H]thymidine into DNA was monitored during a 6-h period beginning 16 h after the addition of the samples.
Saturation binding. Saturation binding studies with 125I-FGF-1 were performed according to the methods described previously (2), and the binding data were analyzed with Ligand software (27). 125I-FGF-1, which was prepared by the Bolton-Hunter method and purified by heparin-Sepharose affinity chromatography (specific activity, 20 to 50 µCi/µg), was purchased from DuPont NEN (North Billerica, Mass.). The biological activity of the 125I-FGF-1 as measured by the thymidine incorporation assay described above always showed more than 90% of the potency of the unlabeled ligand.
| |
RESULTS |
|---|
|
|
|---|
Heparin or heparan sulfate glycosaminoglycan is required for
high-affinity binding of FGF to FGFR2 and c-fos mRNA
induction.
The addition of heparin is required for high-affinity
binding of FGF-2 to FGFR1 expressed in mutant CHO cells defective in HSGAG synthesis (50). To examine whether FGF-1 and FGFR2
show the same requirements in similar systems, we stably expressed an
isoform of FGFR2 containing Ig-2 and Ig-3 loops and the K exon sequence
in the Ig-3 domain (FGFR2-K;
AD [Fig. 1]) in a mutant cell line,
CHO-745, deficient in glycosaminoglycan chain initiation (8). Scatchard analysis of the FGF-1 saturation binding to the cells expressing FGFR2-K showed curvilinear plotting in the presence of heparin (Fig. 2A), suggesting
that multiple forms of complex with different affinities can be formed
between the ligand and the receptor by adding heparin, as reported
previously (29). To assess the effect of heparin on the
dissociation constant (Kd), we applied linear
regression to the Scatchard plots. Heparin increased the binding
affinity of FGF-1 to FGFR2-K in a dose-dependent fashion with
Kds of 2250, 450, and 200 pM at 0, 1, and 10 µg of heparin/ml, respectively. The increase of binding affinity by the addition of 10 µg of heparin/ml was more than 10-fold higher than
the basal level (Fig. 2A). Addition of chondroitin sulfate (up to 10 µg/ml) in place of heparin did not affect the binding affinity. Cells
expressing vector alone showed barely detectable levels of FGF-1
binding either with or without heparin (data not shown).
|
A high-molecular-mass FGFR2 species is created by glycosaminoglycan modification. During the course of expression cloning of oncogenes activated in osteosarcoma cells, we identified an FGFR2 variant with a large molecular mass generated by C-terminal fusion to a novel protein, FRAG1 (21). We have converted this constitutively activated FGFR2 to a wild type FGFR2 by replacing the rearranged C-terminal domain with the normal sequence and designated it FGFR2-WT. While the cDNA for the same FGFR2-WT isoform had already been cloned from stomach cancer and HeLa cells (3, 11), neither the receptor expression nor the glycosaminoglycan modification has been characterized for this FGFR2 isoform. When expressed in NIH 3T3 cells and analyzed by SDS-PAGE following cross-linking with 125I-FGF-1, this wild type receptor still showed a diffuse band with a mass larger than that predicted from the primary amino acid sequence (Fig. 3A). Since the broad band was suggestive of glycosaminoglycan modification of the receptor, we digested the cell surface receptor with heparitinase and chondroitinase ABC, which degrade glycosaminoglycan moieties. The enzyme treatment shifted the molecular mass of the receptor to ~130 kDa, which after subtraction of the mass of the ligand, corresponded well to the reported size of FGFR2 with Ig-2 and Ig-3 loops (Fig. 3A). These results indicated that the diffuse high-molecular-mass band of FGFR2-WT in these transfectants arises from glycosaminoglycan modification.
|
Glycosaminoglycan modification is determined by an alternative exon
encoding the acidic domain.
The extracellular domain of the wild
type FGFR2 modified by glycosaminoglycan contained the acidic domain
and Ig-2 and Ig-3 loops, as shown in Fig. 1. Two FGFR2 isoforms,
FGFR2-B and FGFR2-K, have different amino acid sequences in the second
half of the Ig-3 loop which are encoded by alternative exons, B and K,
respectively (24) (Fig. 1). We have found that the FGFR2-K
isoforms containing Ig-2 and Ig-3 loops, but lacking the acidic domain,
did not exhibit these glycosaminoglycan modifications (24,
25). Since the glycosaminoglycan-modified FGFR2 contained the
sequence derived from the B exon in its Ig-3 loop, the receptor is the
FGFR2-B isoform. Therefore, we reasoned that the B-exon-derived
sequence, or the acidic domain, determines the modification. To test
these possibilities, we constructed a set of FGFR2-K isoforms
containing (WT) or lacking (
AD) the acidic domain (Fig. 1) and
expressed these constructs in NIH 3T3 cells. As shown in Fig. 3B,
FGFR2-K-WT showed mobility similar to that of FGFR2-B-WT by SDS-PAGE,
suggesting that the B-exon-derived sequence is not responsible for the
modification. Although we previously found that the Ig-3 loop of
FGFR2-K (K-exon sequence) is weakly modified by glycosaminoglycans in a
parathyroid cell line (41), this sequence was not involved
in the major glycosaminoglycan modification detected here. In
contrast, an FGFR2-K isoform lacking the acidic domain
(FGFR2-K-
AD) was identified as a discrete band with a much smaller
molecular mass. These results indicated that the acidic domain is
involved in the glycosaminoglycan modification.
