Previous Article | Next Article 
Molecular and Cellular Biology, October 1999, p. 6906-6917, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Nucleolar Factors Direct the 2'-O-Ribose
Methylation and Pseudouridylation of U6 Spliceosomal RNA
Philippe
Ganot,1
Beáta E.
Jády,1,2
Marie-Line
Bortolin,1
Xavier
Darzacq,1 and
Tamás
Kiss1,*
Laboratoire de Biologie Moléculaire
Eucaryote du CNRS, 31062 Toulouse, France,1 and
Biological Research Center, Hungarian Academy of Sciences,
Szeged, Hungary2
Received 18 May 1999/Returned for modification 29 June
1999/Accepted 8 July 1999
 |
ABSTRACT |
The nucleolus has long been known as a functionally highly
specialized subnuclear compartment where synthesis, posttranscriptional modification, and processing of cytoplasmic rRNAs take place. In this
study, we demonstrate that the nucleolus contains all the
trans-acting factors that are responsible for the accurate and efficient synthesis of the eight 2'-O-methylated nucleotides and
three pseudouridine residues carried by the mammalian U6 spliceosomal small nuclear RNA. Factors mediating the formation of pseudouridine residues in the U3 small nucleolar RNA are also present and
functionally active in the nucleolus. For selection of the correct
target nucleotides in the U6 and U3 RNAs, the nucleolar
2'-O-methylation and pseudouridylation factors rely on short sequences
located around the target nucleotide to be modified. This observation
further underscores a recently proposed role for small nucleolar guide
RNAs in the 2'-O-methylation of the U6 spliceosomal RNA (K. T. Tycowski, Z.-H. You, P. J. Graham, and J. A. Steitz, Mol.
Cell 2:629-638, 1998). We demonstrate that a novel 2'-O-methylated
nucleotide can be generated in the yeast U6 RNA by use of an artificial
2'-O-methylation small nucleolar guide RNA. We also show that a short
fragment of the 5.8S rRNA, when expressed as part of the human U6 RNA,
is faithfully 2'-O-methylated and pseudouridylated. These results are
most consistent with a trafficking pathway in which the U6 spliceosomal
RNA cycles through the nucleolus to undergo nucleolar RNA-directed modifications.
 |
INTRODUCTION |
In eukaryotes, most stable cellular
RNAs undergo extensive posttranscriptional nucleoside modifications
(5, 41, 62). For tRNAs, rRNAs, and small nuclear RNAs
(snRNAs), about 90 different modified nucleotides have been identified
(39). Despite the great structural diversity of modified
residues, methylation of the backbone ribose at the 2'-hydroxyl
position and conversion of uridine residues into pseudouridine residues
represent the most abundant RNA modifications. The versatile
hydrogen-bonding capacity of pseudouridines and the hydrophobic nature
of 2'-O-methyl groups can modulate the three-dimensional
structure of the RNA or fine-tune its interactions with other RNAs or
proteins (36, 41, 55).
In tRNAs, modified nucleosides are important determinants of the
specificity and efficiency of both aminoacylation and codon recognition
(5, 81). The actual role of the large number of
2'-O-methyl groups and pseudouridines found in rRNAs and
snRNAs is unknown. However, the fact that these modifications cluster around the functionally essential regions of these RNAs suggests that
they contribute to RNA function (1, 41, 62). Consistent with
this notion, a 2'-O-methyl group at G2251 in yeast
mitochondrial 21S RNA has been found to be essential for the production
of functional 50S ribosomal subunits (71). The importance of
modifications in spliceosomal snRNAs has recently been underscored by
the findings that in vitro-synthesized U2 snRNAs failed to reconstitute
pre-mRNA splicing both in a U2-depleted HeLa cell splicing extract
(66) and in Xenopus oocytes (57, 82).
A cell follows different strategies to accomplish the accurate
synthesis of modified nucleosides in tRNAs, rRNAs, and snRNAs. The
formation of pseudouridines and 2'-O-methylated nucleosides in tRNAs is
catalyzed by protein enzymes which recognize the sequence and/or
structure of the target site (3, 10, 38, 70). In 18S, 5.8S,
and 28S rRNAs, the selection of more than 200 2'-O-methylation and
pseudouridylation sites that occupy diverse sequence and structural environments is mediated by small nucleolar guide RNAs (snoRNAs). For
each modification site, transient base-pairing interactions between a
specific snoRNA and the target rRNA sequence occur. Methylation snoRNAs
form 10- to 21-bp perfect double helices with rRNAs that are
immediately followed by the conserved D or D' box sequence motifs of
the snoRNAs. In the snoRNA-rRNA double helix, the fifth ribosomal
nucleotide upstream of the D or D' box represents the target nucleotide
for the methyltransfer reaction (11, 31, 32).
Pseudouridylation snoRNAs take part in two short interactions with rRNA
sequences that precede and follow the target uridine residue. Normally,
in the pseudouridylation snoRNA-rRNA interaction, the substrate uridine
is located 14 nucleotides (nt) upstream of the ACA or H box motif of
the snoRNA (8, 16, 52). A pseudouridine synthase and a
methyltransferase enzyme, most probably the Nap57p/Cbf5p
(34) and fibrillarin/Nop1 (53, 75) proteins, that
are directly or indirectly bound to the H/ACA or C/D box elements of
the snoRNAs catalyze the nucleoside modification reaction. Therefore,
the formation of numerous ribosomal pseudouridines and 2'-O-methylated
nucleotides most likely is catalyzed by a single pseudouridine synthase
and a methyltransferase enzyme.
Less is known about the generation of pseudouridines and
2'-O-methylated residues in spliceosomal snRNAs. In vitro
pseudouridylation experiments suggest that multiple
pseudouridine synthase activities direct the pseudouridylation of
the polymerase II-synthesized U1, U2, and U5 snRNAs (59,
60). Since maturation of these snRNAs proceeds via a cytoplasmic
phase (20, 47, 58), it remains unclear whether their
modification occurs in the nucleoplasm or the cytoplasm. The U6 snRNA,
an RNA polymerase III product (12, 21), represents the most
conserved and most extensively modified spliceosomal RNA
(62). Microinjection experiments indicated that U6 does not
leave the nucleus of Xenopus oocytes, suggesting that its
maturation occurs in the nucleus (80). Unexpectedly, it has
recently been found that 2'-O-methylation of U6 snRNA at C-77 and
perhaps at A-47 is directed by C and D box-containing methylation
snoRNAs (79).
The nucleolus has long been considered a subnuclear compartment that is
devoted to the maturation of cytoplasmic rRNAs (18). The
formation of mature rRNAs, including 2'-O-ribose methylation, pseudouridylation, and nucleolytic processing of the newly synthesized precursor rRNA is assisted by many snoRNAs (48, 72, 73, 77).
Here, we demonstrate that factors directing the correct posttranscriptional modification of mammalian U6 snRNA at the eight
known 2'-O-methylation and three pseudouridylation sites are present
and functionally active in the nucleolus.
 |
MATERIALS AND METHODS |
General procedures and oligos.
Unless otherwise noted, all
cloning and nucleic acid manipulation procedures were performed
according to standard laboratory protocols (65). The
identity of all constructs was confirmed by sequence analyses. The
oligodeoxynucleotides (oligos) used in this study and their sequences
are as follows: 1, CTAGTACTAAAATTGGAACGATACAGAGAA; 2, TCGATTCTCTGTATCGTTCCAATTTTAGTA; 3, CTAGAGAAGATTAGCATGGCCC; 4, TCGAGGGCCATGCTAATCTTCT;
5, CTAGATGGCCCCTGCGCAAGGATGACA; 6, TCGATGTCATCCTTGCGCAGGGGCCAT; 7, CTAGAGATGACACGCAAATTCGTGAAGCGC; 8, TCGAGCGCTTCACGAATTTGCGTGTCATCT; 9, CTAGAGTGTAGTATCTGTTCTTATCAGC; 10, TCGAGCTGATAAGAACAGATACTACACT; 11, CTAGAAAGACTATACTTTCAGGGATCAC; 12, TCGAGTGATCCCTGAAAGTATAGTCTTT; 13, CTAGATTAATGTGAATTGCAGGACACATGACTAGTC; 14, TCGAGACTAGTCATGTGTCCTGCAATTCACATTAAT; 15XhoI,
TTTCTCGAGCCCCAGTGGAAAGACGCGCAG; 16SspI,
CCCAATATTGGAACGCTTCACGAATTTGCG; 17SpeI,
TTTACTAGTAATATTTTTACATCAGGTTG; 18SacI,
TTTGAGCTCTGGTAAACCGTGCACCGGCG; 19 ATTAATGTGAATTGCAGGACACAGA; 20, CTAGTCTGTGTCCTGCAATTCACATTAAT; 21SacI,
CTCAATATTATGTGCTGCCGAAGCG; 22SpeI,
CTCACTAGTCATACTAAAATTGGAACGATACA; 23XhoI,
TTCTCGAGTAGCTGGGACTACAGACGG; 24BclI,
TTTTGATCACTATAGAAATGATCCCTG; 25SpeI,
TTTACTAGTGTTACTAGAGAAGTTTCTC; 26KpnI,
TTTGGTACCTTTCTCGCGACATTGCCAAGC; 27, GATCATTAATGTGAATTGCAGGACACATGA; 28, CTAGTCATGTGTCCTGCAATTCACATTAAT; 29, GATCCTTAATGTGAATTGCAGGACACATGACTAGTG; 30, GATCCACTAGTCATGTGTCCTGCAATTCACATTAAG; 31KpnI,
TTTGGTACCTGGTGCATCAGTTTGGTCAATTTGATTAAAATGTCATCA; 32XhoI, ATACTCGAGTGTGCAGATGATGTAAAAG; 33, CCAGCTCAAGATCGTAATAT; 34, GTTATTACATCATTTGA;
35XbaI, TGCTCTAGAGTGCTCGCTTCGGCAGC;
36XhoI, CCGCTCGAGAAAATATGGAACGCTTCAC;
37XbaI, TGCTCTAGATCCCAATGATGAGTTGCCATGC; 38XhoI, CCGCTCGAGACCCCTCAGATCTTCATGTGAG;
39, AAAATATTACTAGTCTGTG; 40, ATTTTAGTATGACTAGTCTGTG; 41, GTGGACGGAGCAACTAGTCATG;
42, TTCTCTAGTAACACTAGTCATG; 43, TTCTCAGGATCCACTAGTCATG; 44, CCAGTGATTTTTTTCTCCATTTTAGC;
45, GTCTTCAAAGTTCTCATTTG; and 46, ACTGCTGATCATCTCTGTATTG.
Construction of plasmids and transfection of mammalian
cells.
To generate the pW-U6-1 expression construct,
appropriate oligos (oligos 1 and 2) were annealed and inserted into the
XbaI and XhoI sites of recombinant plasmid
pW(Xb/Xh) carrying the mouse ribosomal minigene (16, 19).
The same strategy was used to obtain pW-U6-2 (oligos 3 and
4), pW-U6-3 (oligos 5 and 6), pW-U6-4 (oligos 7 and 8), pW-U2 (oligos 9 and 10), pW-U3 (oligos 11 and 12), and pW-5.8S (oligos 13 and 14). Transfection of
mouse L929 (American Type Culture Collection [ATCC] CCL1) cells was
achieved by use of the DEAE-dextran method (67).
To construct pGL/U6-5.8S(3'), two contiguous
fragments of the human U6 gene (33) (GenBank accession no.
M14486) from positions
328 to +100 and from positions +101 to +199
were PCR amplified with Vent DNA polymerase (New England
BioLabs), human genomic DNA as a template, and oligo primers
15XhoI/16SspI and 17SpeI/18SacI, respectively. The amplified
fragments were digested with appropriate endonucleases and joined in a
quadrimolecular ligation reaction in the presence of the
XhoI- and SacI-digested pGL2 promoter vector
(Promega) and annealed oligos 19 and 20, which represented a fragment
of the human 5.8S rRNA gene from positions 62 to 84 and formed
SspI- and SpeI-compatible termini. The same
approach was used to construct pGL/U6-5.8S(5')
and pGL/U3-5.8S. For amplification of the 5' and 3' halves
of the human U6 gene from positions
328 to +22 and from positions +23
to +199, oligos 15XhoI/21SacI and
22SpeI/18KpnI were used as specific primers, respectively. The amplified fragments were digested and connected via
