Molecular and Cellular Biology, October 1999, p. 6775-6787, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Department of Biochemistry, University of Iowa, Iowa City, Iowa 52242
Received 15 June 1999/Accepted 8 July 1999
| |
ABSTRACT |
|---|
|
|
|---|
Plasma membrane localization of Ras requires posttranslational
addition of farnesyl and palmitoyl lipid moieties to a C-terminal CaaX motif (C is cysteine, a is any aliphatic
residue, X is the carboxy terminal residue). To better
understand the relationship between posttranslational processing and
the subcellular localization of Ras, a yeast genetic screen was
undertaken based on the loss of function of a palmitoylation-dependent
RAS2 allele. Mutations were identified in an
uncharacterized open reading frame (YLR246w) that we have
designated ERF2 and a previously described suppressor of
hyperactive Ras, SHR5. ERF2 encodes a 41-kDa
protein with four predicted transmembrane (TM) segments and a motif
consisting of the amino acids Asp-His-His-Cys (DHHC) within a
cysteine-rich domain (CRD), called DHHC-CRD. Mutations within the
DHHC-CRD abolish Erf2 function. Subcellular fractionation and
immunolocalization experiments reveal that Erf2 tagged with a triply
iterated hemagglutinin epitope is an integral membrane protein that
colocalizes with the yeast endoplasmic reticulum marker Kar2. Strains
lacking ERF2 are viable, but they have a synthetic growth
defect in the absence of RAS2 and partially suppress the
heat shock sensitivity resulting from expression of the hyperactive
RAS2(V19) allele. Ras2 proteins expressed in an
erf2
strain have a reduced level of palmitoylation and
are partially mislocalized to the vacuole. Based on these observations,
we propose that Erf2 is a component of a previously uncharacterized Ras
subcellular localization pathway. Putative members of an Erf2 family of
proteins have been uncovered in yeast, plant, worm, insect, and
mammalian genome databases, suggesting that Erf2 plays a role in Ras
localization in all eucaryotes.
| |
INTRODUCTION |
|---|
|
|
|---|
Ras proteins are small
membrane-associated GTP binding proteins that cycle between active
(GTP-bound) and inactive (GDP-bound) states to regulate cell growth and
differentiation. In Saccharomyces cerevisiae, two Ras
proteins (Ras1 and Ras2) affect such diverse processes as vegetative
growth, sporulation, carbon source utilization, stress response, and
pseudohyphal growth (12, 25, 45, 61, 64). Ras-dependent
growth requires plasma membrane localization, which in turn depends on
a series of posttranslational modifications that occur on a
carboxyl-terminal CaaX box (C is cysteine, a is any aliphatic residue, X is the carboxy-terminal residue)
(15, 20, 21, 57). The first step is the farnesylation of the CaaX box cysteine by a soluble, heterodimer farnesyl protein
transferase encoded by the RAM1 and RAM2 genes in
yeast (34, 39, 53). The aaX sequence is removed
by one of two endoplasmic reticulum (ER)-associated proteases encoded
by RCE1 and AFC1/STE24 (9, 58). The
newly exposed cysteinyl
-carboxyl is then methyl esterified by the
product of STE14, an integral membrane protein which also colocalizes with the ER in yeast and mammalian cells (16, 18, 22,
54, 56).
The mature form of Ras is localized primarily on the cytoplasmic surface of the plasma membrane. Mutations in either the CaaX box or the genes encoding the posttranslational modification enzymes cause a reduction in Ras plasma membrane localization and a corresponding reduction in the ability of Ras to support growth (15, 57). However, the mechanism by which prenylation and subsequent posttranslational modifications direct Ras proteins to the plasma membrane is not known. It is clear that prenylation alone is not sufficient for efficient plasma membrane targeting of Ras. Yeast mutants that fail to carry out the palmitoylation step have reduced amounts of Ras protein at the plasma membrane and increased resistance to heat shock in the presence of activated Ras2(V19) alleles (6). Palmitoylation, unlike the CaaX processing steps, is reversible, making it a likely regulatory step. Interestingly, oncogenic forms of Ras are also rendered nontransforming by mutating the palmitoylation sites (69). Unfortunately, palmitoylation is the least well understood step in the Ras posttranslational modification pathway. A major obstacle has been the failure to identify a protein palmitoyltransferase, although reports of partial purification of palmitoyltransferase activities have appeared (3, 19, 37). The matter is further complicated by the fact that protein palmitoylation can occur nonenzymatically; however, the reaction rate is considerably lower than that observed in vivo (1, 23, 66). The issue is unlikely to be resolved until there is a better understanding of the requirements for and biological consequences of palmitoylation in vivo.
The multistep nature of Ras modification suggests that subcellular targeting may be an ordered process involving distinct intracellular membrane compartments. In support of this idea is the recent demonstration that the -aaX proteases (Afc1 and Rce1) and methyltransferase (Ste14) are associated with the ER in yeast and mammalian cells (9, 18, 54, 58). It would appear that prenylated Ras first associates with the ER membrane, although the mechanism by which it is targeted there is unknown. One possible mechanism is a receptor-mediated process that is prenylation dependent. Indeed, high-affinity association of prenylated peptides with microsomal membranes has been observed (62, 63). However, a receptor or anchor protein has not been identified. It is also not known at this time how Ras translocates from the ER to the plasma membrane. One possibility is that Ras associates with the cytoplasmic surface of the classical secretory pathway. However, studies on the prenylated yeast mating pheromone a-factor argue against this model. Similar to Ras, a-factor is posttranslationally processed by prenylation, -aaX proteolysis, and Ste14-dependent methylation. Export of a-factor was unaffected by temperature-sensitive blocks at several key steps of the yeast secretory pathway (36, 40). This has led to the proposal that Ras, a-factor, and possibly other prenylated proteins may utilize a nonclassical pathway to traffic from the ER to the plasma membrane. However, the components of such a pathway and the mechanism by which they act remain elusive.
To investigate in greater detail the relationship between posttranslational modification and Ras trafficking, we have employed a genetic screen using a palmitoylation-dependent Ras allele that we previously described (43). Due to the palmitate dependence of the Ras allele and its defect in localization, we predicted that mutations affecting palmitoylation or a component of the Ras localization pathway would be uncovered in this screen. In this report, we describe the isolation of two mutations designated erf2 and erf4 (effect on Ras function). ERF4 was found to encode a protein previously described by Jung et al. as a suppressor of a hyperactive Ras allele, SHR5 (31). ERF2 encodes a novel integral membrane protein harboring a recently described cysteine-rich domain (CRD) containing a DHHC motif (DHHC-CRD) (52). Characterization of Erf2 reveals that it is required for the proper subcellular localization and palmitoylation of Ras proteins and may represent a component of a previously uncharacterized Ras localization pathway.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, media, and yeast techniques.