The Ser-Gly-acidic box motif is essential for glycosaminoglycan modification of FGFR2. Glycosaminoglycans modify core proteins at the Ser residue of a putative attachment site of Ser-Gly (8, 49). Close inspection of the amino acid sequence of the wild type two-loop FGFR2-B (FGFR2-B-WT) revealed a Ser-Ser-Gly sequence in the acidic domain. To examine whether this sequence is involved in the modification, we mutated the cDNA sequences of the amino acids in this site of FGFR2-B, as well as FGFR2-K (Fig. 1). The mutant receptors were stably expressed in NIH 3T3 cells, affinity-labeled with 125I-FGF-1, and subjected to treatments with heparitinase, an HSGAG-degrading enzyme, and/or chondroitinase ABC, a chondroitin sulfate glycosaminoglycan (CSGAG)-degrading enzyme. As shown in Fig. 3C, the broad band of FGFR2-B-WT was shifted to a smaller discrete band by the double digestion with heparitinase and chondroitinase ABC. Single digestions with either of the enzymes resulted in similar but incomplete shifts of the band, indicating that each FGFR2-B-WT molecule was modified by either HSGAG or CSGAG. Mutation of the first Ser residue in the Ser-Ser-Gly sequence did not alter the level of glycosylation by HSGAG or CSGAG (Fig. 3C and D). In contrast, mutation of the second Ser residue to Ala in the Ser-Ser-Gly sequence abolished the modification by glycosaminoglycans (Fig. 3C), indicating that this Ser residue is essential for the modification. Thus, an FGFR2 molecule can be modified by either HSGAG or CSGAG at the single Ser residue adjacent to Gly. The population of FGFR2 molecules modified by CSGAG was predominant over that modified by HSGAG by about twofold.
To examine the effect of the acidic amino acid residues (acidic box) on the glycosaminoglycan modification, we constructed a deletion mutant, FGFR2-B-
A, which lacks the acidic box but retains the Ser-Ser-Gly
sequence. The modification of this receptor was drastically reduced
compared with FGFR2-B-WT (Fig. 3C). The glycosaminoglycan species
attached to the FGFR2-B-
A disappeared after chondroitinase ABC
digestion, but not after heparitinase digestion, indicating that most
of the molecules were modified by CSGAG alone. These findings suggest
that the presence of the acidic box is more critical for HSGAG
modification than for CSGAG modification. Essentially the same results
were obtained with FGFR2-K constructs containing these mutations (data
not shown).
To confirm that the entity detected by FGF-1 affinity labeling is FGFR2
and not comigrating proteoglycan, which can bind FGF-1 at a low
affinity, we used immunoblot analysis to detect FGFR2 before and after
enzyme digestion. All of the receptor species were comparably
expressed, as detected by immunoblotting with anti-FGFR2 antibodies
(Fig. 3D). The Ser residue adjacent to Gly was responsible for
modification by glycosaminoglycan. Enzyme digestion showed essentially
the same results as those detected by affinity labeling studies (Fig.
3E). The higher-resolution separation in this experiment revealed
faster-migrating species in every lane at a similar level regardless of
the enzyme digestion. Presumably they represent immature
non-carbohydrate-modified forms of FGFR2 which are not yet processed in
the Golgi.
Based on the above findings, we concluded that the Ser residue of the
Ser-Gly-acidic box motif in FGFR2 is covalently modified by either
HSGAG or CSGAG, with a slight predominance of CSGAG, and that the
acidic box is a prerequisite for modification by HSGAG.
The first Ig domain of FGFR2 inhibits glycosaminoglycan modification. The common Ig-2 loops of FGFR2-B and FGFR2-K are known to bind FGF-1, and their distinct Ig-3 loops bind FGF-2 and KGF/FGF-7, respectively (24). However, no ligand has been identified that binds to the Ig-1 loop. The FGFR2-B and FGFR2-K isoforms with three Ig domains contain the acidic domain between the Ig-1 and Ig-2 domains. To examine the effect of Ig-1 on glycosaminoglycan modification of the receptor, we performed similar enzyme digestion experiments after cross-linking the receptor with 125I-FGF-1. Interestingly, the FGFR2-B isoform with three Ig domains was not modified by either HSGAG or CSGAG (Fig. 3C), despite the presence of the modification site in its acidic domain. Immunoprecipitation and immunoblotting studies with anti-FGFR2 antibodies before and after enzyme digestion also showed essentially the same results (Fig. 3E). These results indicate that the presence of the Ig-1 loop inhibits the glycosaminoglycan modification of FGFR2-B at the site within the acidic domain. Similar results were obtained with the FGFR2-K isoform containing three Ig domains (data not shown). Introduction of a mutation in a site responsible for the disulfide bond of the Ig-1 loop essentially abolished this negative effect of the modification (data not shown). Therefore, the Ig-1 domain appears to act as an inhibitor of glycosaminoglycan modification of both FGFR2-B and FGFR2-K.
