Previous Article | Next Article 
Molecular and Cellular Biology, October 1999, p. 6825-6832, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
An Autoregulatory Loop Controlling
CYP1A1 Gene Expression: Role of H2O2
and NFI
Yannick
Morel,1
Nicolas
Mermod,2 and
Robert
Barouki1,*
INSERM U490, Université Paris
V-René Descartes, Centre Universitaire des Saints-Pères,
75006 Paris, France,1 and Laboratoire de
Biotechnologie Moléculaire, Institut de Biologie Animale et
Centre de Biotechnologie, UNIL-EPFL, Université de Lausanne,
1015 Lausanne, Switzerland2
 |
ABSTRACT |
Cytochrome P450 1A1 (CYP1A1), like many monooxygenases, can produce
reactive oxygen species during its catalytic cycle. Apart from the
well-characterized xenobiotic-elicited induction, the regulatory
mechanisms involved in the control of the steady-state activity of
CYP1A1 have not been elucidated. We show here that reactive oxygen
species generated from the activity of CYP1A1 limit the levels of
induced CYP1A1 mRNAs. The mechanism involves the repression of the
CYP1A1 gene promoter activity in a negative-feedback autoregulatory loop. Indeed, increasing the CYP1A1 activity by transfecting CYP1A1 expression vectors into hepatoma cells elicited an
oxidative stress and led to the repression of a reporter gene driven by
the CYP1A1 gene promoter. This negative autoregulation is
abolished by ellipticine (an inhibitor of CYP1A1) and by catalase (which catalyzes H2O2 catabolism), thus
implying that H2O2 is an intermediate.
Down-regulation is also abolished by the mutation of the proximal
nuclear factor I (NFI) site in the promoter. The transactivating domain
of NFI/CTF was found to act in synergy with the arylhydrocarbon
receptor pathway during the induction of CYP1A1 by
2,3,7,8-tetrachloro-p-dibenzodioxin. Using an NFI/CTF-Gal4 fusion, we show that NFI/CTF transactivating function is decreased by a
high activity of CYP1A1. This regulation is also abolished by catalase
or ellipticine. Consistently, the transactivating function of NFI/CTF
is repressed in cells treated with H2O2, a novel finding indicating that the transactivating domain of a transcription factor can be targeted by oxidative stress. In
conclusion, an autoregulatory loop leads to the fine tuning of the
CYP1A1 gene expression through the down-regulation of NFI
activity by CYP1A1-based H2O2 production. This
mechanism allows a limitation of the potentially toxic CYP1A1 activity
within the cell.
 |
INTRODUCTION |
Cytochrome P450 monooxygenases are
drug-metabolizing enzymes that play a major role in the detoxification
and elimination of hydrophobic xenobiotics. Paradoxically, these
enzymes also generate reactive metabolites which can form DNA adducts
and lead to mutations (26). CYP1A1 is a ubiquitous member of
the P450 superfamily which is among the products of the aryl
hydrocarbon (Ah)-inducible gene battery (reference
50 and references therein). It is highly inducible
by the persistent environmental contaminant 2,3,7,8-tetrachloro-p-dibenzodioxin (TCDD) and by planar
aromatic hydrocarbons, such as 3-methylcholanthrene or benzo(a)pyrene
(BP) (24, 44, 59). CYP1A1 is known to play a critical role
in the activation of BP into a metabolite that can form DNA adducts (7, 32, 47). High-CYP1A1-inducibility phenotypes and the MspI polymorphism are suspected to be correlated with increased lung
cancer frequency, at least in some populations (28, 34).
The Ah receptor (AhR), once activated by ligands such as TCDD or planar
aromatic hydrocarbons, translocates from the cytosol into the nucleus,
heterodimerizes with Arnt (AhR nuclear translocator), and binds to a
class of promoter DNA sequences called xenobiotic-responsive elements
(XRE) (references 17 and 48 and
references therein). This mechanism of induction has been widely
studied at several laboratories (references 21, 30,
38, and 59; for a recent extensive review,
see reference 57). Studies on the murine
cyp1A1 gene have shown that its regulation involves cross
talk between enhancer and promoter sequences and concomitant changes in
the chromatin structure (30). The 5' upstream region of the
CYP1A1 gene contains several XRE that mediate the Ah
response, a negative regulatory element (6, 42, 56), and a
proximal promoter. In the latter, a short sequence, also referred to as
the basic transcriptional element (BTE), has been shown to be critical
for both basal and induced activities (24, 59). This complex
sequence contains overlapping binding sites for Sp1 and nuclear factor I (NFI) and can bind several proteins (23, 60).
In addition to the well-known positive regulation of CYP1A1,
the expression of this gene is repressed by several agents and conditions. Inflammatory cytokines as well as oxidative stress have
been shown to down-regulate the CYP1A1 gene expression and the expression of other cytochromes P450 (1, 3, 4, 37, 40).
The mechanisms involved are transcriptional, and in the case of tumor
necrosis factor alpha (TNF-
), H2O2 addition,
or glutathione depletion, we have shown that the integrity of the NFI
site in the BTE was critical. The binding of NFI/CTF to its consensus
DNA site is blunted by treatment of cells with either addition at
millimolar concentrations of H2O2 or
glutathione depletion (37). Yet, an additional mechanism is
likely to be involved since NFI-driven promoter activities (including
that of CYP1A1) were repressed by addition of submillimolar
concentrations of H2O2 in an NFI-depletion
manner (37). Whether the transcriptional activating domain
(TAD) of NFI is targeted by the H2O2 treatment is still an unresolved issue.
The down-regulation of CYP1A1 by H2O2 raised an
important question. Indeed, in vitro experiments showed that some
cytochromes P450 can release reactive oxygen species (ROS) like
H2O2 during their catalytic cycles,
particularly with uncoupled substrate (5, 41). Within the
cellular context, CYP2E1 overexpression was shown to produce ROS
(reference 8 and references within). In this study,
we assayed the ROS release due to the catalytic activity of CYP1A1 in
intact cells and hypothesized that it could influence the expression of
the CYP1A1 gene, leading to a feedback loop controlling the
steady-state level of the enzyme. Previous studies have suggested that
such an autoregulatory loop should be functional. Indeed, it has been
observed that endogenous CYP1A1 mRNA levels were higher in a
mouse hepatoma mutant cell line expressing a nonfunctional CYP1A1
enzyme than in the wild-type cell line (14, 45). Another
study also suggested that overexpression of CYP1A1 decreased its own
expression (25). However, the regulatory mechanism for such
an autoregulation process has remained unclear.
The mechanisms of autoregulation of several genes have already been
described. They mostly concern genes coding for transcription factors
whose promoters contain cognate DNA sequences for the encoded
transcription factors themselves. Positive feedback and negative
feedback have been reported (22, 36, 55). To our knowledge,
the mechanisms of autoregulation of a gene resulting from the activity
of the encoded enzyme itself have been rarely described in mammalian
cells. Protein kinase C has been shown to up-regulate its own
expression through the phosphorylation of some transduction proteins
(18), yet this mechanism is similar to the autoactivation of
genes coding for transcription factors and seems to be designed to
activate more efficiently a response to a signal. In the yeast, the
activity of a metallothionein protein has been reported to repress the
expression of its own gene (58).
In the present study, we provide a mechanism for the autoregulation of
CYP1A1 gene expression by the CYP1A1 enzymatic activity. We
show that the release of H2O2 during the
catalytic cycle targets the NFI/CTF transcription factor and thus
represses the promoter activity. We also show that the TAD of NFI/CTF
is involved in this regulation and that it specifically cooperates with
the signaling mediated by the AhR.
 |
MATERIALS AND METHODS |
Chemicals.
H2O2 was from a 30%
stock (Merck). TCDD was obtained from Promochem (Strasbourg, France).
2',7'-Dichlorodihydrofluorescein-diacetate (H2DCF-DA) was
purchased from Interchim (Asnière, France). BP and other
chemicals were obtained from Sigma (L'Ile d'Abeau, France), and
oligonucleotides were obtained from Genset (Paris, France).
Cell culture.
The human hepatoma cell line HepG2
(29) was maintained as described elsewhere (12).
These cells were used because the endogenous CYP1A1 gene is
regulated by H2O2 (37) and because of their excellent transfection efficiency.
Intracellular H2O2 generation
assay.