The yeast strains used
in this study are listed in Table 1.
Solid and liquid media were prepared as described by Sherman et al.
(59) and included synthetic complete (SC) medium lacking one
or more specified amino acids and rich medium (YPD). Induction of
expression of GAL1,10 promoters was achieved by
adding 4% galactose to SC medium lacking uracil. Standard procedures
were used for yeast manipulations (59). Yeast
transformations were done by the lithium acetate procedure
(30). Medium containing 5-fluoro-orotic acid (5-FOA; PCR,
Inc.) was prepared as described elsewhere (7).
|
Genetic screen for mutants that affect the subcellular
localization of Ras.
The screen was based on a sectoring assay in
which the ability to lose an ADE8/URA3-marked
RAS2-encoding plasmid (YCp52-Ras2) was monitored by the
red/white sectoring of the colonies (see Fig. 1). Cultures of RJY1106
and RJY1107 (8 × 107 cells/ml) were plated on rich
medium (YPD) plates (103 cells/plate) and mutagenized with
UV light to obtain approximately an 80% kill rate. Plates were
incubated for 5 days (30°C), and the sectoring patterns of 152,000 colonies were assessed. Nonsectored colonies (total of 1,346) were
grown as patches on YPD plates and replicated to plates containing
5-FOA (1.0 g/liter). A recessive/dominant test of prospective mutants
was performed by backcrossing to either RJY1106 or RJY1107. A
complementation test based on restoration of sectoring and 5-FOA
resistance was performed on all recessive mutants. A clone by
complementation strategy was performed by using the acquisition of
5-FOA resistance as the primary screen to identify the wild-type gene
corresponding to the erf mutations. For example, strain
RJY1081 was transformed with a YSB32-based (ATCC 77162) genomic
library, and transformants were plated onto SC medium plates lacking
leucine. To select for cells capable of losing YCp52-Ras2,
transformants were replicated to plates containing 5-FOA and plasmid
DNA was isolated from the 5-FOA-resistant colonies. Bypass suppressors
were eliminated by transforming plasmids into RJY248 (ras1
ras2
[YCp50Ras1]) and testing for 5-FOA sensitivity. The
plasmid (B644) which complemented erf2 was mapped by a
combination of deletion analysis and subcloning strategies which
allowed the identification of open reading frame (ORF)
YLR246w as the gene responsible for complementing the
erf2 mutation.
Plasmid construction.
The ERF2 gene
(YLR246w) was isolated by PCR amplification from the
YSB32-based genomic library plasmid (B644) that complemented the 5-FOA
sensitivity and red nonsectoring phenotypes of the erf2-5 mutant. Two oligonucleotide primers, OLI-222 (
165 to
150;
5'-CGCGAATTCTCTGTTTGGTTT-3') and OLI-225 (+1061 to +1079;
5' CGATGAGCTCTTAGCGGCCGCATATTTTCTGTATTTTT-3'), were designed
to amplify the ERF2 ORF. The 1.2-kb PCR product was digested
with EcoRI and SacI (sites incorporated into the PCR oligonucleotides) and ligated into
EcoRI/SacI-digested pRS314 (60) to
create B642. The OLI-225 primer was designed to include a
NotI site into which a triply iterated version of the
influenza hemagglutin epitope (HA3) was placed at the C
terminus to create the plasmid B753. Erf2-HA3 protein
expressed from B753 was shown to be expressed by immunoblotting and to
be fully functional by complementation of the 5-FOA sensitivity and
nonsector phenotype of RJY1277. Low-copy-number and multicopy plasmids
expressing Erf2-HA3 were constructed by subcloning a
XhoI/SacI fragment derived from pRS314-Erf2-HA3
(B753) into pRS315 (60) (B754) and YEp351 (27)
(B745), respectively.
382 to
368; 5'AGCTAGCTAAGCTTCGGATGCAAGGGTTCG3')
and OLI-457 (
25 to
8;
5'TCGATCGATCTAGAGATGGGGGTAATAGAATTG 3'). The
MET25 PCR fragment was digested with HindIII
and XbaI and ligated into pRS315 to create B803.
RAS1 was amplified from the genome by PCR using OLI-455 (+1
to +19; 5'AGCTAGCTACTAGTATGCAGGGAAATAAATCAA 3') and OLI-456
(+316 to +365; 5'CGTACGTAGAGCTCGCCGAGTTTATTGTTGCTAG 3'). The
RAS1 PCR fragment was digested with SpeI and
SacI and ligated into B803 cut with XbaI and
SacI to create B804. As expected, the expression of
RAS1 from the MET25 promoter construct was under the control of methionine concentrations in the medium (47) (data not shown).
Green fluorescent protein (GFP)-Ras2(SCIIS) (B763) was derived from
GFP-Ras2 (9). The glutathione S- (GST)-Ras2
fusion plasmid pEG(KG)Ras2(CCIIS) has been described previously
(44). pRS315-Ras2 (B250) was created by removing the 3.1-kb
EcoRI-HindIII fragment from YCp50Ras2
(43) and placing into pRS315 (60). pRS315-Ras2
(V19) (B561) and pRS315-Ras2(V19,SCIIS) (B562) were created by
site-directed mutagenesis.
Preparation of yeast extracts and immunoblot analysis. Cultures were grown (25 ml) to a density of 1 × 107 to 2 × 107 cells/ml in synthetic medium and then collected by centrifugation, washed with water, and resuspended in sorbitol buffer (0.3 M sorbitol, 0.1 M NaCl, 5 mM MgCl2, 10 mM Tris-HCl [pH 7.4]) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 100 U of aprotinin per ml, 1 µM pepstatin, 100 µM leupeptin, and 1 µg of chymostatin per ml) and lysed as described previously (43). Soluble (S100) and membrane (P100) fractions were separated at 100,000 × g at 4°C, using a TLA100.2 rotor of a Beckman TLA100 ultracentrifuge. Protein loading buffer was added, extracts were denatured (95°C, 5 min), and proteins (50 µg) were resolved by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (12.5% gel). Proteins were transferred to nitrocellulose by semidry electrotransfer in transfer buffer (20 mM Tris base, 150 mM glycine, 0.1% SDS 20% [wt/vol] methanol [pH 8.0]) at 400 mA for 1 h. All subsequent manipulations were performed at room temperature. The filter was blocked for 1 h in buffer A (100 mM Tris-HCl [pH 7.4], 150 mM NaCl, 0.05% Tween 20) containing 5% nonfat dried milk. After one washing with buffer A, the membrane was incubated with the designated primary antibody (2 h), washed three times (15 min) in buffer A, and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (2 h). Following three buffer A washes (15 min), the blot was visualized by using a Pierce SUPER-SIGNAL kit.