Glycosaminoglycan-modified FGFR2 increases and sustains ligand-induced phosphorylation of the receptor and its substrates. The presence of covalently linked glycosaminoglycan chains in a two-loop FGFR2 containing the acidic domain suggested that this receptor species might function as a high-affinity receptor without the requirement of other cell surface heparin-like molecules. We reasoned that, in wild type CHO cells or in NIH 3T3 cells, the glycosaminoglycan-modified FGFR2 may be more potently stimulated by FGFs than unmodified receptor species, which require cell surface heparin-like molecules to function as high-affinity receptors.
We first examined the effect of FGF-1 on the time course of receptor autophosphorylation in NIH 3T3 cells expressing vector alone or various forms of FGFR2, including WT, SAG,
A, or 3 Loop. To quantitatively
estimate the phosphorylation levels of the receptor, samples were
treated by enzymes which degrade glycosaminoglycans before
electrophoresis. As shown in Fig. 4A,
cells expressing FGFR2-B-WT, which is a glycosaminoglycan-modified
form, showed increased phosphorylation of the receptor over those
expressing other forms of FGFR2, and the stimulation was sustained for
more than 6 h. The expression levels of the receptor did not
change over a 12-h period in cells expressing any forms of FGFR2-B
(Fig. 4B).
|
Glycosaminoglycan modification of FGFR2 results in sustained MAP kinase activation. Two parallel signaling pathways converge at the level of the serum-responsive element (SRE) to induce c-fos expression (12). Signals through Ras activate ERK MAP kinase pathways, which in turn activate TCF, which binds the SRE. Another signal through the Rho family of small GTPases results in activation of SRF, which binds the 3' half of SRE, designated SRE.mutL. Therefore, we first investigated the effect of FGF-1 on MAP kinase activation in NIH 3T3 cells expressing FGFR2-B-WT, its glycosaminoglycan modification site mutant (SAG), or the three-loop form with anti-phosphorylated ERK MAP kinase antibody (Fig. 5A and B). All of these FGFR2-B transfectants showed increased ERK activity compared to cells transfected with vector alone. Interestingly, NIH 3T3 cells expressing the FGFR2-B isoform with glycosaminoglycan modification (WT) showed sustained ERK MAP kinase phosphorylation of both p42 and p44 over a 4-h period, compared to those expressing mutant (SAG) or natural (3 Loop) receptors lacking HSGAG modification. The protein expression levels of all three FGFR2-B constructs were comparable (Fig. 3D). It is noteworthy that the cells expressing FGFR2-B with three Ig domains (3 Loop), which is not modified by glycosaminoglycan, exhibited the same time course as those expressing the mutant two-loop FGFR2-B (SAG) lacking the glycosaminoglycan modification site. These findings indicate that the activation of the MAP kinase pathway is sustained in the FGFR2 isoforms with glycosaminoglycan modification.
|
TCF-independent transcription is also potentiated by
glycosaminoglycan-modified FGFR2.
Although it is known that
FGFR2 can activate SRE through phosphorylation of TCF by ERK MAP
kinase, whether FGFRs can activate TCF-independent transcription is
still unknown. To examine TCF-independent activation of SRE, we
transfected CHO-Ki cells with FGFR2-K isoforms either containing or
lacking the acidic box together with a luciferase reporter DNA
construct containing SRE.mutL (12), which can be activated
by SRF but not by TCF. Exposure of the transfectants to FGF-1 resulted
in a three- to fivefold increase of luciferase activity over the basal
level (data not shown), indicating that FGFR2-K can activate
TCF-independent transcription upon FGF-1 stimulation. Cells expressing
the FGFR2-K isoform with the glycosaminoglycan modification domain
(FGFR2-K-WT) showed a higher peak and a more sustained time course than
those expressing an FGFR2-K isoform without the glycosaminoglycan
modification site (FGFR2-K-
AD) (Fig. 5C). In separate experiments,
cells expressing FGFR2-K-WT showed a luciferase activity increased over
the basal level for more than 4 h, while luciferase activity
decreased to the basal level within 3 h in FGFR2-K-
AD or
FGFR2-K-3Loop (data not shown). Similar amounts of receptor protein
were expressed in these two transfectants, as assessed by Western
blotting after immunoprecipitation from equal amounts of cell protein
(Fig. 5D). Cells transfected with a vector lacking SRE.mutL did not
show luciferase induction upon exposure to FGF-1 (data not shown).
