Previous Article | Next Article 
Molecular and Cellular Biology, November 1999, p. 7399-7409, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cytokine Receptor Common
Chain as a Potential
Activator of Cytokine Withdrawal-Induced Apoptosis
Shern-Fwu
Lee,1
Huei-Mei
Huang,1,2
Jyh-Rong
Chao,3
Shirley
Lin,1,4
Hsin-Fang
Yang-Yen,3 and
Jeffrey
J.-Y.
Yen1,*
Institute of Biomedical
Sciences1 and Institute of Molecular
Biology,3 Academia Sinica, Graduate
Institute of Life Sciences, National Defense Medical
Center,2 and Graduate Institute of
Biology, Fu-Jen Catholic University,4
Taipei, Taiwan
Received 8 April 1999/Returned for modification 18 May
1999/Accepted 29 July 1999
 |
ABSTRACT |
Growth factors and cytokines play an important role in supporting
cellular viability of various tissues during development due to their
ability to suppress the default cell death program in each cell type.
To date, neither the triggering molecule nor the transduction pathway
of these default apoptosis programs is understood. In this study, we
explored the possibility that cytokine receptors are involved in
modulating cytokine withdrawal-induced apoptosis (CWIA) in
hematopoietic cells. Expression of the exogenous cytokine receptor
common
chain (
c), but not the
chains, accelerated CWIA in
multiple cytokine-dependent cell lines. Reduction of the expression
level of endogenous
c by antisense transcripts resulted in prolonged
survival during cytokine deprivation, suggesting a critical role of
c in modulating CWIA. Fine mapping of the
c subunit revealed that
a membrane-proximal cytoplasmic sequence, designated the death
enhancement region (DER), was critical to the death acceleration effect
of
c. Furthermore, DER accelerated cell death either as a chimeric
membrane protein or as a cytosolic protein, suggesting that DER
functions independently of the cytokine receptor and membrane
anchorage. Cross-linking of the chimeric membrane-bound DER molecules
by antibody or of the FK506-binding protein-DER fusion protein by a
synthetic dimerizing agent, AP1510, did not abrogate the death
acceleration effect. Transient transfection assays further indicated
that DER promoted cell death in the absence of serum in the
nonhematopoietic 293 cell line. In summary, our data suggest that
c
plays an important role in modulating CWIA via an anchorage-independent
and aggregation-insensitive mechanism. These findings may facilitate
further studies on the signaling pathways of CWIA.
 |
INTRODUCTION |
During animal development, cells
undergo vigorous selection in most tissues where only some will
survive. The number of cells that survive within a tissue is thought to
be determined by the concentration of its survival factor(s). In a
variety of growth factor-dependent cell types, supplementation with
exogenous survival growth factors usually results in hypertrophy of a
given organ whereas withdrawal of survival factors induces programmed
cell death, also called apoptosis (20). As the
death-triggering molecule(s) is poorly defined, little is known about
the signal transduction pathway of survival factor withdrawal-induced
apoptosis. The hematopoietic system is one of the best-characterized
examples where the population of each cell lineage is tightly regulated
by cytokines (6). In response to an antigenic stimulus, the
blood concentration of cytokines increases causing a rapid
proliferation and accumulation of certain blood cells. When the antigen
is later cleared, massive cell death occurs via apoptosis due to a lack
of growth and survival cytokines. This prompt growth and death
regulation of primary blood cells by cytokines is well preserved in
many cytokine-dependent leukemic cell lines. Therefore, the
cytokine-dependent hematopoietic cell line provides an excellent model
for exploring the triggering mechanism of cytokine withdrawal-induced
apoptosis (CWIA).
Granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin
5 (IL-5), and IL-3 are potent hematopoietic growth and survival factors
that not only promote proliferation but also support survival via their
membrane receptor complexes on the cell surface. Functional GM-CSF,
IL-5, and IL-3 receptors are composed of a ligand-recruiting
chain,
which is specific for each cytokine, and a signal-transducing
subunit (
c), which is shared by all three cytokine receptors
(8, 24, 46, 54). Humans possess only one
subunit (h
c)
gene, whereas mice have two highly related genes for the signal
transducing subunit m
c and m
IL-3. m
c is 56%
identical to h
c at the amino acid level and serves as the common
subunit for murine IL-3 (mIL-3), GM-CSF, and IL-5 receptors. However,
there is an extensive sequence homology between m
c and
m
IL-3 (91% identity at the amino acid level). In
addition, m
IL-3 forms a high-affinity receptor and
transmits a proliferation signal with the mIL-3 receptor
subunit
(mIL3R
) but not with IL5R
or the GM-CSF receptor
subunit
(GMR
) (13, 15, 19). Upon ligand binding,
c becomes
heavily tyrosine phosphorylated (46) and associates with
many SH2-containing signaling proteins (45, 48). Although
the antiapoptotic function of the activated receptor is not clearly
elucidated (5), several observations suggest that the
receptor
chain and the phosphotyrosine-mediated signals play
important roles in activating the antiapoptotic signals. The activation
of tyrosine phosphorylation and proliferation function of
c were
shown to depend on the presence of the cytoplasmic domain of the
receptor
chain (38, 48), which associates with JAK2
kinase. The deletion mutant of
c which lacks a tyrosine residue in
the cytoplasmic domain (
590) not only partially lost mitogenic
activity but completely lost its antiapoptotic function (4).
Furthermore, a cytoplasmic region required for activation of the
Ras/Raf/mitogen-activated protein kinase pathway is essential for
c
to transduce cytokine-dependent survival activity (21, 23).
Expression of activated Ras protein in trans complemented the defect in apoptosis prevention of the mutant
c and supported long-term proliferation in association with GM-CSF (22).
Additionally, another serine/threonine kinase, Akt/PKB, was suggested
to be involved in the antiapoptotic function of IL-3. Akt/PKB was
activated by IL-3 in a phosphatidylinositol 3-kinase-dependent manner
in the IL-3-dependent cell line Ba/F3. Active but not inactive forms of
Akt/PKB were found to phosphorylate BAD, a distinct member of the Bcl-2
family that promotes cell death, in vivo and in vitro at the same
residues that are phosphorylated in response to IL-3 (7,
49).
Like most apoptotic programs, CWIA in the IL-3-dependent cell line
requires activation of the caspase-3 like proteases and is sensitive to
caspase inhibitors (39). However, to date neither the
triggering molecule nor the transduction pathway of this default apoptotic program is well understood. We therefore set out to determine
whether the cytokine receptor itself was involved in CWIA. In this
report, we show that the
c molecule plays an important role in
modulating CWIA. The
c molecule promoted apoptosis via a cytoplasmic
sequence, named the death enhancement region (DER), in a membrane
anchorage-independent, aggregation-insensitive manner. The novel
function of
c in the modulation of apoptosis may shed light on the
mechanism of leukemogenesis of hematopoietic cells.
 |
MATERIALS AND METHODS |
Cell lines and culture conditions.