Subcellular fractionation of Erf2. RJY1318 was transformed with an Erf2-HA3-expressing plasmid (B754), and the resulting strain was grown at 30°C to an A600 of 0.5 to 1.0 in SC medium lacking tryptophan (2% glucose). Subcellular fractionation was performed essentially as previously described (28). Briefly, cells were spheroplasted, lysed by Dounce homogenization, and subjected to centrifugation in a Beckman GS-15R to obtain 13,000 × g pellet (P13) and supernatant (S13) fractions. The P100 and S100 fractions were obtained and immunoblot analyses were performed as described above. Erf2-HA3 was detected by using mouse anti-HA antibody (BAbCo) followed by sheep anti-mouse-HRP conjugate (Amersham). Dpm1 was detected by using an anti-Dpm1 antibody (1:20) followed by sheep anti-mouse-HRP conjugate. Kar2 was detected by using an anti-Kar2 antibody (55) (1/20,000 dilution) followed by HRP-conjugated goat anti-rabbit (1:1,000) (Bio-Rad). Pma1 was detected with anti-Pma1 (1:2,000) antibody followed by HRP conjugated sheep anti-mouse-HRP.
In vivo labeling of GST-Ras2 with
[3H]palmitate.
Metabolic labeling of GST-Ras was
performed as described previously (43). The
galactose-inducible GST-Ras2 expression plasmid, pEG(KG)Ras(CCIIS)
(B529), was also described previously (43). RJY1270,
RJY1272, and RJY1274 cells (100 ml) were grown to a density of 2 × 107 cells/ml in SC medium lacking uracil (4%
raffinose), spun, and resuspended in 10 ml of the same medium
containing 3 µg of cerulenin per ml, and the cells were incubated for
2 h. The expression of GST-Ras2 was induced by the addition of
galactose (4%), and cells were labeled for 4 h with
[3H]palmitic acid (1 mCi, 50 Ci/mmol; NEN). Cells were
broken with glass beads, and the sample was subjected to low-speed
centrifugation (100 × g, 2 min) to remove unbroken
cells. The cleared lysate was resuspended in protein loading buffer
without
-mercaptoethanol and heated (60°C, 5 min). After
separation by SDS-PAGE, the gel was fixed and visualized as described
elsewhere (43).
Immunofluorescence and fluorescence microscopy. Immunolocalization of Erf2-HA3 was performed as described previously (4), with the following modifications. RJY1318 was transformed with YEp351-Erf2-HA3 (B745) and grown in SC medium lacking leucine (2% glucose) to 107 cells/ml. Erf2-HA3 was detected by using mouse anti-HA epitope antibody (1:400) (BAbCo) followed by Oregon Green 488-conjugated goat anti-mouse immunoglobulin G (IgG; 1:240 dilution; Molecular Probes Inc., Eugene, Oreg.). Kar2 was detected with anti-Kar2 antibody (55) (1/2,000 dilution) and lissamine rhodamine-conjugated goat anti-rabbit (1:240 dilution; Jackson ImmunoResearch Laboratories, West Grove, Pa.). To visualize GFP-Ras, cultures (5 ml) were grown to mid-exponential phase in synthetic medium under the same conditions as the palmitate labeling and concentrated by centrifugation. FM4-64 labeling of the vacuoles was done as described elsewhere (68). Images were obtained for Erf2-HA3 with a Zeiss Axioskop microscope (100× objective). GFP-Ras localization images were obtained with a laser scanning confocal system (MRC-1024; Bio-Rad) (60× objective).
Heat shock assay. The heat shock assay was performed by growing LRB759 (ERF2) and RJY1438 (erf2::HIS3) harboring a pRS315 plasmid expressing RAS2 (B250), RAS2(V19) (B561), or RAS2(V19,SCIIS) (B562) in SC medium lacking leucine for 3 days 30°C. Equal numbers of cells (107) were aliquoted into wells of a 96-well titer plate, and a fivefold dilution series prepared. Heat shock was carried out by placing the microtiter plate, at 55°C for the indicated period of time (typically 10 to 30 min). An aliquot of cells was transferred to SC medium plates lacking leucine, using a CLONEMASTER (Immusine Laboratories), and allowed to grow for 2 days (30°C).
| |
RESULTS |
|---|
|
|
|---|
Isolation of mutants affecting Ras localization. In a previous study, we described a group of RAS2 mutants in which the CaaX box (Cys-Cys-Ile-Ile-Ser) was replaced by the basic extension sequence Cys-Ser-Ile-Ile-Lys-Leu-Ile-Lys-Arg-Lys (Ras2-ext) (43). The membrane association of the Ras2-ext form of Ras2 requires the basic residues in the extension as well as palmitoylation but not prenylation (43). It was not possible in that study to determine how these nonprenylated Ras2-ext proteins functioned given the overall lack of information on Ras trafficking. In an attempt to shed light on this process, we performed a genetic screen that was designed to uncover mutants that affect Ras processing and/or subcellular trafficking. The screen was based on the assumption that the nonprenylated Ras2-ext alleles are partially defective in membrane binding and therefore more sensitive than wild-type Ras to defects in the processing or trafficking pathway.
Strains RJY1106 and RJY1107 were mutagenized as described in Materials and Methods and screened as illustrated in Fig. 1. Mutants exhibiting a synthetic lethality with the Ras2-ext allele were detected by a red/white sectoring assay and by monitoring the inability of the strain to lose an ade8/URA3 plasmid expressing RAS2 (YCp52-Ras2). The screen is a variation of a method described by Bender and Pringle to isolate synthetic lethal mutants (2), except that we used ade8 instead of ade3 to block the production of pigment accumulation of ade2 mutants. A total of 152,000 colonies were screened by the sectoring assay. To confirm that nonsectoring colonies represented cells unable to lose the (YCp52-Ras2) (URA3/ADE8) plasmid, patches (total of 1,346) were replicated to plates containing 5-FOA (1 g/liter). Approximately 0.9% of the colonies satisfied the criteria of being unable to sector and 5-FOA sensitive.
