Previous Article | Next Article 
Molecular and Cellular Biology, October 1999, p. 7264-7275, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Repression of Stat6-Dependent
Interleukin-4-Induced Genes by BCL-6: Specific Regulation of I
Transcription and Immunoglobulin E Switching
Miera B.
Harris,1
Chih-Chao
Chang,2
Michael T.
Berton,3
Nika N.
Danial,1
Jandong
Zhang,2
Denise
Kuehner,4
Bihui H.
Ye,2
Marina
Kvatyuk,4
Pier Paolo
Pandolfi,5
Giorgio
Cattoretti,2
Riccardo
Dalla-Favera,2 and
Paul
B.
Rothman4,*
Integrated Program in Cellular, Molecular and Biophysical
Sciences,1 Departments of Pathology and
Genetics & Development,2 and
Departments of Medicine and
Microbiology,4 Columbia University College of
Physicians and Surgeons, and Department of Human Genetics
and Molecular Biology Program, Memorial Sloan Kettering Cancer
Center,5 New York, New York, and
Department of Microbiology, University of Texas Health Science
Center at San Antonio, San Antonio,3 Texas
Received 28 December 1998/Returned for modification 19 February
1999/Accepted 20 July 1999
 |
ABSTRACT |
The BCL-6 proto-oncogene encodes a POZ/zinc-finger transcription
factor that is expressed in B cells and a subset of CD4+ T
cells within germinal centers. Recent evidence suggests that BCL-6 can
act as a sequence-specific repressor of transcription, but the target
genes for this activity have not yet been identified. The binding site
for BCL-6 shares striking homology to the sites that are the target
sequence for the interleukin-4 (IL-4)-induced Stat6 (signal transducers
and activators of transcription) signaling molecule. Electrophoretic
mobility shift assays demonstrate that BCL-6 can bind, with different
affinities, to several DNA elements recognized by Stat6. Expression of
BCL-6 can repress the IL-4-dependent induction of immunoglobulin (Ig)
germ line
transcripts, but does not repress the IL-4 induction of
CD23 transcripts. Consistent with the role of BCL-6 in modulating
transcription from the germ line
promoter, BCL-6
/
mice display an increased ability to class switch to IgE in response to
IL-4 in vitro. These animals also exhibit a multiorgan inflammatory disease characterized by the presence of a large number of
IgE+ B cells. The apparent dysregulation of IgE production
is abolished in BCL-6
/
Stat6
/
mice,
indicating that BCL-6 regulation of Ig class switching is dependent
upon Stat6 signaling. Thus, BCL-6 can modulate the transcription of
selective Stat6-dependent IL-4 responses, including IgE class switching
in B cells.
 |
INTRODUCTION |
Rearrangement of the BCL-6
proto-oncogene can be detected in 30 to 40% of diffuse large-cell
lymphomas (DLCLs) and in 6 to 14% of follicular lymphomas (FLs)
(5, 37, 42). In DLCLs and FLs, chromosomal rearrangements
affecting the BCL-6 gene are located within a region spanning
approximately 4 kb of the promoter and the first exon and result in the
juxtaposition of the BCL-6 coding domains downstream of heterologous
promoters derived from other chromosomes (53). These
alterations lead to the production of chimeric transcripts which encode
a wild-type BCL-6 protein, suggesting that the functional consequence
of these translocations is the deregulation of BCL-6 expression by
promoter substitution (53). The high frequency of
dysregulated BCL-6 expression in these tumors suggests that this
oncogene plays an important role in the transformation of human B cells.
The BCL-6 gene encodes a polypeptide containing six carboxy-terminal
zinc-finger motifs homologous to members of the Krüppel subfamily
of zinc-finger proteins (30, 38, 54). This domain of BCL-6
has been shown to recognize and bind to specific DNA sequences in vitro
(4, 9, 48). The N-terminal portion of BCL-6 contains a ZiN
(for zinc-finger N-terminal)/POZ (POX/zinc-finger) domain which is also
present in other zinc-finger proteins, including the mammalian
transcriptional regulators PLZF, ZF5, and ZID (3, 11, 12, 18, 40,
55). Transfection experiments have demonstrated that BCL-6 can
act as a transcriptional repressor, and its ability to mediate
repression requires the N-terminal POZ domain (9, 48). These
results suggest that BCL-6 modulates transcription not simply through
competitive binding, but through a mechanism of active repression.
Indeed, the POZ domains of both BCL-6 and PLZF have recently been shown
to associate with the SMRT corepressor, and, by extension, the histone
deacetylase repression complex (17, 23, 25, 35).
BCL-6 is normally expressed in a tissue-specific and developmentally
regulated manner. Although many tissues express low levels of BCL-6
mRNA, high levels of the BCL-6 protein have been found only in certain
B cells and T cells (6). Within the B-cell lineage, BCL-6 is
expressed at high levels in mature, germinal center B cells, but not in
other B cells or plasma cells (6, 19, 41). BCL-6 expression
in T cells is limited to cortical thymocytes and a population of
CD4+ cells within the germinal center and perifollicular
zones of the lymph nodes (6). The importance of BCL-6 in
normal lymphocyte function has recently been demonstrated in mice in
which the gene for BCL-6 has been disrupted by homologous recombination
(16, 20, 52). Although these mice contain normal numbers of
B and T cells, they fail to form germinal centers or mount
T-cell-dependent antibody responses. In addition, many of these mice
develop a systemic inflammatory disease characterized by the
infiltration of multiple organ systems by eosinophils and
immunoglobulin E (IgE)-bearing B cells; these features are indicative
of a Th2 polarized inflammatory response, which could potentially
result from the inappropriate influence of the Th2 cytokines
(interleukin-4 [IL-4], IL-5, and IL-13) on immune function. The
striking phenotype of the knockout animal therefore implicates BCL-6 in
the normal regulation of the immune system.
The evidence suggesting a disruption of cytokine regulation in the
BCL-6
/
mice prompted the comparison between the in
vitro defined binding site of BCL-6 (B6BS) and the binding sites of
STAT proteins, molecules which are important mediators of cytokine
signal transduction (reviewed in references 27, 34,
and 46). In fact, B6BS shows a marked similarity to
STAT recognition sequences, and one study has demonstrated the ability
of BCL-6 to bind to the Stat6 site of the IL-4-inducible CD23b promoter
(16). Furthermore, transient transfection studies have
suggested that BCL-6 may regulate the Stat6-dependent transcription of
the CD23b gene (16). However, the regulation of gene
expression by BCL-6 under physiological conditions has not yet been
tested, and other physiologic targets of BCL-6 repression are so far unknown.
In order to identify physiological targets for BCL-6, we have analyzed
its ability to bind and regulate Stat6-dependent promoters in vitro and
in vivo. Our results demonstrate that although BCL-6 can bind to the
Stat6 sites present in several IL-4-responsive promoters in vitro, it
can regulate only a subset of Stat6-dependent promoters in vivo; this
subset includes the germ line
promoter, but not the CD23b promoter.
The germ line
promoter regulates the production of the Ig sterile
transcripts necessary for the Ig isotype class switch to IgE (reviewed
in reference 13). Consistent with a role for BCL-6
in the regulation of class switching, IgE production is increased in B
cells lacking BCL-6 in vitro and in vivo. This dysregulation of IgE
production is not observed in B cells lacking Stat6 as well as BCL-6.
These results provide evidence for the physiologic regulatory activity
of BCL-6 on specific Stat6-dependent IL-4 signaling and identify the
regulation of IgE class switching as a target of this activity in vivo.
 |
MATERIALS AND METHODS |
Mice.
The BCL-6 knockout mice have been described previously
(52). Stat6 knockout mice were obtained from Michael Grusby
(29).
Plasmid construction.
The eukaryotic expression vector
pMT2T-BCL-6 and the reporter gene vector B6BS-LUC have been described
previously (9). The reporter (luciferase) vector containing
four copies of the I
Stat6 binding site (14) was linked
upstream to the minimal thymidine kinase (TK) promoter (Stat6-LUC). The
reporter plasmid containing tandem repeats of human immunodeficiency
virus (HIV)-
B binding motif linked upstream to the minimal murine
c-fos promoter was obtained from D. Baltimore
(10). The germ line
driven reporter was constructed by
insertion of I
162 to +57 into the MluI and
BglII sites of the pGL2-basic vector (Promega). Germ line
mutants were constructed by combining two PCR half-reactions with
overlapping sequences, as described in (24). For the 5' reaction, a common primer derived from
167 to
149 of the murine I
promoter (mI
-5', gggacgcgtCAGGTGTGTCTCCTAGAAA) was
used with each of the following primers: S2m1,
TCAACTCCTAGAAAGCAGAATCAAAAGGGAA; S2m4,
TCAACTTCTAGAGAACAGAATCAAAAGGGAA; and S2m6,
TCAACTTCCCGATCTCAGAATCAAAAGGGAA. For the 3' reaction,
a common primer derived from +42 to +55 of the murine I
promoter (mI
-3', tttagatctCCCCTGTGCAGGCT) was used with
each of the following primers: S2m1,
TTCTGCTTTCTAGGAGTTGACTAAGGCACAG; S2m4,
TTCTGTTCTCTAGAAGTTGACTAAGGCACAG; and S2m6,
TTCTGAGATCGGGAAGTTGACTAAGGCACAG. PCR half-reactions were
then combined, and a second PCR was performed by using the common
mI
-5' and mI
-3' primers. These primers were also used to generate
a wild-type promoter construct (WT) (mI
167 to +55). The products
of these reactions were then cloned into the MluI and
BglII sites of the pGL2-basic vector (Promega). All
sequences were verified by automated sequencing at the DNA sequencing
facility at Columbia University. The simian virus 40-chloramphenicol acetyltransferase (SV40-CAT) reporter plasmid driven by the CD23b promoter (
183 to
33) was obtained from D. Katz (43).
EMSA.
Preparation of total cellular extracts from the Mutu
I, Mutu III, and M12 lines was performed by an NP-40 lysis method as previously described (44). Electrophoretic mobility shift
assays (EMSAs) and antibody-mediated supershift assays were performed as described previously (9), except that the EMSA reaction buffer was 40 mM KCl, 1 mM MgCl2, 0.1 mM EGTA, 10 mM
ZnCl2, 20 mM HEPES (pH 7.9), and 4% Ficoll. For
competition assays, the indicated amount of cold competitor
oligonucleotide was added 15 min prior to addition of labeled probe.
The following probes were used in these experiments: I
Stat6,
5'agctAACTTCCCAAGAACA3'; CD23b Stat6,
5'GGTGAATTTCTAAGAAAGG3'; B6BS,
5'GAAAATTCCTAGAAAGCATA3'; S2m1,
5'gatcATTCTCTTTCTAGGAGTTGACTAAGGCACA3'; S2m4,
5'gatcATTCTGTTCTCTGGAAGTTGACTAAGGCACA3'; and S2m6,
5'gatcATTCTGAGATCGGGAAGTTGACTAAGGCACA3'.
DNase I footprinting.
Construction of the
glutathione-S-transferase (GST)-BCL-6ZF expression plasmid