Ba/F3, a murine
IL-3-dependent pro-B-cell line (41), was a gift from Atsushi
Miyajima, Institute of Molecular and Cellular Biosciences, The
University of Tokyo, Tokyo, Japan. Ba/F3 cells were maintained in 10%
fetal calf serum (FCS)-containing RPMI 1640 medium supplemented with 55 µM
-mercaptoethanol and 10 U of mIL-3 per ml. HT-2, an
mIL-2-dependent T-lymphocytic cell line (55) purchased from
the American Type Culture Collection (Rockville, Md.), was maintained
in a medium similar to that for Ba/F3 cells but supplemented with 10 U
of mIL-2 per ml. TF-1, a human GM-CSF- or IL-3-dependent
erythroleukemic cell line (25), was a gift from Toshio
Kitamura, Department of Hematopoietic Growth Factor, University of
Tokyo. TF-1 cells were maintained in a medium similar to that for Ba/F3
but supplemented with 20 U of human GM-CSF per ml. Teo4 is a pTet-Off
(14) (Clontech, Palo Alto, Calif.)-transfected TF-1 cell
line and was maintained in TF-1 culture medium plus 200 µg of G418
per ml. Antisense h
c transfectants
(AS)1 and
(AS)2 were
maintained in the same medium as that used for Teo4, with the inclusion
of hygromycin B (200 µg/ml). The ectotropic package cell line BOSC23
(43) and the human embryonic kidney cell line 293 were
purchased from the American Type Culture Collection and maintained in
Dulbecco modified Eagle medium (DMEM) supplemented with 10% FCS.
Plasmid DNA construction.
Retroviral expression plasmids for
wild-type h
c (pBabe- h
c) and hGMR
were constructed by
inserting the coding sequences from pKH97 (16) and pKH125
(47) (gifts from A. Miyajima) into the retroviral expression
vector pBabeHygro and pBabeNeo (32) (gifts from Hartmut
Land, Imperial Cancer Research Fund, London, England), respectively, by
standard molecular cloning methods.
The antisense h
c plasmid was constructed by inserting the
full-length h
c into the tetracycline-regulatable vector pTRE
(Clontech) in a reverse orientation.
Deletion mutants of h
c were created by inserting the Stop linker
(top oligonucleotide, 5' CCCGGGTTAACTTAACTTAAGGATCC 3'; bottom oligonucleotide, 5' GGATCCTTAAGTTAAGTTAACCCGGG 3')
into the FspI, ApaI, and MunI
sites of the h
c cDNA to generate
470,
590, and
772,
respectively. To generate mutants
512,
590(
473-505), and
560(
473-505), the wild-type cytoplasmic domain of h
c was replaced with PCR-amplified DNA fragments at the FspI site.
Primers 5' CGCACGCGTAGAAAGTGGGAGGAGAAG 3' (5' primer)
and 5'CGGGAATTCTCACCCCTGGTGTGGGGGACT 3' (3' primer)
were used for the construction of
512, and primers 5'
CGCACGCGTAGTCCCCCACACCAGGGG 3' (5' primer) and 5'
CGCGAATTCTCAATCTGAGGCAGCTGGAGT 3' (3' primer) were used for the
construction of
560(
473-505). The 5' primer of
560(
473-505)
and the bottom primer of the Stop linker were used to generate
590(
473-505), with the mutant
590 used as the template DNA.
Plasmids pCD16/7/
471-590 and pCD16/7/Stop were both derived from
plasmid pCD16/7/Syk (30) (provided by Tadatsugu Taniguchi, Institute for Molecular and Cellular Biology, Osaka University, Osaka,
Japan). The Stop linker (described above) was inserted into the blunted
MluI site at the junction between CD7 and Syk cDNA to
generate pCD16/7/Stop. For the construction of pCD16/7/
471-590, the
PCR fragment encoding amino acids (aa) 471 to 590 of h
c (amplified by the 5' primer of
512 and the bottom primer of the Stop linker with
590 as the template DNA) was digested with XbaI and
MluI and ligated with the XbaI-MluI
DNA fragment containing the CD16/7 extracellular and transmembrane
domain to generate the CD16/7/
471-590 chimeric molecule. The
resulting plasmid was cut at the XbaI site and blunted and
then cut at the EcoRI site to release the entire coding
sequence. This fragment was subcloned into the SnaBI and EcoRI sites of pBabeHygro (32) to generate the
retroviral expression plasmid pCD16/7/
471-590.
The cDNA sequence encoding aa 471 to 590 of h
c was modified to be
flanked by the MluI restriction enzyme site and the stop codon by using standard PCR technique. This PCR product was cloned into
the EcoRI site of pcDNA3.1.His-A (Invitrogen) to generate plasmid pcDNA-3/ h
c(471-590). This plasmid encodes a cytoplasmic DER
protein that fuses to the hexahistidine tag. An extra IRLRP pentapeptide sequence was created between the expression vector and the
h
c coding sequence as a result of the plasmid construction strategy.
The entire coding sequence of this chimeric cDNA was then transferred
to the retroviral expression vector pBabeNeo by inserting the
PmeI fragment into the SnaBI site of pBabeNeo to
generate pBabeHis
DER.
Plasmids pBabeF1E and pBabeF1
E were both derived from pCF1E (Ariad
Pharmaceuticals, Inc., Cambridge, Mass.). The nucleotide sequence of
c encoding aa 466 to 590 was amplified by PCR and subcloned into the
SpeI site of pCF1E to generate pCF1
E. The flanking
restriction sites of the entire coding sequences of pCF1E and pCF1
E
were modified and subcloned into the SnaBI and
BamHI sites of pBabeNeo to generate plasmids pBabeF1E and
pBabeF1
E.
Gene transfer by retroviral infection and lipofection.
For
retroviral infection, 12 µg of plasmid DNA was transfected into
3 × 106 cells of the packaging cell line BOSC23
(42) with Lipofectamine (Life Science, Gaithersburg, Md.)
according to the manufacturer's protocol, and the 24-h conditioned
media from the transfected cells were used to infect mIL-3-dependent
cell line Ba/F3, using the standard protocol. The stable infectants
were selected in medium containing hygromycin B (500 µg/ml) or G418
(800 µg/ml), and the expression of receptor subunits was confirmed by
flow cytometry and Western blot analysis.
TF-1 cells were transfected as previously described (4).
Briefly, 2 µg of plasmid DNA was mixed with 2.5 µl of DMRIE-C (Life
Science) in 0.5 ml of serum-free DMEM and incubated at room temperature
for 30 min; 1.2 × 106 TF-1 cells were washed and
resuspended in 50 µl of serum-free DMEM. Cells were mixed with
DMRIE-C-bound plasmid DNA and incubated at 37°C for 5 h. The
transfected cells were washed twice and resuspended in fresh growth
medium for 24 to 48 h before G418 or hygromycin B was added to
select for the stable clones.
For each transfection experiment, more than 20 independent subclones
were first analyzed by flow cytometry (see below). All candidate clones
were further analyzed by Western blotting (see below). More than three
positive transfectants were subjected to functional analysis. Since the
properties of all positive clones were similar, only the results from
one representative clone, unless specifically indicated, are presented
and discussed.
Antibodies, immunoprecipitation, Western blot analysis, and
antibody cross-linking.
