Previous Article | Next Article ![]()
Molecular and Cellular Biology, October 1999, p. 6980-6990, Vol. 19, No. 10
Developmental, Cell and Molecular Biology
Group, Departments of Botany and Zoology, Duke University, Durham,
North Carolina 27708
Received 19 May 1999/Accepted 29 June 1999
Random mutations were generated in the sequence for the 5'
untranslated region (5'UTR) of the Chlamydomonas
reinhardtii chloroplast rps7 mRNA by PCR, the coding
sequence for the mutant leaders fused upstream of the lacZ'
reporter in pUC18, and transformed into Escherichia coli,
and white colonies were selected. Twelve single base pair changes were
found at different positions in the rps7 5'UTR in 207 white
colonies examined. Seven of the 12 mutant leaders allowed accumulation
of abundant lacZ' message. These mutant rps7 leaders were ligated into an aadA expression cassette and
transformed into the chloroplast of C. reinhardtii and into
E. coli. In vivo spectinomycin-resistant growth rates and
in vitro aminoglycoside adenyltransferase enzyme activity varied
considerably between different mutants but were remarkably similar for
a given mutant expressed in the Chlamydomonas chloroplast
and in E. coli. The variable effect of the mutants on
aadA reporter expression and their complete abolition of
lacZ' reporter expression in E. coli suggests
differences in the interaction between the 5'UTR of rps7 and aadA or lacZ' coding regions. Several
rps7 5'UTR mutations affected the predicted folding pattern
of the 5'UTR by weakening the stability of stem structures.
Site-directed secondary mutations generated to restore these structures
in the second stem suppressed the loss of reporter activity caused by
the original mutations. Additional site-directed mutations that were
predicted to further strengthen (A-U Translational regulation plays a
major role in controlling the expression of chloroplast-encoded genes
(7, 13, 18, 26, 29). While the translation machinery of the
chloroplast shares many functional characteristics with that of its
prokaryotic relatives (14, 16), several differences are
beginning to emerge with respect to the well-defined Escherichia
coli model (2, 11, 27, 38). Interactions between
evolutionarily conserved Shine-Dalgarno (SD) sequences (GGAGG)
found in the vast majority of genes in E. coli 7 ± 2 nucleotides (nt) upstream of the initiator AUG codon and anti-SD
sequences near the 3' end of the 16S rRNA (CCUCC) are known
to be essential for translational initiation in this bacterium.
Although the anti-SD sequences in the chloroplast 16S rRNAs are highly
conserved, SD-like sequences in the leaders of chloroplast mRNAs vary
significantly in location, size, and nucleotide composition or are
absent altogether (3, 8, 31). Neither elimination of the
variable putative SD sequences in chloroplast leaders by deletion
mutagenesis (1, 19, 22, 32) or replacement mutagenesis
(8, 21) nor insertion of canonical SD sequences (8) has significant effects on chloroplast gene expression, indicating that translation initiation in the chloroplast occurs largely in an SD-independent manner. Surprisingly, the same chloroplast reporter constructs lacking SD sequences are also expressed efficiently in E. coli and addition of canonical SD sequences to the
leaders of these constructs only modestly enhances translation of these mRNAs by the bacterial protein synthesizing system (8).
In contrast to the majority of E. coli mRNAs, chloroplast
mRNAs contain fairly long, AU-rich 5' untranslated regions (5'UTRs) with little primary sequence conservation that appear to play a major
role in the regulation of translation initiation (10, 13,
18). Analyses of representative chloroplast 5'UTRs, to determine
likely secondary structure based on minimum energy models (42), predict that these leaders are highly folded, with
several having large stem-loop structures directly upstream of the
initiation codon (10, 18). Interactions between these
structures and the translational apparatus of the chloroplast
presumably allow for the regulation of translation initiation.
We have carried out a random PCR mutagenesis on the sequence for the
5'UTR of the chloroplast rps7 gene from Chlamydomonas reinhardtii that specifies a protein of the small subunit of the chloroplast ribosome. The population of rps7 mutant
leaders was then fused to the E. coli lacZ' coding
sequence in a pUC18 plasmid, and bacterial transformants that
were unable to express Changes in the predicted secondary and tertiary structures of the
mutant 5'UTRs were also supported by differences in the RNA
melting-reannealing profiles and RNase T1 gel shift protection patterns
from those of wild-type and suppressed mutant strains. The combined
genetic and physical evidence supports the hypothesis that the
wild-type rps7 leader sequence resulting in the predicted folding pattern for the second stem-loop is essential for normal function.
Strains and culture conditions.
The C. reinhardtii
atpB deletion mutant ac-u-c-2-21 (5) was
used as the recipient for chloroplast transformation. Strain CC-3277
carried the chloroplast reporter construct
rps7::aadA::rbcL with the wild-type
rps7 leader (8). This strain and derived strains
carrying rps7 leader mutations fused to the aadA
reporter construct (with CC prefix) and plasmids with the mutant
chimeric constructs (with P prefix) described in this paper are
available from Elizabeth Harris (Chlamydomonas Genetics
Center, Duke University, Durham, N.C.). C. reinhardtii and
E. coli strains were grown and harvested for transformation
and biochemical and molecular analyses as described previously (8,
15).
Mutagenesis of the rps7 chloroplast leader.
The
chloroplast rps7::aadA::rbcL reporter
gene (P-655) was constructed in pUC18 as described previously
(8). To generate loss-of-function mutants, random
mutagenesis was conducted in vitro on the 625-nt fragment from P-655
upstream of the translation start site (AUG) in the chloroplast
rps7 construct from C. reinhardtii. This fragment
was shown to contain the 266-nt 5'UTR by primer extension (data not
shown) as well as the chloroplast promoter and an upstream
transcriptional enhancer (8a). Mutagenic PCR mixtures
(24, 41) included 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM
ZnCl2, 62 µM deoxynucleoside triphosphates (dNTPs; a 20 µM concentration of each of three dNTPs and a 2 µM concentration of
a fourth to generate a 10:1 nucleotide imbalance), 10 µl (0.1 ng/µl) of rps7 5' leader template, 30 pmol of each of the
primers, 10 µl of 2-mercaptoethanol, 10 µl of dimethyl sulfoxide, 5 U of Taq polymerase, and distilled water to 200 µl. Thirty
PCR cycles of 94°C for 1 min, 59°C for 2 min, and 72°C for 3 min
were carried out.