has been previously described (39). For footprinting experiments, a germ line
promoter fragment (
162 to +57) was end
labeled on the noncoding strand and incubated (10,000 cpm) for 20 min
at room temperature with the indicated amounts of purified recombinant
proteins in 50 µl of binding buffer (40 mM KCl, 1 mM
MgCl2, 0.1 mM EGTA, 10 mM ZnCl2, 20 mM HEPES
[pH 7.9], 4% Ficoll). DNase footprinting was performed with the
Pharmacia Biotech SureTrack Footprinting system, as per the
manufacturer's protocol. The reaction products were ethanol
precipitated, dried, and resuspended in 6 µl of loading dye. One-half
of the sample (3 µl) was then loaded on a 6.3% wedge gel (0.4- to
1.2-mm gradient).
Cell lines, transient transfection, and reporter gene
assays.
The Mutu I and Mutu III cell lines were obtained from A. Rickinson (22) and maintained in Iscove's modified
Dulbecco's medium supplemented with 10% fetal calf serum, 100 U of
penicillin per ml, 100 U of streptomycin per ml, 2 mM
L-glutamine, and 10 mM HEPES. Mutu III cells
(107) were transfected by electroporation with 4 µg of
reporter constructs [B6BS-LUC, Stat6-LUC or
B(HIV)-LUC], 2 µg of
-galactosidase (
-gal) reporter plasmid, and the indicated amounts
of the pMT2T-based expression constructs of either the full length of
BCL-6 (BCL-6) or the zinc finger portion of BCL-6 (HAZF). The total DNA
used in each transfection was adjusted to 30 µg by addition of
control plasmids (pMT2T without cDNA insert). Cells were treated with 10 U of recombinant human IL-4 (Schering Plough) per ml or remained untreated immediately after transfection. After 24 h, the
luciferase and
-galactosidase activities of the transfected cells
were measured. Percent relative reporter gene activities were expressed
as arbitrary units of luciferase activities normalized with
-galactosidase activities. M12.4.1 cells were maintained in RPMI
supplemented with 10% fetal calf serum, 100 U of penicillin per ml,
100 U of streptomycin per ml, 2 mM L-glutamine, and 1 mM
-mercaptoethanol. Cells (5 × 106) were transfected
by electroporation as described previously (21). The
transfection cocktail contained 5 µg of either germ line
(
162
to +57) luciferase reporter, mutant germ line
reporter luciferase
reporter constructs (WT, S2m1, S2m4, or S2m6, as described above), or
CD23b (
183 to
33) SV40-CAT reporter construct, 1 µg of
-gal
reporter plasmid, and the indicated BCL-6 or HAZF expression
constructs. Vector DNA (pMT2T) was added as necessary to achieve a
constant amount of transfected DNA. Following transfection, cells were
incubated in the presence or absence of 10 U of murine recombinant IL-4
per ml for 24 h. After 24 h, the luciferase activity of cells
transfected with the germ line
reporter was measured, while the CAT
activity of those cells transfected with the CD23b reporter was
measured at 36 to 48 h. Transfection efficiency was normalized
relative to
-galactosidase activity.
LPS culture of IgM+ B cells and Ig ELISA.
Murine
splenocytes were harvested as described previously (45) and
enriched for IgM+ cells by using anti-IgM magnetic beads
(Miltenyi Biotec, Bergish-Gladback, Germany). After enrichment, the
cells were found to be about 90% IgM+ by
fluorescence-activated cell sorter. The cells were cultured for 6 days
with lipopolysaccharide (LPS) with or without cytokine (IL-4 or gamma
interferon [IFN-
]) as described previously (51). The
concentration of secreted Ig of various isotypes was determined by
enzyme-linked immunosorbent assay (ELISA). Anti-IgE antibodies were
obtained from Pharmingen (San Diego, Calif.) and all of the other
antibodies came from Southern Biotechnology Associates (Birmingham, Ala.). ELISA procedures were performed according to the manufacturer's recommendations.
Immunohistochemistry.
A goat anti-mouse IgE polyclonal
antibody (1:10,000; ICN Biomedicals, Aurora, Ohio) or a goat anti-mouse
IgG1 polyclonal antibody (1:3,000; Southern Biotechnology Associates)
was used to stain formalin-fixed, paraffin-embedded tissue sections
after unmasking (7). Dewaxed sections were boiled in 10 mM
EDTA (pH 7.5) for 15 min, cooled, blocked with 3% human AB serum
(Sigma), and incubated overnight with the appropriate primary
antibodies and control sera. The sections were then washed in washing
buffer (Tris-buffered saline, 50 mM Tris [pH 7.5], 0.001% Tween 20)
and counterstained with a 1:200 dilution of biotin-conjugated, mouse
and human serum-adsorbed, rabbit anti-goat antibody (Southern
Biotechnology Associates). Finally, horseradish peroxidase-conjugated
avidin (Dako, Carpinteria, Calif.) was added and developed, after
washing, with aminoethyl carbazole (Sigma). Slides were lightly
counterstained with hematoxylin.
 |
RESULTS |
BCL-6 binds with high affinity to the I
Stat6 site.
The
dysregulation of IgE production suggested by the increased number of
IgE-bearing B cells present in the inflammatory infiltrate of BCL-6
null mice (52), compounded with the strong homology noted
between the binding sites for STAT proteins and the in vitro defined
binding site for BCL-6, led us to investigate the involvement of BCL-6
in the regulation of Stat signaling pathways. Binding sites for the
Stat6 transcriptional activator are found in the regulatory regions of
a number of IL-4-responsive genes. These include an element in the gene
encoding IL-4 itself that has been reported to act as a silencer in Th1
cells (33), the germ line
promoter (I
) (14, 32,
47), and the promoter of the CD23b gene (31). One
study has suggested that CD23b may be regulated by BCL-6
(16). In order to investigate the possibility of BCL-6 regulation of these genes, we first examined the ability of BCL-6 to
bind Stat6 sites derived from these promoters in an EMSA. Extracts used
in this assay were prepared from two Epstein-Barr virus-infected lymphoma lines that had been cultured either alone or in the presence of IL-4 for 1 h prior to harvest: Mutu I, which expresses BCL-6; and Mutu III, a BCL-6-negative line derived from the same patient (22). The extracts were incubated with probes generated from the Stat6 elements of either the I
promoter, the CD23b promoter previously shown to bind BCL-6 (16), or the IL-4
silencer, and the products of the binding reaction were separated by
polyacrylamide gel electrophoresis.
EMSA analysis of extracts prepared from the BCL-6-positive Mutu I line
and incubated with probes derived from either the germ line
or
CD23b Stat6 sites reveals a single complex absent in EMSAs performed
with extracts from the BCL-6-negative Mutu III cells (Fig.
1A and B). This
constitutive complex is supershifted with an antiserum specific for
BCL-6, but not with an antiserum which recognizes Stat6, confirming
that this complex contains BCL-6. This band is also present in EMSAs
performed with the IL-4 silencer Stat6 site as a probe (data not
shown). Examination of extracts from IL-4-treated Mutu I cells by EMSA
reveals an additional complex that is also present in EMSAs performed
with extracts prepared from IL-4-treated Mutu III cells. Unlike the
faster-migrating complex, which is supershifted specifically with the
BCL-6 antiserum, this second complex is supershifted by the
Stat6-specific antiserum and is present in EMSAs performed with all
three Stat6 binding sites used as probes in these experiments. While
the activated Stat6 complex is present at lower levels in
EMSAs using extracts from Mutu III cells, it is unclear whether
this phenomenon is due to the difference in BCL-6 expression, the stage
of EBV infection, or another uncharacterized clonal variation between
the two lines. These experiments indicate that BCL-6 can bind to the
Stat6 sites present in the regulatory regions of many IL-4-responsive
genes, including the I
promoter, the CD23b promoter, and the
putative silencer of the IL-4 gene.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 1.
The germ line promoter is a high-affinity binding
site of BCL-6. Two EBV-transformed human B-cell lines which
differentially express BCL-6, Mutu I (BCL-6 positive) and Mutu III
(BCL-6 negative), were cultured in the presence or absence of human
recombinant IL-4 (10 U/ml) for 1 h prior to harvest. EMSAs were
performed with 5 µg of whole-cell extract and an oligonucleotide
probe corresponding to the germ line promoter Stat6 site (A) or the
CD23b Stat6 site (B). The DNA binding complexes were identified upon
supershift with antisera (Ab [antibody]) to the Stat6 ( Stat6) or
BCL-6 ( BCL-6) proteins. In panels C and D, the affinity of BCL-6 for
the Stat6 site at 115 to 99 of the germ line promoter relative
to other known binding sites of BCL-6 was assessed in cold competition
assays. Five micrograms of whole-cell extract prepared from the
BCL-6-positive M12.4.1 murine B-cell lymphoma line was incubated with a
labeled probe generated from the I Stat6 site ( 115 to 99) and
increasing concentrations (10, 30, 60, or 100 ng) of cold competitor
oligonucleotides. (C) The I Stat6 site (lanes 2 to 5) and B6BS, the
in vitro defined binding site for BCL-6 (lanes 7 to 10). (D) The I
Stat6 site (lanes 2 to 5), the Stat6 site of the CD23b promoter (lanes
7 to 10), and the Stat6 site of the putative IL-4 silencer (lanes 12 to
15).
|
|
In order to compare the relative affinity of BCL-6 for the I
, B6BS
(the in vitro defined binding site of BCL-6), CD23b, and IL-4 silencer
binding sites, we analyzed the ability of unlabeled oligonucleotides
derived from these various Stat6-BCL-6 sites to compete for BCL-6
binding with a labeled probe generated from the Stat6 site of the I
promoter. Extracts prepared from cells of the murine B-lymphoma line
M12.4.1 were incubated with labeled I
probe and increasing
concentrations of the appropriate cold competitor, and the reaction
products were analyzed by EMSA (Fig. 1C and D). The results demonstrate
that unlabeled I
and B6BS are able to effectively compete with
labeled probe for BCL-6 binding, even at the lowest concentrations used
in this assay (Fig. 1C, lanes 2 to 5 and 7 to 10). The Stat6 binding
sites from the CD23b promoter and IL-4 silencer, however, prove
considerably less effective competitors of BCL-6 binding. While they
compete for BCL-6 binding at the highest concentrations used in this
assay (Fig. 1D), the affinity of these sites for BCL-6 seems weak
relative to that of I
or B6BS. These data indicate that BCL-6 can
bind to some sites also recognized by Stat6, but that its affinity for
these sites is not equivalent. Furthermore, the previously defined
Stat6 element of the germ line
promoter appears to be a
high-affinity binding site for BCL-6.
In order to further characterize the relationship between the Stat6 and
BCL-6 recognition sites of the germ line