Antibodies were as follows; for
immunoprecipitation and flow cytometric analysis of h
c, S-16
(catalog no. sc-457; Santa Cruz Biotechnology, Santa Cruz, Calif.); for
Western blot analysis of the carboxyl terminus of h
c, C-20 (catalog
no. sc-675; Santa Cruz); for the amino terminus of h
c, N-20 (catalog
no. sc-676; Santa Cruz); for immunoprecipitation, flow cytometric
analysis, and Western blot analysis of human GMR
(hGMR
), S-50
(catalog no. sc-456; Santa Cruz); for Western blot analysis of
phosphotyrosine, PY20 (catalog no. p11120; Transduction Laboratories,
Lexington, Ky.); for immunoprecipitation and Western blot analysis of
STAT3, C-20 (catalog no. sc-482; Santa Cruz). The monoclonal antibody for immunoprecipitation, flow cytometric analysis, and cross-linking of
CD16 was LNK16 (catalog no. MCA1193XZ; Serotec, Oxford, England), and
that for Western blot analysis of CD16 was 2H7 (catalog no. NCL-CD16;
Novocastra, Newcastle upon Tyne, England).
Cells were lysed in radioimmunoprecipitation assay lysis buffer, and
the cell lysates were subjected to immunoprecipitation and Western blot
analysis as previously described (4) except that the bands
of interest were visualized with an enhanced chemiluminescence (ECL)
detection system (Amersham, Little Chalfont, England). When reprobing
the same blot with another antibody was necessary, membranes were
treated in stripping buffer (100 mM 2-mercaptoethanol, 2% sodium
dodecyl sulfate, 62.5 mM Tris-HCl [pH 6.7]) at 55°C for 30 min
prior to reprobing.
For antibody cross-linking experiments, cells were initially incubated
with 2.5 µg of anti-CD16 monoclonal antibody LNK16 per
107 cells in 0.5 ml of medium at room temperature for 15 min. Cells were then cross-linked with 7.5 µg of goat anti-mouse
immunoglobulin G1 antibody (Jackson ImmunoResearch Laboratories, Inc.,
West Grove, Pa.) at 37°C for 15 min before harvesting and analysis.
Cell viability, proliferation, and DNA fragmentation assay.
Cell viability was determined by trypan blue exclusion staining.
Proliferation activity was measured by a colorimetric assay with
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) as
a substrate as described by Mosmann et al. (33). For detection of the DNA ladder during cell death, cells were treated as
described in the text and subjected to lysis and agarose gel electrophoresis as previously described (59).
Flow cytometric analysis of surface receptor expression.
For
analyzing surface receptor expression, 1 million cells were washed and
resuspended in 1 ml of staining buffer (2% FCS and 0.1% sodium azide
in phosphate-buffered saline). Cells were pelleted after 30 min on ice
and mixed with 0.5 µg of primary antibody. After incubation, cells
were mixed with fluorescein isothiocyanate-conjugated goat anti-mouse
secondary antibody. Fluorescence intensity was analyzed by FACScan
(Becton Dickinson, Mountain View, Calif.).
RT-PCR analysis.
A single-tube reverse transcription
(RT)-PCR format was used to analyze the expression of the exogenous
genes. The cytoplasmic RNA was prepared from the target cells and
subjected to RT-PCR analysis as specified for the Access RT-PCR system
(Promega, Madison, Wis.).
 |
RESULTS |
In this study, we explored the potential role of cytokine
receptor subunits in the modulation of CWIA. To this end, multiple stable transfectants of mIL-3-dependent cell line Ba/F3 expressing hGMR
(12) or h
c (16) were established and
subjected to survival rate measurement by trypan blue staining during
mIL-3 deprivation. All transfectants expressing similar amounts of the
same type of receptor subunit behaved similarly, and the results of one representative clone of each type are shown in Fig.
1. The surface expression of each
receptor subunit in individual stable clones was confirmed by flow
cytometric analysis using antibodies specific for hGMR
and h
c
(Fig. 1A). While cells expressing hGMR
alone showed death kinetics
similar to that of control cells transfected with the retroviral vector
alone (half-life [t1/2]
24 h), cells expressing h
c alone manifested an accelerated death rate after deprivation of mIL-3 (t1/2
9 h) (Fig.
1B). Overexpression of the human IL-5 receptor
chain (hIL5R
)
(59) in Ba/F3 cells did not alter the death rate (data not
shown). Accelerated death caused by h
c overexpression was mainly due
to apoptosis, which was demonstrated by a DNA fragmentation assay
(58) (Fig. 1C) and an annexin V binding assay (data not
shown). One clone of the h
c transfectant showed an extensive DNA
oligonucleosomal ladder at 8 h after deprivation of mIL-3, while
control cells did not show apoptotic DNA laddering even up to 12 h
(Fig. 1C). To exclude the possibility that h
c accelerates CWIA by
interfering with the mIL-3 responsiveness of the host cells, the
half-maximum effective dose (ED50) of mIL-3 for an h
c
transfectant was determined and shown to be the same as that of the
parental Ba/F3 cells (data not shown). The h
c was heavily tyrosine
phosphorylated 3 min after stimulation with mIL-3 (Fig. 1D), suggesting
that h
c formed a hybrid functional receptor complex with mIL3R
and was involved in growth signaling of mIL-3 in h
c transfectant
cells. To further support the apoptosis-enhancing role of h
c, we
expressed h
c in an IL-2-dependent cell line, HT-2 (Fig.
2A), and measured the apoptotic rates of
the transfectants. As with Ba/F3 cells, HT-2 subclones expressing the
control vector or hGMR
manifested a death rate similar to that of
the parental cells (Fig. 2B). Although the expression level of h
c in
HT-2 cells was about half of that seen in Ba/F3 cells, HT-2 subclones
expressing h
c or h
c plus hGMR
still showed accelerated death
and survival reduction by 27% compared to control cells after 24-h
depletion of IL-2 (Fig. 2B). Coexpression of hGMR
in
h
c-transfected Ba/F3 or HT-2 cells allowed cell growth in human
GM-CSF-containing medium (data not shown) but did not alter the
accelerated apoptotic rate of h
c transfectants in the absence of
cytokines (Fig. 2B). Overexpression of h
c in human GM-CSF-dependent
cell line TF-1 (25) (Fig. 2A) also led to an increase in the
apoptotic rate by 22% compared to that of vector-expressing TF-1 cells
(Fig. 2B). In conclusion, expression of exogenous h
c in both human
and murine hematopoietic cell lines accelerates their death rates in
the absence of survival factors.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
Ectopic expression of cytokine receptor h c, but not
hGMR , accelerates CWIA in Ba/F3 cell line. (A) Surface expression of
h c and hGMR in Ba/F3 cells. The cells were incubated with
receptor specific antibodies (Ab; indicated at the right) and
fluorescein isothiocyanate-conjugated secondary antibody. Fluorescence
intensity is shown on the x axis, and cell numbers are shown
on the y axis. The background fluorescence was detected with
a nonimmunized serum and is shown as a dashed line. V,
vector-expressing control cells; , hGMR -expressing subclone; ,
h c-expressing subclone. (B) Death acceleration by h c in the
mIL-3-dependent Ba/F3 cell line. Ba/F3 cells expressing various
exogenous genes were depleted of mIL-3 for various time periods as
indicated, and viable cell numbers were determined by trypan blue
exclusion assay. Each curve represents the average values of three
independent clones expressing vector, hGMR , or h c cDNA. (C) Human
c accelerates death via apoptosis. Genomic DNA of h c- and
vector-expressing Ba/F3 cells were prepared from cells treated as
described for panel A and analyzed in agarose gel to show the
oligonucleosomal DNA ladder. (D) Human c participates in mIL-3
signaling. Human c-expressing Ba/F3 cells were cultured in
cytokine-free medium for 12 h and restimulated by mIL-3 at 37°C
for various time intervals as indicated. Protein lysates were prepared
and subjected to immunoprecipitation (IP) with antibody specific to
human c (sc-457) and then to Western blot analysis with
antiphosphotyrosine antibody PY20 (P-Tyr) or anti-h c antibody
( c). The specific bands were visualized by ECL.