The oxidation-sensitive probe H2DCF-DA is
a nonpolar compound that readily diffuses into cells, where it is
hydrolyzed by endogenous esterases (46). The resulting
compound is not fluorescent but yields the fluorescent compound
2',7'-dichlorofluorescein (DCF) when oxidized. Cells were cultured in
6-well plates (Costar, Corning, N.Y.). H2DCF-DA (200 µM)
was added directly to the culture medium, and cells were cultured under
standard conditions for 1 h. The fluorescence of DCF was then
measured with a Bio-Tek FL-600 fluorimeter (Fisher, Elancourt, France)
by using 485 and 530 nm as the excitation and emission wavelengths,
respectively. In each well (diameter, 3.5 cm), 109 measurements were
made with a 3-mm-diameter optic so as to cover the whole well surface.
The result given for each well was expressed as the sum of the 109 values obtained.
Northern blotting.
RNA preparation and Northern blotting
were performed as already described (11). Probes were
synthesized from cDNAs with the Megaprime DNA labeling kit (Amersham)
according to the manufacturer's instructions. Quantifications were
performed by using a Phosphorimager and the ImageQuant software
(Molecular Dynamics, Inc).
Plasmids.
The plasmid p1A1-FL, containing the 5' region of
the human CYP1A1 gene (positions
1566 to +73) upstream of
the firefly luciferase coding sequence, and the plasmid p
glob-RL,
which expresses Renilla luciferase and was used as the control plasmid
in transfection experiments, were described previously (37).
The plasmid p50mut1A1-FL is identical to p1A1-FL except for a double
mutation at the
50 position in the NFI site. The NFI half-site
sequence GCCA was converted to CGCA. This mutation was obtained by
site-directed mutagenesis on p1A1-FL, using a mutated oligonucleotide
and the GeneEdit kit (Promega) according to the manufacturer's instructions.
A DNA sequence containing five Gal4 binding sites and a TATA box was
excised from the plasmid pG5BCAT (described in reference 2) and inserted between the SacI and
XmaI sites of the pGL3-FL vector (Promega), to give pG5-FL.
A double-stranded oligonucleotide (5'
CCTTCTCACGCAACGCCGCGGCGCACGCAAGCTCTTCTCACGCGAG
3') containing three XRE sequences (underlined) located around
the
980,
900, and
500 positions in the human CYP1A1
gene promoter was inserted between the SacI and
EcoRI sites of pG5-FL, upstream of the Gal4 sites, to give
pXRE3G5-FL.
A 1,560-bp cDNA of the human CYP1A1 gene, a generous gift of
I. de Waziers (INSERM, Paris, France) was inserted between the NotI and XbaI sites into the pOPRSVI/MCS vector
(Stratagene) (also named pRSV/MCS in this study), which contains two
procaryotic lac operons, to give pRSV-1A1. pLacI (from the
Inducible Mammalian Expression System kit; Stratagene) expresses the
LacI protein under the control of the cytomegalovirus (CMV) promoter.
The smaller BamHI-NotI fragment from pRSV-1A1 was
subcloned into the BamHI and NotI sites of pcDNA
1.1 AmpR (Invitrogen) (also named pCMV/MCS in this study) to give
pCMV-1A1, which thus expresses the human CYP1A1 protein under the
control of the CMV promoter.
pRSV.Gal.CTF, pRSV.Gal.Sp1, and pRSV.Gal.Oct are derived from the
plasmids pGal(399-499), pGalOct2, and pGalSp1 (described in reference
2), in which the simian virus 40 promoters have been
replaced by Rous sarcoma virus (RSV) promoters. They express fusion
proteins containing the Gal4 DNA binding domain linked to the TAD of
the human transcription factors NFI/CTF, Sp1 and Oct, respectively
(2).
Transfection experiments.
Transfection experiments were
performed in HepG2 cells by a standard calcium phosphate
coprecipitation technique as previously described (37). The
transfection efficiency was assayed with 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
staining of intact cells transfected with a
-galactosidase
expression vector according to the protocol of the p-Hook kit
(Invitrogen). The metabolism of this compound by the enzyme
-galactosidase yields a blue staining of cells. Briefly,
approximately 0.5 × 106 cells were trypsinized
30 h after transfection and resuspended in 100 µl of X-Gal
reagent (a phosphate-buffered saline solution [pH 7.4] containing the
following: X-Gal, 1 mg/ml in dimethylformamide; K3Fe(CN)6, 4 mM;
K4Fe(CN)6, 4 mM; MgCl2, 2 mM).
After overnight incubation at room temperature on a rocker, blue cells
were counted under a microscope. The transfection efficiency was
expressed as the quotient of the number of blue cells and the total
number of cells multiplied by 100.
Dual luciferase assay (firefly and Renilla) was performed with a
Promega kit. Renilla luciferase activity was used to normalize the
transfection efficiency in all culture dishes. Blanks were obtained by
assaying luciferase activity in mock-transfected cells.
Statistics.
Student's two-tailed t-tests were
performed by using Statview software (Abacus Concepts, Inc.).
 |
RESULTS |
CYP1A1-mediated intracellular H2O2
production.
The production of ROS by CYP1A1 in cultured HepG2
cells was assayed as described in the Materials and Methods section,
using H2DCF-DA as a probe. This compound yields DCF, a
fluorescent compound, when oxidized within the cell by ROS, especially
H2O2 (46). The induction of the
endogenous CYP1A1 gene by BP caused a two- to threefold increase in DCF
fluorescence (Fig. 1A). A similar increase was observed when cells were treated with dioxin (data not
shown). The addition of ellipticine (a CYP1A1 inhibitor
[53]) or catalase (an H2O2
scavenger) to the culture medium abolished the increase in DCF
fluorescence. The compounds used to treat cell cultures (BP,
ellipticine, and catalase) did not affect cell growth or viability
(data not shown). These results suggest that the activity of CYP1A1
leads to an intracellular production of ROS, essentially
H2O2.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Intracellular H2O2 generation by
CYP1A1 activity. H2O2 levels within HepG2 cells
were assayed as described in the Materials and Methods section. Cells
were cultured for 30 h with or without addition of ellipticine (10 µM) or catalase (200 U/ml). Plates were then read in a fluorometer,
and fluorescence was expressed in arbitrary units. Results were
expressed as means ± standard errors of the means (n = 6), normalized to 100% for control cells. Statistical differences
from values for the control are marked with double asterisks
(P < 0.01). (A) Assay of the
H2O2 produced following the induction of the
endogenous CYP1A1 by BP (2.5 µM). (B) Assay of the
H2O2 produced following the transfection of a
CYP1A1 expression vector (pRSV-1A1). Control cells were transfected
with pRSV/MCS.
|
|
The transfection of a plasmid expressing the human CYP1A1 isoform also
led to a 60% increase in DCF fluorescence (Fig. 1B). As in the
previous experiment, the increase was abolished by ellipticine or
catalase. In our experiments, the transfection efficiency in HepG2
cells (see the Materials and Methods section) was about 20% (19.8% ± 4.4%, n = 3; data not shown). Thus, the level of intracellular oxidative stress obtained with the induction of the
endogenous CYP1A1 gene and that obtained with the
transfection of a CYP1A1 expression vector are within the same range.
The production of H2O2 limits
CYP1A1 mRNA induction.
The effect of
H2O2 (i.e., H2O2
released by CYP1A1 activity) on CYP1A1 induction was studied in cells
of the human hepatoma cell line HepG2, where the regulation of this
gene by Ah ligands, oxidative stress, and cytokines was demonstrated
previously (37). The induction of the endogenous
CYP1A1 gene was achieved by BP treatment of cell cultures
and assayed by Northern blotting experiments. As shown in Fig.