Cells expressing FGFR2-K with three Ig domains (3 Loop), which is not
modified by glycosaminoglycan, exhibited a time course of luciferase
induction similar to that of the cells expressing the
AD isoform of
FGFR2-K. Essentially the same results were obtained with the
corresponding FGFR2-B constructs (data not shown). These results
indicate that glycosaminoglycan modification of FGFR2 promotes
sustained activation of TCF-independent transcription as well as the
ERK-mediated pathway.
Glycosaminoglycan modification potentiates induction of DNA
synthesis by FGF-1.
Since glycosaminoglycan-modified FGFR2
exhibited sustained activation of ERK activity and TCF-independent
transcription, we examined the effects of the glycosaminoglycan
modification of FGFR2 on a long-term biological effect of FGF by
measuring DNA synthesis. NIH 3T3 cells expressing FGFR2-B with
glycosaminoglycan modification (WT) showed a dose-dependent response of
DNA synthesis upon FGF-1 stimulation between 0.1 and 20 ng/ml (Fig.
6A). This response was almost completely
abolished in cells expressing FGFR2-B without glycosaminoglycan
modification (SAG), especially at low concentrations of FGF-1,
indicating that the receptor-linked glycosaminoglycan potentiates the
long-term response upon FGF-1 stimulation. In cells expressing the
FGFR2-B modified by CSGAG alone (
A), DNA synthesis was not induced
by FGF-1 at concentrations lower than 1 ng/ml, and only moderate
induction was observed at higher concentrations. Cells transfected with
vector alone exhibited a response similar to that by SAG-transfected
cells (data not shown). In contrast, platelet-derived growth factor
(PDGF) induced DNA synthesis similarly in all of these transfectants.
When the DNA synthesis stimulation by FGF-1 was compared with that by 3 ng of PDGF/ml in the same transfectants, the cells expressing
FGFR2-B-WT showed significantly higher values than did those expressing
FGFR2-B-SAG or FGFR2-B-
A at 1 and 1.5 ng of FGF-1/ml (Fig. 6B). The
expression levels of all receptor species used in these studies were
similar, as detected by immunoblotting with anti-FGFR2 antibodies
following immunoprecipitation of the receptors from equal amounts of
cell protein (Fig. 6C). All of these results indicate that HSGAG
modification of FGFR2 promotes more potent FGF-1 stimulation of DNA
synthesis and that cells expressing the modified receptor are
stimulated even at low concentrations of the ligand.
|
| |
DISCUSSION |
|---|
|
|
|---|
A number of FGFR2 isoforms generated by alternative splicing have been reported (13). These include FGFR2-B and FGFR2-K, with three Ig loops, and those with two Ig loops containing or lacking the acidic domain. However, the functions of the Ig-1 loop and the acidic domain were not known. We have identified a major glycosaminoglycan modification site in both FGFR2-B and FGFR2-K molecules. The modification site has been localized to the Ser residue of the Ser-Gly sequence immediately N-terminal to the acidic box in these FGFR2 isoforms. The sequence requirement of core proteins for glycosaminoglycan modification, especially by HSGAG, has been studied in several proteoglycans (16, 36, 51, 52). A Ser-Gly motif flanked by acidic residues appears to be required for HSGAG modification (51, 52). The localization of the modification site in FGFR2 that we report here is consistent with these results. In FGFR2, the Ser-Gly sequence and the acidic box are encoded by a single exon (13, 48). The acidic box in FGFR2 appears to be a prerequisite for HSGAG modification of the Ser residue in this Ser-Gly motif immediately N-terminal to the acidic box, while it is not absolutely required for CSGAG modification. These results suggest that the Ser-Gly-acidic box motif is crucial in promoting glycosaminoglycan attachment to FGFR2.
We have shown that only the two-loop isoforms containing the acidic domain can be modified by glycosaminoglycan. It was surprising that FGFR2-B and FGFR2-K, with three Ig loops, showed no modification by either HSGAG or CSGAG, even though they contain the required amino acid structural motif. This finding strongly suggests that the Ig-1 domain has an inhibitory effect on the glycosaminoglycan modification. The Ig-1 loop appears to be encoded by a single exon (13). An isoform containing the Ig-1 loop but not the acidic domain is not known. Based upon these results, we have concluded that the glycosaminoglycan modification of FGFR2 at the Ser residue N-terminal to the acidic box is regulated by alternative splicing: positively and negatively by exons encoding the acidic domain and the Ig-1 domain, respectively.
Since the four known FGFRs are closely related, they may also contain possible glycosaminoglycan modification sites. FGFR3 is likely to be subject to glycosaminoglycan modification, since it has a sequence similar to that of FGFR2, including the Ser-Gly-acidic box motif (14). FGFR1 is unlikely to be modified by glycosaminoglycan, since the Ser-Gly motif is located more than 15 amino acid residues to the N-terminal side of the acidic box and is encoded by the same exon as that for the Ig-1 loop (46). FGFR4 does not have any Ser-Gly motifs in the region flanking the acidic box. These features of FGFRs are conserved in mice, rats, and humans.