|
Isolation of ERF2. The ERF2 gene was isolated by complementation of the 5-FOA sensitivity and nonsectoring phenotype of RJY1081 (MATa ras1::HIS3 ras2-ext erf2-5 ura3 ade2 ade8 leu2 [YCp52-Ras2]), using a low-copy-number (YSB32) yeast genomic DNA library (ATCC 77162). Plasmid B644 was recovered and found by sequencing the plasmid/insert junctions to contain an insert encompassing 12.3 kb of chromosome XII. Two known genes, MAP1 and ARV1, and four uncharacterized ORFs are encoded in this interval (Fig. 2A). A series of deletion plasmids was constructed and tested for the ability to complement the 5-FOA sensitivity of an erf2 mutant. Deletions that removed YLR246w failed to complement erf2 (Fig. 2A), and a construct expressing only YLR246w was able to restore 5-FOA resistance (data not shown). In addition, a TRP1 gene disruption of YLR246w exhibits the nonsectoring phenotype of the original erf2 mutants. When a diploid arising from a cross between erf2-5 and a strain harboring the TRP1 disruption of YLR246w was sporulated, all of the resulting progeny were nonsectoring and 5-FOA sensitive. Finally, sequence analysis of all but one of the erf2 mutants uncovered either missense or nonsense mutations in YLR246w.
|
ERF2 encodes a novel protein containing a DHHC-CRD. ERF2 is predicted to encode a 359-residue protein with a calculated molecular mass of 41 kDa and four predicted transmembrane (TM) segments (Fig. 2B). A possible metal binding site consisting of a DHHC-CRD is found between TM2 and TM3. The DHHC-CRD has been referred to as a NEW1 variant of the C2H2 zinc finger motif (8). The appearance of the DHHC motif within the CRD distinguishes this family from other cysteine-rich metal binding domains (42, 52). However, the function of this domain has not been established despite the presence of the sequence in genomic databases of S. cerevisiae, Schizosaccharomyces pombe, Arabidopsis thaliana, Drosophila melanogaster, Caenorhabditis elegans, and Homo sapiens (Fig. 2C). The region of highest sequence identity encompasses the DHHC-CRD and ranges from 65% (YDR126w) to 36% (YDR459c). Members of the Erf2 subgroup of this family share additional similarities. All are predicted to encode integral membrane proteins, often with four TM segments and a molecular mass of approximately 40 kDa. YDR459c and Akr1 (YDR264c) may be more distantly related to Erf2 because the DHHC motif has been replaced by DHYC, several cysteines within the CRD are not conserved, and the number of TM domains is less certain.
The CRD region of Erf2 appears to be critical for its function. Several of the mutant alleles isolated in the screen map to this region (Fig. 2B). For example, mutation of the conserved residue Arg-182 to Gln (erf2-7) and Lys-174 to Glu (erf2-1) abolishes Erf2 function without significantly affecting the expression level of the protein (data not shown). Site-directed mutagenesis was used to mutate two of the conserved Cys residues within the CRD to Ser (C189S and C192S). The erf2(C189S,C192S) mutant protein was expressed normally but failed to complement the nonsectoring and 5-FOA sensitivity of the erf2
mutant
(RJY1277) (data not shown). The DHHC motif is also required for Erf2
function. Mutating Asp-200 to Ala inactivated Erf2, as measured by the
failure to complement the nonsectoring and 5-FOA sensitivity in RJY1277
(data not shown). The screen also identified a F218S substitution
(erf2-2) in the region predicted to be the start of TM3. The
other alleles identified in the screen resulted in the insertion of
stop codon at Leu-3 (erf2-5) or Leu-145 (erf2-6).
In one case (erf2-4), we were unable to detect a change
within the ORF and presume that the mutation affects the expression of
the protein, but this was not confirmed.
No overlap in function was observed between Erf2 and the other yeast
DHHC-CRD ORFs. First, deletion of YDR126, YOL003,
YNL326, or YDR459 in RJY1107 had no effect on
viability or 5-FOA sensitivity, and all strains sectored normally.
Second, overexpression of YDR126, YOL003,
YNL326, or YDR459 could not compensate for the
loss of ERF2 in the sector or 5-FOA sensitivity assays in
RJY1277 (data not shown). Finally, we deleted each of these ORFs alone
or in combination with ERF2 and found that the double
deletions did not alter the viability of the erf2
strain
alone (data not shown). Therefore, the other Erf2-like proteins appear
to function outside the Ras pathway.
Subcellular localization of Erf2-HA3.
The
subcellular localization of Erf2 was investigated next in an effort to
understand its function. A hydropathy plot of the Erf2 sequence
predicts that it is an integral membrane protein with four TM segments
(Fig. 3A). To examine this directly, an HA3 tag was inserted at the C terminus of Erf2 in a
low-copy-number Erf2-HA3 expression plasmid (B754).
Expression of B754 in RJY1277 (erf2
) was able to
complement the 5-FOA sensitivity and nonsectoring phenotypes (data not
shown). Total cell lysates were fractionated by centrifugation to
obtain soluble (S100) and high-speed crude membrane (P100) fractions,
and Erf2-HA3 was found exclusively in the P100
fraction (Fig. 3B). Addition of 1.0 M NaCl, 1.6 M urea or 0.1 M sodium
bicarbonate (pH 11) was unable to release Erf2-HA3 from the
P100 fraction, consistent with it being an integral membrane protein.
Ras1 and Ras2 proteins also fractionated with the P100 fraction under
the same conditions. The nonionic detergent Triton X-100 (1%)
extracted only a portion of the Erf2-HA3 from the membrane
(Fig. 3B). Similar results were obtained with the ionic detergent
sodium cholate (1%). In contrast, Ras proteins were effectively
solubilized by Triton X-100 (1%) or sodium cholate (1%) (Fig. 3B).
The combination of Triton X-100 and sodium cholate was able to complete
the solubilization of Erf2-HA3.
|
|
Deletion of ERF2 affects the function of wild-type
Ras.
Deletion of ERF2 has no discernible effect on
growth or viability of RAS1 RAS2 wild-type cells growing in
rich or synthetic growth medium (Fig. 5
and data not shown). However, ERF2 is required when the
CaaX mutant Ras2-ext is the only Ras expressed. This might
indicate that Erf2 is essential only when Ras is not prenylated. Alternatively, there may be a differential requirement for Erf2 depending on the allele of RAS being expressed. We examined
the requirement for ERF2 when either RAS1 or
RAS2 is deleted. Tetrad analysis revealed that ras2
erf2
strains exhibited a severe growth defect, whereas a
ras1
erf2
strain grew normally (Fig. 5A). This effect
was not due to a sporulation or germination defects because the slow
growth of ras2
erf2
strains was also observed when
cells were streaked on plates (Fig. 5B) or growth curves were measured
(data not shown). The apparent differential requirement of Erf2
depending on the RAS gene being expressed could arise from
differences in the level of Ras activity in ras2
and
ras1
cells or perhaps a functional difference between the
two Ras proteins. RAS1 and RAS2 are
differentially expressed depending on growth conditions and the
position in the growth curve (10, 11). However, we did not
observe a difference in the steady-state levels of Ras1 and Ras2
proteins in our strains (Fig. 3B). ras2
cells have lower
cyclic AMP levels than isogenic ras1
cells, and purified recombinant Ras2 protein is a more effective activator of adenylyl cyclase than Ras1 (13, 29). We reasoned therefore that Erf2 is required in ras2
cells because the overall Ras
activity in the cell is reduced. Consistent with this explanation,
overexpression of RAS1 from the MET25 promoter
rescues the growth defect of a ras2
erf2
strain (Fig.