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutations Altering the Predicted Secondary Structure of a
Chloroplast 5' Untranslated Region Affect Its Physical and Biochemical
Properties as Well as Its Ability To Promote Translation of Reporter
mRNAs Both in the Chlamydomonas reinhardtii
Chloroplast and in Escherichia coli
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
G-C) or weaken (G-C
A-U) the
second stem of the rps7 leader both resulted in reduced
reporter expression. This genetic evidence combined with differences
between mutant and wild-type UV melting profiles and RNase T1
protection gel shifts further indicate that the predicted wild-type
folding pattern in the 5'UTR is likely to play an essential role in
translation initiation.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase on X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside)
plates were identified as white colonies. Twelve of the 207 white
colony mutants were found to have alterations in the coding sequence for the first 225 nt upstream of the initiation AUG codon of the rps7 5'UTR. Seven rps7 mutants that did not alter
levels of lacZ' mRNA accumulation affected expression of the
aminoglycoside adenyltransferase (AAD) reporter protein to various
degrees in both the C. reinhardtii chloroplast and in
E. coli. The marked difference between the effect of a given
mutant rps7 leader on translation of the lacZ' and aadA reporter mRNAs in E. coli suggests that
interactions between the coding sequences and the 5'UTR sequence play a
role in the regulation of translation initiation. Three of the seven mutants altered the predicted structure of the second stem-loop upstream of the AUG initiation codon. Complementary nucleotide changes
made in these mutants to reconstitute this predicted wild-type stem-loop structure restored spectinomycin-resistant growth and AAD
enzyme activity. Additionally, site-directed mutants with base pair
changes that strengthened or weakened the second predicted stem-loop of
the rps7 5'UTR decreased growth and AAD enzyme activity in
the C. reinhardtii chloroplast. These data strongly suggest that the secondary structure of this rps7 leader in vivo
involves these predicted stem-loop structures that are essential for
normal translational regulation.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
36A
G
(5'TCTATTTAACCGTTTAGTAAAAT3'),
36A
C
(5'TCTATTTAACCCTTTAGTAAAAT3'),
92A
G
(5'GTCCTATTAAGCCATCACATAAC3'),
65U
A
(5'AATTGCTTATTAGGTATGAAAG3'), and
62U
A
(5'GCTTATTTGGAATGAAAGTTTG3'). To generate the
mutant weakening the second stem-loop structure, primers with
nucleotide changes at
63G
A and
64G
A
(5'CTAAAATTGCTTTAATATGAAAGTTTG3') as well as at
91C
U and
90C
U (5'GTCCTATTAAATTATCACATAAC3') were used. To create the mutant strengthening the second
stem-loop, we employed primers to generate nucleotide changes at
83U
C and
82A
G (5'AACCATCACACGACTAAATTG3')
as well as at
69U
C and
68A
G (5'ACTAAAATTGCTCGTTTGGTATG3'). Mutant nucleotides
are indicated in italics. The presence of the new mutations at position
36, of the second site mutations at positions
62,
65, and
92,
and of the stem-weakening and -strengthening mutations in these
rps7 fragments was verified by DNA sequence analysis with
the Sequenase II system, and the site-directed mutant fragments were
cloned into the aadA expression vector P-655 as described above.
To determine whether alterations of G-C base pairs in the first 225 nt
of the rps7 leader or nucleotide changes elsewhere in the
400 nt upstream of the mutagenized fragment were blocking expression of
the lacZ' reporter in the remaining white colony mutants, we
sequenced the entire 625-nt fragment in 20 additional randomly selected
isolates by using the ABI sequencer.
Transformation of the aadA reporter constructs with mutant rps7 leaders into the C. reinhardtii chloroplast and into E. coli. The nonphotosynthetic C. reinhardtii strain CC-373 was transformed by the biolistic method (4) with DNA from a chimeric pUC18 plasmid containing the wild-type atpB gene fused to aadA reporter constructs with mutant rps7 leaders (8). Photosynthetically competent transformants were selected on minimal HS medium as previously described (4, 5, 8). Homologous integration of the donor constructs at the atpB locus of the recipients' chloroplast genome restored the function of the single-copy atpB gene. Transformants homoplasmic for the donor atpB gene were obtained after relatively few cell generations on HS medium (5). The linked reporter constructs, which integrate into the adjacent inverted repeat sequence, copy correct at high frequency (4). Continued selection of the wild-type rps7::aadA::rbcL chloroplast transformants on spectinomycin resulted in cells homoplasmic for two copies of this insert, whereas three or four rounds of subcloning in the absence of spectinomycin were necessary to obtain isolates homoplasmic for two copies of the insert with mutant leaders. Once homoplasmic isolates were obtained, they appeared to be stable. Only a single transformant with each mutant reporter construct was analyzed since previous studies demonstrated that insertion of the aadA reporter at this site in the chloroplast genome yielded independent transformants with no significant variation in AAD expression (8). E. coli cells (XL1-Blue) were transformed by electroporation with the same mutant reporter constructs, and transformants were selected on Luria-Bertani (LB) plates containing 100 µg of ampicillin per ml by using standard techniques (33). Chimeric constructs in E. coli were maintained as multicopy plasmids under ampicillin selection at 100 µg/ml. A single E. coli transformant was analyzed for each mutant leader since individual transformants of the chimeric reporter construct display minimal variability in expression (8).
Northern and Southern analysis of the transformants and primer
extension.
DNA was isolated from transformed cells of E. coli (33) and C. reinhardtii (23)
and digested with BamHI. Chloroplast DNA fragments were
separated on 0.9% agarose gels, transferred to a Magna NT nylon
membrane (MSI Scientific) with a Stratagene blot apparatus, and probed
with the cloned chloroplast BamHI fragment 10 that covers
the site of integration (8). RNA was extracted from E. coli and C. reinhardtii cells with 4 M guanidine
isothiocyanate-25 mM sodium citrate (pH 7.0)-0.1 M
2-mercaptoethanol-0.05% Sarkosyl as described previously
(6). RNA was separated on 1.1% agarose-2.2 M formaldehyde
gels, blotted onto Magna NT membranes (MSI Scientific), and probed with
an 0.81-kb aadA fragment or an 0.41-kb lacZ'
fragment from the respective coding sequences. For each DNA and RNA
sample, nucleic acid concentrations were measured
spectrophotometrically and standardized to ensure equal loading of
lanes. Stringent hybridization and washing conditions were used on both
the DNA and RNA blots. The probes were labeled with
[
-32P]dATP (NEN) by using a random priming kit
(Boehringer Mannheim). Blots were exposed to X-ray film (Kodak X
OMAT-AR) at
70°C. RNA blots were also quantified with a Molecular
Dynamics PhosphorImager. Primer extension analysis of the wild-type
rps7 5'UTR was conducted to locate the transcription
initiation site. These reactions employing a primer complementary to
the amino-terminal end of the aadA coding sequence
5'-CGATCACCGCTTCCCTCAT-3' and 10 U of avian myeloblastosis virus reverse transcriptase were run at 42°C for 60 min. Reactions were displayed on both a 5% polyacrylamide gel with DNA size standards and by running them next to the corresponding DNA sequence on a 6%
polyacrylamide-8 M urea sequencing gel as described before (34).