We have shown that glycosaminoglycan-modified FGFR2 exhibited an increased and sustained autophosphorylation and substrate phosphorylation and sustained responses to the two pathways leading to c-fos induction. In addition to the sustained activation of ERK MAP kinase, which mediates the TCF-dependent pathway for SRE activation, we found TCF-independent activation of SRE by FGFR2. The activity of this TCF-independent pathway was also increased and sustained in the cells expressing glycosaminoglycan-modified FGFR2. These findings suggest that the two pathways are simultaneously activated by FGFR2. Whereas both the ERK-mediated and the TCF-independent pathways lead to c-fos induction, they may synergize to augment the mitogenic activity of FGFR2. FGFR2 may regulate pathways controlled by Rho proteins, such as actin reorganization, since Rho family GTPases are known to regulate TCF-independent transcription (12). There appear to be some differences in the degree of phosphorylation of FGFR2 and its substrates and MAP kinase activation between the HSGAG-modified and unmodified receptors. However, it is known that phosphorylation of different sites of FGFR transmits different downstream signals (40). We previously found that the ligand-independent transforming activity of FGFR2 mutants is not well correlated either with the overall phosphorylation level of the receptor or with their effect on MAP kinase activation (20). The glycosaminoglycan modification of FGFR2 might have differential effects on its downstream pathways. Furthermore, MAP kinases, receptors, and receptor substrates should have different feedback regulation mechanisms for reversing phosphorylation. This might explain the apparent discrepancy in phosphorylation levels along the signal transduction pathway.
In accordance with the sustained activation of ERK MAP kinase and TCF-independent transcription, glycosaminoglycan-modified FGFR2 greatly potentiated induction of DNA synthesis, a long-term response by FGF stimulation. The glycosaminoglycan-modified FGFR2 responded to FGF-1 at concentrations as low as 0.1 ng/ml, while the receptors without glycosaminoglycan modification did not show any increase in DNA synthesis in this concentration range. The mutant receptor with CSGAG modification alone showed no response at low FGF-1 concentrations, although a small increase in DNA synthesis was observed at higher concentrations. Therefore, it is confirmed that HSGAG, rather than CSGAG, is important to enhance and sustain the signal transduction of FGFR2.
The presence of a low-affinity receptor, HSGAG, covalently bound to a high-affinity receptor, FGFR2, appears to increase the binding affinity of FGF to FGFR and thereby to enhance downstream signal transduction. An alternative explanation for the enhancement of FGFR2 signal transduction might be differences in receptor turnover caused by glycosaminoglycan modification of FGFR2. However, this is much less likely, though not excluded completely, since the expression level of the modified receptor was similar to those of the unmodified receptors during the course of 12 h of ligand exposure. The high-affinity FGF binding induced by HSGAG does not exclude other reported functions of the glycosaminoglycan. The glycosaminoglycan-modified receptor appears to be subject to oligomerization through the ligand bound to the glycosaminoglycan (39). Since the glycosaminoglycan is covalently attached to the high-affinity receptor, ligand accessibility to the receptor and subsequent receptor oligomerization would probably be elevated compared to the case where glycosaminoglycan is attached to other cell surface proteoglycans. Furthermore, the HSGAG on the receptor might also protect the ligand from degradation by proteases and thereby prolong the activation of FGFR, as reported for the cell surface HSGAG (6, 10, 19, 30, 33, 38).
Based on the data described here, we propose a model for an FGF dual-receptor system (Fig. 7). In cells where proteoglycans are not present, FGF-1 binds marginally to an isoform of FGFR2 that contains two Ig loops but no acidic box and transmits weak downstream signals (Fig. 7A). In cells which have proteoglycans on their surfaces, FGF-1 binds to FGFR2 with a high affinity through the help of the glycosaminoglycan moiety (Fig. 7B). The effect of proteoglycans to increase the FGF-1 binding affinity to FGFR2 can be mimicked by exogenously added heparin (Fig. 7C). A two-loop form of FGFR2 containing the acidic box can be modified by HSGAG, and the modified receptor can act as a high-affinity receptor without the assistance of cell surface proteoglycans or exogenously added heparin. This receptor can transmit potent signals, particularly at physiological or subphysiological ligand concentrations (Fig. 7D). The three-loop form of FGFR2 cannot be modified by glycosaminoglycans even though it contains the modification site, since the Ig-1 domain inhibits the modification (Fig. 7E). Therefore, it behaves the same way as the two-loop receptor without any glycosaminoglycan modification in ligand binding and in signal transduction and requires cell surface proteoglycan or exogenous heparin for potent ligand signaling.