ligation of annealed oligos 19 and 20 to the PCR-introduced SspI and SpeI sites. The 5' and 3' halves of the
human U3 gene (83) (GenBank accession no. X14945) from
positions
478 to +33 and from positions +34 to +313 were PCR
amplified with oligos 23XhoI/24BclI and
25SpeI/26KpnI, respectively. Annealed oligos 27 and 28 carrying 5.8S-specific tag sequences were inserted between the
PCR-introduced BclI and SpeI sites of the U3 gene
fragments. The resulting 5.8S-tagged U6 and U3 genes were cloned into
the XhoI/SacI and XhoI/KpnI
sites of the pGL2 promoter vector, respectively. To generate
pG-5.8S, annealed oligos 29 and 30 were inserted into the
BamHI site of the pG expression construct (29).
Transfection of COS-7 (ATCC CRL 1651) cells was performed with DOTAP
{N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate} transfection reagent (Boehringer) according to the
manufacturer's instructions.
Cell fractionation.
Fractionation of transfected simian
COS-7 and mouse cells as well as human HeLa cells was performed as
described earlier (27, 78).
Construction of plasmids for transformation of yeast cells.
The pFL45/ACT/U24 yeast expression construct has already been described
(32). To generate pFL45/ACT/U24-6, the coding region of the
human U24 snoRNA gene was PCR amplified with oligos 31KpnI and 32XhoI as 3' and 5' end-specific primers, respectively.
The resulting U24-6 fragment was inserted into the XhoI and
KpnI sites of the pFL45/ACT expression construct
(32). Transformation of the yeast
U24 strain
(a trp1
his3
ura3,52
lys2,801 ade2,101 URA3::U24) (31)
was performed by the lithium acetate transformation procedure
(22).
RNA analysis.
Total RNAs from human HeLa, mouse L929, and
simian COS-7 cells (17) and yeast cells (76) were
isolated by guanidinium thiocyanate-phenol-chloroform extraction. For
Northern analysis, 10 µg of yeast cellular RNAs was separated on a
6% sequencing gel, electroblotted onto a Hybond-N nylon membrane, and
probed with a mixture of 5'-end-labeled oligos complementary to the
yeast snR36 (oligo 33) and human U24 (oligo 34) snoRNAs. RNase A and T1 mapping was performed as described previously
(17). Generation of a sequence-specific antisense RNA probe
for human U3 snoRNA has been reported elsewhere (15, 27). To
obtain RNA probes for the U6-5.8S(5') and
U6-5.8S(3') RNAs, the
XhoI/SacI fragments of the
pGL/U6-5.8S(5') and
pGL/U6-5.8S(3') constructs were inserted into the
same sites of pBluescript KS (Stratagene). The resulting pU6-5.8S(5') and
pU6-5.8S(3') plasmids were linearized with
XhoI and used as templates for the synthesis of antisense
RNA probes by use of T7 RNA polymerase. To generate probes for the
human U6 and mgU6-53 RNAs, the coding regions of the U6 (oligos
35XbaI and 36XhoI) and mgU5-53 (oligos
37Xbal and 38XhoI) snRNAs were PCR amplified
with human genomic DNA as a template. The resulting DNA fragments were
inserted into the XbaI/XhoI sites of pBluescript KS, linearized with XhoI, and transcribed by use of T3 RNA
polymerase. To generate an antisense probe for the W-U6-1
mouse minigene transcript, the PstI/EcoRI
fragment of pW-U6-1 encompassing the full-length ribosomal
minigene was subcloned into the same sites of pBluescript KS,
linearized with HindIII, and transcribed by use of T7
RNA polymerase.
Mapping of 2'-O-methylated nucleotides and pseudouridine
residues.
Detection of 2'-O-ribose-methylated
nucleotides and pseudouridine residues was performed by primer
extension analyses as described by Maden et al. (42) and
Bakin and Ofengand (2), respectively. Terminally labeled
oligos 39 [for U6-5.8S(5') RNA], 40 [for
U6-5.8S(3') RNA], 41 [for human U2 snRNA], 42 (for U3-5.8S RNA), 43 (for G-5.8S RNA), 44 (for mouse
ribosomal minigene transcripts), 45 (for yeast 25S rRNA), and 46 (for
yeast U6 snRNA) complementary to the appropriate target RNAs were used
as primers for reverse transcription. The extended DNA products were
analyzed on 6% sequencing gels.
 |
RESULTS |
A putative guide snoRNA for 2'-O-methylation of human U6 snRNA at
Am53.
During characterization of a cDNA library of human snoRNAs
(31), we identified a 109-nt novel small RNA (Fig.
1A). Cell fractionation experiments
demonstrated that the newly identified RNA, like the authentic U3
snoRNA (78), copurifies with the nucleolar fraction of human
HeLa cells (Fig. 1B, upper panel, lane 5) and is absent from the
nucleoplasmic fraction, where the U6 spliceosomal snRNA accumulates
(lane 4). The new RNA features all of the structural elements, the box
C, C', D, and D' motifs and a short 5'-, 3'-terminal helix, that are
essential for the expression, nucleolar localization, and function of
2'-O-methylation snoRNAs (31, 32, 37, 64). However, the
novel putative 2'-O-methylation snoRNA lacks a significant sequence
complementarity to rRNA sequences, indicating that it cannot function
in rRNA methylation.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Human mgU6-53 is a novel C and D box-containing snoRNA
that possesses sequence complementarity to U6 spliceosomal RNA. (A)
Nucleotide sequence of mgU6-53 snoRNA. The conserved sequence box
motifs of 2'-O-methylation snoRNAs are indicated. Sequences potentially
involved in the formation of a 5'-, 3'-terminal helix are indicated by
inverted arrows. Sequences of the human U6 snRNA that are complementary
to the mgU6-53 snoRNA sequence are shown. Nucleotides carrying
2'-O-methyl groups are indicated (m). The nucleotide sequence of
mgU6-53 has been deposited in the EMBL database under accession no.
AJ243222. (B) Subcellular localization of mgU6-53 snoRNA. RNA samples
(200 ng) extracted either from human HeLa cells (T) or from nuclear
(N), nucleoplasmic (Np), nucleolar (No), and cytoplasmic (Cy) fractions
of HeLa cells were mapped by RNase A and T1 protection by
use of sequence-specific antisense RNA probes as indicated on the
right. Lane C represents a control mapping with Escherichia
coli tRNA. Lane M, size markers in nucleotides (a mixture of
HaeIII- and TaqI-digested pBR322).
|
|
Recently, it was shown that 2'-O-methylation of the Cm77 residue of
human U6 spliceosomal snRNA, upon injection into
Xenopus oocytes, is dependent on a C and D box-containing methylation
snoRNA
called mgU6-77 (methylation guide for U6 RNA at position
77)
(
79). Another C and D box-containing snoRNA (mgU6-47) was
implicated in the synthesis of the 2'-O-methylated Am47 residue
in U6
snRNA (
79). A closer examination of our new C and D
box-containing
snoRNA revealed that it carries an 11-nt sequence that
is perfectly
complementary to the human U6 snRNA from positions 50 to
60 (Fig.
1A). A putative base-pairing interaction between the snoRNA
and
the U6 snRNA places the D' box of the snoRNA 5 bp upstream of
the
A53 residue that is known to be 2'-O-methylated in mammalian
U6 snRNAs
(
62). We therefore concluded that the novel RNA, now
termed
the mgU6-53 snoRNA, represents a new member of the group
of C and D
box-containing snoRNAs and is likely to direct the
2'-O-methylation of
U6
snRNA.
Factors directing 2'-O-methylation and pseudouridylation of U6 and
U3 snRNAs are functional in the nucleolus.
Implication of the
mgU6-47, mgU6-77, and mgU6-53 snoRNAs in 2'-O-methylation of the U6
spliceosomal snRNA raises the possibility that posttranscriptional
modification of the U6 RNA takes place in the nucleolus. We therefore
tested whether factors supporting the 2'-O-methylation and
pseudouridylation of U6 snRNA are present in the nucleolus. Short
overlapping fragments of the rat U6 snRNA, U6-1 to
U6-4 (Fig. 2A), encompassing
its eight 2'-O-methylation (m) and three pseudouridylation (
) sites
(62), were inserted into the pW(Xb/Xh) mouse ribosomal
minigene (19). As controls, fragments of the human 5.8S rRNA
(from U63 to U85), U2 snRNA (from A30 to G52), and U3 snoRNA (from A1
to A22) were inserted into the pW(Xb/Xh) minigene. Each fragment
contained residues that are 2'-O-methylated and/or pseudouridylated in
wild-type RNAs (Fig. 2A) (41, 62). Upon transfection into
mouse cells, the polymerase I-directed transcription of the ribosomal
minigene occurs in the nucleolus (18, 50), and the resulting
RNA transcript accumulates in the nucleolus (16, 19).
Indeed, cell fractionation experiments followed by RNase A and
T1 mapping and phosphorimager quantification showed that
between 90 and 96% of the minigene transcripts studied in our
experiments localized to the nucleolus of transfected mouse cells. As a
representative example, the intracellular distribution of the
W-U6-1 transcript is shown in Fig. 2B. The small amount of
W-U6-1 RNA detected in the nucleoplasmic fraction derived
most likely from cross-contaminating nucleoli, since the nucleolar U3
RNA was also detectable in this fraction (Fig. 2B, lane 5).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleolar expression of the mouse ribosomal minigene
tagged with human U6, U2, U3, and 5.8S RNA-specific sequences. (A)
Schematic structure of the pW(Xb/Xh) mouse ribosomal minigene
construct. pW(Xb/Xh) contains the mouse polymerase I (Pol I) promoter
and terminator (term), some 5' (hatched boxes) and 3' (open box)
external transcribed spacer (ETS) sequences, and a fragment of the
chloramphenicol acetyltransferase (CAT) gene that carries the
XbaI (Xb) and XhoI (Xh) restriction sites. The
pW-U6-1, pW-U6-2, pW-U6-3,
pW-U6-4, pW-U5.8S, pW-U3, and
pW-U2 constructs were created by insertion of appropriate
synthetic DNA fragments into the XbaI and XhoI
sites of pW(Xb/Xh). Nucleotides which are 2'-O-methylated (m) or
pseudouridylated ( ) in rat U6, U3, and U2 snRNAs and human 5.8S rRNA
are indicated. (B) Subcellular localization of the W-U6-1
ribosomal minigene transcript. Upon transfection of the
pW-U6-1 minigene into mouse cells, RNA samples (200 ng)
extracted either from total cells (T) or from cytoplasmic
(Cy), nuclear (Nu), nucleoplasmic
(Np), and nucleolar (No) fractions were
analyzed by RNase A and T1 protection by use of antisense
RNA probes specific to the W-U6-1 transcript (upper panel),
U3 snoRNA (middle panel), or U4 snRNA (lower panel). Lane C represents
a control mapping with E. coli tRNA. Lane M, size markers in
nucleotides.
|
|
The state of 2'-O-methylation and pseudouridylation of the minigene
transcripts was observed by primer extension analyses
with a
32P-labeled deoxyoligonucleotide primer complementary to
the minigene
RNA downstream of the insertion site. In the presence of a
low
concentration of deoxynucleoside triphosphates, (0.004 mM), reverse
transcriptase stops 1 nt before and/or at the 2'-O-methylated
nucleotide (
31,
32,
42). Pseudouridine residues were
visualized
by primer extension analysis with CMC
[N-cyclohexyl-
N'-