2A, the induction was greatly enhanced
when catalase was added together with the BP, whereas catalase alone
did not increase the basal (i.e., noninduced) levels of
CYP1A1 mRNAs. Ellipticine also enhanced the levels of
CYP1A1 mRNAs induced by BP (Fig. 2B). The mean values for
fold enhancement of the BP inducing effect by catalase (200 U/ml) and
ellipticine (10 µM) were 4.2 ± 0.7 and 4.4 ± 1.3, respectively (n = 6). These experiments show that the
induction of the endogenous CYP1A1 gene by BP alone is not
maximal and is limited by a repressive mechanism. This limitation is,
at least partially, abolished when the activity of CYP1A1 is inhibited
or when the H2O2 release resulting from this
activity is blunted. These data suggest that the expression of the
endogenous CYP1A1 gene could be regulated in a
negative-feedback loop by the activity of the enzyme itself.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Limitation of level of CYP1A1 mRNAs induced
by CYP1A1 activity. Northern blots were prepared by using 20 µg of
HepG2 cell mRNAs in each lane and probed with a labeled human
CYP1A1 cDNA. Cells were treated for 72 h with the
compounds mentioned below. After 36 h, the culture medium was
changed and the treatment was resumed. BP (2.5 µM) was used in order
to induce CYP1A1 mRNAs. (A) In addition to BP, the indicated
concentrations of catalase were added to the culture medium. (B) In
addition to BP, ellipticine (10 µM) was added, or not, to the culture
medium.
|
|
Direct assessment of the autoregulation of CYP1A1.
We next
designed an experimental approach to directly assess the effect of
increased CYP1A1 activity on CYP1A1 gene expression. Indeed,
the induction of the endogenous enzyme by AhR ligands interferes with
the promoter activity and may not be appropriate for studying the
repression. Thus, the increase in CYP1A1 activity was achieved by
transfection of a CYP1A1-expressing vector (pRSV-1A1). As shown above
(Fig. 1), this procedure leads to a modification of the intracellular
redox status that is similar to the one produced by the endogenous
enzyme induction (Fig. 1). Cotransfection of a luciferase reporter gene
driven by the CYP1A1 gene promoter (Fig.
3A) allowed us to evaluate the effect of
increased CYP1A1 activity on its own gene promoter activity. When cells
were cotransfected with the pRSV-1A1 vector expressing the human CYP1A1
protein, the activity of the CYP1A1 gene promoter decreased
by half (Fig. 3B). The pRSV-1A1 vector contains two lac
operons located in the immediate vicinity of the RSV promoter. This
allows the repression of the latter promoter by the LacI protein. When
the pLacI vector, expressing the LacI protein, was cotransfected with
pRSV-1A1, the inhibitory effect on the CYP1A1 promoter observed was
abolished (Fig. 3B). Thus, this effect was indeed mediated by the
transfected CYP1A1 gene expression. Treatment of cells with
pyrrolidine dithiocarbamate, a redox-active compound containing two
thiol moieties, prevented the effect of the CYP1A1 protein expression,
suggesting a contribution of ROS in this regulation (Fig. 3B).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Autoregulation of CYP1A1 (basal activity). HepG2 cells
were transfected with the p1A1-FL reporter plasmid (2 µg). (A)
Structure of the 1.6-kb-long human CYP1A1 promoter used in transfection
experiments (p1A1-FL vector). (B) Effect of the expression of CYP1A1 on
the basal activity of the CYP1A1 promoter. In order to express the
CYP1A1 protein, cells were cotransfected with 4 µg of the pRSV-1A1
expression vector (gray bars). In control cells (open bars), the same
plasmid lacking the CYP1A1 cDNA (pRSV/MCS) was transfected
in order to have an equivalent amount of total transfected DNA. All the
cells were cotransfected with p glob-RL (1 µg) as an internal
control. Results were expressed as the means ± standard errors of
the means for the quotient of firefly luciferase activity and Renilla
luciferase activity (n = 10), normalized to 100% for
control cells transfected with pRSV/MCS. A statistical difference
between pRSV/MCS and pRSV-1A1 for the same condition is marked with a
double asterisk (P < 0.0001).
|
|
The experiments described above were performed in the absence of an
exogenous substrate of CYP1A1. It is thus likely that overexpressed CYP1A1 metabolized endogenous substrates.
Autoregulation of the induced CYP1A1 in the presence of BP.
BP, which is a known ligand of the AhR, strongly induced the
transcription driven by the CYP1A1 promoter (2.5 µM BP for 24 h
led to a 35 ± 9 fold induction; data not shown). It is also a
substrate of CYP1A1 that can be converted into an epoxide by this
enzyme (reference 27 and references within). In the
presence of BP, the cotransfection of pRSV-1A1 led to a decrease by
half of the induced CYP1A1 gene promoter activity (Fig.
4). As observed with the basal activity,
this effect was the result of the transfected CYP1A1 cDNA
expression since it was abolished by the cotransfection of the pLacI
vector. In cells treated with catalase (an
H2O2-scavenging enzyme) or ellipticine, the
BP-induced activity of the CYP1A1 promoter was no longer
sensitive to CYP1A1 protein expression. Thus, both basal and induced
CYP1A1 promoter activities are down-regulated by the
activity of CYP1A1, in an H2O2-dependent
manner.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
Autoregulation of CYP1A1 (BP-induced activity). HepG2
cells were transfected with the p1A1-FL plasmid (2 µg). In order to
express the CYP1A1 protein, cells were cotransfected with 4 µg of the
pRSV-1A1 expression vector (gray bars). In control cells (open bars),
the same plasmid lacking the CYP1A1 cDNA (pRSV/MCS) was
transfected in order to have an equivalent amount of total transfected
DNA. All cells were cotransfected with p glob-RL (1 µg) as an
internal control. Results were expressed as the means ± standard
errors of the means for the quotient of firefly luciferase activity and
Renilla luciferase activity (n = 10), normalized to
100% for control cells transfected with pRSV/MCS. A statistical
difference between pRSV/MCS and pRSV-1A1 for the same condition is
marked with a double asterisk (P < 0.0001). All cells
were treated by BP (2.5 µM) for 24 h before harvest. C, control
cells; pLacI, cells cotransfected with the pLacI plasmid (1 µg);
Catalase, cells treated with catalase (100 U/ml) for 24 h; and
Ellipticine, cells treated with ellipticine (10 µM) for 24 h.
|
|
A mutation in the proximal NFI site abolishes the
autoregulation.
We have shown previously that NFI-driven promoters
are sensitive to oxidative stress (37). We thus tested
whether the mutation of the proximal NFI site in the CYP1A1
gene promoter affected the autoregulation. The p50mut1A1-FL vector is
identical to the p1A1-FL vector except for a mutation in the NFI site
located at the
50 position in the proximal promoter of the
CYP1A1 gene. This mutation decreases the basal activity
about fivefold (Fig. 5), but this
activity remains well above background levels (37). We have
shown previously that this mutation abolished the repression of the
promoter by oxidative stress (37). The results shown in Fig.
5 indicate that the expression of the CYP1A1 protein had no effect on
the activity of p50mut1A1-FL, suggesting a role for the NFI site in the
autoregulatory process (Fig. 5).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of CYP1A1 expression on the NFI-mutated CYP1A1
promoter. Cells were transfected with the p1A1-FL or the p50mut1A1-FL
reporter plasmid and cotransfected with either the CYP1A1-expressing
vector pRSV-1A1 (4 µg) (gray bars) or the vector pRSV/MCS (4 µg)
(open bars) in order to transfect similar amounts of DNA. All cells
were cotransfected with p glob-RL (1 µg) as an internal control.
Results were expressed as means ± standard errors of the means
for the quotient of firefly luciferase activity and Renilla luciferase
activity (n = 8), normalized to 100% for cells
transfected with p1A1-FL and pRSV/MCS. A statistical difference between
pRSV/MCS and pRSV-1A1 for the same condition is marked with a double
asterisk (P < 0.0001).
|
|
The transactivating function of NFI/CTF is sensitive to CYP1A1
activity.
To study the role of the transcription factor NFI in the
activation of the CYP1A1 gene promoter and its
down-regulation by the activity of the CYP1A1 protein, we focused on
its TAD. Indeed, our previous studies suggested that the
transactivating function of NFI/CTF was repressed at lower
concentrations of H2O2 than its DNA binding
activity. Fusion proteins containing the DNA binding domain of the
bacterial Gal4 protein coupled to the TADs of various human
transcription factors were cotransfected with the pG5-FL reporter
vector containing five Gal4 binding sites (Fig.
6A). The cotransfection of the vector
expressing the NFI/CTF-Gal4 fusion protein activated the transcription
of pG5-FL about fourfold (3.6 ± 0.2 fold, data not shown; see
also Fig. 8). In the experiments whose results are shown in Fig. 6 and
7, we used pCMV-1A1 as a CYP1A1 expression vector (this vector was used
instead of pRSV-1A1 because we noticed a poor expression of pG5-FL upon
cotransfection with pRSV-1A1, possibly due to a decreased expression of
NFI/CTF, which is also driven by an RSV promoter).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
The transactivating function of NFI/CTF is altered by
CYP1A1 activity. (A) Structure of the promoter driving the reporter
gene in the pG5-FL plasmid. (B) Activity driven by the TAD of NFI/CTF.
