INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The p53 tumor suppressor plays a central role in the cellular response to DNA damage and blocks the proliferation of cells which have undergone genomic damage. Exposure of cells to genotoxic stress activates p53 as a transcription factor capable of regulating a wide range of downstream genes involved in G₁ arrest, in DNA repair, and in apoptosis (for recent reviews, see references 13, 20, and 26). The p53 protein has two separate domains involved in DNA binding. The central core domain (residues 98 to 303) is responsible for binding to sequence-specific DNA elements located near promoters of downstream target genes (3, 39, 49). p53 can also form stable complexes with "nonspecific" DNA targets, including mismatched DNA (or lesion DNA [L-DNA]), double-strand breaks, single-stranded DNA (ssDNA), and Holliday junction structures (1, 16, 22, 23, 36, 37, 40). Interaction with abnormal DNA involves the carboxyl-terminal domain of p53 (residues 363 to 392), and the p53-DNA complexes may serve to recruit other proteins which function in DNA repair. Interaction with sites of DNA damage may also contribute to the activation of p53 by inducing proteolytic cleavage with removal of negative regulatory domains from the protein (38).

Treatment of cells with inhibitors of nucleotide biosynthesis can also activate a p53 response with induction of G₁ arrest (27; reviewed in reference 19). This suggests that p53 can respond to altered levels of nucleotides within cells. The mechanism of p53 activation under such conditions is unknown. One possibility is that limiting levels of nucleoside triphosphates (or their precursors) lead to abnormal DNA and/or RNA within the cell, thus indirectly activating a p53 response. Another possibility is that p53 directly interacts with ribonucleotides and, in nondamaged cells, this contributes to the normal cellular function(s) of p53. Indeed, there is some evidence that p53 may play a role in the maintenance of cellular nucleotide pools. p53 was identified as a possible regulator of guanine synthesis at the step of IMP conversion to XMP (42). A link with adenosine metabolism is also indicated since a functional p53 response element is located in the first intron of the adenosine deaminase gene (21). In addition, a direct interaction between p53 and nucleotides is possible, and p53 protein binds ATP at its C terminus (4) and ATP facilitates the release of p53 from sites of DNA damage (34, 38).

In the present study, we have examined the effects of nucleotides on p53-DNA interactions in more detail by using murine and human p53s and specific and nonspecific DNA targets. The experimental model used p53-DNA complexes that were formed in vitro and incubated with different nucleotides. We observed that ATP, dATP, GTP, and dGTP facilitated the release of p53 from both sequence-specific and nonspecific DNA targets but, importantly, did not interfere with p53 binding to the DNA. In contrast, ADP and dADP stabilized p53-DNA complexes, and we demonstrated that tetramerization of p53 was required for this effect. Further experiments showed that p53, purified from a baculovirus expression system, was associated with Mg²⁺-dependent ATPase and GTPase activities: however, hydrolysis was not required for the release of p53 from DNA. The characteristics of the system bear a striking resemblance to the human mismatch recognition complex hMSH2-hMSH6, which functions as an ATP/ADP-dependent molecular switch. Thus, the hMSH2-hMSH6 complex binds mismatched DNA in the ADP-bound form (on) but not in the ATP-bound form (off) (14; reviewed in reference 10). Our results indicate that DNA binding by p53 is also on when bound to ADP and off when bound to ATP. Moreover, we also show that ADP-p53 can be dissociated from DNA by specific protein-protein interactions, raising the possibility that ADP-p53 functions as a molecular matchmaker for recruiting protein complexes to specific sites on DNA, followed by dissociation of p53 from the complex.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction of p53 derivatives and mutants. Wild-type murine p53 cDNA was used as a template to produce the truncated p53 derivatives. PCR primers were designed to generate cDNAs 50N (residues 24 to 392), 50C (residues 1 to 363), and 40NC (residues 67 to 363) and C-terminal peptide (residues 323 to 363). All generated PCR fragments were His tagged at the amino terminus and cloned under the T7 promoter into the pBluescript II SK(+) vector. Plasmids containing p53 cDNAs coding for R273H, R175H, and M340Q/L344R mutants were kindly made available by Trevor Mee. All cloned cDNAs were verified by DNA sequencing.