-(4-methyl-morpholinium)ethylcarbodiimide
p-tosylate]-treated RNAs (
2). CMC reacts
irreversibly with
N3 of pseudouridine and stops reverse transcriptase 1 nt before
the pseudouridylation
site.
As expected (
16), the 5.8S rRNA sequences in the nucleolar
W-
5.8S transcript were faithfully 2'-O-methylated at G75
(Fig.
3A, lane 10) and pseudouridylated
at U69 (Fig.
3B, lane 9). More
interestingly, the U6-specific sequences
expressed in the nucleolus
were accurately 2'-O-methylated at A47, A53,
G54 (Fig.
3B, lane
2), C60, C62 (lanes 2 and 4), C63, A70 (lane 4), and
C77 (lane
6) as well as pseudouridylated at U31, U40 (lane 1), and U85
(lane
3). The same results were obtained when 2'-O-methylation of the
W-
U6-3 RNA and pseudouridylation of the W-
U6-1
RNA were monitored
with RNA samples obtained from the nucleolar
fraction of transfected
mouse cells (data not shown). Both
pseudouridine residues of the
U3 snoRNA (

8 and

12)
(
62) were accurately formed in the nucleolar
W-
U3
transcript (Fig.
3B, lane 5). However, neither ribose methylation
nor
pseudouridine formation was observed in the U2-specific tag
sequences
(Fig.
3A, upper panel, lane 8, and Fig.
3B, lane 7).
To ensure that the
lack of stop signals in the primer extension
mapping of 2'-O-methyl
groups in the W-
U2 transcript was not due
to the special
sequence context of the U2 RNA, we performed control
mapping with the
human U2 snRNA (Fig.
3A, lower panel, lanes 7
and 8). No RNA
modification was detected when another fragment
of the U2 RNA (from A48
to U70) carrying two known pseudouridylation
sites (