Cells were cotransfected with the pG5-FL (1.75 µg) reporter vector
and 2.5 µg of the pRSV.Gal.CTF vector expressing a Gal-TAD fusion
protein (see the Materials and Methods section). Cells were
cotransfected with 3 µg of either the CYP1A1 expression vector
pCMV-1A1 (gray bars) or the empty pCMV/MCS vector (open bars). All
cells were cotransfected with p glob-RL (0.75 µg) as an internal
control. Cells were untreated or treated with BP (2.5 µM) for 40 h. In addition, cell were treated with catalase (100 U/ml) (lanes 5 to
8) or ellipticine (10 µM) (lanes 9 to 12) for 40 h. Dimethyl
sulfoxide vehicle (0.5% [vol/vol] final concentration) did not
significantly change the expression of the reporter gene. Results were
expressed as means ± standard errors of the means for the
quotient of firefly luciferase activity and Renilla luciferase activity
(n > 8), normalized to 100% for control cells
transfected with pCMV/MCS. For each group of results (lanes 1 to 4, 5 to 8, and 9 to 12), values were compared to that for the corresponding
pCMV/MCS-transfected control (lane 1, 5, and 9, respectively), and only
differences that are statistically significant are marked with double
asterisks (P < 0.001).
|
|
As can be seen in Fig. 6B, the transactivating function of NFI/CTF was
decreased upon cotransfection of pCMV-1A1 (compare lanes 1 and 3). The
addition of BP to the culture medium slightly (but significantly)
decreased the transactivating function of NFI/CTF, even in the absence
of pCMV-1A1 (20% inhibition; compare lanes 1 and 2). This is probably
due to the induction of the endogenous CYP1A1. It is noticeable that
the addition of BP did not lead to a significant decrease when cells
were treated with catalase or ellipticine (compare lanes 5 and 6 and
lanes 9 and 10).
Upon cotransfection of the pCMV-1A1 vector, BP strongly inhibited the
transactivating function of NFI/CTF, by almost 70% (compare lanes 1 and 4). The addition of catalase or ellipticine abolished the
inhibitory effect observed with pCMV-1A1, in the absence of BP (compare
lanes 5 and 7 and lanes 9 and 11) or in the presence of BP (compare
lanes 5 and 8 and lanes 9 and 12). These data suggest that the TAD of
NFI/CTF is a likely target of CYP1A1 activity and mediates the
autoregulation of the CYP1A1 gene expression.
Specificity of NFI/CTF TAD regulation.
In order to assess the
specificity of the NFI/CTF role in CYP1A1 autoregulation, the TADs of
the ubiquitous transcription factors Sp1 and Oct were also tested. The
Sp1 transcription factor has been shown to play an important role in
the activation of the CYP1A1 gene promoter (31).
In this study, the TAD of Oct was used as a negative control. In
contrast to NFI/CTF, the transactivating functions of Sp1 and Oct were
decreased neither by the expression of the CYP1A1 protein nor by BP
treatment (Fig. 7A). It should be noted
that NFI/CTF and Sp1 had a similar efficiency in activating transcription, whereas Oct was about 60% as efficient as NFI/CTF (Fig.
7A). We then assessed the sensitivity of these TADs to direct oxidative
stress (Fig. 7B). Upon H2O2 treatment, the NFI
transactivating function was significantly decreased whereas that of
either Sp1 or Oct was not. These data highlight the particular
sensitivity of NFI to oxidative stress.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the sensitivities of the TADs of NFI/CTF,
Sp1, and Oct. Cells were cotransfected with the pG5-FL (1.75 µg)
reporter vector and 2.5 µg of either pRSV.Gal.CTF, pRSV.Gal.Sp1, or
pRSV.Gal.Oct (see the Materials and Methods section). All cells were
cotransfected with p glob-RL (0.75 µg) as an internal control.
Results were expressed as means ± standard errors of the means
for the quotient of firefly luciferase activity and Renilla luciferase
activity (n > 8), normalized to 100% for control
cells transfected with pRSV.Gal.CTF and pCMV/MCS. For each Gal-TAD
fusion, statistical differences from the untreated pRSV/MCS-transfected
control cells are marked with an asterisk (P < 0.01)
or a double asterisk (P < 0.0001). (A) Cells were
cotransfected with either the CYP1A1-expressing vector pCMV-1A1 (3 µg) or the pCMV/MCS (3 µg) vector in order to transfect similar
amounts of DNA and were treated or not with BP (2.5 µM) for 40 h. (B) Effect of oxidative stress on the TADs of NFI/CTF, Sp1, and Oct.
Cells were treated or not with H2O2 (17.5 µM)
for 16 h.
|
|
Reconstitution of the cooperation between NFI and XRE sites.
The data presented above suggested a critical role of the TAD of
NFI/CTF in the autoregulation of the CYP1A1 gene and its regulation by oxidative stress. Since the major transcription factor
controlling the induction of the CYP1A1 gene is the Ah receptor, we next asked whether we could provide evidence for a
putative synergy between the TAD of NFI/CTF and the AhR. We thus
attempted to reconstitute an AhR-sensitive system using the pXRE3G5-FL
reporter vector (Fig. 8A). Three XRE
present in the CYP1A1 promoter (see the Materials and Methods section)
were inserted upstream of the Gal4 binding sites in the pG5-FL vector.
Upon cotransfection with vectors expressing the above-mentioned fusion proteins and TCDD induction, this vector allowed us to assess the role
that the TAD of a transcription factor can play in the Ah response
mediated by the XRE sequences. As can be seen in Fig. 8B, TCDD induced
almost eightfold the expression of the luciferase gene in the
pXRE3G5-FL vector (compare lanes 1 and 2). This expression was also
activated upon cotransfection of the vectors expressing the fusion
proteins Gal.CTF, Gal.Sp1, and Gal.Oct in the absence of TCDD treatment
(compare lane 1 to lanes 4, 7, and 10, respectively). The inducing
effect of the Gal.CTF fusion protein on the expression of the reporter
gene was similar to that of the Gal.Sp1 fusion (about fivefold) and
approximately twice that of Gal.Oct, in agreement with the results
shown in Fig. 7. Thus, the neighboring XRE and Gal4 binding sites are
responsive to their respective specific stimuli.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8.
Synergistic effect of TCDD signaling and NFI/CTF. (A)
Structure of the promoter driving the reporter gene in the pXRE3G5-FL
plasmid. (B) Cells were transfected with the pXRE3G5-FL reporter vector
(2.5 µg) and with 3 µg of either pRSV.Gal.CTF, pRSV.Gal.Sp1,
pRSV.Gal.Oct (see the Materials and Methods section), or pRSV/MCS. All
cells were cotransfected with p glob-RL (1 µg) as an internal
control. Cells were left untreated or treated with TCDD (3 nM, and/or
H2O2 (50 µM) for 16 h. Results were expressed
as means ± standard errors of the means for the quotient of
firefly luciferase activity and Renilla luciferase activity
(n = 9), normalized to 100% for cells transfected with
pRSV/MCS and treated with TCDD. For each Gal fusion, statistical
differences between TCDD-treated cells treated with
H2O2 (50 µM) and cells not treated are marked
with a double asterisk (P < 0.0001).
|
|
When the cells were cotransfected with the Gal.CTF expression vector
and treated with TCDD, the reporter gene expression was increased
almost 60-fold, revealing a synergistic effect of the two stimuli
(compare lane 5 to lanes 2 and 4). Cooperation with the TCDD treatment
was much less potent in the case of the Gal.Sp1 and Gal.Oct fusions.
Indeed, in the presence of Gal.CTF, TCDD elicited a 14-fold increase in
the reporter gene activity (compare lanes 4 and 5), whereas in the case
of Gal.Sp1, TCDD elicited only a fourfold increase (compare lanes 7 and
8). Thus, the TAD of NFI/CTF displays a particularly efficient synergy
with the AhR signaling, at least with the target promoter and the
experimental conditions used in this study.