|
|


View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Ectopic expression of cytokine receptor h c, but not
hGMR , accelerates CWIA in HT-2 and TF-1 cells. (A) Surface
expression of receptor molecules in HT-2 and TF-1 cells. Various stable
transfectants were stained with antibodies (Ab) and analyzed as
described in the legend to Fig. 1. V, vector-expressing control cells;
, hGMR -expressing subclone; , h c-expressing subclone;
 , hGMR - and h c-coexpressing subclone. (B) Death
acceleration by h c in HT-2 and TF-1 cell lines. Stable transfectants
of the mIL-2-dependent helper T-cell line HT-2 expressing the indicated
genes were depleted of mIL-2 for 0, 15, and 24 h; viable cell
numbers were determined and are shown at the left. Stable transfectants
of the human GM-CSF-dependent cell line TF-1 expressing the indicated
plasmids were depleted of human GM-CSF for 0, 1, and 2 days (d); viable
cell numbers were determined and are shown at the right. For most of
the genes, each value is the average of two independent duplicated
experiments of one stable clone; the value for the h c gene is the
average of two independent stable clones.
|
|
These results suggest that the level of expression of
c in a given
cell may determine the rate of apoptosis. To further explore this, we
investigated whether down-regulation of the endogenous h
c protein
would ameliorate CWIA. We transfected the antisense h
c plasmid into
Teo4 cells, a derivative of human TF-1 cell line suitable for inducible
expression by tetracycline withdrawal, and selected for
hygromycin-resistant clones. Two representative stable clones,
(AS)1
and
(AS)2, were characterized. Upon removal of tetracycline,
expression of h
c proteins were reduced to about one-third of that of
the control (Fig. 3A) in both cell lines. The antisense h
c transcripts were specific for h
c mRNA and had no
effect on the levels of hGMR
(data not shown) or of STAT3 (Fig. 3A).
CWIA delay in these cells was demonstrated by two methods. First, a
time course study was performed by trypan blue exclusion assay (Fig.
3B). Under conditions used in this study, differences of the survival
cell number between cells cultivated in medium with or without Tet
[Tet(+) or Tet(
) medium] were discernible 24 h after GM-CSF
starvation, and the difference became even more prominent thereafter.
Seventy-two hours after cytokine depletion,
(AS)1 cell viability was
30% in Tet(+) medium and 42% in Tet(
) medium;
(AS)2 cell
viability was 38 and 66%, respectively. Second, the 48-h time point
was chosen to repeat the measurement of increased survival at various
concentrations of GM-CSF (below the ED50) by MTT dye
reduction assay (33). In these experiments, 2 × 104 cells were seeded per well. After 48 h
cultivation, survival percentage was referred to the optical density
reading of each sample compared to that of initiating cells. In the
absence of tetracyline, the survival cell numbers at all concentrations
of GM-CSF tested increased (Fig. 3C). The lower the concentration of
GM-CSF, the more profound the protection effects. In GM-CSF-free medium, survival cell numbers increased from 25% in Tet(+) medium to
60% in Tet(
) medium for
(AS)1 cells and from 35 to 70%,
respectively, for
(AS)2 cells (Fig. 3C). The antisense construct did
not completely prevent CWIA in these experiments, possibly due to
incomplete ablation of h
c expression and/or because h
c may not be
the only cytokine receptor which can modulate CWIA in TF-1 cells (see
below). Nevertheless, CWIA was dramatically inhibited when the
expression level of endogenous h
c was reduced. Therefore, not only
exogenous h
c but also endogenous h
c regulates the death rate in a
seemingly dose-dependent manner.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Antisense h c transcript delays CWIA of
GM-CSF-dependent cells. (A) Suppression of endogenous h c protein
expression by the antisense h c plasmid in stable cell lines. Two
antisense h c-expressing TF-1 subclones [ (AS)1 and (AS)2] and
control cells (TRE) were cultured with (+) or without ( ) tetracycline
(2 µg/ml) for 48 h. Cell lysates were then prepared and
subjected to immunoprecipitation (IP) and Western blot analysis (Blot)
with anti-h c antibody ( c) and anti-STAT3 antibody (STAT3),
respectively. (B) Time course study of retarded CWIA of stable cell
lines expressing h c antisense RNA. Viable cell numbers of each cell
line were determined by trypan blue staining and are relative to that
of initial seeded cell number during cytokine depletion in Tet(+) or
Tet( ) medium. The values are averages of two independent experiments
performed in duplicate. (C) Survival effect of antisense h c in
low-GM-CSF medium. Experiments were conducted as for panel B except
that various low concentrations of human GM-CSF were used in the
presence (open bar) or absence (solid bar) of tetracycline and samples
were analyzed only at the 48-h time point by MTT dye reduction assay.
Percentage of survival is relative to that of cells initially seeded.
The values are averages of two independent experiments performed in
triplicate.
|
|
The structural domains essential for transducing proliferation signals
of the h
c molecule have been mapped (45, 47). To
determine whether the domains needed for proliferation overlap with
that for apoptosis modulation, we constructed a series of deletion
mutants to delineate sequence domains of h
c critical for the death
acceleration effect (Fig. 4A). These
constructs were introduced into Ba/F3 cells by
retroviral infection, and the hygromycin-resistant clones were analyzed
and verified for the expression of h
c mutants by flow cytometry
(data not shown) and Western blot analysis (Fig. 4B). At least three
independent clones for each mutation were subjected to survival
kinetics study after depletion of mIL-3. The death acceleration ability
of each mutation is summarized in Fig. 4A. The h
c mutations with
C-terminal deletions up to aa 773 (
772) or 591 (
590) retained
full death acceleration ability. However, with further deletions to aa
513 (
512) and 471 (
470), death-promoting activity was completely lost (Fig. 4C). Internal deletion of the DNA sequence containing the
conserved box I (31, 34, 40) from both
590 [i.e.,
590(
473-505)] and
560 [i.e.,
560(
473-505)] did not
abolish, but resulted in a slight reduction in, death acceleration
ability (Fig. 4C). These data suggest that the box I sequence is not
essential for the apoptosis-enhancing activity of h
c per se but may
be required for optimizing its death activity. The minimum sequence
essential for accelerating apoptosis, designated the DER, is mapped by
this deletion analysis to a 54-aa peptide fragment from aa 506 to 560 (Fig. 4D). In contrast to the dependence on the presence of hGMR
for
transducing proliferation signals of GM-CSF (24),
coexpression of hGMR
with all h
c mutants tested did not alter the
survival kinetics in the absence of cytokines (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
Mapping of the DER of h c. (A) Schematic
depiction of cytoplasmic deletion mutants of cytokine receptor h c.