54 and

58)
and one 2'-O-methylation site (Am61) was tested
(data not shown).
Likewise, primer extension analyses of the W-
U6-1 and
W-
U6-3 transcripts revealed no stop signals that could have
indicated the formation of the base-methylated m
6A43 and
m
2G72 nucleotides that are present in the wild-type U6
snRNA (
62)
(Fig.
3A, lanes 3 and 4, and Fig.
3B, lane 1).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension mapping of modified nucleotides in
mouse ribosomal minigene transcripts. (A) Mapping of 2'-O-methylated
nucleotides. RNAs isolated from mouse cells transfected with the
pW-U6-2, pW-U6-3, pW-U6-4,
pW-U2, or pW-U5.8S construct were analyzed by
primer extension in the presence of a high (1 mM) or a low (0.004 mM)
concentration of deoxynucleoside triphosphates. Panel U2 shows mapping
of 2'-O-methyl groups in the wild-type human U2 snRNA. Lanes C, T, A,
and G represent sequencing ladders. The extension products were
fractionated on 6% sequencing gels. (B) Mapping of pseudouridines.
RNAs obtained from mouse cells transfected (R) or not transfected (N)
with the pW-U6-1, pW-U6-4, pW-U3,
pW-U2, or pW-U5.8S expression construct were
subjected to CMC-alkali treatment. The modified pseudouridine-CMC
residues were visualized by primer extension.
|
|
These results demonstrate that
trans-acting factors
directing the site-specific 2'-O-methylation and pseudouridylation of
the U6 spliceosomal snRNA and pseudouridylation of the U3 snoRNA
are
present and are functionally active within the nucleolus.
The fact that
short fragments of the U6 snRNA and the U3 snoRNA
are faithfully
methylated and/or pseudouridylated in the nucleolus
lends further
support to the assumption that modification of these
snRNAs is directed
by snoRNAs. The snoRNA-directed synthesis of
2'-O-methylated
nucleotides requires a 10-bp interaction between
the snoRNA and the
substrate RNA (
11,
31). Since the target
nucleotide is
located in the middle of this interaction, the synthesis
of Cm60 and
Cm62 residues lacking U6-specific 3'-flanking sequences
in the
W-
U6-2 transcript (Fig.
3A, lane 2) was unexpected. However,
we noticed that minigene sequences following the
U6-2
sequences
are capable of extending a base-pairing interaction with a
putative
snoRNA up to 12 bp with two mismatches (GGCCCctcgaga;
the authentic
U6 sequences are shown in uppercase
letters).
5.8S rRNA-specific tag sequences carried by U6 RNA are faithfully
modified.
In view of the above results, it seems possible that the
U6 snRNA cycles through the nucleolus for snoRNA-mediated nucleotide modification. The snoRNA-directed synthesis of ribose-methylated nucleotides and pseudouridine residues in the 18S, 5.8S, and 28S rRNAs
occurs within the nucleolus shortly after or during the synthesis of
precursor rRNA (13, 41). In accordance with this fact, rRNA
methylation and pseudouridylation snoRNAs show an exclusive nucleolar
localization (48). To assess whether the U6 snRNA can
establish an interaction with the rRNA modification snoRNAs, a short
fragment of the human 5.8S rRNA containing the pseudouridylated U69 and
2'-O-methylated G75 residues (41) was inserted into the 5'-
or 3'-terminal part of the coding region of the human U6 snRNA gene
(33) (Fig. 4A). The same 5.8S
tag was inserted into the human U3 snoRNA gene (83) as well
as into the second exon of the human
-globin gene (29).
Upon transfection of the 5.8S-tagged genes into simian COS-7 cells,
RNase A and T1 mapping performed with sequence-specific
antisense probes revealed that the chimeric
U6-5.8S(5') and U6-5.8S(3')
RNAs (Fig. 4B, lanes 2 and 4) and U3-5.8S and
GL-5.8S RNAs (data not shown) were correctly and efficiently
expressed. The observed heterogeneity of the
U6-5.8S(5')- and
U6-5.8S(3')-specific protected fragments likely
represents RNase mapping artifacts, since fragments protected by the
3'-terminal part of the endogenous U6 snRNA also appeared as a doublet
(Fig. 4B, lane 3) and primer extension revealed a unique 5' terminus for both U6-5.8S(5') and
U6-5.8S(3') (Fig.
5B, lanes 1 and 3).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of human U6 snRNA, U3 snoRNA, and -globin
mRNA tagged with 5.8S-specific sequences. (A) Schematic structures of
the expression constructs used for the transfection of COS-7 cells. The
coding regions of human U6 and U3 snRNA genes are represented by open
arrows. The cytomegalovirus promoter (CMV), three exons (E1 to E3), and
the polyadenylation region (PA) of the human -globin gene are
indicated for pGL-5.8S. The inserted tag sequences and their
positions as well as relevant restriction sites (B,
BamHI; E, EcoRI; H,
HindIII; K, KpnI; S,
SacI; X, XhoI) are indicated above the
constructs. Nucleotides representing authentic 5.8S rRNA sequences are
in uppercase letters. Nucleotides introduced to facilitate cloning are
in lowercase letters. The U69 and G75 residues that are
pseudouridylated or 2'-O-methylated in human 5.8S rRNA are marked. (B)
Accumulation of U6-5.8S(5') and
U6-5.8S(3') RNAs in COS-7 cells. RNAs extracted
from transfected (T) and nontransfected (N) cells were analyzed by
RNase A and T1 mapping by use of antisense RNA probes
specific for either the U6-5.8S(5') or the
U6-5.8S(3') RNA. The protected fragments were
separated on a 6% sequencing gel. Lane M, size markers.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 5.
Primer extension mapping of modified nucleotides. (A)
Mapping of 2'-O-methyl groups. RNAs obtained from COS-7 cells
transfected with the pU6-5.8S(5'),
pU6-5.8S(3'), pU3-5.8S, or
pGL-5.8S expression construct were annealed with specific
32P-labeled primers and extended with avian myeloblastosis
virus reverse transcriptase in the presence of 1 mM (lanes 1, 3, 5, 7, and 9) or 0.004 mM (lanes 2, 4, 6, 8, and 10) deoxynucleoside
triphosphates. The origin of the stop signal at A51 in the U6 snRNA is
unknown (lanes 5 and 6). (B) Mapping of pseudouridine residues. RNAs
isolated from COS-7 cells transfected (R) or not transfected (N) with
the pU6-5.8S(5'),
pU6-5.8S(3'), pU3-5.8S, or
pGL-5.8S construct were treated with CMC and analyzed by
primer extension. For other details, see the legend to Fig. 3.
|
|
Primer extension mapping of 2'-O-methylated nucleotides in the
U6-
5.8S(
5') and U6-
5.8S(
3')
RNAs in the presence of 0.004 mM
deoxynucleoside triphosphates (Fig.
5A, lanes 2 and 4) resulted
in stop signals at the G75 residue,
indicating that the 5.8S tag
sequence is correctly methylated in both
chimeric U6-
5.8S RNAs.
Mapping of pseudouridines revealed
that the U69 residue was converted
into pseudouridine in both
U6-
5.8S(
5') and U6-
5.8S(
3')
(Fig.
5B,
lanes 1 and 3). Moreover, mapping of the 5'-terminal region
of
the U6-
5.8S(
3') RNA showed that
2'-O-methylated nucleotides and
pseudouridines found in the rat U6
snRNA (
62) were also present
in the chimeric
U6-
5.8S(
3') RNA (Fig.
5A, lanes 5 and 6, Fig.
5B,
lane 4, and data not shown), indicating that not only the
5.8S but also
the U6-specific sequences were correctly modified
in the chimeric
U6-
5.8S(
3') RNA. Likewise, when expressed as part
of the U3-
5.8S RNA, the 5.8S tag sequences were correctly
2'-O-methylated
at G75 (Fig.
5A, lane 8) and pseudouridylated at U69
(Fig.
5B,
lane 5). Pseudouridines found in the rat U3 snoRNA (

8 and

12)
were also readily detectable in the chimeric U3-
5.8S
RNA (Fig.
5B, lane 5). However, in marked contrast to the findings for
the
U6-
5.8S and U3-
5.8S RNAs, no
2'-
O-methyl group and no pseudouridine
residue were detected
in the 5.8S tag sequences carried by the
cytoplasmic

-globin mRNA
(Fig.
5A, lane 10, and Fig.
5B, lane
7).
These results demonstrate that the chimeric U6-
5.8S and
U3-
5.8S RNAs, when expressed in simian cells, undergo
correct posttranscriptional
modifications. This finding indicates that
these RNAs are able
to establish physical contacts with rRNA
methylation and pseudouridylation
snoRNAs as well as with all the
factors that are responsible for
the site-specific 2'-O-methylation and
pseudouridylation of U6
and U3
RNAs.
Targeted 2'-O-methylation of yeast U6 snRNA is directed by an
artificial snoRNA.
By use of artificial 2'-O-methylation snoRNAs
that carry properly designed rRNA recognition motifs, novel
2'-O-methylation sites can be generated in eukaryotic rRNAs (11,
14, 30, 31). We tested whether site-specific 2'-O-methylation of
the yeast Saccharomyces cerevisiae U6 snRNA can be achieved
by an artificial snoRNA that carries an antisense element complementary to the U6 snRNA.
When expressed in yeast cells, the human U24 snoRNA can direct
2'-O-methylation of the 25S rRNA at two positions (
32). The
upstream antisense element (UAE) directs the methylation of C1450,
and
the downstream antisense element (DAE) selects the C1436 residue
(Fig.
6A). The DAE of human U24 was replaced
with sequences complementary
to the yeast U6 snRNA from U27 to A40. The
resulting U24-6 snoRNA
is predicted to direct the 2'-O-methylation of
residue G31 in
yeast U6 RNA in addition to residue C1450 in 25S rRNA.
DNA fragments
encoding the mutant U24-6 and wild-type U24 snoRNAs were
inserted
into the intron region of the yeast alcohol dehydrogenase gene
and transformed into a yeast strain that lacks a functional U24
locus
(

U24) (
31,
32). Northern analysis showed that the U24
and
U24 snoRNAs were correctly expressed in yeast (Fig.
6B).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Site-specific 2'-O-ribose methylation of
yeast U6 snRNA directed by an artificial snoRNA. (A) Potential
base-pairing interactions formed between human U24 snoRNA and yeast 25S
rRNA or U24-6 snoRNA and yeast U6 snRNA. Nucleotides known or expected
to be 2'-O-methylated are indicated by closed or open circles,
respectively. DNA fragments encoding U24 or U24-6 snoRNAs were inserted
into the intron of the yeast actin gene that had been placed under the
control of the promoter (ADH-P) and terminator (ADH-T) of the yeast
alcohol dehydrogenase gene. The relevant restriction sites are shown
(H, HindIII; X, XhoI;
K, KpnI). (B) Northern blot analysis of human U24
and U24-6 snoRNAs. RNAs isolated from control U24 yeast cells (lane
1) and U24 cells transformed with the pFL45/ACT expression construct
carrying either the U24 (lane 2) or the U24-6 (lane 3) snoRNA gene were
fractionated on a 6% sequencing gel and probed with a mixture of
labeled oligos specific for U24 and snR36 snoRNAs. Lane M, size
markers. (C) Mapping of ribose-methylated nucleotides in yeast 25S
rRNA. RNAs obtained from the U24 strain (lanes 1 and 2) and from
cells expressing either the U24 (lanes 3 and 4) or the U24-6 (lanes 5 and 6) snoRNA were analyzed by primer extension in the presence of 1 or
0.004 mM deoxynucleoside triphosphates. Lanes C, T, A, and G represent
sequencing ladders. (D) Primer extension mapping of ribose-methylated
nucleotides in yeast U6 snRNA. Oligo primers specific for the yeast U6
RNA were annealed to RNAs obtained from the yeast U24 strain
expressing the human U24 (lanes 1 and 2) or U24-6 (lanes 3 and 4)
snoRNA. Primer extension was performed in the presence of 1 mM (lanes 1 and 3) or 0.004 mM (lanes 2 and 4) deoxynucleoside triphosphates.
|
|
The 2'-O-methylation pattern of the 25S rRNA (Fig.
6C) and the U6 snRNA
(Fig.
6D) was tested by primer extension analyses.
The U24-6 snoRNA
(Fig.
6C, upper panel, lane 6), in contrast to
the wild-type U24 snoRNA
(lane 4), did not support the DAE-dependent
methylation of 25S rRNA at
C1436. The U24-6 snoRNA, like the wild-type
U24 snoRNA, directed the
UAE-dependent methylation of the C1450
residue (Fig.
6C, lower panel).
More interestingly, in the