5A). We cannot, however, rule out the possibility that Erf2 has a
preference for Ras1 and that this preference can be overcome by
overexpression of RAS1.
|
Overexpression of GPA2 fails to suppress the growth
defect of a ras2-ext erf2
strain.
Our results
demonstrate that Erf2 is required when the Ras CaaX box is
mutated and under conditions of reduced Ras activity. Recently, the
heterotrimeric G protein
subunit Gpa2 has been shown to act in
parallel to Ras when Ras activity is compromised (17, 35,
70). Specifically, elevated expression of Gpa2 rescues the growth
defect of a ras2ts strain at the nonpermissive temperature
(49). A ras2
gpa2
strain grows very poorly,
reminiscent of the growth defect of a ras2
erf2
strain
(35, 38). This raises the possibility that the effect of
Erf2 on the Ras pathway is actually mediated through modulation of the
Gpa2 pathway. To test this hypothesis, we constructed a set of double
and triple mutants and analyzed tetrads following sporulation. Strains
harboring ras2
erf2
and ras2
gpa2
deletions were viable but grew slowly. In contrast, a
ras2
erf2
gpa2
strain was inviable (data not shown). The additive effect of the erf2
and
gpa2
mutations suggests that they operate in different
pathways. Consistent with this interpretation, overexpression of
GPA2 failed to rescue the inviability of a ras2-ext
erf2
strain.
Deletion of ERF2 leads to a reduction in Ras
palmitoylation.
To examine the effect of Erf2 on Ras
palmitoylation, wild-type and erf2
cells expressing
GST-Ras2 were labeled with [3H]palmitate, and the fusion
protein was analyzed by SDS-PAGE. As seen in Fig.
6A, deletion of either ERF2 or
ERF4/SHR5 results in a decrease but not complete loss of
steady-state Ras palmitoylation. The steady-state palmitoylation of
other acylated proteins, however, was not affected in
erf2
or erf4/shr5
strains (Fig. 6B). It is
therefore unlikely that either ERF2 or ERF4/SHR5
encodes a component of a general palmitoyltransferase. It is possible
that Erf2 is a Ras-specific palmitoylation system. Alternatively, Erf2 and Erf4/Shr5 could be involved in a step in Ras processing or trafficking that precedes palmitoylation.
|
Deletion of ERF2 causes mislocalization of Ras. We performed subcellular fractionation and immunofluorescence experiments to examine the role of Erf2 in Ras membrane localization. Extracts from isogenic ERF2 and erf2::TRP1 deletion strains (RJY1107 and RJY1277) were separated into P100 and S100 fractions. As seen in Fig. 7, deletion of ERF2 did not significantly change the distribution of wild-type Ras proteins, but there was a redistribution of Ras2-ext protein from the membrane into the soluble fraction (Fig. 7). The prenyl group appears to be sufficient to retain wild-type Ras in the membrane, whereas the Ras2-ext protein requires palmitoylation for membrane association.
|
strain (Fig. 6). We therefore examined the
subcellular localization of GFP-Ras by fluorescence microscopy. As seen
in Fig. 8A (upper left panel), GFP-Ras2
appears on the cell perimeter, consistent with its localization on the
plasma membrane. In contrast, a shift of GFP-Ras to internal membranes
occurs when ERF2 is deleted (Fig. 8A, top panels). The
internal membrane compartment is stained with FM4-64, indicative of the
vacuole (68). A more pronounced Ras mislocalization defect
is observed with GFP-Ras2(SCIIS), a Ras mutant that cannot be
palmitoylated (Fig. 8B). GFP-Ras2(SCIIS) is found primarily on internal
membranes that include, but are not restricted to, the vacuole (Fig.
8B).
|
Deletion of ERF2 reduces the heat shock sensitivity caused by expression of Ras2(V19). Yeast strains expressing Ras2(V19), a form that cannot hydrolyze GTP, are sensitive to heat shock. We examined whether Erf2 affected the heat shock sensitivity of strains expressing wild-type and Ras2(V19) proteins. Deletion of ERF2 had no measurable effect on the heat shock sensitivity of wild-type Ras2 but did have a protective effect on strains expressing Ras2(V19) (Fig. 9, 10-min heat shock treatment). It is important to note that the protection afforded by deleting ERF2 is less than the protection seen when palmitoylation is prevented by mutating Cys-318 to Ser [Ras2(V19,SCIIS)]. However, deletion of ERF2 provides further heat shock protection to the nonpalmitoylated Ras2(V19,SCIIS) allele. Since Erf2 affects the function of a nonpalmitoylated form of Ras2(SCIIS), it is not likely to be a component of the palmitoyltransferase; rather, Erf2 appears to play a role in Ras trafficking prior to palmitoylation.
|
| |
DISCUSSION |
|---|
|
|
|---|
It is now well established that subcellular targeting of Ras
proteins requires a series of posttranslational modifications of a
C-terminal CaaX box motif. The modifications include
prenylation, -aaX proteolysis, carboxy methylation, and
either palmitoylation or a patch of basic amino acid residues. It is
also apparent that these modifications are not unique to Ras. In fact,
it has been estimated that 1% of cellular proteins undergo prenylation
and the associated CaaX modification events (24).
It is therefore reasonable to expect to find additional factors that
are required for correct subcellular targeting of Ras and other
CaaX proteins. In this study, a genetic screen was carried
out to identify additional components involved in the Ras subcellular
localization pathway. A key feature of the screen was that it used a
previously described Ras CaaX mutant (Ras2-ext) that is not
farnesylated, aaX proteolyzed, or carboxyl methylated.
Ras2-ext proteins are functional but exhibit lower affinity for
membranes than prenylated Ras. Membrane association relies on a patch
of basic amino acid residues and palmitoylation. We reasoned that
strains expressing only Ras2-ext would have an increased sensitivity to
mutations that affect Ras binding to the membrane, Ras trafficking,
and/or palmitoylation. To date, we have identified mutants that fall
into two complementation groups. ERF4/SHR5 was previously
identified as a suppressor of the hyperactivity of a
RAS2(V19) allele (31). Loss of
Erf4/Shr5 causes a reduction in Ras palmitoylation, but this apparently results from a defect in membrane trafficking and not a defect in
palmitoylation per se. Our analysis involving an additional seven
mutant alleles of erf4/shr5 is consistent with that
conclusion (data not shown). The second mutant identified in our
screen, erf2, encodes a 41-kDa ER-localized protein. As for
Erf4/Shr5, loss of Erf2 function results in a reduction in Ras
palmitoylation and causes a similar mislocalization of Ras.
erf4/shr5
and erf2
strains also suppress
the heat shock phenotype of Ras2(V19). Interestingly, the double mutant
(erf2
erf4/shr5
) is indistinguishable from either
single mutant alone, suggesting that Erf2 and Erf4/Shr5 may function in
the same pathway (data not shown).