Growth and enzyme activity assays.
Growth rates of 1.0-ml
cultures of representative C. reinhardtii and E. coli
rps7::aadA transformants with each rps7 5'UTR mutation were measured in 24-well microtiter plates (Falcon no. 3047)
by the increase in A740 or
A650, respectively, as described previously
(8, 9). The AAD enzyme activity of these transformants was
measured as the capacity to transfer
-32P-labeled ATP to
spectinomycin by binding the spectinomycin breakdown product to
chromatography paper (8, 12).
-Galactosidase activity was
assayed for the original rps7::lacZ' E. coli
transformants by standard techniques (33).
Predicted RNA secondary structures. RNA secondary structures were predicted by using the MFOLD algorithm available online (42a). Several wild-type rps7 structures were examined; they included the 625-nt upstream sequence that was mutagenized and is transcribed in E. coli, the 266-nt full-length 5'UTR, and the truncated 225-nt 5'UTR sequence. Additionally, the 266-nt 5'UTR sequence upstream of the aadA or the lacZ' reporter sequence was examined for alteration of the predicted stem-loop structures by association with the downstream reporter RNA. In all of the constructs described above, the predicted wild-type secondary structure of the first five stem-loops corresponding to the 225 nt proximal to the AUG initiation codon (Fig. 1) are maintained. The MFOLD analyses were conducted at 25°C with 5% suboptimability in 1 M NaCl (default conditions). Additional predicted structures examined at 37°C displayed a similar global folding pattern with alterations in local stem-loop structures expected, given the increase in available free energy.
|
UV melting-reannealing profile analyses.
RNA was synthesized
in vitro from an SKII+ plasmid with the T7 promoter upstream of
sequences corresponding to (i) the 266-nt wild-type rps7
5'UTR (P-833), (ii) three of the mutant 5'UTRs affecting the second
predicted stem (
62U
C [P-848],
89A
U [P-849], and
92A
U
[P-850]), (iii) three of the 5'UTRs with the corresponding suppressor
double mutants (
62U
C and
92A
G [P-851],
89A
U and
65U
A [P-852], and
92A
U and
62U
A [P-853]), (iv)
5'UTRs with the three mutants at nucleotide position
36 (A
C
[P-854]), A
G [P-855], and A
U [P-856]), and (v) 5'UTRs with
the second stem-strengthening (double G-C [P-857]) and weakening
(double A-U [P-858]) mutants. Each of the 20-ml reaction mixtures
contained 4 mM each NTP, 25 mM MgCl2, 25 mM NaCl, 50 mM
Tris-HCl (pH 8.1), 20 mM dithiothreitol, 50 nM T7 plasmid promoter
template DNA, and 100 nM T7 RNA polymerase as described previously
(22). Transcription reaction mixtures were extracted with
phenol-chloroform and run over an 8 M urea-8% (wt/vol) polyacrylamide
gel, excised, and electroeluted. The A260 was
measured over a 20 to 80°C range at 2°C increments changing at
1°C/min on a Shimadzu TCC-260 spectrophotometer. Melting and reannealing profiles were obtained, and derivative values were determined to identify regions of varied hyperchromicity and changes in
the temperature of the transition from primarily secondary structure to
primarily tertiary structure unfolding (22).
RNase T1 protection gel shift assays.
Radiolabeled RNA
leaders corresponding to the wild-type and mutant rps7
5'UTRs were synthesized in 20-µl reaction mixtures containing 1 µg
of the linearized plasmid RNA synthesis templates as described above in
40 mM Tris-HCl (pH 7.5)-6 mM MgCl2-2 mM Spermidine
(Sigma)-10 mM dithiothreitol-20 U of RNasin (Promega)-50 µCi of
[
-32P]UTP (DuPont NEN)-12 µM nonradiolabeled
UTP-an 0.3 mM concentration each of ATP, CTP, and GTP-20 U of T7 RNA
polymerase for 1 h at 37°C. Five units of RNase-free DNase I
(Sigma) was added, and the reaction mixtures were incubated for an
additional 10 min at 37°C. RNAs were labeled to specific activities
of 1 × 109 to 2 × 109 cpm/µg. The
reaction mixtures were then extracted with phenol-chloroform and
separated from unincorporated nucleotides on Sephadex G-25 spun columns
as described previously (17).
| |
RESULTS |
|---|
|
|
|---|
Isolation of random mutations in the chloroplast rps7
leader in E. coli.
To identify regions of the 266-nt 5'UTR
of the chloroplast rps7 gene from C. reinhardtii
necessary for the initiation of translation, random PCR mutagenesis was
conducted on the 625-nt wild-type fragment upstream of the AUG
initiation codon. The population of amplified molecules was then
purified on a 0.9% agarose gel and ligated into a pUC18 vector between
the lac promoter and the lacZ' coding sequence.
These constructs were transformed into E. coli XL1-Blue competent cells, and ampicillin-resistant colonies were selected. Transformed isolates unable to produce
-galactosidase were
identified as white colonies. Partial sequencing (A and T bases only)
of the first 225 nt of the rps7 fragment upstream of the
translation start site (greater than 70% A+T) from 207 of these white
colonies identified 12 single base changes within the first 167 nt,
each at a different position (Fig. 1). These changes were confirmed to
be the only alterations present by determining the sequence of the
entire 625-nt fragment mutagenized for each of the 12 mutants. A
quantitative analysis of
-galactosidase activity revealed that the
12 white colony mutant strains had less than 6% of the enzyme activity
level found in E. coli transformants with the wild-type rps7 5'UTR fused to lacZ' (Table
1). RNA blot analysis demonstrated that 7 of the 12 mutants accumulated abundant
rps7::lacZ' mRNA (Fig.
2). These same seven mutants also
accumulated abundant rps7::aadA mRNA (Fig. 2).