promoter,
we examined the
regions of I

these proteins protect from DNase
I cleavage in
footprinting studies. A purified GST fusion with
the zinc finger DNA
binding domain of BCL-6 and purified recombinant
Stat6 protect
overlapping regions of the germ line

promoter
(Fig.
2). The region protected by BCL-6 is
completely contained
within that protected by Stat6 and includes the
previously described
Stat6 site at

111 to

102 relative to the
transcriptional start
site (
14). As these experiments were
performed with only the
DNA binding domain of BCL-6, it is possible
that the full-length
protein may protect a larger region than is
indicated here. Nevertheless,
it is clear from these studies that BCL-6
and Stat6 share a common
binding site at the germ line

promoter.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
BCL-6 and Stat6 protect overlapping regions of the germ
line promoter. Binding of purified GST (400 ng) (lane 2),
recombinant Stat6 (100 ng) (lane 3), or a fusion protein of GST with
the DNA binding domain of BCL-6 (400 ng) (lane 4) to the murine
germ line promoter was compared by DNase I footprinting
analysis. A G+A sequencing reaction is shown in lane 1. The
positions of the protected regions relative to the
transcriptional start site (13) are indicated.
|
|
BCL-6 represses transcription from an I
-driven promoter.
Previous studies have demonstrated the ability of BCL-6 to act as a
site-specific transcriptional repressor in transient transfection assays (9, 48). In order to assess the functional
significance of BCL-6 binding to the germ line
promoter, we first
sought to determine the effect of BCL-6 expression on the IL-4-induced transcription of a reporter driven by the upstream Stat6 element of the
I
promoter (
115 to
99). A tetramer of this site was placed
upstream of the minimal TK promoter and a luciferase reporter; this
construct was cotransfected with increasing amounts of a BCL-6
expression vector into the BCL-6-negative Mutu III human B-cell line.
Transfected cells were cultured either alone or in the presence of IL-4
for 24 h, at which time they were harvested and assayed for
luciferase activity. As shown in Fig. 3A,
IL-4 treatment results in an approximately 20-fold increase in
luciferase activity from the I
-Stat6-LUC reporter. This
cytokine-induced activation of the luciferase reporter is blocked by
BCL-6 in a dose-dependent fashion, as increasing concentrations of
BCL-6 lead to a 75% decrease in the maximal IL-4-induced luciferase activity. BCL-6 similarly represses transcription from a luciferase reporter driven by the cytokine-independent in vitro defined binding site of BCL-6 (B6BS-LUC) (Fig. 3B). Cotransfection of BCL-6 with an
irrelevant reporter, such as the HIV-
B-driven luciferase construct shown in Fig. 3C, does not result in the reduction of reporter signal,
demonstrating the specificity of BCL-6 repression.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
BCL-6 represses IL-4-inducible transcriptional activity.
Mutu III cells (107) were transfected with TK-luciferase
reporter constructs driven by multimerized binding sites corresponding
to either the I Stat6 site (Stat6-LUC) (A and D), the in vitro
defined binding site of BCL-6 (B6BS-LUC) (B), or an HIV- B binding
site linked upstream of the minimal c-Fos promoter ( B-LUC) (C).
These cells were cotransfected with increasing amounts of plasmid
expressing either the full length BCL-6 (A to C) or the zinc finger DNA
binding domain of BCL-6, HAZF (D). Following electroporation, the cells
were either left untreated (B and C) or were divided and cultured
either alone or in the presence of IL-4 (10 U/ml) for 24 h (A and
D). Percent relative reporter gene activities are expressed as
arbitrary units of luciferase activities normalized with
-galactosidase activities. The results are given as means ± standard deviations from three separate experiments.
|
|
The BCL-6 POZ domain has been shown to interact with the SMRT
corepressor and is required for BCL-6 to effectively mediate
repression
(
9,
17,
48). Nevertheless, it remains possible
that
competition for any of the four I

-Stat6 sites of the I

-Stat6-LUC
reporter contributes to the ability of BCL-6 to repress Stat6-mediated
transcription in these transfection assays (although the affinity
of
BCL-6 for these sites is less than that of Stat6 [unpublished
observations]). This model would predict that a mutant BCL-6 protein
lacking the POZ repressor domain might retain some ability to
repress
IL-4-induced transcription

through direct competition
with Stat6 for a
common binding site

so long as its DNA binding
domain remains intact.
This truncated form of BCL-6 (HAZF) binds
B6BS and the I

Stat6 site
with the same affinity as the wild-type
molecule (reference
48 and data not shown). However, HAZF is
unable to
repress the IL-4 induction of the I

-Stat6 reporter
construct in
cotransfection experiments (Fig.
3D). These results
imply that the
binding of BCL-6 to Stat6 sites is not sufficient
to repress Stat6
activity and indicate that the BCL-6-mediated
repression of Stat6
function is active, requiring the POZ repressor
domain of BCL-6.
Although we had demonstrated the ability of BCL-6 to repress the
activity of a reporter driven by a multimerized I

-Stat6
site, we
wanted to determine if BCL-6 was effective in repressing
IL-4-induced
transcription in the context of a larger segment
of the germ line

promoter. The region of murine I

spanning
from

162 to +57, which
includes the binding sites for many of
the factors known to regulate
the activity of this promoter, was
used to drive the transcription of a
luciferase reporter. This
construct was cotransfected with increasing
amounts of a BCL-6
expression vector into cells of the M12.4.1 murine
B-lymphoma
line. Transfected cells were cultured either alone or in the
presence
of IL-4 for 24 h and then harvested and assayed for
luciferase
activity. As shown in Fig.
4A, the IL-4-induced
activity of this
reporter construct is repressed by BCL-6 in a
dose-dependent manner.
The truncated HAZF form of BCL-6, however, is
unable to repress
transcription in these assays; in fact,
cotransfection of HAZF
appears to result in an increased basal level of
transcription
of this reporter, perhaps due to binding competition with
the
endogenous BCL-6. Interestingly, in similar experiments performed
with a CAT reporter driven by the IL-4-responsive region of the
murine
CD23b promoter (

183 to

33) (
43), BCL-6 failed to mediate
the repression of IL-4-induced transcription (Fig.
4B). These
experiments demonstrate the ability of BCL-6 to modulate the I
transcriptional response to IL-4, not only when expression is
driven by
a multimerized Stat6 element derived this site, but
also when driven by
a large segment of the germ line

promoter
itself. In addition, the
regulation of transcription by BCL-6
appears to be limited to a subset
of IL-4-inducible promoter regions.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Differential regulation of I and CD23b by BCL-6.
M12.4.1 cells (5 × 106) were cotransfected with a
luciferase reporter driven by either 162 to +57 of the murine germ
line promoter (A) or 183 to 33 of the murine CD23b
promoter (B) and increasing concentrations of the indicated
expression construct. Following electroporation, the cells were divided
and cultured either alone or in the presence of IL-4 (10 U/ml) for 24 to 48 h. The results are given as means ± standard
deviations from two (I ) or three (CD23b) separate experiments and
are normalized with -galactosidase activities. Fold induction is
given relative to unstimulated cells.
|
|
Repression of germ line
transcription is dependent upon BCL-6
binding at I
111 to
102.
The experiments described above
have demonstrated the ability of BCL-6 to bind to the Stat6 site at
111 to
102 of the murine I
promoter and the ability of BCL-6 to
repress transcription from this promoter in transient transfection
assays. However, it remained possible that the repression mediated by
BCL-6 occurs through a mechanism other than the direct binding of BCL-6
to this shared site. In order to formally discount this possibility, we
created a series of mutants in which the binding of either BCL-6,
Stat6, or both proteins to the BCL-6-Stat6 site is disrupted (Fig.
5A). These mutations were generated
within the context of the IL-4-responsive region of the murine germ
line
promoter (
167 to +55) and specifically ablate the
association of the targeted protein with its binding site.