DHHC motif proteins represent a distinct subgroup of zinc finger proteins (8, 42, 52). Although it is not known whether DHHC proteins bind zinc, it is clear from the mutations identified in ERF2 that the CRD region is important for function. ERF2 is the first member of this family found to have an effect on a known pathway. In the absence of Erf2, yeast Ras2 protein is mislocalized, leading to a growth defect under conditions of low Ras activity. The DHHC-CRD could form a protein-protein or protein-lipid binding domain. In this respect, the DHHC-CRD may be similar to the zinc clusters or zinc ring proteins Raf, Vav, Nore1, and rabphilin that interact with G proteins including metazoan Ras (33, 41, 65, 67). The structure of the Raf CRD has been solved and compared to the lipid binding domain of the protein kinase C cysteine-rich region (46). It would be interesting to determine the structure of the Erf2 DHHC-CRD and compare it to structures of these other domains.
Despite the high level of sequence similarity, the four other yeast
DHHC-CRD proteins do not have functional overlap with Erf2. Gene
disruptions of the other members (YDR126, YOL003,
YNL326, and YDR459) of the group have no effect
on Ras-dependent growth, and their overexpression does not suppress the
Ras localization defect observed in an erf2
strain (data
not shown). Thus, these other DHHC-CRD proteins likely function in
pathways outside Ras. One member, YDR126w, has been
uncovered in a synthetic lethal screen using a hypomorphic profilin
gene and designated PSL10 (26a). Deletion of
other members of the yeast Erf2 family have no discernible defects in
growth on fermentable or nonfermentable carbon sources, mating, or bud
polarity. Among the yeast DHHC-CRD proteins, only the most distantly
related member, AKR1, has received attention. Akr1
physically associates with the cytoplasmic tail of the
a-factor receptor (Ste3) and with the associated 
(Ste4/Ste18) subunit of the heterotrimeric G protein activated during
mating (26, 51). Genetic interactions have also been observed between AKR1 and the yeast Rho family G gene
CDC42 (32). Finally, Akr1 may also play a role in
trafficking due to its interaction with the ARF GTPase-activating
protein Gcs1 (32). It is not known at this time whether the
CRD of Akr1 contributes to these interactions.
The localization of Erf2 to the ER places it in the same subcellular membrane compartment as the -aaX proteases Rce1 and Afc1/Ste24 and the prenyl protein carboxymethyltransferase Ste14. It is tempting to speculate that Erf2, Rce1, and Ste14 may exist in a complex. Although there is no indication of a complex at this time, attempts to extract Erf2 with Triton X-100 were only partially successful, leading us to consider the possibility that Erf2 associates with a complex. Triton X-100 insolubility has been interpreted as evidence of interaction with the cytoskeleton, but sodium cholate, a detergent reported to extract cytoskeletal proteins, was only partially effective at extracting Erf2 from the P100 fraction. The combination of Triton X-100 and sodium cholate effectively solubilizes the bulk of Erf2. Perhaps there are two distinct pools of Erf2 within the cell that can be distinguished by detergent solubility. Perhaps Erf2 resides in two distinct microdomains of the ER; alternatively, Erf2 may cycle between the ER and another organelle such as the Golgi complex. Results of subcellular localization experiments were consistent with an ER localization, but we cannot rule out the existence of another pool of Erf2.
Mutations in ERF2 were isolated by using a Ras2-ext allele
which terminates in a nonfunctional CaaX box. Several lines
of evidence indicate that Erf2 is required for the function of
wild-type RAS alleles as well. The growth of a RAS1
ras2
strain is significantly impaired by the deletion of
ERF2. GFP-Ras2 is mislocalized upon deletion of
ERF2. Finally, the heat shock sensitivity of the activated Ras2(V19) allele is partially suppressed in the absence of
ERF2. Deletion of ERF2 also reduces the
steady-state level of Ras palmitoylation (Fig. 6). Protein
palmitoylation has received considerable attention as a potential
regulatory mechanism in cell signaling (48, 66). Palmitoylation often occurs in conjunction with myristoylation or
farnesylation, but unlike these other lipid modifications, palmitoylation is reversible and therefore a potential point of regulation. Unfortunately, little is known about the enzymology of
protein palmitoylation. Protein palmitoyltransferase activities have
been reported, but the purification of the enzyme or identification of
the genes has not been accomplished (5, 19, 37). This has
led some to suggest that protein palmitoylation may occur nonenzymatically (1, 23); however, the rates of the
nonenzymatic reaction are probably too low to account for
palmitoylation observed in vivo (1). The screen that we
describe in this report was based on a palmitoylation-dependent Ras
allele, and thus mutants derived from the screen might shed light on
the palmitoylation debate. Are Erf2 and Erf4/Shr5 components of the
elusive palmitoyltransferase? Several observations argue against this
hypothesis. First, the sequences of Erf2 and Erf4/Shr5 bear no
relationship to those of known acyltransferases. Second, palmitoylation
of GST-Ras2 is not completely abolished in an erf2
strain, and when crude extracts were analyzed for
[3H]palmitate incorporation, no major differences were
apparent between erf2
and wild-type extracts (Fig. 6).
Third, phenotypic differences exist between an erf2
strain and an ERF2 strain expressing a mutant Ras2 protein
that cannot be palmitoylated [Ras2(SCIIS)]. Nonpalmitoylated Ras is
virtually undetectable on the plasma membrane, whereas deletion of
ERF2 causes a less severe localization defect. A difference
is also observed when we analyze heat shock sensitivities in strains
expressing a Ras2(V19) allele. Preventing palmitoylation by mutating
the palmitoylated Cys of Ras to Ser affords a better heat shock
protection than deleting ERF2. Furthermore, deleting ERF2 has an additive protective effect even in the case of a
nonpalmitoylated Ras protein. We therefore conclude that the reduction
of Ras palmitoylation in the absence of Erf2 and Erf4/Shr5 is due to a
step prior to palmitoylation such as Ras trafficking.