Sequence analysis of the entire 625-nt rps7 fragment from 20 additional randomly selected white colony mutants with no A or T
alterations in the first 225 nt revealed no further nucleotide changes.
|
|
Functional analysis of the mutant rps7 leaders using
the aadA reporter construct in chloroplast transformants of
C. reinhardtii and in E. coli.
The DNA sequences
encoding the seven mutant rps7 leaders that allowed normal
or near-normal accumulation of lacZ' mRNA in E. coli were subcloned into the C. reinhardtii chloroplast
transformation cassette
rps7::aadA::rbcL linked to a
wild-type atpB gene, replacing the wild-type rps7
leader sequence. These chimeric plasmids were transformed into the
C. reinhardtii recipient strain CC-373, an atpB
partial deletion mutant, to complement the photosynthetic defect in
this strain (4, 8). Homologous integration of the donor DNA
fragment introduces the aadA reporter construct into one
copy of the inverted repeat adjacent to the single-copy atpB
gene, and the reporter sequence then copy corrects and segregates to
homoplasmicity to yield progeny with one copy of the wild-type atpB gene and two copies of the
rps7::aadA::rbcL construct.
Homoplasmicity was confirmed by digesting total DNA from each subclone
of the C. reinhardtii chloroplast transformants as well as
the CC-373 recipient strain with BamHI and probing with the
cloned chloroplast BamHI fragment 10 spanning this region
(8). The rps7 leaders with the
24U
G and
120U
C mutations that failed to accumulate lacZ' mRNA in
E. coli were similarly ligated into the C. reinhardtii transformation cassette, transformed into the
chloroplast, and subcloned to homoplasmicity. This set of nine mutant
rps7::aadA constructs ligated into pUC18 by using
XhoI and NcoI restriction sites was also
transformed into E. coli for analysis of reporter gene expression.
24U
G and
120U
C
alterations that failed to accumulate lacZ' mRNA in E. coli also failed to accumulate aadA mRNA in C. reinhardtii when fused to this reporter construct.
|
Assay of aadA reporter activity.
The homoplasmic
chloroplast transformants with mutant rps7 leaders fused to
the aadA reporter were analyzed for their ability to express
the AAD protein by two independent tests. In vivo growth rates for each
of the mutant strains were determined with spectinomycin concentrations
ranging from 0 to 500 µg/ml as described previously (8).
We showed previously that spectinomycin-resistant growth was directly
correlated with the level of AAD protein activity (8). The
spectinomycin-resistant growth rates for chloroplast transformants with
the seven rps7 leader mutants that accumulated normal levels
of aadA mRNA varied from 13 to 98% that of the control strain with the wild-type rps7 leader (Table 2). The
activity of the AAD reporter enzyme in the aadA
transformants was measured in cell extracts (8, 12) as
microcuries of 32P-labeled product bound and was found to
be linear over the 40-min assay period up to 100 µg of S100 protein
per ml. The in vitro enzyme activity of chloroplast transformants
carrying the rps7 mutants was highly correlated with their
respective spectinomycin-resistant growth rates (Table 2). In both
assays, the
36A
U mutation was the most deleterious change and the
135A
G mutation was the least detrimental.
36A
U mutant is the most impaired and the
135A
G mutant is the
least affected compared to the wild type (compare Tables 1 and 2). We
found that rps7 leader mutations that result in the apparent
loss of lacZ' expression in E. coli (white
colonies on X-Gal plates, <6% of the enzyme activity of the construct
with the wild-type rps7 leader) can permit widely varying
levels of aadA reporter expression in both E. coli and the C. reinhardtii chloroplast (<10% to
>90% of the aadA construct with the wild-type rps7 leader). Differences in interactions of the mutant
rps7 leaders with the respective lacZ' and
aadA coding sequences in E. coli might explain
these differences in reporter gene expression, either by causing
alterations in the global folding of the mRNA or by promoting the
differential ability of the mRNAs to recruit factors to the translation
preinitiation complex.
Generation and analysis of site-directed alterations in the mutant
rps7 leaders.
We used site-directed mutagenesis to
determine whether nucleotide changes in four of the mutant
rps7 leaders could restore their substantially reduced
function. Second site
92A
G,
65U
A, and
62U
A alterations
in the leader were tested for their ability to complement respectively
the
62U
C,
89A
U, and
92A
U mutants that are predicted to
reduce pairing in the second stem-loop (Fig. 3A). In each case, the
alterations were designed to restore the putative wild-type
rps7 secondary stem structure as is represented for the
62U
C mutation (Fig. 3B) and
92 A
G second site complementary nucleotide change (Fig. 3C). Since the
36A
U mutant falls in a
predicted loop (Fig. 1), we generated
36A
G and
36A
C mutant constructs to examine the effects of all 4 nt at this position. Each of
the three rps7::aadA::rbcL constructs
containing both the original mutation and the complementary second site
change, as well as the
36A
G and
36A
C alterations, was
transformed into the chloroplast of C. reinhardtii and
subcloned to homoplasmicity, and spectinomycin-resistant growth and AAD
reporter enzyme activity were determined on individual representative
isolates (Table 3). While
36A
G and
36A
C mutations failed to restore wild-type levels of
aadA expression, the rps7 leader with the
36A
G alteration, a purine-for-purine replacement, is at least
twice as competent at promoting translation as those with either the
36A
U or the
36A
C substitutions. Clearly, the wild-type
sequence at nucleotide
36 is necessary for full expression of the
rps7 leader.
|
|
92A
G and
62U
A second site mutations fall on opposite
sides of the second extended stem structure predicted for the wild-type
rps7 leader (Fig. 1). The presence of both mutations restores normal rps7 leader function, resulting in
spectinomycin-resistant growth and AAD enzyme activity levels only
moderately below those of the wild-type rps7 construct in
the chloroplast aadA transformants (Table 3). The
65U
A
second site mutation falls in the middle of the second predicted
extended stem (Fig. 3A) and almost fully restores the loss of activity
caused by the
89A
U alteration. The effects of secondary mutations
were not examined in the
15U
A mutant, which falls in a predicted
bulge, and the upstream
117U
C and
135A
G mutants that
displayed aadA reporter expression closest to that of the
wild type.
The same rps7 5'UTR constructs with the five site-directed
mutations were also examined in E. coli by using both the
aadA and lacZ' reporters. A quantitative analysis
of representative E. coli transformants with each of these
mutations revealed that the alterations at the
36 position (
36A
G
and
36A
C) failed to restore expression for either reporter
(expression < 10% of transformants with the wild-type
rps7 5'UTR for each reporter), whereas the three
transformants carrying second site mutations designed to reform
predicted stem-loop structures expressed both of the reporters at or
near wild-type levels (Table 3).
Analysis of site-directed mutants designed to weaken or strengthen
pairing in the predicted second stem-loop.