Position 1 is the first methionine of the open reading frame c,
full-length wild-type molecule of h c; hatched and double-hatched
boxes, conserved cytoplasmic box I and box II sequences, respectively;
dashed lines, the internal deletion; circles, extracellular domains of
the chimeric CD16/7/ 471-590 and control CD16/7/Stop molecules. Death
acceleration is indicated as +++ (strong enhancement [decrease of 50 to 60% of survival cells compared to the control]), ++ (moderate
enhancement [decrease of 20 to 40%]), and (no enhancement).
(B) Expression of the mutant h c proteins in Ba/F3 cells. Stable
Ba/F3 subclones infected with vector pBabeHygro (lane 1) or with h c
(lane 2), 772 (lane 3), 590 (lane 4), 512 (lane 5), 470
(lane 6), 590( 473-505) (lane 7), and 560( 473-505) (lane 8)
were lysed and subjected to Western blot analysis using a polyclonal
antibody specific to the extracellular domain of the h c protein. The
predicted position of each mutant h c in the blot is indicated by
arrows. (C) Survival of cells expressing various h c mutants during
the course of cytokine deprivation. Viability of cells expressing
various h c mutants at various time points were measured as described
in legend to Fig. 1A. Each number is the average of two experiments of
two to three independent subclones of each mutation. (D) Alignment of
DER sequences of different species of c. The amino acid sequence
from 506 to 560 of human c was compared to equivalent regions from
m IL-3, m c, and rat c. Identical amino acids are
shown as white letters; the conserved box II sequence is indicated by a
bracket.
|
|
These observations question whether DER can accelerate apoptosis via a
mechanism independent of the cytokine receptor complex. To address this
question, we fused the cDNA sequence encoding aa 471 to 590 of h
c,
which contains DER, to a heterologous transmembrane protein, the
chimeric CD16-CD7 molecule (30) (Fig. 4A, CD/
471-590), to
test the ability of this chimeric h
c molecule to affect CWIA. The
construct CD16/7/Stop (Fig. 4A, CD/Stop), which contains no cytoplasmic
domain, was introduced to serve as a negative control. Surface
expression of these chimeric CD16 antigens in all transfectants was
confirmed by flow cytometry (Fig. 5A) and
Western blot analysis (Fig. 5B). Ba/F3 cells expressing CD16/7/Stop did
not show an altered rate of CWIA compared to parental cells (Fig. 5D,
CD/S), whereas Ba/F3 cells expressing CD16/7/
471-590 showed
moderately accelerated CWIA compared to parental cells, with the
decrease of viable cells from 80 to 50% at the 12-h time point (Fig.
5D, CD/
). These data suggest that promotion of CWIA is independent of the GM-CSF receptor complex and is mediated via cis
element(s) distinct from those required for proliferation.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Physical aggregation did not abrogate the function of
DER. (A) Surface expression of the chimeric CD16-DER molecules in Ba/F3
cells. The stable cell lines were treated with anti-CD16 antibody (Ab)
and analyzed by flow cytometry as described for Fig. 1. CD/S,
pCD16/7/Stop-expressing cell line; CD/ ,
pCD16/7/ 471-590-expressing cell line. (B) Protein expression of the
CD16 chimeric genes. Cell lysates were prepared from control cells
(lane 1), CD/S cells (lane 2), and CD/ cells (lane 3) and were
subjected to Western blot analysis with the anti-CD16 antibody. Sizes
are indicated in kilodaltons. (C) Cross-linking of the DER sequence of
h c by anti-CD16 antibody. Ba/F3 subclones as described for panel A
were cross-linked with (+) or without ( ) anti-CD16 antibody. The
total cell lysates were prepared and analyzed for the protein tyrosine
phosphorylation by Western blot analysis using antiphosphotyrosine
(anti-p-Tyr) antibody. The STAT5 protein levels are shown as loading
controls for each lane. (D) The survival rate of cells expressing
various CD16/7 chimera with or without antibody cross-linking (CL).
Cells as indicated were treated as described for panel B and were
depleted of cytokine. Viable cell numbers were determined at various
time points after cytokine depletion; the values are averages of two
independent experiments performed in duplication. V, vector-expressing
cells.
|
|
By taking advantage of the presence of the CD16 tag in the chimeric
CD16/7/
471-590 protein, we further tested whether dimerization or
aggregation of the DER sequence would abrogate death acceleration activity. Since both box I and box II motifs of h
c are present in
the chimeric CD16/7/
471-590 molecule and the JAK kinases were reported to be preassociated with the box I sequence (38,
43), cross-linking of this molecule is likely to activate the
associated tyrosine kinases and result in tyrosine phosphorylation of
certain cellular proteins. As indicated by the appearance of
tyrosine-phosphorylated protein signals in Western blot analysis (Fig.
5C, rightmost lane), we successfully cross-linked the surface
CD16/7/
471-590 molecules. Several tyrosine-phosphorylated cellular
proteins (ranging from 97 to 150 kDa) were detectable in
CD16/7/
471-590-expressing cells when the surface CD16 was
cross-linked. Upon aggregation, the CD16/7/
471-590 molecules
retained their ability to accelerate apoptosis (Fig. 5D, CD/
+ CL). At 18 h, the surviving cells decreased from 55% for all
control cells to 15% for CD16/7/
471-590-expressing cells regardless
of cross-linking with the antibody. Our data strongly suggest that
physical aggregation caused by antibody cross-linking does not
down-regulate the death acceleration activity of the DER sequence.
Given the fact that subclones expressing CD16/7/
471-590 grew well in
mIL-3-containing medium and that h
c-expressing HT-2 cells grew
satisfactorily in mIL-2, cytokines obviously abrogate in
trans the apoptosis enhancing activity of DER.
Many membrane proteins function in an anchorage-dependent manner, due
to the special membrane localization of their signaling components. To
further understand the mechanism of death promotion by h
c and to
explore whether this apoptosis acceleration activity is anchorage
dependent, we constructed the retroviral expression plasmid
pBabeHis
DER, encoding a hexahistidine-tagged cytoplasmic DER of h
c, and established several
pBabeHis
DER-expressing cell lines by retroviral
infection. Although the protein product of pBabeHis
DER
was readily detectable by Western blot analysis in a transient
transfection assay with HeLa cells (data not shown), the expression
level of the cytoplasmic chimeric h
c protein in these stable lines
was very low and undetectable by a conventional Western blot analysis.