We then tested the effect of oxidative stress on the activation of the
XRE-Gal4 promoter (pXRE3G5-FL reporter vector).
H2O2 did not affect the TCDD response in the
absence of cotransfected fusion protein (compare lanes 2 and 3). This
suggests that, under our experimental conditions, the AhR activity
itself is not sensitive to oxidative stress. Furthermore,
H2O2 treatment did not significantly affect the
induction of the promoter by a combination of TCDD treatment and either
Gal.Sp1 or Gal.Oct cotransfection. In contrast, under the same
experimental conditions, H2O2 decreased by more than 60% the promoter activity elicited by a combination of TCDD treatment and Gal.CTF cotransfection.
In conclusion, the activity of the TAD of NFI/CTF is specifically
repressed by oxidative stress in two different promoter contexts, i.e.,
when it is the major activator of transcription (cf. Fig. 7B) and when
it acts in synergy with the AhR (cf. Fig. 8B).
 |
DISCUSSION |
The cellular steady state of a protein results from a balance
among several processes: the positive and negative regulation of mRNA
transcription, mRNA stability, protein stability, and transport. It has
been shown that the fine tuning of these processes sometimes requires
feedback loops and autoregulatory mechanisms. This is the case in
particular for several transcription factors and nuclear receptors
which regulate their own expressions (as discussed in the
introduction). Yet, autoregulatory mechanisms have been rarely
described for other proteins.
Autoregulation requirements are particularly important when the gene is
highly inducible because several steady states are reached under
different conditions. CYP1A1 is a typical case of a highly inducible
gene. Furthermore, the precise determination of the levels of
cytochromes P450 is all the more important that these enzymes can
produce ROS during their catalytic cycles (8, 41), leading
to cell toxicity (8, 9, 39). It is therefore critical to
control the activity of an enzyme such as CYP1A1, in particular by
regulating its expression level.
In this study, we present data supporting the following model for the
autoregulation of CYP1A1 expression (Fig.
9): (i) BP activates CYP1A1 expression
via the AhR pathway; (ii) the subsequent increase in CYP1A1 activity
leads to H2O2 production; (iii) NFI transactivating function is altered by H2O2,
which in turn represses CYP1A1 expression. This mechanism should limit
the expression of the CYP1A1 gene and thus prevent an
excessively large accumulation of the protein and of ROS.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
Autoregulation of CYP1A1 gene expression. This scheme
summarizes the autoregulatory mechanism proposed in this study. The Ah
receptor (AhR), after activation by a ligand such as BP, dimerization
with Arnt, and interaction with transcription factors, stimulates the
CYP1A1 gene promoter. The interaction with NFI leads to a
synergistic effect on transcription. This leads to the synthesis of the
enzyme. CYP1A1 enzymatic activity generates
H2O2, especially in the presence of uncoupled
substrates such as BP (which can be converted into a metabolite
[BP*]). H2O2 then alters NFI function, mainly
at the level of its TAD. In consequence, NFI loses its ability to
activate the CYP1A1 gene basal promoter activity and to act
in synergy with the AhR signaling, which limits the expression of the
CYP1A1 enzyme.
|
|
The formation of H2O2 by microsomal cytochromes
P450 has been consistently observed, particularly with uncoupled
substrates (19, 33) including BP (20). Recently,
in vitro experiments studying electron transport during the catalytic
cycle of human CYP1A1 showed that this enzyme could produce
H2O2 (43). Within the cellular
context, 8-oxo-guanine formation in DNA was observed after CYP1A1
induction (39), showing that CYP1A1 can generate oxidative
stress in vivo and have a nuclear impact. Consistently, a recent study
showed that TCDD treatment of mice led to a sustained oxidation of
hepatic glutathione and 8-oxo-guanine formation (51). In
this study, we show that the activity of CYP1A1 leads to an intracellular H2O2 production in HepG2 cells.
Our data suggest that the H2O2 released by
CYP1A1 is required for the autoregulatory process since antioxidants,
in particular catalase, disrupt this effect. The activity of CYP1A1 was
required for gene repression since ellipticine could prevent this
effect. The next step in our model, i.e., the repression of the TAD of
NFI/CTF by oxidative stress, is supported by data from this study. We
have previously shown that NFI binding to DNA was blunted by millimolar
amounts of H2O2 or by glutathione depletion
(37). Here we show that the TAD of NFI is repressed by much
smaller amounts (in the range from 10 to 100 µM
H2O2). Thus, this function of NFI is the likely relevant target in vivo. Furthermore, we show that the expression of
CYP1A1 represses the TAD of NFI as efficiently as exogenous H2O2 addition. The question of whether the
conformation of the TAD is modified by oxidative stress needs further
investigation. In this respect, we are presently investigating the
amino acid targeted by H2O2 in the TAD and have
found that a critical cysteine seems to be involved. These molecular
mechanisms are novel since most studies (in eukaryotic cells) on the
oxidative modulation of transcription factors have focused on their DNA
binding activities without a specific assessment of their
transactivating functions. It appears to be a likely mechanism in vivo
since it involves limited H2O2 concentrations
(such as those generated by CYP1A1 activity within the cell). Since NFI
is a ubiquitous transcription factor, its oxidative repression could
modulate the expression of several genes (depending on the relative
importance of NFI function compared to that of other transcription
factors for the activation of the promoter).
The last step in our model is the contribution of NFI to the expression
and regulation of the CYP1A1 gene promoter. We have previously shown that the mutation of the NFI site located in the
proximal promoter (BTE) decreased both basal and induced promoter activities, in agreement with other studies (24). This
mutation prevented the negative regulation by
H2O2 (37). We also observed that
other, more conserved NFI sites within the enhancer regions also
contribute to the induction of the promoter but not to its basal
activity (data not shown). We have reconstituted a system evaluating
the synergy between the AhR pathway and transcription factor
transactivating domains and have shown that the TAD of NFI is more
efficient than other TADs in cooperating with the Ah activation of a
XRE-driven promoter. These data do not preclude the contribution of
other transcription factors that bind to the promoter, such as Sp1
(31), but they highlight the important contribution of NFI
to the activation of CYP1A1 by AhR ligands and its crucial role in the
repression of this activation by H2O2. Indeed,
in our experiments, the induction of the XRE-driven reporter gene by
TCDD, in the absence of the TAD of NFI, was not altered by
H2O2, underscoring again the role of NFI in the
down-regulation (e.g., in the autoregulation) of CYP1A1 by oxidative
stress. It would be interesting to assess whether
H2O2 alters directly a putative NFI-AhR
interaction or if the mechanism involves an interaction with a common coactivator.
The autoregulatory loop shown here may not be the only one operating to
control the level of CYP1A1 gene expression. TCDD, which
strongly induces CYP1A1 expression, also stimulates the expression of
the cytokines TNF-
and interleukin-1 (16). These cytokines can in turn down-regulate the CYP1A1 gene
expression (1, 4, 40). In the case of TNF-
, we have shown
that NFI and ROS were involved in the signaling mechanism
(37). In an interesting study, Fujii-Kuriyama et al. have
suggested that the AhR, stimulated by TCDD, could induce the expression
of a specific repressor (AhRR), which then limits the AhR effect
(35). Indeed, the autoregulatory mechanism does not imply a
decrease in AhR or Arnt production, since the expression of CYP1A1 does
not affect the levels of their mRNAs (25). Moreover, it was
reported recently that the transcription factor NF-
B (which is
induced by H2O2 and TNF-
[13,
49]) and the AhR displayed mutual functional repression
(54). Thus, more than one mechanism could be involved in the
fine tuning of the CYP1A1 gene expression. The existence of
several such mechanisms is likely to be due to the deleterious effect
of the oxidative stress generated by a high activity of the CYP1A1
enzyme (39, 51, 52) as well as the activation of
carcinogenic compounds (references 26 and
47 and references therein). The autoregulation of
CYP1A1 gene expression and its down-regulation by
H2O2 and inflammatory cytokines are part of a
general cellular response to exogenous or endogenous oxidative stress.
This response involves the well-known activation of antioxidant enzymes
(10). However, this may not be sufficient, and it is important to prevent the intracellular production of ROS by repressing ROS-producing metabolic pathways, such as those catalyzed by
monooxygenases (e.g., CYP1A1). In this respect, we are presently
studying the redox regulation of other CYP isoforms. Owing to an
historical focus on gene inductions, transcriptional repression by
oxidative stress has been less studied than its activating capacity and few molecular mechanisms have been demonstrated. The repression of the
transactivating function of NFI/CTF appears to be one such mechanism.