There are still many gaps in our knowledge of how Ras assembles into an
active signaling complex at the plasma membrane. Processing of the
CaaX clearly plays a central role and has provided important insights into the trafficking pathway. Once prenylylation occurs, all
subsequent Ras CaaX processing events occur on membranes. For example, the -aaX proteases (Rce1 and Afc1) and the
carboxymethyltransferase (Ste14) are localized on the ER membrane,
suggesting that translocation of Ras to the plasma membrane begins on
the surface of the ER (9, 18, 54, 58). However the steps
from ER to plasma membrane are not known. It has been hypothesized that
a second signal in the form of palmitoylation or a patch of basic amino acids is required for plasma membrane localization (14).
This stems from observations that nonpalmitoylated Ras mutant protein accumulates on intracellular membranes. But it is not known at this
time whether palmitoylation serves as a signal that directs Ras to the
plasma membrane or as an anchor once Ras arrives. A more fundamental
question is whether Ras is a passenger on the surface of other
secretory pathway organelles or if there a novel translocation pathway
that delivers Ras from the ER to the plasma membrane. The further
characterization of Erf2 and Erf4/Shr5 may provide some insight into
these questions. The aberrant localization of Ras in an
erf2
deletion strain suggests that Erf2 does indeed play
a role in Ras trafficking.
An intriguing idea is that Erf2 may be part of a scaffold or receptor
for Ras binding to the ER. A similar scaffolding function has been
proposed for Akr1 with the heterotrimeric G
proteins
in the mating pheromone pathway (51). However, to date we
have been unable to demonstrate a direct interaction between Ras and
Erf2 by using two-hybrid analysis or immunoprecipitation. Perhaps other
components such as Erf4/Shr5 are needed to form a functional scaffold.
Future work will investigate whether Erf2 and Erf4/Shr5 comprise a
membrane-organizing center for the Ras signaling complex.
| |
ACKNOWLEDGMENTS |
|---|
We thank Mark Rose (Princeton) and Tom Stevens (Oregon) for antibodies, Jasper Rine (Berkeley) for the GFP-Ras plasmid, and Lucy Robinson for strains. In addition, we thank Lois Weisman and Jan Fassler for many helpful discussions and for reading the manuscript. Immunolocalization studies were done with the assistance of Cherie Malone and of Tom Monniger, University of Iowa Central Microscopy Research Facility. FM4-64 labeling was done with the skillful assistance of Cecilia Bonangelino of the Weisman lab. We especially thank members of the lab (Cherie Malone, Hong Lin, Addison Ault, and Lihong Zhao) for their input throughout the study.
This work was supported by grant CA50211 from the National Cancer Institute.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, University of Iowa, Iowa City, IA 52242. Phone: (319) 335-7884. Fax: (319) 335-9570. E-mail: robert-deschenes{at}uiowa.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bano, M. C., C. S. Jackson, and A. I. Magee. 1998. Pseudo-enzymatic S-acylation of a myristoylated Yes protein tyrosine kinase peptide in vitro may reflect non-enzymatic S-acylation in vivo. Biochem J. 330:723-731. |
| 2. |
Bender, A., and J. R. Pringle.
1991.
Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:1295-1305 |
| 3. |
Berger, M., and M. F. G. Schmidt.
1984.
Cell-free fatty acid acylation of Semliki forest viral polypeptides with microsomal membranes from eucaryotic cells.
J. Biol. Chem.
259:7245-7252 |
| 4. | Berkower, C., D. Loayza, and S. Michaelis. 1994. Metabolic instability and constitutive endocytosis of STE6, the a-factor transporter of Saccharomyces cerevisiae. Mol. Cell. Biol. 5:1185-1198. |
| 5. |
Berthiaume, L., and M. D. Resh.
1995.
Biochemical characterization of a palmitoyl acyltransferase activity that palmitoylates myristoylated proteins.
J. Biol. Chem.
270:22399-22405 |
| 6. |
Bhattacharya, S.,
L. Chen,
J. R. Broach, and S. Powers.
1995.
Ras membrane targeting is essential for glucose signaling but not for viability in yeast.
Proc. Natl. Acad. Sci. USA
92:2984-2988 |
| 7. | Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline]. |
| 8. |
Bohm, S.,
D. Frishman, and H. W. Mewes.
1997.
Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins.
Nucleic Acids Res.
25:2464-2469 |
| 9. |
Boyartchuk, V. L.,
M. N. Ashby, and J. Rine.
1997.
Modulation of Ras and a-factor function by carboxyl-terminal proteolysis.
Science
275:1796-1800 |
| 10. |
Breviario, D.,
A. Hinnebusch,
J. Cannon,
K. Tatchell, and R. Dhar.
1986.
Carbon source regulation of RAS1 expression in Saccharomyces cerevisiae and the phenotypes of ras2 cells.
Proc. Natl. Acad. Sci. USA
83:4152-4156 |
| 11. | Breviario, D., A. G. Hinnebusch, and R. Dhar. 1988. Multiple regulatory mechanisms control the expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae. EMBO J. 7:1805-1813[Medline]. |
| 12. | Broach, J. R., and R. J. Deschenes. 1990. The function of RAS genes in Saccharomyces cerevisiae. Adv. Cancer Res. 54:79-140[Medline]. |
| 13. | Broek, D., N. Samiy, O. Fasano, A. Fujiyama, F. Tamanoi, J. Northup, and M. Wigler. 1985. Differential activation of yeast adenylate cyclase by wild-type and mutant RAS proteins. Cell 41:763-769[Medline]. |
| 14. |
Cadwallader, K. A.,
H. Paterson,
S. G. Macdonald, and J. F. Hancock.
1994.
N-terminally myristoylated Ras proteins require palmitoylation or a polybasic domain for plasma membrane localization.
Mol. Cell. Biol.
14:4722-4730 |
| 15. | Clarke, S. 1992. Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61:355-386[Medline]. |
| 16. |
Clarke, S.,
J. P. Vogel,
R. J. Deschenes, and J. Stock.
1988.
Posttranslational modification of the Ha-ras oncogene protein: evidence for a third class of protein carboxyl methyltransferases.
Proc. Natl. Acad. Sci. USA
85:4643-4647 |
| 17. | Colombo, S., P. Ma, L. Cauwenberg, J. Winderickx, M. Crauwels, A. Teunissen, D. Nauwelaers, J. H. de Winde, M. F. Gorwa, D. Colavizza, and J. M. Thevelein. 1998. Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signaling in the yeast Saccharomyces cerevisiae. EMBO J. 17:3326-3341[Medline]. |
| 18. |
Dai, Q.,
E. Choy,
V. Chiu,
J. Romano,
S. R. Slivka,
S. A. Steitz,
S. Michaelis, and M. R. Philips.
1998.
Mammalian prenylcysteine carboxyl methyltransferase is in the endoplasmic reticulum.
J. Biol. Chem.
273:15030-15034 |
| 19. |
Das, A. K.,
B. Dasgupta,
R. Bhattacharya, and J. Basu.
1997.