View larger version (107K):
[in this window]
[in a new window]
|
FIG. 5.
Repression of germ line transcription is dependent
on an intact BCL-6 binding site. (A) Schematic diagram of mutations
used in this study. These mutations were generated within the context
of the germ line promoter ( 167 to +55). (B) M12.4.1 cells were
cultured in the presence of recombinant murine IL-4 for 1 h prior
to harvest. EMSAs were performed with 5 µg of whole-cell extract and
oligonucleotide probes corresponding to the germ line promoter
BCL-6-Stat6 site mutants described in panel A: WT (lane 1), S2m1 (lane
2), S2m4 (lane 3), and S2m6 (lane 4). In panel C, the affinity of BCL-6
for the wild-type BCL-6-Stat6 site relative to the mutant BCL-6-Stat6
binding sites was assessed in cold competition assays. Five micrograms
of whole-cell extract prepared in panel B was incubated with a labeled
probe generated from the wild-type BCL-6-Stat6 site and increasing
concentrations (3, 10, 30, or 100 ng) of cold competitor
oligonucleotides: the wild-type BCL-6-Stat6 site (lanes 2 to 5), S2m1
(lanes 7 to 10), S2m4 (lanes 12 to 15), and S2m6 (lanes 17 to 20). In
panel D, 5 × 106 M12.4.1 cells were cotransfected
with a luciferase reporter driven by the indicated variations on the
germ line promoter (WT, S2m1, S2m4 or S2m6) and either control
plasmid or 2.5 µg of BCL-6 expression vector. Following
electroporation, the cells were divided and cultured either alone or in
the presence of IL-4 (10 U/ml) for 24 to 48 h. The results are
given as means ± standard deviations from three separate
experiments and are normalized with -galactosidase activities. Fold
induction is given relative to unstimulated cells.
|
|
EMSA analysis using oligonucleotides derived from the various binding
site mutants as probes exhibited the predicted patterns
of BCL-6 and
Stat6 protein binding (Fig.
5B). S2mut1 fails to
bind activated Stat6
present in extracts from IL-4-stimulated
M12 cells, but retains the
ability to bind BCL-6 present in these
extracts. Conversely, S2mut4
cannot bind BCL-6 present in M12
cell extracts, yet retains its ability
to bind Stat6 present in
extracts from IL-4-stimulated M12 cells.
S2mut6 is unable to bind
either protein (Fig.
5B). We next analyzed the
ability of unlabeled
mutant Stat6-BCL-6 promoters to compete for
factor binding with
the wild-type I

promoter (Fig.
5C). These
results demonstrate
that the affinities of proteins not targeted by the
specific mutations
are little changed. In addition, the binding of the
transcription
factor C/EBP

to its adjacent site at

120 to

113 is
undisturbed
(data not
shown).
In order to assess the dependence of BCL-6-mediated repression on the
presence of an intact BCL-6 binding site at I

111
to

102, the
promoter mutants described above were used to drive
a luciferase
reporter in transient transfection assays. These
constructs were
cotransfected with either a control plasmid or
with a BCL-6 expression
vector into cells of the M12.4.1 murine
B-lymphoma line. Transfected
cells were cultured either alone
or in the presence of IL-4 for 24 h and then harvested and assayed
for luciferase activity. As expected,
germ line

promoter constructs
with mutations in their Stat6 binding
sites (S2mut1 and S2mut6)
are unresponsive to stimulation by IL-4 (Fig.
5D). These promoters
are little affected by cotransfection with BCL-6.
On the other
hand, promoter constructs with intact Stat6 binding sites
demonstrate
equivalent induction of transcription in response to IL-4,
regardless
of BCL-6 binding activity (WT and S2mut4). Significantly,
while
IL-4 induction of wild-type promoter activity is repressed by
cotransfection of BCL-6 in these experiments, BCL-6 is unable
to
mediate the repression of IL-4-induced transcription from the
promoter
carrying the mutant BCL-6 binding site (S2mut4). These
results
demonstrate the requirement of an intact BCL-6 binding
site at I

111 to

102 for the proper function of the
repressor.
Class switching to IgE is increased in B cells from
BCL-6
/
mice.
Examination of mice with a targeted
disruption of BCL-6 has revealed several interesting phenotypes,
including a lack of germinal centers and a novel Th2-type inflammatory
disease characterized by the infiltration of multiple organ systems by
eosinophils and IgE+ B cells (16, 52). The
presence of these IgE+ B cells within the inflammatory
infiltrate observed in BCL-6-deficient mice suggests that there is some
dysregulation of IgE production in mice that lack BCL-6. The data
presented above demonstrate that the expression of BCL-6 in B
lymphocytes can inhibit the induction of germ line
transcription in
response to IL-4. Because the IL-4-dependent production of germ line
transcripts is a requisite step in the process of Ig class
switching to IgE, it is possible that BCL-6 normally performs a role in
regulating this process by inhibiting the induction of germ line
transcription by IL-4.
In order to determine whether the effect of BCL-6 on germ line

transcription has physiologic significance in vivo, we examined
Ig
class switching in B cells that lack expression of BCL-6.
IgM
+ B cells were isolated from the spleens of
BCL-6
/
mice and wild-type littermate controls and then
cultured with
the mitogen LPS for 6 days, either alone or in the
presence of
IL-4 or IFN-

. The ability of these cells to class switch
to different
Ig isotypes was measured by ELISA analysis of the
supernatants
of these cultures. As shown in Fig.
6, the production of IgM and
IgG2a by B
cells isolated from wild-type or BCL-6-deficient mice
is not
significantly different in this in vitro culture system.
In contrast,
the ability of cells derived from the BCL-6
/
mice to
produce IgE and IgG1 (another IL-4-dependent Ig isotype)
in response to
IL-4 is markedly enhanced when compared with that
of cells isolated
from wild-type controls, supporting an in vivo
role for BCL-6 in the
regulation of class switching.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
B cells from BCL-6 / mice produce higher
levels of IgE in response to IL-4. IgM+ B cells from the
spleens of 11 BCL-6 / mice or 10 wild-type littermates
were cultured in the presence of LPS and cytokine (either 5,000 U of
IL-4 per ml or 60 U of IFN- per ml) for 6 days. Supernatants from
these cultures were assayed for secreted Ig isotypes by ELISA. Each
diamond represents the levels from 1 mouse. The mean concentrations are
noted by lines.
|
|
BCL-6
/
Stat6
/
mice do not show
increased class switching to IgE.
Although we had shown that B
cells derived from BCL-6
/
mice demonstrate a marked
enhancement in IgE production, it remained conceivable that the
dysregulation of IgE responses observed in these animals was due to a
disruption in the regulation of pathways other than those activated
through Stat6 signaling. In order to formally prove that BCL-6
deregulation of I
transcription acts on a Stat6-dependent pathway,
we generated mice doubly deficient in BCL-6 and Stat6. Like the
BCL-6
/
animals, the BCL-6
/
Stat6
/
mice, although born according to Mendelian
frequencies, are runted, lack germinal centers, and exhibit a
multiorgan inflammatory disease (8a). However, the
inflammatory infiltrate present in the BCL-6
/
Stat6
/
mice does not contain the IgE+ B
cells which characterize the disease of the BCL-6
/
parental strain (Fig.
7A). Analysis of these
animals confirms that the increased level of IgE and IgG1 production
observed in mice deficient in BCL-6 is dependent on Stat6 signaling
pathways, as LPS-IL-4 cultures of IgM+ B cells isolated
from BCL-6
/
Stat6
/
mice are greatly
deficient in class switching to either IgE or IgG1 (Fig. 7B). These
data provide a genetic demonstration of the modulation of Stat6
function by BCL-6 and therefore further support an in vivo role for
BCL-6 in the regulation of the IgE immune response.