|
The concentration of FGF-1 in vivo has not been extensively studied. The soluble concentrations of FGF-2 reported in the aqueous humor of the eye are on the order of 1 ng/ml (43). If the physiological concentration of the growth factor is typically less than 1 ng/ml, our results would predict that the FGFR2 isoform containing the acidic domain might be required for the stimulation of cells by FGF-1. These results suggest that the HSGAG-modified FGFR2 plays a critical role where responses to low concentrations of FGFs are critical. Is the sustained effect on intracellular signaling critical in cellular responses? In PC12 cells, many signal transduction events seem to be shared between differentiation and proliferation (4). EGF stimulation of PC12 cells results in transient ERK activation and leads to cell proliferation, while NGF stimulation of the same cells results in sustained ERK activation and leads to differentiation to sympathetic neurons. Marshall (22) proposed a model in which quantitative differences in ERK activation are translated into qualitative differences in transcription factor activation. FGFR is known to be expressed in various stages of embryonic development (40). At certain stages, the two-loop form containing the acidic domain, which can be modified by glycosaminoglycans, might be selectively expressed and might thus play critical roles in decisions of differentiation. We propose a novel regulation of FGFR2 glycosaminoglycan modification by alternative splicing and thereby of the signal transduction via FGFR2.
| |
ACKNOWLEDGMENTS |
|---|
We thank M. Yanagishita and J. H. Pierce for support and Jeffrey Esko, Tom Curran, and P. E. Danielson for the gifts of the CHO pgsA-745 cell line, rat c-fos cDNA, and rat cyclophilin cDNA, respectively.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Medicine, Wakayama Medical College, 811-1 Kimiidera, Wakayama, Wakayama 641-8509, Japan. Phone and fax: 81-734-41-0607. E-mail: ksaka{at}wakayama-med.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Baird, A. 1994. Fibroblast growth factors: activities and significance of non-neurotrophin neurotrophic growth factors. Curr. Opin. Neurobiol. 4:78-86[Medline]. |
| 2. |
Bottaro, D. P.,
J. S. Rubin,
D. Ron,
P. W. Finch,
C. Florio, and S. A. Aaronson.
1990.
Characterization of the receptor for keratinocyte growth factor: evidence for multiple fibroblast growth factor receptors.
J. Biol. Chem.
265:12767-12770 |
| 3. | Champion-Arnaud, P., C. Ronsin, E. Gilbert, M. C. Gesnel, E. Houssaint, and R. Breanthnach. 1991. Multiple mRNAs code for proteins related to the BEK fibroblast growth factor receptor. Oncogene 6:979-987[Medline]. |
| 4. | Chao, M. V. 1992. Growth factor signaling: where is the specificity? Cell 68:995-997[Medline]. |
| 5. | Curran, T., M. B. Gordon, K. L. Rubino, and L. C. Sambucetti. 1987. Isolation and characterization of the c-fos(rat) cDNA and analysis of post-translational modification in vitro. Oncogene 2:79-84[Medline]. |
| 6. | Damon, D. H., R. R. Lobb, P. A. D'Amore, and J. A. Wagner. 1989. Heparin potentiates the action of acidic fibroblast growth factor by prolonging its biological half-life. J. Cell. Physiol. 138:221-226[Medline]. |
| 7. | Danielson, P. E., S. Forss-Petter, M. A. Brow, L. Calavetta, J. Douglass, R. J. Milner, and J. G. Sutcliffe. 1988. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA 7:261-267[Medline]. |
| 8. | Esko, J. D. 1991. Genetic analysis of proteoglycan structure, function and metabolism. Curr. Opin. Cell Biol. 3:805-816[Medline]. |
| 9. |
Folkman, J., and M. Klagsbrun.
1987.
Angiogenic factors.
Science
235:442-447 |
| 10. | Gospodarowicz, D., and J. Cheng. 1986. Heparin protects basic and acidic FGF from inactivation. J. Cell. Physiol. 128:475-484[Medline]. |
| 11. |
Hattori, Y.,
H. Odagiri,
H. Nakatani,
K. Miyagawa,
K. Naito,
H. Sakamoto,
O. Katoh,
T. Yoshida,
T. Sugimura, and M. Terada.
1990.
K-sam, an amplified gene in stomach cancer, is a member of the heparin-binding growth factor receptor genes.
Proc. Natl. Acad. Sci. USA
87:5983-5987 |
| 12. | Hill, C. S., J. Wynne, and R. Treisman. 1995. The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81:1159-1170[Medline]. |
| 13. | Johnson, D. E., and L. T. Williams. 1993. Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res. 60:1-41[Medline]. |
| 14. |
Keegan, K.,
D. E. Johnson,
L. T. Williams, and M. J. Hayman.
1991.
Isolation of an additional member of the fibroblast growth factor receptor family, FGFR3.
Proc. Natl. Acad. Sci. USA
88:1095-1099 |
| 15. | Klagsbrun, M., and A. Baird. 1991. A dual receptor system is required for basic fibroblast growth factor activity. Cell 67:229-231[Medline]. |
| 16. |
Kokenyesi, R., and M. Bernfield.