To determine the
effects of mutations that either weaken or strengthen the second
predicted stem without disrupting the predicted global folding pattern
of the rps7 5'UTR, we generated two sets of site-directed
mutants. We replaced two predicted A-U pairs with G-C pairs to make the
stem stronger
(A
68-U
82
G
68-C
82 and
U
69-A
83
G
69-C
83)
and replaced two predicted G-C pairs with A-U pairs to make the stem
weaker (G
63-C
91
A
63-U
91
and
G
64-C
90
A
64-U
90) (Fig. 1). 5'UTRs with both of these sets of alterations were placed upstream of the aadA reporter in P-655 and transformed into
the chloroplast of C. reinhardtii. Homoplasmic transformants
were analyzed by using the same growth and AAD enzyme activity assays described above. Either strengthening or weakening the stem beyond its
predicted wild-type configuration had a deleterious effect on the
translational activity of the 5'UTR. The stem-strengthening mutant with
two adjacent (A-U
G-C) pairs created in the second stem-loop had a
calculated increase in available free energy (
G =
4.8 kcal mol
1) and displayed spectinomycin-resistant
growth at only 57% and AAD enzyme activity at only 61% of that of the
wild type. The stem-weakening mutant with two adjacent (G-C
A-U)
pairs had a calculated decrease in available free energy
(
G = +3.9 kcal mol
1) and displayed
spectinomycin-resistant growth at only 73% and AAD enzyme activity at
only 63% of that of the wild type (Table 4).
|
Melting-reannealing profile analyses of rps7 5'UTRs
from the wild type, mutants, and designed suppressors.
Melting and
reannealing profiles of the wild-type and 11 mutant 266-nt
rps7 5'UTR RNAs were examined for both the hyperchromicity (peak of the derivative curve) and the temperature at which the transition from predominantly tertiary to predominantly secondary structure melting occurs. Changes in these parameters are indicative of
differences in the global folding structure between the wild-type and
the mutant RNAs (22). Recovery of the wild-type
melting-reannealing profile in the double mutant suppressors that were
designed to restore predicted stem structures would provide further
evidence that the predicted secondary structure is valid. Our
melting-reannealing data indicate an alteration of wild-type secondary
and tertiary folding in each of the original mutants and a
near-wild-type recovery in the designed second-site suppressors (Fig.
4). The
89A
U mutant melting
profile in Fig. 4A displays a shift in the derivative curve indicative of the transition from tertiary to secondary melting
at 42°C instead of 50°C, suggesting a less-stable tertiary structure. The hyperchromicity is also decreased, indicating a difference in either the individual secondary structure elements or a
difference in their interactions. The temperature of transition for the
92A
U and
62U
C mutants is similar to that of the wild type,
but the hyperchromicity is again greatly reduced (Fig. 4B and C). The
36 substitution mutants fall in two structural populations (A or G
and C or U) in terms of the temperature of transition from
predominantly tertiary to predominantly secondary melting (Fig. 4D).
|
G-C) changes, indicating increased overall secondary
structure, and the derivative peak is decreased and broadened for the
stem-weakening mutant with adjacent (G-C
A-U) changes, indicating
decreased secondary structure (Fig. 4E). Unfortunately, the large size
of the RNA leaders makes determining any specific secondary structures
from the melting profiles impossible since interactions between the
folding of stem-loops generates 2n + 1 (n = the number of stem-loops) possible interactions.
RNase T1 protection gel mobility shift assays.
5'UTRs from the
wild type, the
89A
U mutant, and the
89A
U
65U
A double
mutant were incubated with heparin-Actigel-purified chloroplast
proteins from C. reinhardtii and run on native 5% polyacrylamide gels with and without T1 RNase digestion (Fig. 5). The assay examined the migration of
the 5'UTR RNA alone, RNA plus enriched proteins, and RNA plus enriched
proteins plus T1 RNase. A single up-shifted band is seen in the
wild-type, the
89A
U mutant, and the
89A
U
65U
A double
mutant lanes when combined with the enriched proteins. When T1 RNase is
added, a single shifted-protected band migrating slightly faster is
visible in the wild type and the double mutant. In contrast, two
shifted-protected bands are seen in the
89A
U mutant, one in the
same position as that in the wild type and the double mutant and one
migrating much more rapidly through the gel. An assay with labeled
mutant RNA and cold wild-type RNA in the presence of T1 RNase revealed that the higher of the two shifted-protected bands in the mutant was
competed off at a lower RNA concentration than the lower band.
|
| |
DISCUSSION |
|---|
|
|
|---|
cis-acting mutations in the 5'UTR of the chloroplast
rps7 leader that block expression of the lacZ'
reporter gene in E. coli (<6% of the
-galactosidase
activity produced by the wild-type rps7 leader) show the
same wide range of the aadA reporter activity (10% to
>90% of the wild-type rps7 leader value) when examined in
either E. coli or in the chloroplast of C. reinhardtii. One possible explanation for the variance between the
expression levels of the lacZ' and aadA reporters
is feedback regulation by their protein products, as has been
previously observed in other systems (27). Association of a
5'UTR and its protein product might block or promote the initiation of
translation, as has been observed in the regulation of E. coli ribosomal protein expression (38). This seems an
unlikely possibility since neither of the reporter proteins is known to
have nucleic acid binding activity. A more likely possibility is that
some structure or sequence within the coding region of the mRNA
participates in the formation of the active element in translation
initiation. This element might be located either within the coding
region itself, as has been demonstrated with chloramphenicol
acetyltransferase (28), or else involve interactions between
the 5'UTR and the coding sequence to yield a conformation required for
translation initiation. Our finding that these leader mutations have
similar effects on gene expression both in E. coli and the
chloroplast of C. reinhardtii suggests either that the
sequences affected are important recognition regions in translation
initiation in both organisms or that they present binding sites for
trans-acting factors required for initiation common to both.
The 12 individual nucleotide alterations found in the 266-nt rps7 5'UTR among 207 white colony mutants screened map at different sites within the first 167 nt upstream of the initiation codon, but the 7 which alter mRNA translation are restricted to the first 135 nt. Since these mutations were identified by sequencing only A and T residues in the first 225 nt of the 625-nt mutagenized fragment which is 70% A+T rich, we recognized that our screen might have missed changes in other important residues. However, when we sequenced the entire 625-nt fragment from 20 of the remaining 195 white colony mutants, we found no additional changes. This localization of mutants affecting translation to the first 135 nt of the 266-nt 5'UTR suggests that structures proximal to the initiation codon may be most crucial for translation initiation (Fig. 1). While the entire 625-nt fragment is transcribed in E. coli from the endogenous plasmid promoter, no mutations were isolated in the upstream 400-nt region that folds independently as determined by using the MFOLD algorithm, suggesting that this remaining upstream sequence may not function in translation.