View larger version (135K):
[in this window]
[in a new window]
|
FIG. 7.
BCL-6 / Stat6 / mice do
not produce increased levels of IgE. (A) Submandibular lymph node (top)
and spleen (bottom) sections from BCL-6 /
Stat6+/+ (left panels) or BCL-6 /
Stat6 / mice (right panels) were stained with anti-IgE
or anti-IgG1 mouse antibodies, as indicated. The original
magnifications were ×125 (top) and ×80 (bottom). (B) IgM+
B cells were isolated from the spleens of BCL-6 / mice,
Stat6 / mice, BCL-6 /
Stat6 / mice, or wild-type littermate controls. LPS
cultures and ELISAs were performed as in Fig. 6. Each diamond
represents the levels from one mouse. The mean concentrations are noted
by lines.
|
|
 |
DISCUSSION |
This study was aimed at identifying the physiologically relevant
transcriptional events regulated by the BCL-6 proto-oncogene. The main
findings of the study are that BCL-6 is likely to modulate the
transcription of some, but not all, Stat6-dependent genes. In
particular, our results identify the I
promoter as a physiologic target of BCL-6 transcriptional regulation. These results have implications for the function of BCL-6, the mechanism regulating IgE
switching, and the role of BCL-6 in lymphomagenesis.
Selective modulation of Stat6-dependent transcription by
BCL-6.
Previous studies have demonstrated the recognition of Stat6
binding elements by BCL-6 and suggested that BCL-6 may broadly modulate
Stat6-mediated IL-4 signaling (16). However, we show here
that despite the fact that BCL-6 can bind various Stat6 binding sites
in vitro and regulate the corresponding promoters under highly
experimental conditions, its physiologic role in regulating Stat6-mediated transcription may be more specific. This conclusion is
supported by the following observations: (i) BCL-6 can bind various
Stat6 sites with different affinity in vitro (I
> IL-4 > CD23b), (ii) BCL-6 can regulate the transcription of only a subset of
IL-4-inducible genes in transiently transfected cells (I
, but not
CD23b), and (iii) the lack of BCL-6 deregulates IgE class switching in
vivo. Thus, our results do not support a broad role for BCL-6 in the
regulation of Stat6-dependent IL-4 signaling and, in particular,
indicate that CD23b may not be a target of BCL-6 in vivo. The
discrepancy between our data and results previously obtained with the
CD23b promoter may be explained by the observation that the high levels
of BCL-6 typically introduced through transient transfection were in
this instance used to examine the effect of BCL-6 on a similarly
overexpressed reporter; in previous studies, however, transient
transfection assays were used to examine the effect of BCL-6 on the
activation of the endogenous CD23b gene (16). However, we
cannot entirely discount the possibility that CD23b transcription is
regulated, at some level, by BCL-6, for although increasing
concentrations of BCL-6 had no effect on the levels of IL-4-induced
transcription in our system, a slight repression of basal transcription
of the CD23b reporter was observed at the highest dosage of BCL-6 (5 µg) used in our cotransfection assays. This is reflected in the
modest increase in fold induction seen when higher levels of BCL-6 are
cotransfected with the CD23b reporter (Fig. 4B). It should be noted,
however, that in similar studies using the germ line
reporter,
cotransfection of even low levels of BCL-6 (1 µg) resulted in a
significant repression of basal, as well as IL-4-inducible, transcription.
The mechanism for the selective activity of BCL-6 is not known. It is
possible that BCL-6 plays a role in determining the
activation
thresholds of various IL-4-responsive genes, repressing
basal
transcription from promoters which bind BCL-6 over a wide
range
of affinities, yet repressing activated transcription only
from sites
to which it binds avidly. Alternatively, the ability
of BCL-6 to
repress transcription may be more dependent on promoter
context or
topology. For instance, the presence of certain promoter-specific
transcription factors or additional Stat6 binding sites may allow
BCL-6-mediated repression of germ line

transcription to the
exclusion of CD23b. In this regard, recent studies involving the
exchange of high- and low-affinity binding sites of the B-cell-specific
activator protein (BSAP) have demonstrated that the context of
a
particular binding site can be more important than its relative
affinity for BSAP in determining the activity of promoters regulated
by
this transcription factor (
49).
Modulation of I
transcription and IgE switching by BCL-6.
Our results clearly identify I
transcription as a physiologic target
of BCL-6. The induction of germ line
transcription in germinal
center B lymphocytes is one important mechanism by which IL-4 regulates
the production of IgE (13). Mice which are deficient in
Stat6 do not secrete IgE in response to IL-4 stimulation, presumably
due to their inability to produce these transcripts (36). By
extension, the enhanced production of IgE by B cells which lack BCL-6
may be attributed to the absence of BCL-6 repressive activity at the
I
promoter. In support of this argument, we have demonstrated the
high-affinity binding of BCL-6 to the I
Stat6 site, the ability of
BCL-6 to mediate the repression of germ line
transcription in
transient transfection assays, and the dependence of repression on an
intact BCL-6 site within the germ line
promoter. We have further
shown that the hyper-IgE response observed in the BCL-6 knockout mice
is absent in animals doubly deficient in BCL-6 and Stat6, illustrating
the dependence of the BCL-6
/
phenotype on Stat6 with
respect to IgE production. These experiments represent the first
evidence that BCL-6 can in fact regulate Stat6-inducible gene
expression in vivo. Previous studies have failed to demonstrate any
reciprocal regulation of gene activity by BCL-6 and Stat6, as
illustrated by the perseverance of BCL-6
/
phenotypes,
such as hyperinflammation and Th2 shift, in mice deficient in Stat6 as
well as BCL-6 (15). However, despite convincing evidence
implicating BCL-6 in the regulation of germ line
transcription, significant differences in the levels of the IL-4-induced I
transcript were not detected between the B cells of
BCL-6
/
mice and wild-type controls (data not shown).
This result may be explained by our finding that only about 5% of
splenic B cells, i.e., germinal center B cells, express detectable
levels of the BCL-6 protein (6); it is unlikely that changes
in the production of germ line
transcript would be detected in this
small fraction of the B-cell population. In addition, it is possible
that BCL-6 has a direct effect on the ability of these cells to secrete
IgE. Recent data suggest that induction of IgE by IL-4 occurs both through increased class switching to IgE and through the increased secretion of IgE by cells which have switched to production of this
isotype (48a).
Two Stat6 binding elements have been identified within the
IL-4-responsive region of the germ line

promoter; mutations made
at
either site can result in an increase in I

basal transcription,
suggesting a disruption in the recruitment of a repressor to these
sites (
1,
14,
26,
50). The data presented in this study
demonstrate that BCL-6 can, in fact, bind to the Stat6 element
at

111
to

102 of the germ line

promoter and repress transcription
from
this promoter. There are several cases in which transcriptional
activators and repressors have been described to recognize common
DNA
elements; in many of these instances, the mechanism of repression
is
passive, involving simple competition for the shared binding
motif
(reviewed in reference
28). However, results from
our
transfection studies using a truncated form of BCL-6 suggest that
the repression of Stat6 activity mediated by BCL-6 requires the
intact
BCL-6 POZ repression domain. Because the truncated form
of BCL-6 binds
DNA avidly (
48), these data imply that the repression
of
Stat6 function occurs through active repression and not only
competitive binding. These results correlate with data which have
demonstrated the interaction of the SMRT corepressor complex with
the
POZ domain of BCL-6 (
17). Given these data, it is likely
that the regulation of germ line

transcription by BCL-6 is directed
through its site-specific binding to either of the two Stat6 elements
of the I

promoter and is mediated through the recruitment of
corepressors to the
promoter.
The role of BCL-6 in the regulation of germinal center events, such as
Ig class switching, is indicated by its restricted
expression within
the lymphocyte population to germinal center
B cells and T cells. In
fact, BCL-6 is required for the formation
of germinal centers (
16,
20,
52), suggesting a model of
BCL-6 function in which the
repressor complexes containing BCL-6
are already in place when the B
cell enters the cytokine-rich
culture of the germinal center. In this
environment, the protection
provided by BCL-6 against differentiative
signals is alleviated
only with the convergence of multiple stimuli
which cooperate
to relieve the BCL-6-mediated repression. Such stimuli
may include
signaling through the antigen receptor and CD40, which have
been
shown to regulate levels of BCL-6 protein and mRNA, respectively
(
2,
8,
39), and the IL-4-induced activation of Stat6,
which
can compete directly for BCL-6 binding and may efficiently
displace it
from the promoter. In this manner, BCL-6 can modulate
transcription
from its targets, repressing the activity of promoters
such as I