In addition to oxidative stress, CYP1A1 is also repressed under hypoxic
conditions. The group of Poellinger has shown that, in the case of
hypoxia, the hypoxia-inducible factor HIF1
was stabilized and could
recruit Arnt, its heterodimerization partner (15). A
decrease in the available Arnt protein could, in turn, alter the AhR
response and thus limit CYP1A1 expression. This contributes to the
limitation of O2 waste in monooxygenase-based metabolism
under hypoxic conditions. In conclusion, the CYP1A1 gene appears to
undergo several repressive regulations at the transcriptional level,
owing to its high inducibility and to the possible subsequent toxic
effect within the cell.
 |
ACKNOWLEDGMENTS |
This work was supported by INSERM, Université Paris
V-René Descartes, Fondation pour la Recherche
Médicale (grant 1000031401), and Région
Ile-de-France. N.M. is supported by grants from the Swiss NSF and the
Etat de Vaud.
We especially thank M. Kobr for his kind and useful help with Gal
fusions experiments. We thank P. Beaune and M. Aggerbeck for critical
reading of the manuscript and I. de Waziers and P. Maurel for the
generous gifts of CYP1A1 cDNA and gene promoter, respectively.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: INSERM U490,
Université Paris V-René Descartes, Centre Universitaire des
Saints-Pères, 45, rue des Saints-Pères, 75006 Paris,
France. Phone: 33-1 42 86 20 75. Fax: 33-1 42 86 20 72. E-mail:
robert.barouki{at}biomedicale.univ-paris5.fr.
 |
REFERENCES |
| 1.
|
Abdel-Razzak, Z.,
L. Corcos,
A. Fautrel,
J.-P. Campion, and A. Guillouzo.
1994.
Transforming growth factor- 1 down-regulates basal and polycyclic aromatic hydrocarbon-induced cytochromes P-450 1A1 and 1A2 in adult human hepatocytes in primary culture.
Mol. Pharmacol.
46:1100-1110[Abstract].
|
| 2.
|
Alevizopoulos, A.,
Y. Dusserre,
M. Tsai-Pflugfelder,
T. von der Weid,
W. Wahli, and N. Mermod.
1995.
A proline-rich TGF- -responsive transcriptional activator interacts with histone H3.
Genes Dev.
9:3051-3066[Abstract/Free Full Text].
|
| 3.
|
Barker, C. W.,
J. B. Fagan, and D. S. Pasco.
1994.
Down-regulation of P450 1A1 and 1A2 mRNA expression in isolated hepatocytes by oxidative stress.
J. Biol. Chem.
269:3985-3990[Abstract/Free Full Text].
|
| 4.
|
Barker, C. W.,
J. B. Fagan, and D. S. Pasco.
1992.
Interleukin-1 suppresses the induction of P4501A1 and P4501A2 mRNAs in isolated hepatocytes.
J. Biol. Chem.
267:8050-8055[Abstract/Free Full Text].
|
| 5.
|
Bondy, S. C., and S. Naderi.
1994.
Contribution of hepatic cytochrome P450 systems to the generation of reactive oxygen species.
Biochem. Pharmacol.
48:155-159[Medline].
|
| 6.
|
Boucher, P. D.,
M. P. Piechocki, and R. N. Hines.
1995.
Partial characterization of the human CYP1A1 negatively acting transcription factor and mutational analysis of its cognate DNA recognition sequence.
Mol. Cell. Biol.
15:5144-5151[Abstract].
|
| 7.
|
Butkiewicz, D.,
E. Grzybowska,
K. Hemminki,
S. Ovrebo,
A. Haugen,
G. Motykiewicz, and M. Chorazy.
1998.
Modulation of DNA adduct levels in human mononuclear white blood cells and granulocytes by CYP1A1, CYP2D6 and GSTM1 genetic polymorphisms.
Mutat. Res.
415:97-108[Medline].
|
| 8.
|
Chen, Q., and A. I. Cederbaum.
1998.
Cytotoxicity and apoptosis produced by cytochrome P450 2E1 in Hep G2 cells.
Mol. Pharmacol.
53:638-648[Abstract/Free Full Text].
|
| 9.
|
Chen, Q.,
M. Galleano, and A. I. Cederbaum.
1997.
Cytotoxicity and apoptosis produced by arachidonic acid in Hep G2 cells overexpressing human cytochrome P4502E1.
J. Biol. Chem.
272:14532-14541[Abstract/Free Full Text].
|
| 10.
|
Crawford, D. R., and K. J. Davies.
1994.
Adaptive response and oxidative stress.
Environ. Health Perspect.
102(Suppl. 10):25-28.
|
| 11.
|
Feilleux-Duché, S.,
M. Garlatti,
M. Aggerbeck,
J. Bouguet,
J. Hanoune, and R. Barouki.
1994.
Phorbol esters inhibit the glucocorticoid-mediated stimulation of cytosolic aspartate aminotransferase gene transcription.
Biochem. J.
297:497-502.
|
| 12.
|
Garlatti, M.,
M. Aggerbeck,
J. Bouguet, and R. Barouki.
1996.
Contribution of nuclear factor I binding site to the glucocorticoid regulation of cytosolic aspartate aminotransferase gene promoter.
J. Biol. Chem.
271:32629-32634[Abstract/Free Full Text].
|
| 13.
|
Ginn-Pease, M. E., and R. L. Whisler.
1998.
Redox signals and NF- B activation in T cells.
Free Radic. Biol. Med.
25:346-361[Medline].
|
| 14.
|
Gonzalez, F. J., and D. W. Nebert.
1985.
Autoregulation plus upstream positive and negative control regions associated with transcriptional activation of the mouse P1(450) gene.
Nucleic Acids Res.
13:7269-7288[Abstract/Free Full Text].
|
| 15.
|
Gradin, K.,
J. McGuire,
R. H. Wenger,
I. Kvietikova,
M. L. Whitelaw,
R. Toftgard,
L. Tora,
M. Gassmann, and L. Poellinger.
1996.
Functional interference between hypoxia and dioxin signal transduction pathways: competition for recruitment of the Arnt transcription factor.
Mol. Cell. Biol.
16:5221-5231[Abstract].
|
| 16.
|
Grantley, D. C., and K. T. Shiverick.
1997.
2,3,7,8-Tetrachloro-p-dioxin increases mRNAs levels for interleukin-1 , urokinase plasminogen activator and tumor necrosis factor alpha in human uterine endometrial adenocarcinoma RL95-2 cells.
Biochem. Biophys. Res. Commun.
238:338-342[Medline].
|
| 17.
|
Hankinson, O.
1995.
The aryl hydrocarbon receptor complex.
Annu. Rev. Pharmacol. Toxicol.
35:307-340[Medline].
|
| 18.
|
Harris, D.,
N. Reiss, and Z. Naor.
1997.
Differential activation of protein kinase C and gene expression by gonadotropin-releasing hormone in alphaT3-1 cells. Autoregulation by protein kinase C.
J. Biol. Chem.
272:13534-13540[Abstract/Free Full Text].
|
| 19.
|
Heinemeyer, G.,
A. G. Hildebrandt,
I. Roots,
L. Lehne, and S. Nigam.
1979.
Demonstration of drug-ethanol interactions by changes in activity of hepatic microsomal oxidase/oxygenase cytochrome P-450 function.
Arch. Toxicol. Suppl.
2:491-496.
|
| 20.
|
Hildebrandt, A. G.,
C. Bergs,
G. Heinemeyer,
E. Schlede,
I. Roots,
B. Abbas-Ali, and A. Schmoldt.
1981.
Studies on the mechanism of stimulation of microsomal H2O2 formation and benzo(a)pyrene hydroxylation by substrates and flavone.
Adv. Exp. Med. Biol.
136A:179-198.
|
| 21.
|
Hines, R. N.,
J. M. Mathis, and C. S. Jacob.
1988.
Identification of multiple regulatory elements on the human cytochrome P450IA1 gene.
Carcinogenesis
9:1599-1605[Abstract/Free Full Text].
|
| 22.
|
Ichiba, M.,
K. Nakajima,
Y. Yamanaka,
N. Kiuchi, and T. Hirano.
1998.
Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element-binding protein.
J. Biol. Chem.
273:6132-6138[Abstract/Free Full Text].
|
| 23.
|
Imataka, H.,
K. Sogawa,
K. Yasumoto,
Y. Kikuchi,
K. Sasano,
A. Kobayashi,
M. Hayami, and Y. Fujii-Kuriyama.
1992.
Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene.
EMBO J.
11:3663-3671[Medline].
|
| 24.
|
Jones, K. W., and J. P. Whitlock, Jr.
1990.
Functional analysis of the transcriptional promoter for the CYP1A1 gene.
Mol. Cell. Biol.
10:5098-5105[Abstract/Free Full Text].
|
| 25.
|
Jorgensen, E. C., and H. Autrup.
1996.
Autoregulation of human CYP1A1 gene promoter activity in HepG2 and MCF-7 cells.
Carcinogenesis
17:435-441[Abstract/Free Full Text].
|
| 26.
|
Kadlubar, F., and G. Hammons.
1987.
The role of cytochrome P450 in the metabolism of chemical carcinogens, p. 81-130.
In
F. P. Guengerich (ed.), Mammalian cytochromes P-450. CRC Press, Boca Raton, Fla.
|
| 27.
|
Kim, J.,
K. Stansbury,
N. Walker,
M. Trush,
P. Strickland, and T. Sutter.
1998.
Metabolism of benzo(a)pyrene and benzoapyrene-7,8-diol by human cytochrome P450 1B1.
Carcinogenesis
19:1847-1853[Abstract/Free Full Text].
|
| 28.
|
Kiyohara, C.,
Y. Nakanishi,
S. Inutsuka,
K. Takayama,
N. Hara,
A. Motohiro,
K. Tanaka,
S. Kono, and T. Hirohata.
1998.
The relationship between CYP1A1 aryl hydrocarbon hydroxylase activity and lung cancer in a Japanese population.
Pharmacogenetics
8:315-323[Medline].
|
| 29.
|
Knowles, B. B.,
C. D. Howe, and D. P. Aden.
1980.
Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen.
Science
209:497-499[Abstract/Free Full Text].
|
| 30.
|
Ko, H. P.,
S. T. Okino,
Q. Ma, and J. P. Whitlock, Jr.
1996.
Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydrocarbon receptor mediates transactivation, enhancer-promoter communication, and changes in chromatin structure.
Mol. Cell. Biol.
16:430-436[Abstract].
|
| 31.
|
Kobayashi, A.,
K. Sogawa, and Y. Fujii-Kuriyama.
1996.
Cooperative interaction between AhR.Arnt and Sp1 for the drug-inducible expression of CYP1A1 gene.
J. Biol. Chem.
271:12310-12316[Abstract/Free Full Text].
|
| 32.
|
Koch, K. S.,
R. G. Fletcher,
M. P. Grond,
A. I. Inyang,
X. P. Lu,
D. A. Brenner, and H. L. Leffert.
1993.
Inactivation of plasmid reporter gene expression by one benzo(a)pyrene-diol-epoxide DNA adduct in adult rate hepatocytes.
Cancer Res.
53:2279-2286[Abstract/Free Full Text].
|
| 33.
|
Kuthan, H., and V. Ullrich.
1982.
Oxidase and oxygenase function of the microsomal cytochrome P450 monooxygenase system.
Eur. J. Biochem.
126:583-588[Medline].
|
| 34.
|
Le Marchand, L.,
L. Sivaraman,
L. Pierce,
A. Seifried,
A. Lum,
L. Milkens, and A. Lau.
1998.
Associations of CYP1A1, GSTM1 and CYP2E1 polymorphisms with lung cancer suggest cell type specificities to tobacco carcinogens.
Cancer Res.
58:4858-4863[Abstract/Free Full Text].
|
| 35.
|
Mimura, J.,
M. Ema,
K. Sogawa, and Y. Fujii-Kuriyama.
1999.
Identification of a novel mechanism of regulation of Ah (dioxin) receptor.
Genes Dev.
13:20-25[Abstract/Free Full Text].
|
| 36.
|
Molina, C. A.,
N. S. Foulkes,
E. Lalli, and P. Sassone-Corsi.
1993.
Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor.
Cell
75:875-886[Medline].
|
| 37.
|
Morel, Y., and R. Barouki.
1998.
Down-regulation of cytochrome P450 1A1 gene promoter by oxidative stress: critical contribution of NFI.
J. Biol. Chem.
273:26969-26976[Abstract/Free Full Text].
|
| 38.
|
Neuhold, L. A.,
Y. Shirayoshi,
K. Ozato,
J. E. Jones, and D. W. Nebert.
1989.
Regulation of mouse CYP1A1 gene expression by dioxin: requirement of two cis-acting elements during induction.
Mol. Cell. Biol.
9:2378-2386[Abstract/Free Full Text].
|
| 39.
|
Park, J. Y.,
M. K. Shigena, and B. N. Ames.
1996.
Induction of cytochrome P4501A1 by 2,3,7,8-tetrachlorodibenzo-p-dioxin or indolo(3,2-b)carbazole is associated with oxidative DNA damage.
Proc. Natl. Acad. Sci. USA
93:2322-2327[Abstract/Free Full Text].
|
| 40.
|
Paton, T. E., and K. W. Renton.
1998.
Cytokine-mediated down-regulation of CYP1A1 in Hepa1 cells.
Biochem. Pharmacol.
55:1791-1796[Medline].
|
| 41.
|
Perret, A., and D. Pompon.
1998.
Electron shuttle between membrane-bound cytochrome P450 3A4 and b5 rules uncoupling mechanisms.
Biochemistry
37:11412-11424[Medline].
|
| 42.
|
Piechocki, M. P., and R. N. Hines.
1998.
Functional characterization of the human CYP1A1 negative regulatory element: modulation of Ah receptor mediated transcriptional activity.
Carcinogenesis
19:771-780[Abstract/Free Full Text].
|
| 43.
|
Pompon, D.,
A. Perret,
R. Laine, and P. Urban.
1997.
Molecular mechanism of modulation of the oxidative stress generated by uncoupling of the P450-dependant monooxygenases and related enzymes: controlling role of the global chemical environment, abstr. 3, p. 3.
In
Abstracts of the 1st International Workshop on Free Radicals in Liver Metabolism and Disease, 1997, Dinard, France. Université de Rennes I, Rennes, France.
|
| 44.
|
Postlind, H.,
T. P. Vu,
R. H. Tukey, and L. C. Quattrochi.
1993.
Response of human CYP1-luciferase plasmids to 2,3,7,8-tetrachlorodibenzo-p-dioxin and polycyclic aromatic hydrocarbons.
Toxicol. Appl. Pharmacol.
118:255-262[Medline].
|
| 45.
|
RayChaudhuri, B.,
D. W. Nebert, and A. Puga.
1990.
The murine Cyp1a-1 gene negatively regulates its own transcription and that of other members of the aromatic hydrocarbon-responsive [Ah] gene battery.
Mol. Endocrinol.
4:1773-1781[Abstract].
|
| 46.
|
Royall, J. A., and H. Ischiropoulos.
1993.
Evaluation of 2',7'-dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells.
Arch. Biochem. Biophys.
302:348-355[Medline].
|
| 47.
|
Schmalix, W. A.,
H. Maser,
F. Kiefer,
R. Reen,
F. J. Wiebel,
F. Gonzalez,
A. Seidel,
H. Glatt,
H. Greim, and J. Doehmer.
1993.
Stable expression of human cytochrome P450 1A1 cDNA in V79 Chinese hamster cells and metabolic activation of benzo[a]pyrene.
Eur. J. Pharmacol.
248:251-261[Medline].
|
| 48.
|
Schmidt, J. V., and C. A. Bradfield.
1996.
Ah receptor signaling pathways.
Annu. Rev. Cell Dev. Biol.
12:55-89[Medline].
|
| 49.
|
Schmidt, K.,
P. Amstad,
P. Cerruti, and P. Baeuerle.
1995.
The role of hydrogen peroxide and superoxide as messengers in the activation of nuclear factor NF- B.
Chem. Biol.
2:13-22[Medline].
|
| 50.
|
Schrenk, D.
1998.
Impact of dioxin-type induction of drug-metabolizing enzymes on the metabolism of endo- and xenobiotics.