Our analysis of changes in the predicted folding pattern generated by the 225-nt rps7 leader mutations reveals the following. (i) Each of the five mutations that prevent accumulation of the reporter mRNA in E. coli and C. reinhardtii chloroplasts either falls in or creates a predicted loop structure (Fig. 1). This might indicate sensitivity of this region of the mRNA in the mutants to RNase activity. (ii) The three mutations localized to the predicted second stem-loop affect the overall size of the first two stem-loop structures and reduce the level of aadA and lacZ' reporter expression. These nucleotide alterations can be suppressed by complementary mutations also in the second stem-loop that reconstitute the predicted wild-type folding pattern of the first two stem-loop structures (Fig. 3A), supporting the validity of the original predicted folding pattern. (iii) The free energy of each of the mutant rps7 5'UTR folding patterns is fairly similar, differing by less than 4%, arguing that gross thermodynamic changes do not account for the observed differences in translation of the reporter mRNAs.
Several recent studies provide insights into the possible mechanisms responsible for translational regulation of chloroplast gene expression (8, 17, 20, 35, 37). Since SD-like sequences in chloroplast mRNAs appear to be dispensable for translation initiation and other primary sequence motifs known to be involved in translation initiation in E. coli such as the downstream box are also absent, other structures within the long, AU-rich chloroplast leaders likely interact with trans-acting factors to facilitate association of the mRNA with the small subunit of the chloroplast ribosome. The highly ordered secondary structures predicted for the 5'UTRs from the majority of chloroplast mRNAs suggest that they may play a major role in controlling translation initiation.
Studies on a diverse set of chloroplast-encoded genes have identified higher-order RNA structure as an essential determinant in translational control. Multiple putative secondary structures have been detected by RNA mapping techniques in the relatively short (74-nt) 5'UTR from the chloroplast atpH mRNA of Euglena gracilis (1). Many of these structures mask the supposed ribosome binding site on the mRNA thought to be necessary for association with the ribosome. Deletion analysis has identified several small (3- to 8-nt) cis elements, distinct from SD sequences, in the chloroplast psbA mRNA of tobacco plants that associate specifically with trans-acting factors or with the ribosome to facilitate translation of a downstream reporter in an in vitro system (19). Two of these cis elements were proposed to bind cooperatively to the 16S rRNA and thereby position a third element for association of the message with specific trans factors. Deletion analysis has also identified a putative stem-loop structure in the 5'UTR of psbA mRNA in C. reinhardtii that is reported to modulate expression of the downstream D1 coding region in chloroplast transformants (25). However, since mutants lacking the loop sequence reduce accumulation of both the D1 protein and psbA mRNA, one cannot determine whether the region deleted is involved directly in translational regulation (29). In a similar study, two putative binding domains for a postulated initiation complex were identified in the 362-nt 5'UTR of petD mRNA from C. reinhardtii, 210 to 161 and 51 to 33 nt upstream of the initiation codon (32). These domains are thought to form a specific stem-loop structure and to facilitate the association of cis elements with trans factors or to associate directly with the ribosome. The ability of the 5'UTR to assume the correct higher-order structure appears to be crucial for initiation in each of these systems.
A detailed examination of the determinants of translation initiation in
the mRNA of the C. reinhardtii chloroplast-encoded psbC gene has been carried out. Chloroplast mutations in
C. reinhardtii that perturb translation of the
psbC mRNA have been shown to alter the inverted repeat
sequence coding for a predicted 97-nt stem-loop in the 5'UTR of this
gene (30). The nonphotosynthetic mutant FuD34 enhances the
base pairing and elevates the stability of this predicted stem
structure by insertion of two adjacent T residues and deletion of a C
residue 5 nt away. In contrast, the F34sul mutant, which suppresses a
nuclear mutant F34 that blocks translation of the psbC mRNA,
weakens the predicted stem by a T
A change. The behavior of these two
cis mutants suggests that decreasing the free energy of this
extended stem beyond that of the wild-type configuration reduces
translation whereas increasing its free energy may alleviate the need
for a nucleus-encoded trans-acting protein for translation
initiation. Deletion analysis of the extended stem-loop structure of
the psbC 5'UTR fused to an aadA reporter clearly
indicates that specific interactions between this stem-loop structure
and nucleus-encoded trans factors are critical for normal translation initiation of the downstream coding region (39, 40). Two models proposing that the secondary structure of the 5'UTR plays a major role in determining the level of protein expression from chloroplast-encoded genes both invoke trans factor
association with wild-type stem-loop structures in the 5'UTR as a
prerequisite for translation initiation on chloroplast ribosomes
(39).
The foregoing results with the psbC leader mutations are consistent with our observations regarding the functional significance of the predicted stems in the rps7 leader if one assumes that the stability of the wild-type rps7 5'UTR is optimal. We have examined this directly by altering the stability of the predicted second stem-loop by replacing two adjacent A-U pairs with G-C pairs, making the stem more stable, and also by replacing two adjacent G-C pairs with A-U pairs making the stem less stable. Both the increase and the decrease of the local free energy of the predicted stem generated by these changes decrease the translational activity by about one-third, suggesting that the wild-type second stem-loop structure is necessary for optimal translation.
The folding, or unfolding, of RNAs can be visualized as occurring in two phases. Base pairing occurs to produce complex secondary structures, including stems, loops, mismatches, and bulges. Computer algorithms can reasonably predict these structures, which can be tested by using site-directed mutagenesis (42). This is followed by formation of tertiary structure in which loop-loop or other long-range interactions occur. Such tertiary interactions might occur between the unpaired components of the secondary structure, but these interactions will not necessarily produce the most thermodynamically stable final RNA structure since disassociation or recombination of some secondary structure elements leading to a more stable tertiary structure may occur. Thus, the algorithms that predict secondary structure may fail to reveal the true configuration of the RNA even at the secondary structure level despite their clear energy-minimizing parameters (42).
Our analyses of UV melting-reannealing profiles of the rps7
5'UTRs reveal a loss of the wild-type folding in each of the second stem mutants. Restoration of the wild-type structure was found in the
double mutants with complementary second site alterations designed to
restore base pairing in the predicted second stem-loop. Hyperchromicity
is decreased in all three mutants, and in the
89A
U mutant, the
temperature at which the transition from tertiary to secondary
structure unfolding occurs is significantly diminished, indicating a
much less stable tertiary folding pattern (22, 36). Analyses
of rps7 5'UTRs with each of the nucleotides at position
36
indicate two distinct types of folding patterns, with the wild type and
the
36A
G mutant each more stable in tertiary structure than the
36A
U or the
36A
C mutant. The increased hyperchromicity of the
A-U
G-C mutant with the strengthened stem and the decreased
hyperchromicity and broader peak of the G-C
A-U mutant with the
weakened stem support the predicted increase and decrease of the local
free energy of the second stem-loop in the rps7 5'UTR. In
all of the cases described above, disruption of the normal
melting-reannealing profile in the mutants is consistent with the
predicted changes in the secondary structure of the mutant leaders and
with the decrease of their biological activities.