until an activation threshold is achieved and the balance
of regulatory
forces shifts in favor of transcriptional
activation.
Implications for the role of BCL-6 in lymphomagenesis.
Deregulated BCL-6 expression caused by chromosomal translocation is
observed in 30 to 40% of DLCLs and in 5 to 10% of FLs. Both DLCLs and
FLs derive from GC B cells and can be considered aberrations of GC
development. Since cytokines play a key role in the proliferation and
differentiation of B cells within the germinal center, the effect of
BCL-6 in modulating specific cytokine signaling suggests that the
inappropriate expression of BCL-6 might prevent certain
cytokine-induced events required for the normal differentiation of
germinal center cells and thereby contribute to the transformation process.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant P01AI39675 to P.B.R.,
P.P.P., and R.D.-F. B.H.Y. is a fellow of the Leukemia
Society of America, and G.C. is a special fellow of the Leukemia
Society of America. P.P.P. and P.B.R. are scholars of the Leukemia
Society of America.
We thank Satwant Narula from Schering Plough for the recombinant human
IL-4 and Robert Coffman of the DNAX Research Institute for murine IL-4.
We thank Michael Grusby for the Stat6
/
mice.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine/Microbiology, Columbia University, 630 W. 168th St., New York, NY 10032-3702. Phone: (212) 305-6982. Fax: (212) 305-1870. E-mail: pbr3{at}columbia.edu.
 |
REFERENCES |
| 1.
|
Albrecht, B.,
S. Peiritsch, and M. Woisetschlager.
1994.
A bifunctional control element in the human IgE germ line promoter involved in repression and IL-4 activation.
Int. Immunol.
6:1143-1151[Abstract/Free Full Text].
|
| 2.
|
Allman, D.,
A. Jain,
A. Dent,
R. Maile,
T. Selvaggi,
M. Kehry, and L. Staudt.
1996.
BCL-6 expression during B-cell activation.
Blood
87:5257-5268[Abstract/Free Full Text].
|
| 3.
|
Bardwell, V., and R. Treisman.
1994.
The POZ domain: a conserved protein-protein interaction motif.
Genes Dev.
8:1664-1677[Abstract/Free Full Text].
|
| 4.
|
Baron, B.,
G. Nucifora,
N. McCabe,
R. de Espinosa,
M. Le Beau, and T. McKeithan.
1993.
Identification of the gene associated with the recurring chromosomal translocations t(3;14)(q27;q32) and t(3;22)(q27;q11) in B-cell lymphomas.
Proc. Natl. Acad. Sci. USA
90:5262-5266[Abstract/Free Full Text].
|
| 5.
|
Bastard, C.,
C. Deweindt,
J. Kerckaert,
B. Lenormand,
A. Rossi,
F. Pezzella,
C. Fruchart,
C. Duval,
M. Monconduit, and H. Tilly.
1994.
LAZ3 rearrangements in non-Hodgkin's lymphoma: correlation with histology, immunophenotype, karyotype, and clinical outcome in 217 patients.
Blood
83:2423-2427[Abstract/Free Full Text].
|
| 6.
|
Cattoretti, G.,
C. Chang,
K. Cechova,
J. Zhang,
B. Ye,
B. Falini,
D. Louie,
K. Offit,
R. Chaganti, and R. Dalla-Favera.
1995.
BCL-6 protein is expressed in germinal-center B cells.
Blood
86:45-53[Abstract/Free Full Text].
|
| 7.
|
Cattoretti, G.,
S. Pileri,
C. Parravicini,
M. Becker,
S. Poggi,
C. Bifulco,
G. Key,
L. D'Amato,
E. Sabattini,
E. Feudale,
F. Reynolds,
J. Gerdes, and F. Rilke.
1993.
Antigen unmasking on formalin-fixed, paraffin embedded tissue sections.
J. Pathol.
171:83-98[Medline].
|
| 8.
|
Cattoretti, G.,
J. Zhang,
A. Cleary,
S. Lederman,
G. Gaidano,
A. Carbone,
R. Chaganti, and R. Dalla-Favera.
1997.
Downregulation of BCL-6 gene expression by CD40 and EBV latent membrane protein-1 (LMP1) and its block in lymphoma carrying BCL-6 rearrangements.
Blood
90(Suppl. I):175a.
|
| 8a.
| Cattoretti, G., et al. Unpublished data.
|
| 9.
|
Chang, C.,
B. Ye,
R. Chaganti, and R. Dalla-Favera.
1996.
BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor.
Proc. Natl. Acad. Sci. USA
93:6947-6952[Abstract/Free Full Text].
|
| 10.
|
Chang, C.-C.,
J. Zhang,
L. Lombardi,
A. Neri, and R. Dalla-Favera.
1995.
Rearranged NFKB-2 genes in lymphoid neoplasms code for constitutively active nuclear transactivators.
Mol. Cell. Biol.
15:5180-5187[Abstract].
|
| 11.
|
Chardin, P.,
G. Courtois,
M. Mattei, and S. Gisselbrecht.
1991.
The KUP gene, located on human chromosome 14, encodes a protein with two distant zinc fingers.
Nucleic Acids Res.
19:1431-1436[Abstract/Free Full Text].
|
| 12.
|
Chen, Z.,
N. Brand,
A. Chen,
S. Chen,
J. Tong,
Z. Wang,
S. Waxman, and A. Zelent.
1993.
Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia.
EMBO J.
12:1161-1167[Medline].
|
| 13.
|
Coffman, R. L.,
D. A. Lebman, and P. Rothman.
1993.
The mechanism and regulation of immunoglobulin isotype switching.
Adv. Immunol.
54:229-270[Medline].
|
| 14.
|
Delphin, S., and J. Stavnezer.
1995.
Characterization of an interleukin 4 (IL-4) responsive region in the immunoglobulin heavy chain germ line e promoter: regulation by NF-IL4, a C/EBP family member and NF-kB/p50.
J. Exp. Med.
181:181-192[Abstract/Free Full Text].
|
| 15.
|
Dent, A.,
J. Hu-Li,
W. Paul, and L. Staudt.
1998.
T helper type 2 inflammatory disease in the absence of interleukin 4 and transcription factor STAT6.
Proc. Natl. Acad. Sci. USA
95:13823-13828[Abstract/Free Full Text].
|
| 16.
|
Dent, A.,
A. Shaffer,
X. Yu,
D. Allman, and L. Staudt.
1997.
Control of inflammation, cytokine expression, and germinal center formation by BCL-6.
Science
276:589-592[Abstract/Free Full Text].
|
| 17.
|
Dhordain, P.,
O. Albagli,
R. Lin,
S. Ansieau,
S. Quief,
A. Leutz,
J. Kerckaert,
R. Evans, and D. Leprince.
1997.
Corepressor SMRT binds the BTB/POZ repressing domain of the LAZ3/BCL6 oncoprotein.
Proc. Natl. Acad. Sci. USA
94:10762-10767[Abstract/Free Full Text].
|
| 18.
|
DiBello, P.,
D. Withers,
C. Bayer,
J. Fristrom, and G. Guild.
1991.
The Drosophila Broad-Complex encodes a family of related proteins containing zinc fingers.
Genetics
129:385-397[Abstract].
|
| 19.
|
Flenghi, L.,
B. Ye,
M. Fizzotti,
B. Bigerna,
G. Cattoretti,
S. Venturi,
R. Pacini,
S. Pileri,
F. Lo Coco,
E. Pescarmona, et al.
1995.
A specific monoclonal antibody (PG-B6) detects expression of the BCL-6 protein in germinal center B cells.
Am. J. Pathol.
147:405-411[Abstract].
|
| 20.
|
Fukuda, T.,
T. Yoshida,
S. Okada,
M. Hatano,
T. Miki,
K. Ishibashi,
S. Okabe,
H. Koseki,
S. Hirosawa,
M. Taniguchi,
N. Miyasaka, and T. Tokuhisa.
1997.
Disruption of the Bcl6 gene results in an impaired germinal center formation.
J. Exp. Med.
186:439-448[Abstract/Free Full Text].
|
| 21.
|
Gauss, G., and M. Lieber.
1992.
DEAE-dextran enhances electroporation of mammalian cells.
Nucleic Acids Res.
20:6739-6740[Free Full Text].
|
| 22.
|
Gregory, C.,
M. Rowe, and A. Rickinson.
1990.
Different Epstein-Barr virus-B cell interactions in phenotypically distinct clones of a Burkitt's lymphoma cell line.
J. Gen. Virol.
71:1481-1495[Abstract/Free Full Text].
|
| 23.
|
Grignani, F.,
S. De Matteis,
C. Nervi,
L. Tomassoni,
V. Gelmetti,
M. Cioce,
M. Fanelli,
M. Ruthardt,
F. Ferrara,
I. Zamir,
C. Seiser,
F. Grignani,
M. Lazar,
S. Minucci, and P. Pelicci.
1998.
Fusion proteins of the retinoic acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia.
Nature
391:815-818[Medline].
|
| 24.
|
Higuchi, R.
1990.
Recombinant PCR, p. 177-183.
In
M. Innis, D. Gelfand, J. Sninsky, and T. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
|
| 25.
|
Hong, S.,
G. David,
C. Wong,
A. Dejean, and M. Privalsky.
1997.
SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha (RARalpha) and PLZF-RARalpha oncoproteins associated with acute promyelocytic leukemia.
Proc. Natl. Acad. Sci. USA
94:9028-9033[Abstract/Free Full Text].
|
| 26.
|
Ichiki, T.,
W. Takahashi, and T. Watanabe.
1993.
Regulation of the expression of human C epsilon germ line transcript. Identification of a novel IL-4 responsive element.
J. Immunol.
150:5408-5417[Abstract].
|
| 27.
|
Ihle, J.,
B. Witthuhn,
F. Quelle,
K. Yamamoto, and O. Silvennoinen.