Biochem. Pharmacol.
55:1155-1162[Medline].
|
| 51.
|
Shertzer, H. G.,
D. W. Nebert,
A. Puga,
M. Ary,
D. Sonntag,
K. Dixon,
L. J. Robinson,
E. Cianciolo, and T. P. Dalton.
1998.
Dioxin causes a sustained oxidative stress response in the mouse.
Biochem. Biophys. Res. Commun.
253:44-48[Medline].
|
| 52.
|
Stohs, S. J.
1990.
Oxidative stress induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).
Free Radic. Biol. Med.
9:79-90[Medline].
|
| 53.
|
Tassaneeyakul, W.,
D. J. Birkett,
M. E. Veronese,
M. E. McManus,
R. H. Tukey,
L. C. Quattrochi,
H. V. Gelboin, and J. O. Miners.
1993.
Specificity of substrate and inhibitor probes for human cytochromes P450 1A1 and 1A2.
J. Pharmacol. Exp. Ther.
265:401-407[Abstract/Free Full Text].
|
| 54.
|
Tian, Y.,
S. Ke,
M. S. Denison,
A. B. Rabson, and M. A. Gallo.
1999.
Ah receptor and NF- B interactions, a potential mechanism for dioxin toxicity.
J. Biol. Chem.
274:510-515[Abstract/Free Full Text].
|
| 55.
|
Timchenko, N.,
D. R. Wilson,
L. R. Taylor,
S. Abdelsayed,
M. Wilde,
M. Sawadogo, and G. J. Darlington.
1995.
Autoregulation of the human C/EBP gene by stimulation of upstream stimulatory factor binding.
Mol. Cell. Biol.
15:1192-1202[Abstract].
|
| 56.
|
Walsh, A. A.,
K. Tullis,
R. H. Rice, and M. S. Denison.
1996.
Identification of a novel cis-acting negative regulatory element affecting expression of the CYP1A1 gene in rat epidermal cells.
J. Biol. Chem.
271:22746-22753[Abstract/Free Full Text].
|
| 57.
|
Whitlock, J. J.
1999.
Induction of cytochrome P450 1A1.
Annu. Rev. Pharmacol. Toxicol.
39:103-125[Medline].
|
| 58.
|
Wright, C. F.,
D. H. Hamer, and K. McKenney.
1988.
Autoregulation of the yeast copper metallothionein gene depends on metal binding.
J. Biol. Chem.
263:1570-1574[Abstract/Free Full Text].
|
| 59.
|
Yanagida, A.,
K. Sogawa,
K. I. Yasumoto, and Y. Fujii-Kuriyama.
1990.
A novel cis-acting DNA element required for a high level of inducible expression of the rat P-450c gene.
Mol. Cell. Biol.
10:1470-1475[Abstract/Free Full Text].
|
| 60.
|
Zhang, W.,
J. M. Shields,
K. Sogawa,
Y. Fujii-Kuriyama, and V. W. Yang.
1998.
The gut-enriched Kruppel-like factor suppresses the activity of the CYP1A1 promoter in an Sp1-dependent fashion.
J. Biol. Chem.
273:17917-17925[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 1999, p. 6825-6832, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chiaro, C. R., Patel, R. D., Marcus, C. B., Perdew, G. H.
(2007). Evidence for an Aryl Hydrocarbon Receptor-Mediated Cytochrome P450 Autoregulatory Pathway. Mol. Pharmacol.
72: 1369-1379
[Abstract]
[Full Text]
-
Gao, S., Zhao, Y., Kong, L., Toselli, P., Chou, I.-N., Stone, P., Li, W.
(2007). Cloning and Characterization of the Rat Lysyl Oxidase Gene Promoter: IDENTIFICATION OF CORE PROMOTER ELEMENTS AND FUNCTIONAL NUCLEAR FACTOR I-BINDING SITES. J. Biol. Chem.
282: 25322-25337
[Abstract]
[Full Text]
-
Gorter, J. A., van Vliet, E. A., Aronica, E., Breit, T., Rauwerda, H., Lopes da Silva, F. H., Wadman, W. J.
(2006). Potential New Antiepileptogenic Targets Indicated by Microarray Analysis in a Rat Model for Temporal Lobe Epilepsy. J. Neurosci.
26: 11083-11110
[Abstract]
[Full Text]
-
Kang, H. J., Kim, H. J., Kim, S. K., Barouki, R., Cho, C.-H., Khanna, K. K., Rosen, E. M., Bae, I.
(2006). BRCA1 Modulates Xenobiotic Stress-inducible Gene Expression by Interacting with ARNT in Human Breast Cancer Cells. J. Biol. Chem.
281: 14654-14662
[Abstract]
[Full Text]
-
Sinha, A., Muthiah, K., Jiang, W., Couroucli, X., Barrios, R., Moorthy, B.
(2005). Attenuation of Hyperoxic Lung Injury by the CYP1A Inducer {beta}-Naphthoflavone. Toxicol Sci
87: 204-212
[Abstract]
[Full Text]
-
Bessette, E. E., Fasco, M. J., Pentecost, B. T., Kaminsky, L. S.
(2005). MECHANISMS OF ARSENITE-MEDIATED DECREASES IN BENZO[K]FLUORANTHENE-INDUCED HUMAN CYTOCHROME P4501A1 LEVELS IN HEPG2 CELLS. Drug Metab. Dispos.
33: 312-320
[Abstract]
[Full Text]
-
Georgiadis, P., Topinka, J., Vlachodimitropoulos, D., Stoikidou, M., Gioka, M., Stephanou, G., Autrup, H., Demopoulos, N. A., Katsouyanni, K., Sram, R., Kyrtopoulos, S. A.
(2005). Interactions between CYP1A1 polymorphisms and exposure to environmental tobacco smoke in the modulation of lymphocyte bulky DNA adducts and chromosomal aberrations. Carcinogenesis
26: 93-101
[Abstract]
[Full Text]
-
Jiang, W., Welty, S. E., Couroucli, X. I., Barrios, R., Kondraganti, S. R., Muthiah, K., Yu, L., Avery, S. E., Moorthy, B.
(2004). Disruption of the Ah Receptor Gene Alters the Susceptibility of Mice to Oxygen-Mediated Regulation of Pulmonary and Hepatic Cytochromes P4501A Expression and Exacerbates Hyperoxic Lung Injury. J. Pharmacol. Exp. Ther.
310: 512-519
[Abstract]
[Full Text]
-
Gouedard, C., Barouki, R., Morel, Y.
(2004). Dietary Polyphenols Increase Paraoxonase 1 Gene Expression by an Aryl Hydrocarbon Receptor-Dependent Mechanism. Mol. Cell. Biol.
24: 5209-5222
[Abstract]
[Full Text]
-
Marchand, A., Barouki, R., Garlatti, M.
(2004). Regulation of NAD(P)H:Quinone Oxidoreductase 1 Gene Expression by CYP1A1 Activity. Mol. Pharmacol.
65: 1029-1037
[Abstract]
[Full Text]
-
Merrill, C. L., Ni, H., Yoon, L. W., Tirmenstein, M. A., Narayanan, P., Benavides, G. R., Easton, M. J., Creech, D. R., Hu, C. X., McFarland, D. C., Hahn, L. M., Thomas, H. C., Morgan, K. T.
(2002). Etomoxir-Induced Oxidative Stress in HepG2 Cells Detected by Differential Gene Expression Is Confirmed Biochemically. Toxicol Sci
68: 93-101
[Abstract]
[Full Text]
-
Couroucli, X. I., Welty, S. E., Geske, R. S., Moorthy, B.
(2002). Regulation of Pulmonary and Hepatic Cytochrome P4501A Expression in the Rat by Hyperoxia: Implications for Hyperoxic Lung Injury. Mol. Pharmacol.
61: 507-515
[Abstract]
[Full Text]
-
Ke, S., Rabson, A. B., Germino, J. F., Gallo, M. A., Tian, Y.
(2001). Mechanism of Suppression of Cytochrome P-450 1A1 Expression by Tumor Necrosis Factor-alpha and Lipopolysaccharide. J. Biol. Chem.
276: 39638-39644
[Abstract]
[Full Text]
-
Bonvallot, V., Baeza-Squiban, A., Baulig, A., Brulant, S., Boland, S., Muzeau, F., Barouki, R., Mar