Data from the gel mobility shift RNase T1 protection assay conducted on
the wild-type, the
89A
U mutant, and the
89A
U
65U
A double
mutant suppressor are consistent with the changes in folding indicated
by the genetic and melting-reannealing profile analyses (Fig. 5). In
the absence of RNase T1, the wild-type, mutant, and double mutant
suppressor RNA samples show only a single up-shifted protein-protected
band. However, when RNase T1 is added, the wild-type and double mutant
suppressor display a single slightly lower up-shifted band protected by
the protein, whereas the
89A
U mutant RNA sample shows a second
up-shifted band that migrates much more rapidly through the native gel.
Differences in protein association with the folded mutant in the
wild-type or double mutant suppressor 5'UTR RNA could explain this
difference in T1 sensitivity. An alteration in the binding of a
specific protein or several proteins protecting the RNA might be
responsible, assuming that the rps7 5'UTR can exist in two
folding conformations. A change from 99% binding in one RNA
conformation and 1% binding in a second in wild-type or the double
mutant suppressor conformation (lower shift not visible in Fig. 5) to
50% binding in each conformation in the
89A
U mutant might occur.
Competition experiments between the wild-type and
89A
U mutant RNAs
for binding with the enriched nucleic acid binding proteins indicate
that the complex in the higher band is likely the same in both the wild
type and the mutant (Fig. 5). In contrast, the RNA in the lower band
seen in the mutant may be binding a different set of proteins or may
bind a subset of the same proteins in a different conformation with a
stronger affinity and hence may have less of its structure protected
from RNase digestion.
The restoration of a near-wild-type UV melting-reannealing profile in
each of the double mutant suppressors and restoration of the gel
mobility shift protection pattern in the
89A
U
65U
A double
mutant is consistent with the observed restoration of normal growth
rate and enzyme activity and strongly supports the biological relevance
of the predicted folding pattern for the first two stem-loop domains of
the rps7 leader.
Our generation of rps7 5'UTR mutants that display diminished spectinomycin-resistant growth when placed upstream of the aadA reporter will make possible a suppressor screen in both E. coli and in the chloroplast of C. reinhardtii to identify other relevant cis-acting sequences as well as genes encoding trans-acting proteins.
| |
ACKNOWLEDGMENTS |
|---|
We thank C. Hauser and M. Been for their assistance with both methodology and data interpretation.
This work was supported by NIH grant GM-19427.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Developmental Cell and Molecular Biology Group, Departments of Botany and Zoology, Box 91000, Duke University LSRC Bldg., Research Dr., Durham, NC 27708. Phone: (919) 613-8157. Fax: (919) 613-8177. E-mail: jboynton{at}acpub.duke.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Betts, L., and L. L. Spremulli.
1994.
Analysis of the role of Shine-Dalgarno sequence and mRNA secondary structure on the efficiency of translation initiation in the Euglena gracillis chloroplast atpH mRNA.
J. Biol. Chem.
269:26456-26463 |
| 2. |
Blattner, F. R.,
G. Plunket,
C. A. Bloh,
N. T. Perna,
M. R. Burland,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462 |
| 3. |
Bonham-Smith, P. C., and D. P. Bourque.
1989.
Translation of chloroplast-encoded mRNA: potential initiation and termination signals.
Nucleic Acids Res.
17:2057-2080 |
| 4. | Boynton, J. E., and N. W. Gillham. 1993. Chloroplast transformation in Chlamydomonas. Methods Enzymol. 217:510-536[Medline]. |
| 5. |
Boynton, J. E.,
N. W. Gillham,
E. H. Harris,
J. P. Hosler,
A. M. Johnson,
A. R. Jones,
B. L. Randolph-Anderson,
D. Robertson,
T. M. Klein,
K. B. Shark, and J. C. Sanford.
1988.
Chloroplast transformation in C. reinhardtii with high velocity microprojectiles.
Science
240:1534-1538 |
| 6. | Chomczynski, P., and H. Sacchi. 1987. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline]. |
| 7. | Danon, A. 1997. Translational regulation in the chloroplast. Plant Physiol. 115:1293-1298[Medline]. |
| 8. | Fargo, D. C., M. Zhang, N. W. Gillham, and J. E. Boynton. 1998. Shine-Dalgarno-like sequences are not required for translation of chloroplast mRNAs in Chlamydomonas reinhardtii chloroplast or in Escherichia coli. Mol. Gen. Genet. 257:271-282[Medline]. |
| 8a. | Fargo, D. C., et al. Unpublished data. |
| 9. | Förster, B., P. B. Heifetz, A. Lardans, J. E. Boynton, and N. W. Gillham. 1997. Herbicide resistance and growth of D1 Ala251 mutants in Chlamydomonas. Z. Naturforsch. 52c:654-664. |
| 10. | Gillham, N. W., J. E. Boynton, and C. R. Hauser. 1994. Translational regulation of gene expression in chloroplasts and mitochondria. Annu. Rev. Genet. 28:71-93[Medline]. |
| 11. | Gold, L. 1988. Posttranscriptional regulatory mechanisms in Escherichia coli. Annu. Rev. Biochem. 57:199-233[Medline]. |
| 12. |
Goldschmidt-Clermont, M.
1991.
Transgenic expression of amino-glycoside adenine transferase in the chloroplast: a selectable marker for site-directed transformation of Chlamydomonas.
Nucleic Acids Res.
19:4083-4090 |
| 13. | Goldschmidt-Clermont, M. 1998. Coordination of nuclear and chloroplast gene expression in plant cells. Int. Rev. Cytol. 177:115-180[Medline]. |
| 14. | Gray, M. W. 1992. The endosymbiont hypothesis revisited. Int. Rev. Cytol. 141:223-357. |
| 15. | Harris, E. H. 1989. The Chlamydomonas sourcebook. Academic Press, Inc., San Diego, Calif. |
| 16. |
Harris, E. H.,
J. E. Boynton, and N. W. Gillham.
1994.
Chloroplast ribosomes and protein synthesis.
Microbiol. Rev.
58:700-754 |
| 17. |
Hauser, C. R.,
N. W. Gillham, and J. E. Boynton.
1996.