1995.
Signaling through the hematopoietic cytokine receptors.
Annu. Rev. Immunol.
13:369-398[Medline].
|
| 28.
|
Johnson, A.
1995.
The price of repression.
Cell
81:655-658[Medline].
|
| 29.
|
Kaplan, M.,
U. Schindler,
S. Smiley, and M. Grusby.
1996.
Stat6 is required for mediating responses to IL-4 and for development of Th2 cells.
Immunity
4:313-319[Medline].
|
| 30.
|
Kerckaert, J.,
C. Deweindt,
H. Tilly,
S. Quief,
G. Lecocq, and C. Bastard.
1993.
LAZ3, a novel zinc-finger encoding gene, is disrupted by recurring chromosome 3q27 translocations in human lymphomas.
Nat. Genet.
5:66-70[Medline].
|
| 31.
|
Kohler, I., and E. Rieber.
1993.
Allergy-associated I epsilon and Ec epsilon receptor II (CD23b) genes activated via binding of an interleukin-4-induced transcription factor to a novel responsive element.
Eur. J. Immunol.
23:3066-3071[Medline].
|
| 32.
|
Kotanides, H., and N. Reich.
1996.
Interleukin-4-induced STAT6 recognizes and activates a target site in the promoter of the interleukin-4 receptor gene.
J. Biol. Chem.
271:25555-25561[Abstract/Free Full Text].
|
| 33.
|
Kubo, M.,
J. Ransom,
D. Webb,
Y. Hashimoto,
T. Tada, and T. Nakayama.
1997.
T-cell subset-specific expression of the IL-4 gene is regulated by a silencer element and STAT6.
EMBO J.
16:4007-4020[Medline].
|
| 34.
|
Leonard, W., and J. O'Shea.
1998.
Jaks and STATs: biological implications.
Annu. Rev. Immunol.
16:293-322[Medline].
|
| 35.
|
Lin, R.,
L. Nagy,
S. Inoue,
W. Shao,
W. J. Miller, and R. Evans.
1998.
Role of the histone deacetylase complex in acute promyelocytic leukaemia.
Nature
391:811-814[Medline].
|
| 36.
|
Linehan, L.,
W. Warren,
P. Thompson,
M. Grusby, and M. Berton.
1998.
STAT6 is required for IL-4-induced germ line Ig gene transcription and switch recombination.
J. Immunol.
161:302-310[Abstract/Free Full Text].
|
| 37.
|
Lo Coco, F.,
B. Ye,
F. Lista,
P. Corradini,
K. Offit,
D. Knowles,
R. Chaganti, and R. Dalla-Favera.
1994.
Rearrangements of the BCL6 gene in diffuse large cell non-Hodgkin's lymphoma.
Blood
83:1757-1759[Abstract/Free Full Text].
|
| 38.
|
Miki, T.,
N. Kawamata,
S. Hirosawa, and N. Aoki.
1994.
Gene involved in the 3q27 translocation associated with B-cell lymphoma, BCL5, encodes a Kruppel-like zinc-finger protein.
Blood
83:26-32[Abstract/Free Full Text].
|
| 39.
|
Niu, H.,
B. Ye, and R. Dalla-Favera.
1998.
Antigen receptor signaling induces MAP kinase-mediated phosphorylation and degradation of the BCL-6 transcription factor.
Genes Dev.
12:1953-1961[Abstract/Free Full Text].
|
| 40.
|
Numoto, M.,
O. Niwa,
J. Kaplan,
K. Wong,
K. Merrell,
K. Kamiya,
K. Yanagihara, and K. Calame.
1993.
Transcriptional repressor ZF5 identifies a new conserved domain in zinc finger proteins.
Nucleic Acids Res.
21:3767-3775[Abstract/Free Full Text].
|
| 41.
|
Onizuka, T.,
M. Moriyama,
T. Yamochi,
T. Kuroda,
A. Kazama,
N. Kanazawa,
K. Sato,
T. Kato,
H. Ota, and S. Mori.
1995.
BCL-6 gene product, a 92- to 98-kD nuclear phosphoprotein, is highly expressed in germinal center B cells and their neoplastic counterparts.
Blood
86:28-37[Abstract/Free Full Text].
|
| 42.
|
Otsuki, T.,
T. Yano,
H. Clark,
C. Bastard,
J. Kerckaert,
E. Jaffe, and M. Raffeld.
1995.
Analysis of LAZ3 (BCL-6) status in B-cell non-Hodgkin's lymphomas: results of rearrangement and gene expression studies and a mutational analysis of coding region sequences.
Blood
85:2877-2884[Abstract/Free Full Text].
|
| 43.
|
Richards, M., and D. Katz.
1997.
Analysis of the promoter elements necessary for IL-4 and anti-CD40 antibody induction of murine Fc epsilon RII (CD23): comparison with the germ line epsilon promoter.
J. Immunol.
158:263-272[Abstract].
|
| 44.
|
Rothman, P.,
B. Kreider,
M. Azam,
D. Levy,
U. Wegenka,
A. Eilers,
T. Decker,
F. Horn,
H. Kashleva,
J. Ihle, et al.
1994.
Cytokines and growth factors signal through tyrosine phosphorylation of a family of related transcription factors.
Immunity
1:456-468.
|
| 45.
|
Rothman, P.,
S. Lutzker,
W. Cook,
R. Coffman, and F. Alt.
1988.
Mitogen plus interleukin 4 induction of C epsilon transcripts in B lymphoid cells.
J. Exp. Med.
168:2385-2389[Abstract/Free Full Text].
|
| 46.
|
Schindler, C., and J. J. Darnell.
1995.
Transcriptional responses to polypeptide ligands: the JAK-STAT pathway.
Annu. Rev. Biochem.
64:621-651[Medline].
|
| 47.
|
Schindler, C.,
H. Kashleva,
A. Pernis,
R. Pine, and P. Rothman.
1994.
STF-IL-4: a novel IL-4-induced signal transducing factor.
EMBO J.
13:1350-1356[Medline].
|
| 48.
|
Seyfert, V.,
D. Allman,
Y. He, and L. Staudt.
1996.
Transcriptional repression by the proto-oncogene BCL-6.
Oncogene
12:2331-2342[Medline].
|
| 48a.
| Snapper, C. Personal communication.
|
| 49.
|
Wallin, J.,
E. Gackstetter, and M. Koshland.
1998.
Dependence of BSAP repressor and activator functions on BSAP concentration.
Science
279:1961-1964[Abstract/Free Full Text].
|
| 50.
|
Wang, D.,
A. Cherrington,
B. Famakin-Mosuro, and M. Boothby.
1996.
Independent pathways for de-repression of the mouse Ig heavy chain germ-line epsilon promoter: an IL-4 NAF/NF-IL-4 site as a context-dependent negative element.
Int. Immunol.
8:977-989[Abstract/Free Full Text].
|
| 51.
|
Xu, L., and P. Rothman.
1994.
IFN-gamma represses epsilon germ line transcription and subsequently down-regulates switch recombination to epsilon.
Int. Immunol.
6:515-521[Abstract/Free Full Text].
|
| 52.
|
Ye, B.,
G. Cattoretti,
Q. Shen,
J. Zhang,
N. Hawe,
R. de Waard,
C. Leung,
M. Nouri-Shirazi,
A. Orazi,
R. Chaganti,
P. Rothman,
A. Stall,
P. Pandolfi, and R. Dalla-Favera.
1997.
The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation.
Nat. Genet.
16:161-170[Medline].
|
| 53.
|
Ye, B.,
S. Chaganti,
C. Chang,
H. Niu,
P. Corradini,
R. Chaganti, and R. Dalla-Favera.
1995.
Chromosomal translocations cause deregulated BCL6 expression by promoter substitution in B cell lymphoma.
EMBO J.
14:6209-6217[Medline].
|
| 54.
|
Ye, B.,
P. Rao,
R. Chaganti, and R. Dalla-Favera.
1993.
Cloning of bcl-6, the locus involved in chromosome translocations affecting band 3q27 in B-cell lymphoma.
Cancer Res.
53:2732-2735[Abstract/Free Full Text].
|
| 55.
|
Zollman, S.,
D. Godt,
G. Prive,
J. Couderc, and F. Laski.
1994.
The BTB domain, found primarily in zinc finger proteins, defines an evolutionarily conserved family that includes several developmentally regulated genes in Drosophila.
Proc. Natl. Acad. Sci. USA
91:10717-10721[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 1999, p. 7264-7275, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Meyer, R. D., Laz, E. V., Su, T., Waxman, D. J.
(2009). Male-Specific Hepatic Bcl6: Growth Hormone-Induced Block of Transcription Elongation in Females and Binding to Target Genes Inversely Coordinated with STAT5. Mol. Endocrinol.
23: 1914-1926
[Abstract]
[Full Text]
-
Nurieva, R. I., Chung, Y., Martinez, G. J., Yang, X. O., Tanaka, S., Matskevitch, T. D., Wang, Y.-H., Dong, C.
(2009). Bcl6 Mediates the Development of T Follicular Helper Cells. Science
325: 1001-1005
[Abstract]
[Full Text]
-
Chen, Y., Lin, G., Huo, J. S., Barney, D., Wang, Z., Livshiz, T., States, D. J., Qin, Z. S., Schwartz, J.
(2009). Computational and Functional Analysis of Growth Hormone (GH)-Regulated Genes Identifies the Transcriptional Repressor B-Cell Lymphoma 6 (Bc16) as a Participant in GH-Regulated Transcription. Endocrinology
150: 3645-3654
[Abstract]
[Full Text]
-
Avery, D. T., Ma, C. S., Bryant, V. L., Santner-Nanan, B., Nanan, R., Wong, M., Fulcher, D. A., Cook, M. C., Tangye, S. G.
(2008). STAT3 is required for IL-21-induced secretion of IgE from human naive B cells. Blood
112: 1784-1793
[Abstract]
[Full Text]
-
Cimmino, L., Martins, G. A., Liao, J., Magnusdottir, E., Grunig, G., Perez, R. K., Calame, K. L.