Instead, we demonstrated the presence of the RNA transcript of
pBabeHis
DER by RT-PCR using a set of transgene specific
oligonucleotide primers as depicted in Fig. 6A. Three pBabeHis
DER-expressing clones, but not the control
vector transformant cells, showed a reverse transcriptase-dependent
500-bp specific PCR product (Fig. 6A,
lanes 4, 6, and 8 versus lane 10). Additionally, we enriched the
histidine tag-containing proteins with Ni-nitrilotriacetic acid beads
from about 2 mg of the cytoplasmic and nuclear proteins and analyzed
these protein samples as for conventional Western blotting except that
the histidine tag-containing proteins were probed with horseradish
peroxidase-labeled nickel (Kirkegaard & Perry Laboratories,
Gaithersburg, Md.). As shown in Fig. 6B, a 14-kDa protein was detected
in the cytoplasmic fraction of pBabeHis
DER-expressing cells (lane 3) but not in the nuclear fraction or in vector-expressing cells (lanes 1, 2, and 4). In the death rate determination experiment (Fig. 6C), clones 1 and 3 showed death kinetics comparable to that of
the wild-type h
c transformant (columns 1 and 3 versus column V).
Clone 2 showed a death rate slightly lower than the wild-type h
c
control rate but still much higher than the control rate (column 2).
Therefore, the DER sequence is capable of accelerating CWIA in an
anchorage-independent manner.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
The DER functions via an anchorage-independent
mechanism. (A) Expression of the cytoplasmic hexahistidine-tagged DER
in Ba/F3 cells. In the upper portion, the plasmid
pBabeHis DER is shown as an oblong. The hatched and open
bars represent the histidine epitope tag from pcDNA3.1 (E box) and the
h c cytoplasmic domain (aa 471 to 590; containing the DER sequence),
respectively. The pair of arrows and solid bar indicate the
oligonucleotide primers used for RT-PCR and the 500-bp PCR product,
respectively. Cytoplasmic RNA prepared from
pBabeHis DER-expressing Ba/F3 cells (clones 1 to 3) and
from vector-expressing cells (clone V) were subjected to RT-PCR.
Reactions performed without RT served as controls for genomic DNA
contamination. A plasmid DNA control (lane Ctr1) was included to
indicate the position of the PCR product (arrow). M, 1-kb DNA marker.
(B) Expression of cytoplasmic histidine-tagged DER protein. The
cytosolic and nuclear (N) extracts were prepared as described by Dignam
et al. (10). The histidine tag-containing proteins were then
enriched by passing 2 mg of extracts through Ni-nitrilotriacetic acid
beads and were analyzed as for conventional Western blot analysis
except that the proteins were probed with horseradish
peroxidase-labeled nickel. The signals were visualized with the ECL
system. (C) Moderate acceleration of CWIA by cytosolic DER sequence.
Cells expressing indicated plasmids were subjected to cytokine
deprivation and viable cell measurement as described for Fig. 1A. A
cell line expressing wild-type h c ( c) was included as a positive
control. The pBabe vector-containing cell line (V) was included as a
negative control. Sizes are indicated in kilodaltons.
|
|
To further elucidate the mode of DER's function, we expressed
cytoplasmic DER as an FK506-binding protein (FKBP) fusion protein to
explore the effect of dimerization on the deleterious function of DER.
Intriguingly, the cytoplasmic FKBP-DER fusion protein was again
undetectable in stable transfectants with anti-FKBP or hemagglutinin
antigen antibody even though it was highly expressed in a transient
transfection experiment (data not shown). An RT-PCR analysis was
carried out instead to demonstrate the expression of the fusion gene.
Using the pair of primers depicted in Fig. 7A, DNA fragments the size of ~500 and
~1,000 bp were specifically amplified from the plasmids pBabeF1E and
pBabeF1
E, respectively (Fig. 7A, lanes 1 to 4). The stable clone
expressing pBabe vector showed no PCR product (lanes 5 and 6), and
clones expressing pBabeF1E and pBabeF1
E showed a RT-dependent PCR
product of predicted size (lanes 8, 10, 12, and 14). Apoptotic kinetics
was then studied in the presence of the dimerizing agent AP1510.
Following the course of cytokine deprivation, pBabe-F1
E-expressing
cells manifested accelerated death faster than that of controls
regardless of the presence of AP1510 (Fig. 7B). These results further
supported the notion that DER-enhanced apoptosis is independent of
membrane anchorage and insensitive to physical dimerization.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
The cytoplasmic FKBP-DER fusion protein accelerates
apoptosis. (A) Expression of the FKBP-DER chimeric gene in Ba/F3 stable
transfectants. The cytoplasmic RNA samples were prepared from cells
expressing pBabe vector (lanes 5 and 6), pBabeF1E (lanes 7 to 10), and
pBabeF1 E (lanes 11 to 14) and subjected to RT-PCR analysis with a
pair of primers depicted as P1 and P2 in the scheme. Two plasmid DNA
controls (lanes 1 to 4) are included, and the PCR products of 500 bp
for pBabeF1E (lanes 1 and 2) and of 1,000 bp for pBabeF1 E (lanes 3 and 4) are indicated at the left. Samples in odd numbered lanes are
products without RT, and those in even numbered lanes are products with
RT. (B) Dimerization-insensitive death acceleration effect of the
cytosolic FKBP-DER fusion protein. Cells expressing the indicated
plasmids were subjected to cytokine deprivation and were treated with
or without 10 µM AP1510 simultaneously. At various time points, the
viable cells were measured as described for Fig. 1A. The values are
averages of two independent determinations performed in duplicate. The
pBabe vector-containing cell line (V) was included as a negative
control. F1E, pBabeF1E-expressing cells; F1 E, pBabeF1 E-expressing
cells; AP, dimerization with AP1510.
|
|
Finally, we examined whether h
c can promote death in a
nonhematopoietic cell line. This issue was explored in the human kidney cell line 293 by a transient assay measuring loss of green fluorescence protein (GFP) expression in apoptotic cells as previously described (4). As observed in the control group, neither pBabe vector nor pcDNA3 vector caused any significant loss of GFP expression in the
absence of serum (Table 1). However, the
expression of wild-type h
c led to a decrease of 18.95%
GFP+ cells upon serum starvation compared to cells in serum
medium (Table 1). The expression of cytosolic DER-containing sequence, i.e., pcDNA-h
c(471-590), also caused a decrease of 11.25%
GFP+ cells upon serum starvation (Table 1). These data
confirm the anchorage-independent nature of the death acceleration
activity of DER and further suggest that serum starvation sensitizes
the 293 cells to the death-promoting effect of h
c.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Expression of both h c and cytoplasmic DER of h c
affected the viability of human renal epithelial cell line 293
|
|
 |
DISCUSSION |
Hematopoietic cells differ from most other cell types in that
their survival in vitro has an absolute requirement for specific growth
factors. Growth factors are required continuously throughout the
developmental program, and removal of growth factors at any stage
during differentiation into the mature cells leads to apoptosis. Therefore, programmed cell death was suggested to have a physiological significance in hematopoiesis (9). In many factor-dependent hematopoietic cell lines, apoptosis was observed when the relevant cytokines were removed from culture media. However, cell viability could be maintained in these cell lines by the addition of
cycloheximide (56), suggesting that new protein synthesis is
essential and a positive control mechanism is hypothesized to CWIA. In
this report, we provide evidence that the
c molecule is involved in modulating CWIA. We further demonstrate that the
c molecule
modulates apoptosis with the following distinct features. First, its
expression levels closely correlated with the rate of apoptosis when
cytokines were depleted (Fig. 1 to 3). Second, the sequence essential
for death acceleration was distinct from that required for
proliferation (Fig. 4). Third, the death accelerated by
c was
sensitive to cycloheximide treatment (data not shown). Fourth, its
enhancement of cell death did not depend on membrane anchorage (Fig. 6
and 7; Table 1). Fifth, physical aggregation of
c did not abrogate its death-enhancing effect (Fig. 5 and 7). Finally,
c itself was
sufficient to promote cell death in the nonhematopoietic 293 cell line
under serum-free conditions (Table 1).