Purification and biochemical characterization of a protein-palmitoyl acyltransferase from human erythrocytes.
J. Biol. Chem.
272:11021-11025 |
| 20. | Der, C. J., and A. D. Cox. 1991. Isoprenoid modification and plasma membrane association: critical factors for ras oncogenicity. Cancer Cells 3:331-340[Medline]. |
| 21. | Deschenes, R. J., M. D. Resh, and J. R. Broach. 1990. Acylation and prenylation of proteins. Curr. Opin. Cell Biol. 2:1108-1113[Medline]. |
| 22. |
Deschenes, R. J.,
J. B. Stimmel,
S. Clarke,
J. Stock, and J. R. Broach.
1989.
RAS2 protein of Saccharomyces cerevisiae is methyl-esterified at its carboxyl terminus.
J. Biol. Chem.
264:11865-11873 |
| 23. |
Duncan, J. A., and A. G. Gilman.
1996.
Autoacylation of G protein alpha subunits.
J. Biol. Chem.
271:23594-23600 |
| 24. |
Epstein, W. W.,
D. Lever,
L. M. Leining,
E. Bruenger, and H. C. Rilling.
1991.
Quantitation of prenylcysteines by a selective cleavage reaction.
Proc. Natl. Acad. Sci. USA
88:9668-9670 |
| 25. |
Gimeno, C. J., and G. R. Fink.
1994.
Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development.
Mol. Cell. Biol.
14:2100-2112 |
| 26. | Givan, S. A., and G. F. Sprague, Jr. 1997. The ankyrin repeat-containing protein Akr1p is required for the endocytosis of yeast pheromone receptors. Mol. Biol. Cell 8:1317-1327[Abstract]. |
| 26a. | Haarer, B. Personal communication. |
| 27. | Hill, J. E., A. M. Myers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167[Medline]. |
| 28. |
Horazdovsky, B. F., and S. D. Emr.
1993.
The VPS16 gene product associates with a sedimentable protein complex and is essential for vacuolar protein sorting in yeast.
J. Biol. Chem.
268:4953-4962 |
| 29. |
Hurwitz, N.,
M. Segal,
I. Marbach, and A. Levitzki.
1995.
Differential activation of yeast adenylyl cyclase by Ras1 and Ras2 depends on the conserved N terminus.
Proc. Natl. Acad. Sci. USA
92:11009-11013 |
| 30. |
Ito, H.,
Y. Fukada,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168 |
| 31. | Jung, V., L. Chen, S. L. Hofmann, M. Wigler, and S. Powers. 1995. Mutations in the SHR5 gene of Saccharomyces cerevisiae suppress Ras function and block membrane attachment and palmitoylation of Ras proteins. Mol. Cell. Biol. 15:1333-1342[Abstract]. |
| 32. | Kao, L. R., J. Peterson, R. Ji, L. Bender, and A. Bender. 1996. Interactions between the ankyrin repeat-containing protein Akr1p and the pheromone response pathway in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:168-178[Abstract]. |
| 33. |
Kazanietz, M. G.,
X. R. Bustelo,
M. Barbacid,
W. Kolch,
H. Mischak,
G. Wong,
G. R. Pettit,
J. D. Bruns, and P. M. Blumberg.
1994.
Zinc finger domains and phorbol ester pharmacophore. Analysis of binding to mutated form of protein kinase C zeta and the vav and c-raf proto-oncogene products.
J. Biol. Chem.
269:11590-11594 |
| 34. |
Kohl, N. E.,
R. E. Diehl,
M. D. Schaber,
E. Rands,
D. D. Soderman,
B. He,
S. L. Moores,
D. L. Pompliano,
S. Ferro-Novick,
S. Powers,
K. A. Thomas, and J. B. Gibbs.
1991.
Structural homology among mammalian and Saccharomyces cerevisiae isoprenyl-protein transferases.
J. Biol. Chem.
266:18884-18888 |
| 35. |
Kubler, E.,
H. U. Mosch,
S. Rupp, and M. P. Lisanti.
1997.
Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism.
J. Biol. Chem.
272:20321-20323 |
| 36. | Kuchler, K., and J. Thorner. 1992. Secretion of peptides and proteins lacking hydrophobic signal sequences: the role of adenosine triphosphate driven membrane translocators. Endocrine Rev. 13:499-514[Abstract]. |
| 37. |
Liu, L.,
T. Dudler, and M. H. Gelb.
1996.
Purification of a protein palmitoyltransferase that acts on H-Ras protein and on a C-terminal N-Ras peptide.
J. Biol. Chem.
271:23269-23276 |
| 38. | Lorenz, M. C., and J. Heitman. 1997. Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline]. |
| 39. |
Manne, V.,
D. Roberts,
A. Tobin,
E. O'Rourke,
M. De Virgilio,
C. Meyers,
N. Ahmed,
B. Kurz,
M. Resh,
H.-F. Kung, and M. Barbacid.
1990.
Identification and preliminary characterization of protein-cysteine farnesyltransferase.
Proc. Natl. Acad. Sci. USA
87:7541-7545 |
| 40. | McGrath, J. P., and A. Varshavsky. 1989. The yeast STE6 gene encodes a homologue of the mammalian multidrug resistance P-glycoprotein. Nature 340:400-404[Medline]. |
| 41. | McKiernan, C. J., P. F. Stabila, and I. G. Macara. 1996. Role of the Rab3A-binding domain in targeting of rabphilin-3A to vesicle membranes of PC12 cells. Mol. Cell. Biol. 16:4985-4995[Abstract]. |
| 42. | Mesilaty-Gross, S., A. Reich, B. Motro, and R. Wides. 1999. The Drosophila STAM gene homolog is in a tight gene cluster, and its expression correlates to that of the adjacent gene ial. Gene 231:173-186[Medline]. |
| 43. |
Mitchell, D. A.,
L. Farh,
T. K. Marshall, and R. J. Deschenes.
1994.
A polybasic domain allows nonprenylated Ras proteins to function in Saccharomyces cerevisiae.
J. Biol. Chem.
269:21540-21546 |
| 44. | Mitchell, D. A., T. K. Marshall, and R. J. Deschenes. 1993. Vectors for the inducible overexpression of glutathione S-transferase fusion proteins in yeast. Yeast 9:715-722[Medline]. |
| 45. |
Morishita, T.,
H. Mitsuzawa,
M. Nakafuku,
S. Nakamura,
S. Hattori, and Y. Anraku.
1995.
Requirement of Saccharomyces cerevisiae Ras for completion of mitosis.
Science
270:1213-1215 |
| 46. | Mott, H. R., J. W. Carpenter, S. Zhong, S. Ghosh, R. M. Bell, and S. L. Campbell. |