p53 produced in vitro. Transcription and translation were carried out as described previously (33) with plasmids encoding wild-type human p53, murine p53, or its derivatives under the SP6 or T7 promoters. The produced proteins were checked by immunoprecipitation with anti-p53 monoclonal antibodies PAb248, PAb246, PAb1620, PAb240, and PAb421 as described previously (33).

Expression, purification, and analysis of baculovirus-produced p53. Recombinant baculovirus coding for His-tagged murine p53 was expressed in Sf9 insect cells as described previously (34) and p53 was purified as described previously (38). The final buffer used for the purified p53 contained 50 mM NaCl, 10 mM Tris-HCl (pH 7.0), and 5 mM dithiothreitol (DTT). p53 protein was quantitated by the Bradford assay (compared to a bovine serum albumin standard [Boehringer Mannheim]), and its purity was checked by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by either Coomassie or silver staining. A single band corresponding to p53 was observed in all cases (for an example, see Fig. 4A). For immunoblotting, protein samples were separated by SDS-PAGE (15% polyacrylamide) and probed with PAb240 anti-p53 monoclonal antibody as described previously (38). Detection was performed with the Boehringer Mannheim chemiluminescence blotting kit.

Oligonucleotides for binding assays. The following biotinylated oligonucleotides were used: p53-consensus (CON; 20 bases, biotinylated at the 5' end) (5'-GGACATGCCCGGGCATGTCC-3') (12) and L-DNA (5'-GGCTCGAAC CCGTTCTCGGAGCACCCCTGCCCCAGCCCAACCGCTTTGGCCGCCG CCCAGCC-3') (62 bases) (22), where triple cytosine lesions are underlined. The oligonucleotides were annealed as follows: CON to itself and L-DNA oligonucleotide to the reverse sequence 5'-GGCTGGGCGGCGGCCAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCGAGCC-3' (53 bases). The latter was used also as an ssDNA template for binding assays. For NL-DNA (dsDNA with blunt double-strand ends), we used oligonucleotides with the same sequence as L-DNA but missing the triple cytosine lesions.

DNA binding and release assay with magnetic beads. Streptavidin-coated magnetic beads (M-280 Dynabeads; Dynal) were used to harvest biotinylated DNA-protein complexes. dsDNA or ssDNA oligonucleotides were bound to the beads (typically 75 pmol of oligonucleotide per 40 µl of beads for each reaction) in Tris-EDTA (pH 7.5)-1 M NaCl (TE-NaCl) for 15 min at 20°C and washed twice with 400 µl of TE-NaCl and twice with 400 µl of DNA binding buffer (20 mM Tris-HCl [pH 7.5], 100 mM NaCl, 0.1% NP-40, 10% glycerol, 5 mM DTT) to remove nonbound DNA. The supernatant was replaced with fresh 50 µl of DNA binding buffer containing either 25 pmol of purified p53 (in buffer [50 mM NaCl, 10 mM Tris-HCl at pH 7.0, 5 mM DTT]) or a 10-µl aliquot of an in vitro translation reaction mixture. Typically, 40 µl of beads was used in a total reaction volume of 50 µl. After a 20-min incubation at room temperature, the p53-DNA complexes were collected on a magnetic harvester, washed four times with 400 µl of DNA binding buffer to remove all free p53, resuspended in 50 µl of DNA binding buffer, and incubated under the conditions of the experiment. When nucleotides were present, the final concentration of each was 5 mM. After addition of the nucleotide, samples were incubated for 10 min at 37°C (unless otherwise stated). The ATP-regenerating system, when present, contained 4mM ATP, 0.025 U of creatine phosphokinase per ml, 5 mM phosphate creatine, and 0.25 mg of bovine serum albumin per ml. For experiments studying the effect of magnesium, the final concentration of MgCl₂ was 5 mM. No difference in the efficiency of initial p53 binding to DNA was observed in the presence or absence of Mg²⁺ or in the presence of an ATP-regenerating system.