(2008). Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression. J. Immunol.
181: 2338-2347
[Abstract]
[Full Text]
-
Doi, T., Obayashi, K., Kadowaki, T., Fujii, H., Koyasu, S.
(2008). PI3K is a negative regulator of IgE production. Int Immunol
20: 499-508
[Abstract]
[Full Text]
-
Kishida, T., Hiromura, Y., Shin-Ya, M., Asada, H., Kuriyama, H., Sugai, M., Shimizu, A., Yokota, Y., Hama, T., Imanishi, J., Hisa, Y., Mazda, O.
(2007). IL-21 Induces Inhibitor of Differentiation 2 and Leads to Complete Abrogation of Anaphylaxis in Mice. J. Immunol.
179: 8554-8561
[Abstract]
[Full Text]
-
Hiromura, Y., Kishida, T., Nakano, H., Hama, T., Imanishi, J., Hisa, Y., Mazda, O.
(2007). IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis. J. Immunol.
179: 7157-7165
[Abstract]
[Full Text]
-
Mottok, A., Renne, C., Willenbrock, K., Hansmann, M.-L., Brauninger, A.
(2007). Somatic hypermutation of SOCS1 in lymphocyte-predominant Hodgkin lymphoma is accompanied by high JAK2 expression and activation of STAT6. Blood
110: 3387-3390
[Abstract]
[Full Text]
-
Costoya, J. A.
(2007). Functional analysis of the role of POK transcriptional repressors. Brief Funct Genomic Proteomic
0: elm002v1-11
[Abstract]
[Full Text]
-
Obayashi, K., Doi, T., Koyasu, S.
(2007). Dendritic cells suppress IgE production in B cells. Int Immunol
19: 217-226
[Abstract]
[Full Text]
-
Arbouzova, N. I., Zeidler, M. P.
(2006). JAK/STAT signalling in Drosophila: insights into conserved regulatory and cellular functions.. Development
133: 2605-2616
[Abstract]
[Full Text]
-
Arguni, E., Arima, M., Tsuruoka, N., Sakamoto, A., Hatano, M., Tokuhisa, T.
(2006). JunD/AP-1 and STAT3 are the major enhancer molecules for high Bcl6 expression in germinal center B cells. Int Immunol
18: 1079-1089
[Abstract]
[Full Text]
-
Goenka, S., Boothby, M.
(2006). Selective potentiation of Stat-dependent gene expression by collaborator of Stat6 (CoaSt6), a transcriptional cofactor.. Proc. Natl. Acad. Sci. USA
103: 4210-4215
[Abstract]
[Full Text]
-
Harris, M. B., Mostecki, J., Rothman, P. B.
(2005). Repression of an Interleukin-4-responsive Promoter Requires Cooperative BCL-6 Function. J. Biol. Chem.
280: 13114-13121
[Abstract]
[Full Text]
-
Li, Z., Wang, X., Yu, R. Y.-L., Ding, B. B., Yu, J. J., Dai, X.-M., Naganuma, A., Stanley, E. R., Ye, B. H.
(2005). BCL-6 Negatively Regulates Expression of the NF-{kappa}B1 p105/p50 Subunit. J. Immunol.
174: 205-214
[Abstract]
[Full Text]
-
Fernandez de Mattos, S., Essafi, A., Soeiro, I., Pietersen, A. M., Birkenkamp, K. U., Edwards, C. S., Martino, A., Nelson, B. H., Francis, J. M., Jones, M. C., Brosens, J. J., Coffer, P. J., Lam, E. W.-F.
(2004). FoxO3a and BCR-ABL Regulate cyclin D2 Transcription through a STAT5/BCL6-Dependent Mechanism. Mol. Cell. Biol.
24: 10058-10071
[Abstract]
[Full Text]
-
He, B., Qiao, X., Cerutti, A.
(2004). CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-10. J. Immunol.
173: 4479-4491
[Abstract]
[Full Text]
-
Zhou, D., Xue, J., Gavrialov, O., Haddad, G. G.
(2004). Na+/H+ exchanger 1 deficiency alters gene expression in mouse brain. Physiol. Genomics
18: 331-339
[Abstract]
[Full Text]
-
Arimura, A., van Peer, M., Schroder, A. J., Rothman, P. B.
(2004). The Transcriptional Co-activator p/CIP (NCoA-3) Is Up-regulated by STAT6 and Serves as a Positive Regulator of Transcriptional Activation by STAT6. J. Biol. Chem.
279: 31105-31112
[Abstract]
[Full Text]
-
Tunyaplin, C., Shaffer, A. L., Angelin-Duclos, C. D., Yu, X., Staudt, L. M., Calame, K. L.
(2004). Direct Repression of prdm1 by Bcl-6 Inhibits Plasmacytic Differentiation. J. Immunol.
173: 1158-1165
[Abstract]
[Full Text]
-
Lu, B., Zagouras, P., Fischer, J. E., Lu, J., Li, B., Flavell, R. A.
(2004). Kinetic analysis of genomewide gene expression reveals molecule circuitries that control T cell activation and Th1/2 differentiation. Proc. Natl. Acad. Sci. USA
101: 3023-3028
[Abstract]
[Full Text]
-
Kelly-Welch, A. E., Wang, H. Y., Wang, L.-M., Pierce, J. H., Jay, G., Finkelman, F., Keegan, A. D.
(2004). Transgenic Expression of Insulin Receptor Substrate 2 in Murine B Cells Alters the Cell Density-Dependence of IgE Production In Vitro and Enhances IgE Production In Vivo. J. Immunol.
172: 2803-2810
[Abstract]
[Full Text]
-
Niu, H., Cattoretti, G., Dalla-Favera, R.
(2003). BCL6 Controls the Expression of the B7-1/CD80 Costimulatory Receptor in Germinal Center B Cells. JEM
198: 211-221
[Abstract]
[Full Text]
-
Schaffer, A., Kim, E. C., Wu, X., Zan, H., Testoni, L., Salamon, S., Cerutti, A., Casali, P.
(2003). Selective Inhibition of Class Switching to IgG and IgE by Recruitment of the HoxC4 and Oct-1 Homeodomain Proteins and Ku70/Ku86 to Newly Identified ATTT cis-Elements. J. Biol. Chem.
278: 23141-23150
[Abstract]
[Full Text]
-
Pasqualucci, L., Migliazza, A., Basso, K., Houldsworth, J., Chaganti, R. S. K., Dalla-Favera, R.
(2003). Mutations of the BCL6 proto-oncogene disrupt its negative autoregulation in diffuse large B-cell lymphoma. Blood
101: 2914-2923
[Abstract]
[Full Text]
-
Kusam, S., Toney, L. M., Sato, H., Dent, A. L.
(2003). Inhibition of Th2 Differentiation and GATA-3 Expression by BCL-6. J. Immunol.
170: 2435-2441
[Abstract]
[Full Text]
-
Suto, A., Nakajima, H., Hirose, K., Suzuki, K., Kagami, S.-i., Seto, Y., Hoshimoto, A., Saito, Y., Foster, D. C., Iwamoto, I.
(2002). Interleukin 21 prevents antigen-induced IgE production by inhibiting germ line Cepsilon transcription of IL-4-stimulated B cells. Blood
100: 4565-4573
[Abstract]
[Full Text]
-
Pileri, S A, Sabattini, E, Rosito, P, Zinzani, P L, Ascani, S, Fraternali-Orcioni, G, Gamberi, B, Piccioli, M, Vivenza, D, Falini, B, Gaidano, G
(2002). Primary follicular lymphoma of the testis in childhood: an entity with peculiar clinical and molecular characteristics. J. Clin. Pathol.
55: 684-688
[Abstract]
[Full Text]
-
Arima, M., Toyama, H., Ichii, H., Kojima, S., Okada, S., Hatano, M., Cheng, G., Kubo, M., Fukuda, T., Tokuhisa, T.
(2002). A Putative Silencer Element in the IL-5 Gene Recognized by Bcl6. J. Immunol.
169: 829-836
[Abstract]
[Full Text]
-
Pritchard, C. C., Hsu, L., Delrow, J., Nelson, P. S.
(2001). Project normal: Defining normal variance in mouse gene expression. Proc. Natl. Acad. Sci. USA
98: 13266-13271
[Abstract]
[Full Text]
-
Rabah, D., Grant, S., Ma, C., Conrad, D. H.
(2001). Bryostatin-1 Specifically Inhibits In Vitro IgE Synthesis. J. Immunol.
167: 4910-4918
[Abstract]
[Full Text]
-
Laurencikiene, J., Deveikaite, V., Severinson, E.
(2001). HS1,2 Enhancer Regulation of Germline {epsilon} and {gamma}2b Promoters in Murine B Lymphocytes: Evidence for Specific Promoter-Enhancer Interactions. J. Immunol.
167: 3257-3265
[Abstract]
[Full Text]
-
Lossos, I. S., Jones, C. D., Warnke, R., Natkunam, Y., Kaizer, H., Zehnder, J. L., Tibshirani, R., Levy, R.
(2001). Expression of a single gene, BCL-6, strongly predicts survival in patients with diffuse large B-cell lymphoma. Blood
98: 945-951
[Abstract]
[Full Text]
-
Gupta, S., Anthony, A., Pernis, A. B.
(2001). Stage-Specific Modulation of IFN-Regulatory Factor 4 Function by Kruppel-Type Zinc Finger Proteins. J. Immunol.
166: 6104-6111
[Abstract]
[Full Text]
-
Shen, C.-H., Stavnezer, J.
(2001). Activation of the Mouse Ig Germline {{epsilon}} Promoter by IL-4 Is Dependent on AP-1 Transcription Factors. J. Immunol.
166: 411-423
[Abstract]
[Full Text]
-
Reljic, R., Wagner, S. D., Peakman, L. J., Fearon, D. T.
(2000). Suppression of Signal Transducer and Activator of Transcription 3-Dependent B Lymphocyte Terminal Differentiation by Bcl-6. JEM
192: 1841-1848
[Abstract]
[Full Text]
-
Huynh, K. D., Fischle, W., Verdin, E., Bardwell, V. J.
(2000). BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev.
14: 1810-1823
[Abstract]
[Full Text]