U24
yeast strain expressing the U24-6
snoRNA, the U6 RNA was 2'-O-methylated
at the G31 position (Fig.
6D,
lane 4), demonstrating that 2'-O-methylation
snoRNAs can direct the
site-specific methylation of the U6 spliceosomal
snRNA. These results
also show that the UAE and DAE of a methylation
snoRNA can
independently direct 2'-O-methylation of an snRNA and
an rRNA (see also
reference
79).
 |
DISCUSSION |
The rat U6 spliceosomal snRNA carries eight ribose- and two
base-methylated nucleosides and three pseudouridines (62).
Many of these modified nucleosides are present in plant U6 snRNA as well (28), indicating that they play an important and
phylogenetically conserved role in the assembly and/or function of the
U6 snRNP. This study has focused on the molecular mechanism that is
responsible for the generation of modified nucleosides in U6 snRNA.
Factors directing site-specific modification of U6 snRNA and U3
snoRNA.
We have demonstrated that short fragments of the U6 snRNA
embedded in mouse ribosomal minigene transcripts are efficiently and
accurately 2'-O-methylated and pseudouridylated within the nucleolus of
mouse cells (Fig. 3). Two major conclusions can be drawn from these
observations. First, recognition of the correct 2'-O-methylation and
pseudouridylation sites in U6 snRNA relies on short nucleotide
sequences located around the target site. Second,
trans-acting factors directing the modification of U6 snRNA
at all known 2'-O-methylation and pseudouridylation sites are present
and are functionally active in the nucleolus.
After injection of in vitro-transcribed human U6 snRNA into
Xenopus oocytes, the synthesis of the Cm77 2'-O-methylated
nucleotide
in human U6 snRNA depends on the presence of a C and D
box-containing
methylation snoRNA (
79). Mammalian cells
contain at least two
additional C and D box-containing snoRNAs with the
potential to
direct the 2'-O-methylation of U6 snRNA at Am47
(
79) and Am53
(Fig.
1). These observations, coupled with the
conclusion that
the recognition of all known 2'-O-methylation sites of
U6 RNA
depends on nucleotide sequences located around the actual target
site, rather than the secondary structure of the RNA, strongly
support
the notion that the 2'-O-methylation of U6 snRNA is directed
exclusively by snoRNAs. We have demonstrated that
trans-acting
factors directing the synthesis of all
pseudouridine residues
in the U6 (

31,

40, and

85) and U3 (

8
and

12) RNAs are also
present in the nucleolus (Fig.
3B). Since
these pseudouridylation
factors recognize the nucleotide sequences
around the substrate
uridines of the U6 and U3 RNAs, we can anticipate
that the pseudouridylation
of these snRNAs may turn out to be a guide
RNA-mediated
process.
Mammalian U6 snRNAs also contain two base-methylated nucleotides, an
N-6-methyladenosine (m
6A43) and a
2-methylguanosine (m
2G72) (
62). No base
methylation was detected at A43 or G72 in
short fragments of the U6
snRNA that were expressed in the nucleolus
(Fig.
3). This finding lends
further support to the idea that
base methylation of the U6 snRNA is
dependent on the three-dimensional
structure of the RNA (
69)
and may take place in the nucleoplasm.
Similarly, short U2
snRNA-specific sequences are neither 2'-O-methylated
nor
pseudouridylated in the nucleolus (Fig.
3), suggesting that
factors
directing the modification of U2 snRNA are not present
in the nucleolus
and/or they recognize the three-dimensional structure
of the U2 snRNA.
Indeed, a yeast tRNA pseudouridine synthase enzyme,
Pus1p, is also
responsible for the synthesis of the

44 residue
in yeast U2 snRNA
(
44). The nucleoplasmic localization of Pus1p
(
70) and pseudouridylation analyses of in vitro-synthesized
U2 RNAs that were microinjected into the nucleoplasm or cytoplasm
of
Xenopus oocytes (
82) suggest that the
pseudouridylation of
U2 snRNA takes place in the
nucleoplasm.
Does modification of U6 snRNA occur in the nucleolus?
The
nucleus is highly compartmentalized, and most nuclear processes can be
linked to distinct subnuclear structure (35, 74). The
nucleolus, the most extensively studied subnuclear organelle, has long
been known as the site of the biogenesis of cytoplasmic ribosomes
(18). Recently, several lines of evidence suggest that the
nucleolus has more diverse functions than earlier anticipated. In
yeast, the early processing of some precursor tRNAs has been found to
occur within the nucleolus (4). A fraction of mammalian
telomerase (49), signal recognition particle
(63), and RNase P (24) RNAs has been shown to be
present in the nucleolus. Microinjection of in vitro-synthesized signal
recognition particle (23), RNase MRP (25), and
RNase P (24) RNAs into the nucleoplasm of mammalian cells is
followed by transient localization of these RNAs to the nucleolus.
These findings suggest that in addition to the biogenesis of
cytoplasmic ribosomes, the nucleolus also functions in the processing
and/or export of some stable small RNAs (61).
Based on biochemical criteria, the mgU6-47, mgU6-53, and mgU6-77
putative 2'-O-methylation guide RNAs for U6 RNA have been
localized to
the nucleolus (
79) (Fig.
1B). These results, coupled
with
the observation that
trans-acting factors directing the
2'-O-methylation
and pseudouridylation of U6 and U3 snRNAs are
functionally active
in the nucleolus (Fig.
3), suggest that the
nucleolus may function
in the posttranscriptional modification of the
U6 spliceosomal
snRNA and the U3 snoRNA. Since mature U6 snRNA shows a
steady-state
nucleoplasmic localization, the notion that its
posttranscriptional
modification occurs in the nucleolus presupposes
that U6 snRNA
cycles through the nucleolus during its maturation.
Demonstration
that the wild-type U6 snRNA in yeast (Fig.
6) and the
chimeric
U6-
5.8S RNA in mammalian cells (Fig.
5) can undergo
snoRNA-directed
2'-O-methylation and pseudouridylation further supports
this notion.
Recently, it was shown that an in vitro-transcribed U6
snRNA,
upon injection into the nucleoplasm of
Xenopus
oocytes, transiently
accumulates in the dense fibrillar compartment of
the nucleolus
(
51). The fibrillar compartment of the
nucleolus also harbors
the fibrillarin snoRNP protein that is
associated with all 2'-O-methylation
snoRNAs. This protein is most
likely the methyltransferase enzyme
that catalyzes the ribose
methylation of the target nucleotide
specified by the RNA component of
the snoRNP particles (
53,
75).
The above-mentioned study (
51) also revealed that
microinjected U6 snRNA localizes to other conserved subnuclear
organelles,
the coiled bodies, in addition to the nucleolus. The
nucleolus
and coiled bodies have several common antigens and appear to
be
remarkably related in both structure and function (
6,
45,
74). Coiled bodies are attached to the nucleolar periphery and,
under certain physiological conditions, are found within the nucleolus
(
40,
43,
54), suggesting that they either emerge from or
fuse to the nucleolar structures (
6,
45). An exciting
feature
of coiled bodies is that they contain all the major
spliceosomal
snRNPs, including the U6 snRNP (
9,
46). Hence,
coiled bodies
have been implicated in the processing, modification, or
export
of spliceosomal snRNAs (
6,
40,
45).
Although no H or ACA box pseudouridylation guide snoRNP has yet been
detected in coiled bodies, the presence of some C and
D box-containing
snoRNPs has been well documented (
26,
56,
64,
68). Since the
C and D boxes have been identified as the
key transport elements which
target these RNAs to the nucleolus
and coiled bodies (
37,
64), all snoRNAs carrying these box
motifs may be present in
coiled bodies. Thus, snoRNA-directed
2'-O-methylation of U6 snRNA may
take place in coiled bodies (
6,
79). Coiled bodies also
contain the putative 2'-O-methyltransferase
(fibrillarin)
and pseudouridine synthase (Nap57/Cbf5) enzymes
that likely
catalyze the U6 modification reactions. However, the
putative guide
RNAs directing U6 methylation are localized to
the nucleolus and are
practically absent from the nucleoplasm
(
79) (Fig.
1B). In
marked contrast, a coiled body-specific nuclear
protein, p80 coilin,
was detected mainly, if not exclusively,
in the nucleoplasmic fraction
(data not shown). Therefore, a potential
copurification of coiled
bodies with nucleoli cannot account for
the observed nucleolar
localization of the U6 methylation snoRNAs.
We cannot, however, exclude
the possibility that coiled bodies
contain a small but still sufficient
amount of guide snoRNPs to
conduct the modification of U6 snRNA.
Likewise, the available
data cannot unambiguously rule out the formal
possibility that
the modification of U6 snRNA occurs in the
nucleoplasm. In this
context, however, it is noteworthy that, despite
our repeated
efforts, artificial snoRNAs failed to direct the
2'-O-methylation
of the human