1994.
Core protein structure and sequence determine the site and presence of heparan sulfate and chondroitin sulfate on syndecan-1.
J. Biol. Chem.
269:12304-12309 |
| 17. | Kouhara, H., Y. R. Hadari, T. Spivak-Kroizman, J. Schilling, D. Bar-Sagi, I. Lax, and J. Schlessinger. 1997. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89:693-702[Medline]. |
| 18. | Laemmli, U. K. 1970. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 19. | Lobb, R. R. 1988. Thrombin inactivates acidic fibroblast growth factor but not basic fibroblast growth factor. Biochemistry 27:2572-2578[Medline]. |
| 20. | Lorenzi, M. V., P. Castagnino, Q. Chen, M. Chedid, and T. Miki. 1997. Ligand-independent activation of fibroblast growth factor-2 by carboxy terminal alterations. Oncogene 15:817-826[Medline]. |
| 21. |
Lorenzi, M. V.,
Y. Horii,
R. Yamanaka,
K. Sakaguchi, and T. Miki.
1996.
FRAG1, a gene that potently activates fibroblast growth factor receptor by C-terminal fusion through chromosomal rearrangement.
Proc. Natl. Acad. Sci. USA
93:8956-8961 |
| 22. | Marshall, C. J. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179-185[Medline]. |
| 23. | Michieli, P., W. Li, M. V. Lorenzi, T. Miki, R. Zakut, D. Givol, and J. H. Pierce. 1996. Inhibition of oncogene-mediated transformation by ectopic expression of p21waf1 in NIH3T3 cells. Oncogene 12:775-784[Medline]. |
| 24. |
Miki, T.,
D. P. Bottaro,
T. P. Fleming,
C. L. Smith,
W. H. Burgess,
A. M.-L. Chan, and S. A. Aaronson.
1992.
Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene.
Proc. Natl. Acad. Sci. USA
89:246-250 |
| 25. |
Miki, T.,
T. P. Fleming,
D. P. Bottaro,
J. S. Rubin,
D. Ron, and S. A. Aaronson.
1991.
Expression cDNA cloning of the KGF receptor by creation of a transforming autocrine loop.
Science
251:72-75 |
| 26. |
Moscatelli, D.
1988.
Metabolism of receptor-bound and matrix-bound basic fibroblast growth factor by bovine capillary endothelial cells.
J. Cell Biol.
107:753-759 |
| 27. | Munson, P. J., and D. Rodbard. 1984. Computerized analysis of ligand binding data: basic principles and recent development, p. 117-145. In D. Rodbard, and G. Forti (ed.), Computers in endocrinology. Raven Press, New York, N.Y. |
| 28. |
Ornitz, D. M.,
J. Xu,
J. S. Colvin,
D. G. McEwen,
C. A. MacArthur,
F. Coulier,
G. Gao, and M. Goldfarb.
1996.
Receptor specificity of the fibroblast growth factor family.
J. Biol. Chem.
271:15292-15297 |
| 29. | Pantoliano, M. W., R. A. Horlick, B. A. Springer, D. E. Van Dyk, T. Tobery, D. R. Wetmore, J. D. Lear, A. T. Nahapetian, J. D. Bradley, and W. P. Sisk. 1994. Multivalent ligand-receptor binding interactions in the fibroblast growth factor system produce a cooperative growth factor and heparin mechanism for receptor dimerization. Biochemistry 33:10229-10248[Medline]. |
| 30. | Rosengart, T. K., W. V. Johnson, R. Friesel, R. Clark, and T. Maciag. 1988. Heparin protects heparin-binding growth factor-1 from proteolytic inactivation in vitro. Biochem. Biophys. Res. Commun. 152:432-440[Medline]. |
| 31. |
Rubin, J. S.,
H. Osada,
P. W. Finch,
W. G. Taylor,
S. Rudikoff, and S. A. Aaronson.
1989.
Purification and characterization of a newly identified growth factor specific for epithelial cells.
Proc. Natl. Acad. Sci. USA
86:802-806 |
| 32. |
Sakaguchi, K.
1992.
Acidic fibroblast growth factor autocrine system as a mediator of calcium-regulated parathyroid cell growth.
J. Biol. Chem.
267:24554-24562 |
| 33. |
Saksela, O.,
D. Moscatelli,
A. Sommer, and D. B. Rifkin.
1988.
Endothelial cell-derived heparan sulfate binds basic fibroblast growth factor and protects it from proteolytic degradation.
J. Cell Biol.
107:743-751 |
| 34. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. |
Schreiber, A. B.,
J. Kenney,
W. J. Kowalski,
R. Friesel,
T. Mehlman, and T. Maciag.
1985.
Interaction of endothelial cell growth factor with heparin: characterization by receptor and antibody recognition.