Although the expression level of h
c in a given cell line strongly
correlated with the death rate of this cell line in the absence of
cytokine, it did not seem to have a good correlation between cell lines
from different origins. We noticed that TF-1 cells were less sensitive
to CWIA than HT-2 and Ba/F3 cells. Moreover, TF-1 cells were also less
sensitive to the death-enhancing effect of h
c overexpression.
Low-level expression of h
c in HT-2 cells resulted in a 20% increase
in cell death within 24 h. However, an eightfold increase in h
c
expression in TF-1 cells exacerbated cell death by 21% compared to
control cells at 48 h (compare Fig. 1B and 2B). Although there are
many explanations for these results, the most likely is the distinct
genetic background of these cells.
Amino acid sequence alignment of the DER sequence of human
c and
those of m
c (13), m
IL-3 (13),
and rat
c (1) revealed a highly conserved 26-aa motif
(Fig. 4D) which is rich in proline (6 residues of 26), serine/threonine
(6 of 26), and acidic amino acids (4 of 26). The DER sequence also
includes a short sequence motif known as box II that is highly
conserved among several type I cytokine receptors. This observation is
consistent with our data that both hGMR
(Fig. 1A) and hIL5R
(data
not shown) contain no box II sequence in their cytoplasmic domains and
lack cell death-enhancing ability. An intriguing observation is that
the cytokine receptors containing the box II sequence, including gp130,
c, the erythropoietin and G-CSF receptors, and IL-2R
(31, 34, 40), are key signal transducers and are expressed with limited overlap in terms of distribution in hematopoietic cell lineages. It would be of interest to investigate whether these receptors also regulate apoptosis.
The dual role of
c in growth and death regulation may confer an
IL-3-, IL-5, or GM-CSF dependence on
c-expressing cells when these
receptor
chains are coexpressed. During hematopoiesis, IL3R
was
highly expressed in the totipotent stem cell population and mature cell
lineages. The expression of
c and GMR
was not detectable in the
stem cell populations and was induced in the multilineage progenitors
and along the erythroid and myeloid differentiation pathways (2,
28, 57). IL5R
was expressed even later during the
differentiation of eosinophil lineage (51). This
stage-specific expression pattern was concomitant with the
responsiveness and the dependence of myeloid cells on IL-3, GM-CSF, and
IL-5 during differentiation (for a review, see reference
29). For those cell lineages expressing
c
molecules, the continuous presence of IL-3, GM-CSF, or IL-5 in vitro
and in vivo will allow the activation of survival signals via the

c heterodimeric receptor complex and ensure further
differentiation. Mice lacking the receptor
c have recently been
generated. Except with the development of a pulmonary alveolar
proteinosis-like disease and having reduced numbers of peripheral
eosinophils, these m
c-null mice seem to have normal hematopoiesis
(36, 37, 50). The expression of another highly homologous
protein, m
IL-3, in these m
c-null mice was suggested
to be responsible for transducing appropriate proliferation and
differentiation signals during hematopoiesis. Similarly, since the DER
sequence of m
IL-3 is almost identical to that of m
c, it is possible that in these m
c-null mice, m
IL-3 can
substitute for m
c to regulate apoptosis in a subset of hematopoietic
cells. If this scenario is the case and given the fact that the
receptor
c levels affect the death rate of a given cell type, it
would then be interesting to examine whether the expression level of m
IL-3 in these m
c-null mice is elevated, a
compensatory effect that is frequently observed in mice lacking one
member of an important gene family (18, 26).
The functional and structural properties of DER are distinct from those
of the death domains identified in the tumor necrosis factor receptor
family and their adaptor signaling molecules (53). These
death domains can override the survival effects of growth factors and
drive the target cell to undergo apoptosis. Functionally, DER is more
closely related to the addiction/dependence domains (ADD) in the nerve
growth factor receptor (NGFR) (44) and the androgen receptor
(AR) (3) wherein the expression of these receptors
establishes a ligand-dependent cellular status. The ADD-containing
receptors confer host cells with proliferation activity in the presence
of ligands and will drive cells to undergo apoptosis only when ligands
are removed from the culture medium. However, these three functionally
related peptide motifs are structurally very distinct. DER of the
receptor
c is a proline-rich peptide, ADD of NGFR is an
-helical
peptide containing two critical basic residues (17), whereas
ADD of AR is a stretch of glutamines that results from the
trinucleotide repeats in the AR coding sequence (3). It
remains to be determined how these structurally distinct motifs can
manifest similar biological functions.
Although our results strongly suggest that the receptor
c is
involved in modulating growth factor withdrawal-induced apoptosis, the
underlying mechanism is still not clear. On the basis of current knowledge on the signaling molecules involved in growth and death control, we propose the following three likely explanations. (i) Forced
expression of
c might result in sequestering some common signaling
components which interact with the box II sequence, and consequently
these cells die faster upon deprivation of their dependent growth
factors. (ii) The CIS/SOCS/SSI/Jab gene family could be induced by the
receptor
c through the JAK/STAT pathway (11, 27, 35, 52,
60). Induction of these negative regulators may lead to premature
termination of the residual survival signal of the receptor after
cytokine removal, and the CWIA rate is subsequently enhanced. (iii) In
the absence of cytokines, the receptor
c can trigger a death cascade
that eventually kill cells. While these three mechanisms are distinct
from each other, they are not necessarily mutually exclusive in the
context of
c function. More experiments are required to unravel this issue.
 |
ACKNOWLEDGMENTS |
We thank Young-Sun Lin, Yu-Chung Yang, and Atsushi Miyajima for
critical comments on the manuscript, David Baltimore for the BOSC23
packaging cell line, Hartmut Land for retroviral expression vectors,
and Ariad Pharmaceuticals for plasmid pCF1E and the synthetic dimerizing agent AP1510. We are also grateful to Derek W. Gilroy for
preparation of the manuscript.
This work was supported in part by Academia Sinica, Taiwan
(J.J.-Y.Y.) and the National Science Council of Taiwan
(J.J.-Y.Y.). S.-F.L. was supported by a postdoctoral fellowship from
Academia Sinica, Taiwan. H.-M.H. and J.-R.C. were supported by the
postdoctoral fellowships of the National Science Council of Taiwan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Biomedical Sciences, Academia Sinica, No. 128, Sec. 2, Yen-Jiou-Yuan
Rd., Taipei 11529, Taiwan. Phone: 886-2-2652-3077. Fax:
886-2-2785-8847. E-mail:
bmjyen{at}Novell.ibms.sinica.edu.tw.
 |
REFERENCES |
| 1.
|
Appel, K.,
M. Buttini,
A. Sauter, and P. J. Gebicke-Haerter.
1995.
Cloning of rat interleukin-3 receptor -subunit from cultured microglia and its mRNA expression in vivo.