-globin mRNA and precursor mRNA as
well as the nucleoplasmic
U19H RNA (
7,
27).
In summary, the data presented in this paper are most consistent with
the idea that the posttranscriptional modification of
U6 spliceosomal
snRNA and U3 snoRNA takes place in the nucleolus,
although we
acknowledge that other subnuclear compartments, such
as coiled bodies,
may also contribute to this process. Nevertheless,
the fact that
trans-acting factors directing the site-specific
2'-O-methylation and pseudouridylation of the U6 spliceosomal
RNA and
pseudouridylation of the U3 snoRNA are present and are
functionally
active in the nucleolus documents that the nucleolus,
directly or
indirectly, is involved in the biogenesis of some
snRNAs and snoRNAs.
These results further substantiate the emerging
idea that the nucleolus
is a multifunctional organelle that functions
in the maturation and/or
intracellular trafficking of different
classes of cellular
RNAs.
 |
ACKNOWLEDGMENTS |
Thanks are due to Y. de Préval for synthesis of
oligodeoxynucleotides and to L. Poljak for critical reading of the manuscript.
B. E. Jády has been supported by the French Government and
the Hungarian Research Foundation (OTKA, T 029042). This research was
supported by the Centre National de la Recherche Scientifique and by
grants from la Ligue Nationale Contre le Cancer, l'Association pour la
Recherche sur le Cancer, and the Hungarian Research Foundation (OTKA, T 029042).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Biologie Moléculaire Eucaryote du CNRS, 118 Route de Narbonne,
31062 Toulouse, France. Phone: (33) 5 61 33 59 91. Fax: (33) 5 61 33 58 86. E-mail: tamas{at}ibcg.biotoul.fr.
 |
REFERENCES |
| 1.
|
Ares, M., Jr., and B. Weiser.
1995.
Rearrangement of snRNA structure during assembly and function of the spliceosome.
Prog. Nucleic Acid Res.
50:131-159[Medline].
|
| 2.
|
Bakin, A., and J. Ofengand.
1993.
Four newly located pseudouridylate residues in Escherichia coli 23S ribosomal RNA are all at the peptidyltransferase center: analysis by the application of a new sequencing technique.
Biochemistry
32:9754-9762[Medline].
|
| 3.
|
Becker, H. F.,
Y. Motorin,
R. J. Planta, and H. Grosjean.
1997.
The yeast gene YNL292w encodes a pseudouridine synthase (Pus4) catalyzing the formation of 55 in both mitochondrial and cytoplasmic tRNAs.
Nucleic Acids Res.
25:4493-4499[Abstract/Free Full Text].
|
| 4.
|
Bertrand, E.,
F. Houser-Scott,
A. Kendall,
R. H. Singer, and D. R. Engelke.
1998.
Nucleolar localization of early tRNA processing.
Genes Dev.
12:2463-2468[Abstract/Free Full Text].
|
| 5.
|
Björk, G. R.
1995.
Biosynthesis and function of modified nucleosides, p. 165-205.
In
D. Söll, and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis, and function. ASM Press, Washington, D.C.
|
| 6.
|
Bohmann, K.,
J. Ferreira,
N. Santama,
K. Weis, and A. I. Lamond.
1995.
Molecular analysis of the coiled body.
J. Cell Sci.
19:107-113.
|
| 7.
|
Bortolin, M.-L., and T. Kiss.
1998.
Human U19 intron-encoded snoRNA is processed from a long primary transcript that possesses little potential for protein coding.
RNA
4:445-454[Abstract].
|
| 8.
|
Bortolin, M.-L.,
P. Ganot, and T. Kiss.
1999.
Elements essential for accumulation and function of small nucleolar RNAs directing site-specific pseudouridylation of ribosomal RNAs.
EMBO J.
18:457-469[Medline].
|
| 9.
|
Carmo-Fonseca, M.,
R. Pepperkok,
M. T. Carvalho, and A. I. Lamond.
1992.
Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies.
J. Cell Biol.
117:1-14[Abstract/Free Full Text].
|
| 10.
|
Cavaillé, J.,
F. Chetouani, and J.-P. Bachellerie.
1999.
The yeast Saccharomyces cerevisiae YDL112w ORF encodes the putative 2'-O-ribose methyltransferase catalyzing the formation of Gm18 in tRNAs.
RNA
5:66-81[Abstract].
|
| 11.
|
Cavaillé, J.,
M. Nicoloso, and J.-P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[Medline].
|
| 12.
|
Dahlberg, J. E., and E. Lund.
1988.
The genes and transcription of the major small nuclear RNAs, p. 38-70.
In
M. L. Birnstiel (ed.), Structure and function of major and minor small nuclear ribonucleoprotein particles. Springer-Verlag KG, Berlin, Germany.
|
| 13.
|
Eichler, D. C., and N. Craig.
1994.
Processing of eukaryotic ribosomal RNA.
Prog. Nucleic Acid Res. Mol. Biol.
49:179-239.
|
| 14.
| Fournier, M. J. Personal communication.
|
| 15.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 16.
|
Ganot, P.,
M.-L. Bortolin, and T. Kiss.
1997.
Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs.
Cell
89:799-809[Medline].
|
| 17.
|
Goodall, G. J.,
K. Wiebauer, and W. Filipowicz.
1990.
Analysis of pre-mRNA processing in transfected plant protoplasts.
Methods Enzymol.
181:148-161[Medline].
|
| 18.
|
Hadjiolov, A. A.
1985.
The nucleolus and ribosome biogenesis.
In
M. Alfert, W. Beermann, L. Goldstein, K. R. Porter, and P. Sitte (ed.), Cell biology monographs. Springer-Verlag, Vienna, Austria.
|
| 19.
|
Hadjiolova, K. V.,
A. Normann,
J. Cavaillé,
E. Soupène,
S. Mazan,
A. A. Hadjiolov, and J.-P. Bachellerie.
1994.
Processing of truncated mouse or human rRNA transcribed from ribosomal minigenes transfected into mouse cells.
Mol. Cell. Biol.
14:4044-4056[Abstract/Free Full Text].
|
| 20.
|
Hamm, J.,
M. Kazmaier, and I. W. Mattaj.
1987.
In vitro assembly of U1 snRNPs.
EMBO J.
6:3479-3488[Medline].
|
| 21.
|
Hernandez, N.
1992.
Transcription of vertebrate snRNA genes and related genes, p. 281-313.
In
S. McKnight, and K. Yamamoto (ed.), transcriptional regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 23.
|
Jacobson, M. R., and T. Pederson.
1998.
Localization of signal recognition particle RNA in the nucleolus of mammalian cells.
Proc. Natl. Acad. Sci. USA
95:7981-7986[Abstract/Free Full Text].
|
| 24.
|
Jacobson, M. R.,
L.-G. Cao,
K. Taneja,
R. H. Singer,
Y.-L. Wang, and T. Pederson.
1997.
Nuclear domains of the RNA subunit of RNase P.
J. Cell Sci.
110:829-837[Abstract].
|
| 25.
|
Jacobson, M. R.,
L.-G. Cao,
Y.-L. Wang, and T. Pederson.
1995.
Dynamic localization of RNase MRP RNA in the nucleolus observed by fluorescent RNA cytochemistry in living cells.
J. Cell Biol.
131:1649-1658[Abstract/Free Full Text].
|
| 26.
|
Jiménez-Garcia, L. F.,
M. L. Segura-Valdez,
R. L. Ochs,
L. I. Rothblum,
R. Hannan, and D. L. Spector.
1994.
Nucleologenesis: U3 snRNA-containing prenucleolar bodies move to sites of active pre-rRNA transcription after mitosis.
Mol. Biol. Cell
5:955-966[Abstract].
|
| 27.
|
Kiss, T.,
C. Marshallsay, and W. Filipowicz.
1992.
7-2/MRP RNAs in plant and mammalian cells: association with higher order structures in the nucleolus.
EMBO J.
11:3737-3746[Medline].
|
| 28.
|
Kiss, T.,
M. Antal, and F. Solymosy.
1987.
Plant small nuclear RNAs. II. U6 RNA and a 4.5SI-like RNA are present in plant nuclei.
Nucleic Acids Res.
15:543-560[Abstract/Free Full Text].
|
| 29.
|
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424[Abstract/Free Full Text].
|
| 30.
| Kiss-László, Z., and T. Kiss.
Unpublished data.
|
| 31.
|
Kiss-László, Z.,
Y. Henry,
J.-P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 32.
|
Kiss-László, Z.,
Y. Henry, and T. Kiss.
1998.
Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of pre-rRNA.
EMBO J.
17:797-807[Medline].
|
| 33.
|
Kunkel, G. R., and T. Pederson.
1988.
Upstream elements required for efficient transcription of a human U6 RNA gene resemble those of U1 and U2 genes even though a different polymerase is used.
Genes Dev.
2:196-204[Abstract/Free Full Text].
|
| 34.
|
Lafontaine, D. L. J.,
C. Bousquet-Antonelli,
Y. Henry,
M. Caizergues-Ferrer, and D. Tollervey.
1998.
The box H+ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase.
Genes Dev.
12:527-537[Abstract/Free Full Text].
|
| 35.
|
Lamond, A. I., and W. C. Earnshow.
1998.
Structure and function of the nucleus.
Science
280:547-553[Abstract/Free Full Text].
|
| 36.
|
Lane, B. G.,
J. Ofengand, and M. W. Gray.
1995.
Pseudouridine and O2-methylated nucleotides. Significance of their selective occurrence in rRNA domains that function in ribosome-catalyzed synthesis of the peptide bonds in proteins.
Biochimie
77:7-15[Medline].
|
| 37.
|
Lange, T. S.,
A. Borovjagin,
E. S. Maxwell, and S. A. Gerbi.
1998.
Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs.
EMBO J.
17:3176-3187[Medline].
|
| 38.
|
Lecointe, F.,
G. Simos,
A. Sauer,
E. C. Hurt,
Y. Motorin, and H. Grosjean.
1998.