Translational regulation of chloroplast genes: proteins binding to the 5' UTRs of chloroplast mRNAs in Chlamydomonas reinhardtii.
J. Biol. Chem.
271:1486-1497 |
| 18. | Hauser, C. R., N. W. Gillham, and J. E. Boynton. 1998. Regulation of chloroplast translation. In J.-D. Rochaix, M. Goldschmidt-Clermont, and S. Merchant (ed.), Molecular biology of Chlamydomonas: chloroplasts and mitochondria. Kluwer Academic Publishers, Dordrecht, The Netherlands. |
| 19. | Hirose, T., and M. Sugiura. 1996. cis-acting elements and trans-acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system for tobacco chloroplasts. EMBO J. 15:1687-1695[Medline]. |
| 20. | Kim, J., and J. E. Mullet. 1994. Ribosome binding sites on chloroplast rbcL and psbA mRNAs and the light-induced initiation of D1 translation. Plant Mol. Biol. 25:437-448[Medline]. |
| 21. |
Koo, J. S., and L. L. Spremulli.
1994.
Analysis of the translation initiation region of the Euglena gracilis chloroplast ribulose-bisphosphate carboxylase/oxygenase (rbcL) messenger RNA.
J. Biol. Chem.
269:7494-7500 |
| 22. | Laing, L. G., and D. E. Draper. 1994. Thermodynamics of RNA folding in a conserved ribosomal RNA domain. J. Mol. Biol. 237:560-576[Medline]. |
| 23. |
Lers, A.,
P. B. Heifetz,
J. E. Boynton,
N. W. Gillham, and C. B. Osmond.
1992.
The carboxyl-terminal extension of the D1 protein of photosystem II is not required for optimal photosynthetic performance under CO2 and light saturated growth conditions.
J. Biol. Chem.
267:17494-17497 |
| 24. | Leung, D. W., E. Chen, and D. U. Goedde. 1989. A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction. Technique 1:11-15. |
| 25. |
Mayfield, S. P.,
A. Cohen,
A. Danon, and C. B. Yohn.
1994.
Translation of the psbA mRNA of Chlamydomonas reinhardtii requires a structured RNA element contained within the 5' untranslated region.
J. Cell Biol.
127:1537-1545 |
| 26. | Mayfield, S. P., C. B. Yohn, A. Cohen, and A. Danon. 1995. Regulation of chloroplast gene expression. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:147-166. |
| 27. | McCarthy, J. E. G., and R. Brimacombe. 1994. Prokaryotic translation: the interactive pathway leading to initiation. Trends Genet. 10:402-407[Medline]. |
| 28. | Odjakova, M., A. Golshani, G. Ivanov, M. A. Haidar, and I. Ivanov. 1998. The low level expression of chloramphenicol acetyltransferase (CAT) mRNA in Escherichia coli is not dependent on either Shine-Dalgarno or the downstream boxes in the cat gene. Microbiol. Res. 153:173-178[Medline]. |
| 29. | Rochaix, J.-D. 1996. Post-transcriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Plant Mol. Biol. 32:327-341[Medline]. |
| 30. | Rochaix, J.-D., M. Kuchka, S. Mayfield, M. Schirmer-Rahie, J. Girard-Bascou, and P. Bennoun. 1989. Nuclear and chloroplast mutations affect the synthesis or stability of the chloroplast psbC gene product in Chlamydomonas reinhardtii. EMBO J. 8:1013-1021[Medline]. |
| 31. | Ruf, M., and K. Kössel. 1988. Occurrence and spacing of ribosome recognition sites in mRNAs of chloroplasts from higher plants. FEBS Lett. 240:41-44. |
| 32. | Sakamoto, W., X. Chen, K. L. Kindle, and D. B. Stern. 1994. Function of the Chlamydomonas reinhardtii petD 5' untranslated region in regulating the accumulation of subunit IV of the cytochrome b6f complex. Plant J. 6:503-512[Medline]. |
| 33. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 34. | Shapira, M., A. Lers, P. B. Heifetz, V. Irihimovitz, C. B. Osmond, N. W. Gillham, and J. E. Boynton. 1997. Differential regulation of chloroplast gene expression in Chlamydomonas reinhardtii during photoacclimation: light stress transiently suppresses synthesis of the Rubisco protein while enhancing synthesis of the PS II D1 protein. Plant Mol. Biol. 33:1001-1011[Medline]. |
| 35. | Stampacchia, O., J. Girard-Bascou, J.-L. Zanasco, P. Bennoun, and J.-D. Rochaix. 1997. A nuclear-encoded function essential for translation of the chloroplast psaB mRNA in Chlamydomonas. Plant Cell 9:773-782[Abstract]. |
| 36. | Tanner, M., and T. Cech. 1996. Activity and thermostability of the small self-splicing group I intron in the pre-tRNA(Ile) of the purple bacterium Azoarcus. RNA 1:74-83. |
| 37. | Yohn, C. B., A. Cohen, A. Danon, and S. P. Mayfield. 1996. Altered mRNA binding activity and decreased translational initiation of the chloroplast psbA mRNA. Mol. Cell Biol. 16:3560-3566[Abstract]. |
| 38. | Zengel, J. M., and L. Lindahl. 1994. Diverse mechanisms for regulation ribosomal protein synthesis in Escherichia coli. Prog. Nucleic Acids Res. 47:331-370[Medline]. |
| 39. | Zerges, W., J. Girard-Bascou, and J.-D. Rochaix. 1997. Translation of the chloroplast psbC mRNA is controlled by the interactions between its 5' leader and the nuclear loci TBC1 and TBC3 in Chlamydomonas reinhardtii. Mol. Cell Biol. 17:3440-3448[Abstract]. |
| 40. |
Zerges, W., and J.-D. Rochaix.
1994.
The 5' leader of a chloroplast mRNA mediates the translational requirements for two nucleus-encoded functions in Chlamydomonas reinhardtii.
Mol. Cell. Biol.
14:5268-5277 |
| 41. |
Zhou, Y. H.,
X. Zhang, and R. H. Ebright.
1991.
Random mutagenesis of gene-sized DNA molecules by use of PCR with Taq polymerase.
Nucleic Acids Res.
19:6052 |
| 42. | Zuker, M. 1994. Prediction of RNA secondary structure by energy minimization. Methods Mol. Biol. 25:267-294[Medline]. |
| 42a. | Zuker, M. University of Washington. 1995-1999, copyright date. [Online.] http://mfold1.wustl.edu/mfold/rna/form1.cgi. [17 August 1999, last date accessed]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»