Proc. Natl. Acad. Sci. USA
82:6138-6142 |
| 36. |
Shworak, N. W.,
M. Shirakawa,
R. C. Mulligan, and R. D. Rosenberg.
1994.
Characterization of ryudocan glycosaminoglycan acceptor sites.
J. Biol. Chem.
269:21204-21214 |
| 37. |
Smallwood, P. M.,
I. Munoz-Sanjuan,
P. Tong,
J. P. Macke,
S. H. C. Hendry,
D. J. Gilbert,
N. G. Copeland,
N. A. Jenkins, and J. Nathans.
1996.
Fibroblast growth factor (FGF) homologous factors: new members of the FGF family implicated in nervous system development.
Proc. Natl. Acad. Sci. USA
93:9850-9857 |
| 38. | Sommer, A., and D. B. Rifkin. 1989. Interaction of heparin with human basic fibroblast growth factor: protection of the angiogenic protein from proteolytic degradation by a glycosaminoglycan. J. Cell. Physiol. 138:215-220[Medline]. |
| 39. | Spivak-Kroizman, T., M. A. Lemmon, I. Dikic, J. E. Ladbury, D. Pinchasi, J. Huang, M. Jaye, G. Crumley, J. Schlessinger, and I. Lax. 1994. Heparin-induced oligomerization of FGF molecules is responsible for FGF receptor dimerization, activation, and cell proliferation. Cell 79:1015-1024[Medline]. |
| 40. | Szebenyi, G., and F. Fallon. 1999. Fibroblast growth factors as multifunctional signaling factors. Int. Rev. Cytol. 185:45-106[Medline]. |
| 41. |
Takagi, Y.,
S. Shrivastav,
T. Miki, and K. Sakaguchi.
1994.
Molecular cloning and expression of the acidic fibroblast growth factor (aFGF) receptors of a rat parathyroid cell line (PT-r): change of extracellular calcium concentration induces an apparent translocation of the aFGF receptors specifically in the parathyroid cells.
J. Biol. Chem.
269:23743-23749 |
| 42. |
Thornton, S. C.,
S. N. Mueller, and E. M. Levine.
1983.
Human endothelial cells: use of heparin in cloning and long-term serial cultivation.
Science
222:623-625 |
| 43. | Tripathi, R. C., N. S. Borisuth, and B. J. Tripathi. 1992. Detection, quantification, and significance of basic fibroblast growth factor in the aqueous humor of man, cat, dog and pig. Exp. Eye Res. 54:447-454[Medline]. |
| 44. | Vigny, M., M. P. Ollier-Hartmann, M. Lavigne, N. Fayein, J. C. Jeanny, M. Laurent, and Y. Courtois. 1988. Specific binding of basic fibroblast growth factor to basement membrane-like structures and to purified heparan sulfate proteoglycan of the EHS tumor. J. Cell. Physiol. 137:321-328[Medline]. |
| 45. |
Vlodavsky, I.,
J. Folkman,
R. Sullivan,
R. Fridman,
R. Ishai-Michaeli,
J. Sasse, and M. Klagsbrun.
1987.
Endothelial cell-derived basic fibroblast growth factor: synthesis and deposition into subendothelial extracellular matrix.
Proc. Natl. Acad. Sci. USA
84:2292-2296 |
| 46. |
Wang, F.,
M. Kan,
G. Yan,
J. Xu, and W. L. McKeehan.
1995.
Alternately spliced NH2-terminal immunoglobulin-like loop I in the ectodomain of the fibroblast growth factor (FGF) receptor 1 lowers affinity for both heparin and FGF-1.
J. Biol. Chem.
270:10231-10235 |
| 47. |
Yamasaki, M.,
A. Miyake,
S. Tagashira, and N. Itoh.
1996.
Structure and expression of the rat mRNA encoding a novel member of the fibroblast growth factor family.
J. Biol. Chem.
271:15918-15921 |
| 48. | Yan, G., G. McBride, and W. L. McKeehan. 1993. Exon skipping causes alteration of the COOH-terminus and deletion of the phospholipase C gamma1 interaction site in the FGF receptor 2 kinase in prostate epithelial cells. Biochem. Biophys. Res. Commun. 194:512-518[Medline]. |
| 49. |
Yanagishita, M., and V. C. Hascall.
1992.
Cell surface heparan sulfate proteoglycans.
J. Biol. Chem.
267:9451-9454 |
| 50. | Yayon, A., M. Klagsbrun, J. D. Esko, P. Leder, and D. M. Ornitz. 1991. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 64:841-848[Medline]. |
| 51. |
Zhang, L.,
G. David, and J. D. Esko.
1995.
Repetitive ser-gly sequences enhance heparan sulfate assembly in proteoglycans.
J. Biol. Chem.
270:27127-27135 |
| 52. |
Zhang, L., and J. D. Esko.
1994.
Amino acid determinants that drive heparan sulfate assembly in a proteoglycan.
J. Biol. Chem.
269:19295-19299 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»