Characterization of yeast protein Deg1 as pseudouridine synthase (Pus3) catalyzing the formation of 38 and 39 in tRNA anticodon loop.
J. Biol. Chem.
273:1316-1323[Abstract/Free Full Text].
|
| 39.
|
Limbach, P. A.,
P. F. Crain, and J. A. McCloskey.
1994.
Summary: the modified nucleosides of RNA.
Nucleic Acids Res.
22:2183-2196[Abstract/Free Full Text].
|
| 40.
|
Lyon, C. E.,
K. Bohmann,
J. Sleeman, and A. I. Lamond.
1997.
Inhibition of protein dephosphorylation results in the accumulation of splicing snRNPs and coiled bodies within the nucleolus.
Exp. Cell Res.
230:84-93[Medline].
|
| 41.
|
Maden, B. E. H.
1990.
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Prog. Nucleic Acid Res.
39:241-303[Medline].
|
| 42.
|
Maden, B. E. H.,
M. E. Corbett,
P. A. Heeney,
K. Pugh, and P. M. Ajuh.
1995.
Classical and novel approaches to the detection and localization of the numerous modified nucleotides in eukaryotic ribosomal RNA.
Biochimie
77:22-29[Medline].
|
| 43.
|
Malatesta, M.,
C. Zancanaro,
T. E. Martin,
E. K. Chan,
F. Amalric,
R. Lührmann,
P. Vogel, and S. Fakan.
1994.
Is the coiled body involved in nucleolar functions?
Exp. Cell Res.
211:415-419[Medline].
|
| 44.
|
Massenet, S.,
Y. Motorin,
D. L. J. Lafontaine,
E. C. Hurt,
H. Grosjean, and C. Branlant.
1999.
Pseudouridine mapping in the Saccharomyces cerevisiae spliceosomal U small nuclear RNAs (snRNAs) reveals that pseudouridine synthase Pus1p exhibits a dual substrate specificity for U2 snRNA and tRNA.
Mol. Cell. Biol.
19:2142-2154[Abstract/Free Full Text].
|
| 45.
|
Matera, A. G.
1998.
Of coiled bodies, gems and salmon.
J. Cell. Biochem.
70:181-192[Medline].
|
| 46.
|
Matera, A. G., and D. C. Ward.
1993.
Nucleoplasmic organization of small nuclear ribonucleoproteins in cultured human cells.
J. Cell Biol.
121:715-727[Abstract/Free Full Text].
|
| 47.
|
Mattaj, I. W.
1986.
Cap trimethylation of U snRNA is cytoplasmic and dependent on U snRNP protein binding.
Cell
46:905-911[Medline].
|
| 48.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-934.
|
| 49.
|
Mitchell, J. R.,
J. Cheng, and K. Collins.
1999.
A box H/ACA small nucleolar RNA-like domain at the human telomerase RNA 3' end.
Mol. Cell. Biol.
19:567-576[Abstract/Free Full Text].
|
| 50.
|
Moss, T., and V. Y. Stefanovsky.
1995.
Promotion and regulation of ribosomal transcription in eukaryotes by RNA polymerase I.
Prog. Nucleic Acid Res. Mol. Biol.
50:25-66[Medline].
|
| 51.
| Narayanan, A., R. Terns, and M. Terns. Personal
communication.
|
| 52.
|
Ni, J.,
A. L. Tien, and M. J. Fournier.
1997.
Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA.
Cell
89:565-573[Medline].
|
| 53.
|
Niewmierzycka, A., and S. Clarke.
1999.
S-Adenosylmethionine-dependent methylation in Saccharomyces cerevisiae.
J. Biol. Chem.
274:814-824[Abstract/Free Full Text].
|
| 54.
|
Ochs, R. L.,
T. W. Stein, Jr., and E. M. Tan.
1994.
Coiled bodies in the nucleolus of breast cancer cells.
J. Cell Sci.
107:385-399[Abstract].
|
| 55.
|
Ofengand, J.,
A. Bakin,
J. Wrzesinski,
K. Nurse, and B. G. Lane.
1995.
The pseudouridine residues of ribosomal RNA.
Biochem. Cell Biol.
73:915-924[Medline].
|
| 56.
|
Olmedilla, A.,
J. de Dios Alche, and M. I. Rodriguez-Garcia.
1997.
Nucleolar evolution and coiled bodies during meiotic prophase in Olea europaea: differential localization of nucleic acids.
Eur. J. Cell Biol.
74:181-189[Medline].
|
| 57.
|
Pan, Z.-Q., and C. Prives.
1989.
U2 snRNA sequences that bind U2-specific proteins are dispensable for the function of U2 snRNP in splicing.
Genes Dev.
3:1887-1898[Abstract/Free Full Text].
|
| 58.
|
Parry, H. D.,
D. Scherly, and I. W. Mattaj.
1989.
'Snurpogenesis': the transcription and assembly of U snRNP components.
Trends Biochem. Sci.
14:15-19.
|
| 59.
|
Patton, J. R.
1993.
Multiple pseudouridine synthase activities for small nuclear RNAs.
Biochem. J.
290:595-600.
|
| 60.
|
Patton, J. R.
1994.
Formation of pseudouridine in U5 small nuclear RNA.
Biochemistry
33:10423-10427[Medline].
|
| 61.
|
Pederson, T.
1998.
The plurifunctional nucleolus.
Nucleic Acids Res.
26:3871-3876[Abstract/Free Full Text].
|
| 62.
|
Reddy, R., and H. Busch.
1988.
Small nuclear RNAs: RNA sequences, structure, and modifications, p. 1-37.
In
M. L. Birnstiel (ed.), Structure and function of major and minor small nuclear ribonucleoprotein particles. Springer-Verlag KG, Berlin, Germany.
|
| 63.
|
Reddy, R.,
W.-Y. Li,
D. Henning,
Y. C. Choi,
K. Nohga, and H. Busch.
1981.
Characterization and subcellular localization of 7-8S RNAs of Novikoff hepatoma.
J. Biol. Chem.
256:8452-8457[Free Full Text].
|
| 64.
|
Samarsky, D. A.,
M. J. Fournier,
R. H. Singer, and E. Bertrand.
1998.
The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization.
EMBO J.
17:3747-3757[Medline].
|
| 65.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 66.
|
Ségault, V.,
C. L. Will,
B. S. Sproat, and R. Lührmann.
1995.
In vitro reconstitution of mammalian U2 and U5 snRNPs active in splicing: Sm proteins are functionally interchangeable and are essential for the formation of functional U2 and U5 snRNPs.
EMBO J.
14:4010-4021[Medline].
|
| 67.
|
Selden, R. F.
1992.
Transfection using DEAE-dextran, p. 9.2.1-9.2.4.
In
F. M. Ausubel, R. Brent, R. E. Kingson, D. D. Moore, and J. G. Seidman (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 68.
|
Shaw, P. J.,
A. F. Beven,
D. J. Leader, and J. W. S. Brown.
1998.
Localization and processing from a polycistronic precursor of novel snoRNAs in maize.
J. Cell Sci.
111:2121-2128[Abstract].
|
| 69.
|
Shimba, S.,
J. A. Bokar,
F. Rottman, and R. Reddy.
1995.
Accurate and efficient N-6-adenosine methylation in spliceosomal U6 small nuclear RNA by HeLa cell extract in vitro.
Nucleic Acids Res.
23:2421-2426[Abstract/Free Full Text].
|
| 70.
|
Simos, G.,
H. Tekotte,
H. Grosjean,
A. Segref,
K. Sharma,
D. Tollervey, and E. C. Hurt.
1996.
Nuclear pore proteins are involved in the biogenesis of functional tRNA
EMBO J.
15:2270-2284[Medline].
|
| 71.
|
Sirum-Connolly, K., and T. L. Mason.
1993.
Functional requirement of a site-specific ribose methylation in ribosomal RNA.
Science
262:1886-1889[Abstract/Free Full Text].
|
| 72.
|
Smith, C. M., and J. A. Steitz.
1997.
Sno storm in the nucleolus: new roles for myriad small RNPs.
Cell
89:669-672[Medline].
|
| 73.
|
Sollner-Webb, B.,
K. T. Tycowski, and J. A. Steitz.
1996.
Ribosomal RNA processing in eukaryotes, p. 469-490.
In
R. A. Zimmermann, and A. E. Dahlberg (ed.), Ribosomal RNA. Structure, evolution, processing, and function in protein biosynthesis. CRC Press, Inc., Boca Raton, Fla.
|
| 74.
|
Spector, D.
1993.
Macromolecular domains within the cell nucleus.
Annu. Rev. Cell Biol.
9:265-315.
|
| 75.
|
Tollervey, D.,
H. Lehtonen,
R. Jansen,
H. Kern, and E. C. Hurt.
1993.
Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly.
Cell
72:443-457[Medline].
|
| 76.
|
Tollervey, D., and I. W. Mattaj.
1987.
Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate U-snRNPs.
EMBO J.
6:469-476[Medline].
|
| 77.
|
Tollervey, D., and T. Kiss.
1987.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342.
|
| 78.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 79.
|
Tycowski, K. T.,
Z.-H. You,
P. J. Graham, and J. A. Steitz.
1998.
Modification of U6 spliceosomal RNA is guided by another small RNAs.
Mol. Cell
2:629-638[Medline].
|
| 80.
|
Vankan, P.,
C. McGuigan, and I. W. Mattaj.
1990.
Domains of U4 and U6 snRNAs required for snRNP assembly and splicing complementation in Xenopus oocytes.
EMBO J.
9:3397-3404[Medline].
|
| 81.
|
Yokoyama, S., and S. Nishimura.
1995.
Modified nucleosides and codon recognition, p. 207-223.
In
D. Söll, and U. L. RajBhandary (ed.), tRNA: structure, biosynthesis, and function. ASM Press, Washington, D.C.
|
| 82.
|
Yu, Y.-T.,
M.-D. Shu, and J. A. Steitz.
1998.
Modifications of U2 snRNA are required for snRNP assembly and pre-mRNA splicing.
EMBO J.
17:5783-5795[Medline].
|
| 83.
|
Yuan, Y., and R. Reddy.
1989.
Genes for human U3 small nucleolar RNA contain highly conserved flanking sequences.
Biochim. Biophys. Acta
1008:14-22[Medline].
|
Molecular and Cellular Biology, October 1999, p. 6906-6917, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pederson, T., Tsai, R. Y.L.
(2009). In search of nonribosomal nucleolar protein function and regulation. JCB
184: 771-776
[Abstract]
[Full Text]
-
Patel, S. B., Bellini, M.