J. Neurosci.
15:5800-5809[Abstract].
|
| 2.
|
Ashihara, E.,
A. M. Vannucchi,
G. Migliaccio, and A. R. Migliaccio.
1997.
Growth factor receptor expression during in vitro differentiation of partially purified populations containing murine stem cells.
J. Cell. Physiol.
171:343-356[Medline].
|
| 3.
|
Bredesen, D.,
X. Ye,
A. Tasinato,
S. Sperandio,
J. J. Wang,
N. Assa-Munt, and S. Rabizadeh.
1998.
p75NTR and the concept of cellular dependence: seeing how the other half die.
Cell Death Differ.
5:365-371.
[Medline] |
| 4.
|
Chao, J. R.,
J. M. Wang,
S. F. Lee,
H. W. Peng,
Y. H. Lin,
C. H. Chou,
J. C. Li,
H. M. Huang,
C. K. Chou,
M. L. Kuo,
J. J. Y. Yen, and H. F. Yang-Yen.
1998.
mcl-1 is an immediate-early gene activated by the granulocyte-macrophage colony-stimulating factor (GM-CSF) signaling pathway and is one component of the GM-CSF viability response.
Mol. Cell. Biol.
18:4883-4898[Abstract/Free Full Text].
|
| 5.
|
Cleveland, J. L.,
M. Dean,
N. Rosenberg,
J. Y. Wang, and U. R. Rapp.
1989.
Tyrosine kinase oncogenes abrogate interleukin-3 dependence of murine myeloid cells through signaling pathways involving c-myc: conditional regulation of c-myc transcription by temperature-sensitive v-abl.
Mol. Cell. Biol.
9:5685-5695[Abstract/Free Full Text].
|
| 6.
|
Cowling, G. J., and T. M. Dexter.
1994.
Apoptosis in the haemopoietic system.
Philos. Trans. R. Soc. Lond. Ser. B
345:257-263[Medline].
|
| 7.
|
Datta, S. R.,
H. Dudek,
X. Tao,
S. Masters,
H. Fu,
Y. Gotoh, and M. E. Greenberg.
1997.
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell
91:231-241[Medline].
|
| 8.
|
Devos, R.,
G. Plaetinck,
J. Van-der-Heyden,
S. Cornelis,
J. Vandekerckhove,
W. Fiers, and J. Tavernier.
1991.
Molecular basis of a high affinity murine interleukin-5 receptor.
EMBO J.
10:2133-2137[Medline].
|
| 9.
|
Dexter, T. M.,
A. D. Whetton, and C. M. Heyworth.
1986.
The relevance of protein kinase C activation, glucose transport and ATP generation in the response of haemopoietic cells to growth factors, p. 163-169.
In
P. Kahn, and T. Graf (ed.), Oncogenes and growth control. Springer-Verlag Press, Berlin, Germany.
|
| 10.
|
Dignam, J.,
R. Lebovitz, and R. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 11.
|
Endo, T. A.,
M. Masuhara,
M. Yokouchi,
R. Suzuki,
H. Sakamoto,
K. Mitsui,
A. Matsumoto,
S. Tanimura,
M. Ohtsubo,
H. Misawa,
T. Miyazaki,
N. Leonor,
T. Taniguchi,
T. Fujita,
Y. Kanajura,
S. Komiya, and A. Yoshimura.
1997.
A new protein containing an SH2 domain that inhibits JAK kinases.
Nature
387:921-924[Medline].
|
| 12.
|
Gearing, D. P.,
J. A. King,
N. M. Gough, and N. A. Nicola.
1989.
Expression cloning of a receptor for human granulocyte-macrophage colony-stimulating factor.
EMBO J.
8:3667-3676[Medline].
|
| 13.
|
Gorman, D. M.,
N. Itoh,
T. Kitamura,
J. Schreurs,
S. Yonehara,
I. Yahara,
K. Arai, and A. Miyajima.
1990.
Cloning and expression of a gene encoding an interleukin 3 receptor-like protein: identification of another member of the cytokine receptor gene family.
Proc. Natl. Acad. Sci. USA
87:5459-5463[Abstract/Free Full Text].
|
| 14.
|
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline responsive promoters.
Proc. Natl. Acad. Sci. USA
89:5547-5551[Abstract/Free Full Text].
|
| 15.
|
Hara, T., and A. Miyajima.
1992.
Two distinct functional high affinity receptors for mouse interleukin-3 (IL-3).
EMBO J.
11:1875-1884[Medline].
|
| 16.
|
Hayashida, K.,
T. Kitamura,
D. M. Gorman,
K. Arai,
T. Yokota, and A. Miyajima.
1990.
Molecular cloning of a second subunit of the receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF): reconstitution of a high-affinity GM-CSF receptor.
Proc. Natl. Acad. Sci. USA
87:9655-9659[Abstract/Free Full Text].
|
| 17.
|
Hileman, M. R.,
B. S. Chapman,
S. Rabizadeh,
V. V. Krishnan,
D. Bredesen,
N. Assa-Munt, and L. A. Plesniak.
1997.
A cytoplasmic peptide of the neurotrophin receptor p75NTR: induction of apoptosis and NMR determined helical conformation.
FEBS Lett.
415:145-154[Medline].
|
| 18.
|
Hummler, E.,
T. J. Cole,
J. A. Blendy,
R. Ganss,
A. Aguzzi,
W. Schmid,
F. Beermann, and G. Schutz.
1994.
Targeted mutation of the CREB gene: compensation within the CREB/ATF family of transcription factors.
Proc. Natl. Acad. Sci. USA
91:5647-5651[Abstract/Free Full Text].
|
| 19.
|
Itoh, N.,
S. Yonehara,
J. Schreurs,
D. M. Gorman,
K. Maruyama,
A. Ishii,
I. Yahara,
K. Arai, and A. Miyajima.
1990.
Cloning of an interleukin-3 receptor: a member of a distinct receptor gene family.
Science
247:324-327[Abstract/Free Full Text].
|
| 20.
|
Jacobson, M. D.,
M. Weil, and M. C. Raff.
1997.
Programmed cell death in animal development.
Cell
88:347-354[Medline].
|
| 21.
|
Kinoshita, T.,
M. Shirouzu,
A. Kamiya,
K. Hashimoto,
S. Yokoyama, and A. Miyajima.
1997.
Raf/MAPK and rapamycin-sensitive pathways mediate the anti-apoptotic function of p21Ras in IL-3-dependent hematopoietic cells.
Oncogene
15:619-627[Medline].
|
| 22.
|
Kinoshita, T.,
T. Yokota,
K. Arai, and A. Miyajima.
1995.
Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoietic cells.
Oncogene
10:2207-2212[Medline].
|
| 23.
|
Kinoshita, T.,
T. Yokota,
K. Arai, and A. Miyajima.
1995.
Suppression of apoptosis death in hematopoietic cells by signalling through the IL-3/GM-CSF receptors.
EMBO J.
14:266-275[Medline].
|
| 24.
|
Kitamura, T.,
N. Sato,
K. Arai, and A. Miyajima.
1991.
Expression cloning of the human IL-3 receptor cDNA reveals a shared beta subunit for the human IL-3 and GM-CS |