(2008). The assembly of a spliceosomal small nuclear ribonucleoprotein particle. Nucleic Acids Res
36: 6482-6493
[Abstract]
[Full Text]
-
Chen, C.-L., Chen, C.-J., Vallon, O., Huang, Z.-P., Zhou, H., Qu, L.-H.
(2008). Genomewide Analysis of Box C/D and Box H/ACA snoRNAs in Chlamydomonas reinhardtii Reveals an Extensive Organization Into Intronic Gene Clusters. Genetics
179: 21-30
[Abstract]
[Full Text]
-
Trippe, R., Guschina, E., Hossbach, M., Urlaub, H., Luhrmann, R., Benecke, B.-J.
(2006). Identification, cloning, and functional analysis of the human U6 snRNA-specific terminal uridylyl transferase. RNA
12: 1494-1504
[Abstract]
[Full Text]
-
Behm-Ansmant, I., Massenet, S., Immel, F., Patton, J. R., Motorin, Y., Branlant, C.
(2006). A previously unidentified activity of yeast and mouse RNA:pseudouridine synthases 1 (Pus1p) on tRNAs. RNA
12: 1583-1593
[Abstract]
[Full Text]
-
Richard, P., Kiss, A. M., Darzacq, X., Kiss, T.
(2006). Cotranscriptional Recognition of Human Intronic Box H/ACA snoRNAs Occurs in a Splicing-Independent Manner.. Mol. Cell. Biol.
26: 2540-2549
[Abstract]
[Full Text]
-
Egloff, S., Van Herreweghe, E., Kiss, T.
(2006). Regulation of Polymerase II Transcription by 7SK snRNA: Two Distinct RNA Elements Direct P-TEFb and HEXIM1 Binding. Mol. Cell. Biol.
26: 630-642
[Abstract]
[Full Text]
-
Vitali, P., Basyuk, E., Le Meur, E., Bertrand, E., Muscatelli, F., Cavaille, J., Huttenhofer, A.
(2005). ADAR2-mediated editing of RNA substrates in the nucleolus is inhibited by C/D small nucleolar RNAs. JCB
169: 745-753
[Abstract]
[Full Text]
-
Li, S.-G., Zhou, H., Luo, Y.-P., Zhang, P., Qu, L.-H.
(2005). Identification and Functional Analysis of 20 Box H/ACA Small Nucleolar RNAs (snoRNAs) from Schizosaccharomyces pombe. J. Biol. Chem.
280: 16446-16455
[Abstract]
[Full Text]
-
Kiss, T.
(2004). Biogenesis of small nuclear RNPs. J. Cell Sci.
117: 5949-5951
[Full Text]
-
HENRAS, A. K., CAPEYROU, R., HENRY, Y., CAIZERGUES-FERRER, M.
(2004). Cbf5p, the putative pseudouridine synthase of H/ACA-type snoRNPs, can form a complex with Gar1p and Nop10p in absence of Nhp2p and box H/ACA snoRNAs. RNA
10: 1704-1712
[Abstract]
[Full Text]
-
LIU, B., FOURNIER, M. J.
(2004). Interference probing of rRNA with snoRNPs: A novel approach for functional mapping of RNA in vivo. RNA
10: 1130-1141
[Abstract]
[Full Text]
-
Ideue, T., Azad, A. K., Yoshida, J.-i., Matsusaka, T., Yanagida, M., Ohshima, Y., Tani, T.
(2004). The nucleolus is involved in mRNA export from the nucleus in fission yeast. J. Cell Sci.
117: 2887-2895
[Abstract]
[Full Text]
-
Mandelboim, M., Barth, S., Biton, M., Liang, X.-h., Michaeli, S.
(2003). Silencing of Sm Proteins in Trypanosoma brucei by RNA Interference Captured a Novel Cytoplasmic Intermediate in Spliced Leader RNA Biogenesis. J. Biol. Chem.
278: 51469-51478
[Abstract]
[Full Text]
-
Vitali, P., Royo, H., Seitz, H., Bachellerie, J.-P., Huttenhofer, A., Cavaille, J.
(2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res
31: 6543-6551
[Abstract]
[Full Text]
-
Gerbi, S. A., Borovjagin, A. V., Odreman, F. E., Lange, T. S.
(2003). U4 snRNA nucleolar localization requires the NHPX/15.5-kD protein binding site but not Sm protein or U6 snRNA association. JCB
162: 821-832
[Abstract]
[Full Text]
-
Stanek, D., Rader, S. D., Klingauf, M., Neugebauer, K. M.
(2003). Targeting of U4/U6 small nuclear RNP assembly factor SART3/p110 to Cajal bodies. JCB
160: 505-516
[Abstract]
[Full Text]
-
Decatur, W. A., Fournier, M. J.
(2003). RNA-guided Nucleotide Modification of Ribosomal and Other RNAs. J. Biol. Chem.
278: 695-698
[Full Text]
-
Lerch-Gaggl, A., Haque, J., Li, J., Ning, G., Traktman, P., Duncan, S. A.
(2002). Pescadillo Is Essential for Nucleolar Assembly, Ribosome Biogenesis, and Mammalian Cell Proliferation. J. Biol. Chem.
277: 45347-45355
[Abstract]
[Full Text]
-
Dez, C., Noaillac-Depeyre, J., Caizergues-Ferrer, M., Henry, Y.
(2002). Naf1p, an Essential Nucleoplasmic Factor Specifically Required for Accumulation of Box H/ACA Small Nucleolar RNPs. Mol. Cell. Biol.
22: 7053-7065
[Abstract]
[Full Text]
-
Gerbi, S. A., Lange, T. S.
(2002). All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA. Mol. Biol. Cell
13: 3123-3137
[Abstract]
[Full Text]
-
Liang, D., Zhou, H., Zhang, P., Chen, Y.-Q., Chen, X., Chen, C.-L., Qu, L.-H.
(2002). A novel gene organization: intronic snoRNA gene clusters from Oryza sativa. Nucleic Acids Res
30: 3262-3272
[Abstract]
[Full Text]
-
Omer, A. D., Ziesche, S., Ebhardt, H., Dennis, P. P.
(2002). In vitro reconstitution and activity of a C/D box methylation guide ribonucleoprotein complex. Proc. Natl. Acad. Sci. USA
99: 5289-5294
[Abstract]
[Full Text]
-
Morlando, M., Greco, P., Dichtl, B., Fatica, A., Keller, W., Bozzoni, I.
(2002). Functional Analysis of Yeast snoRNA and snRNA 3'-End Formation Mediated by Uncoupling of Cleavage and Polyadenylation. Mol. Cell. Biol.
22: 1379-1389
[Abstract]
[Full Text]
-
Zhou, H., Chen, Y.-Q., Du, Y.-P., Qu, L.-H.
(2002). The Schizosaccharomyces pombe mgU6-47 gene is required for 2'-O-methylation of U6 snRNA at A41. Nucleic Acids Res
30: 894-902
[Abstract]
[Full Text]
-
Tang, T. H., Rozhdestvensky, T. S., d'Orval, B. C., Bortolin, M.-L., Huber, H., Charpentier, B., Branlant, C., Bachellerie, J.-P., Brosius, J., Huttenhofer, A.
(2002). RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing. Nucleic Acids Res
30: 921-930
[Abstract]
[Full Text]
-
d'Orval, B. C., Bortolin, M.-L., Gaspin, C., Bachellerie, J.-P.
(2001). Box C/D RNA guides for the ribose methylation of archaeal tRNAs. The tRNATrp intron guides the formation of two ribose-methylated nucleosides in the mature tRNATrp. Nucleic Acids Res
29: 4518-4529
[Abstract]
[Full Text]
-
Borovjagin, A. V., Gerbi, S. A.
(2001). Xenopus U3 snoRNA GAC-Box A' and Box A Sequences Play Distinct Functional Roles in rRNA Processing. Mol. Cell. Biol.
21: 6210-6221
[Abstract]
[Full Text]
-
Maraia, R. J.
(2001). La Protein and the Trafficking of Nascent RNA Polymerase III Transcripts. JCB
153: F13-F18
[Abstract]
[Full Text]
-
Liang-Hu, Q., Qing, M., Hui, Z., Yue-Qin, C.
(2001). Identification of 10 novel snoRNA gene clusters from Arabidopsis thaliana. Nucleic Acids Res
29: 1623-1630
[Abstract]
[Full Text]
-
Yu, Y.-T., Shu, M.-D., Narayanan, A., Terns, R. M., Terns, M. P., Steitz, J. A.
(2001). Internal Modification of U2 Small Nuclear (sn)RNA Occurs in Nucleoli of Xenopus Oocytes. JCB
152: 1279-1288
[Abstract]
[Full Text]
-
GERBI, S.A., BOROVJAGIN, A.V., EZROKHI, M., LANGE, T.S.
(2001). Ribosome Biogenesis: Role of Small Nucleolar RNA in Maturation of Eukaryotic rRNA. Cold Spring Harb Symp Quant Biol
66: 575-590
[Abstract]
-
Filipowicz, W.
(2000). Imprinted expression of small nucleolar RNAs in brain: Time for RNomics. Proc. Natl. Acad. Sci. USA
97: 14035-14037
[Full Text]
-
Cavaillé, J., Buiting, K., Kiefmann, M., Lalande, M., Brannan, C. I., Horsthemke, B., Bachellerie, J.-P., Brosius, J., Hüttenhofer, A.
(2000). Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. USA
10.1073/pnas.250426397v1
[Abstract]
[Full Text]
-
Lange, T. S., Gerbi, S. A.
(2000). Transient Nucleolar Localization Of U6 Small Nuclear RNA In Xenopus Laevis Oocytes. Mol. Biol. Cell
11: 2419-2428
[Abstract]
[Full Text]
-
Lewis, J. D., Tollervey, D.
(2000). Like Attracts Like: Getting RNA Processing Together in the Nucleus. Science
288: 1385-1389
[Abstract]
[Full Text]
-
Jady, B. E., Kiss, T.
(2000). Characterisation of the U83 and U84 small nucleolar RNAs: two novel 2'-O-ribose methylation guide RNAs that lack complementarities to ribosomal RNAs. Nucleic Acids Res
28: 1348-1354
[Abstract]
[Full Text]
-
Ansmant, I., Motorin, Y., Massenet, S., Grosjean, H., Branlant, C.
(2001). Identification and Characterization of the tRNA:Psi 31-Synthase (Pus6p) of Saccharomyces cerevisiae. J. Biol. Chem.
276: 34934-34940
[Abstract]
[Full Text]
-
Cavaille, J., Vitali, P., Basyuk, E., Huttenhofer, A., Bachellerie, J.-P.
(2001). A Novel Brain-specific Box C/D Small Nucleolar RNA Processed from Tandemly Repeated Introns of a Noncoding RNA Gene in Rats. J. Biol. Chem.
276: 26374-26383
[Abstract]
[Full Text]
-
Cavaille, J., Buiting, K., Kiefmann, M., Lalande, M., Brannan, C. I., Horsthemke, B., Bachellerie, J.-P., Brosius, J., Huttenhofer, A.
(2000). From the Cover: Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. USA
97: 14311-14316
[Abstract]
[Full Text]