Hydrolysis assay and TLC. Purified p53 (5 pM) was added to the reaction mixture containing [³³P]ATP, [³³P]dATP, or [³³P]GTP. The reactions were typically carried out in a total volume of 21 µl, comprising 10 µl of protein sample, 10 µl of the reaction buffer (50 mM NaCl, 10 mM Tris-HCl [pH 7.0]), and 1 µl of radiolabelled nucleoside triphosphate either neat (5 pM) or diluted 1:5 (1 pM). When magnesium was present, the final concentration was 5 mM MgCl₂. All reaction mixtures were incubated at 37°C for 1 h (except the time course samples). Aliquots (4 µl) from each reaction mixture were analyzed by thin-layer chromatography (TLC) on PEI cellulose F plates (Merck) with 0.3 M sodium phosphate buffer (pH 3.5) as the mobile phase. After the chromatography, the TLC plates were air dried and analyzed by autoradiography. The autoradiography image was used to locate the zones of the TLC plate corresponding to the initial substrates and products of hydrolysis, these zones were cut out, and radioactivity was quantitated by scintillation counting.

Gel mobility shift assay. Equal aliquots of in vitro-translated p53 were incubated with 5 ng of ³²P-5'-end-labelled self-annealed double-stranded CON-DNA, in DNA binding buffer in a final volume of 50 µl. After 20 min of incubation at a room temperature, appropriate amounts of adenosine nucleotides were added (see Fig. 6) and incubation was continued for another 10 min. Where stated, 20 µl of hybridoma supernatant of anti-p53 monoclonal antibody was added and the mixture was incubated for another 5 min. If the antibody was not added, the final volume of the reaction mixture was adjusted by addition of 20 µl of DNA binding buffer. Complexes were loaded onto a native 4% polyacrylamide gel in TBE (containing 1 mM EDTA) and electrophoresed for 4 h at 120 V with water cooling (8 to 12°C). The gels were exposed for autoradiography at 70°C with aluminum foil placed between the gel and the X-ray film to cut out the signal from the [³⁵S]methionine.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Previously we have shown that addition of ATP induces the release of p53 from mismatched DNA and ssDNA (34, 38). We have now studied in more detail the effects of ATP and other nucleotides on the interaction of p53 with DNA, by using both sequence-specific and nonspecific DNA targets. The results presented are for sequence-specific DNA (CON-DNA [12]) and mismatched DNA targets (22). Other nonspecific DNA targets included ssDNA and dsDNA with double-strand breaks (see Materials and Methods for details).

ATP and ADP have opposing effects on the stability of p53-DNA complexes. Radiolabelled p53 protein was obtained by in vitro translation with rabbit reticulocyte lysate (see Materials and Methods). The experimental assay used p53-DNA comlexes formed in vitro with biotinylated oligonucleotides bound to streptavidin-coated magnetic beads (Fig. 1A). p53-DNA beads were incubated at 37°C in the presence of different nucleotides. Both supernatant (released p53) and beads (DNA-bound p53) were analyzed by SDS-PAGE (15% polyacrylamide) plus autoradiography. Examples of p53 binding to different oligonucleotide targets are shown in Fig. 1B. In general, the observed binding efficiency was 25 to 30% of the total input radiolabelled p53. The lower efficiency of binding to ssDNA (Fig. 1B) is consistent with previously published results from other laboratories (23, 37). Control incubations demonstrated that there was no binding of radiolabelled p53 to the beads alone (i.e., in the absence of oligonucleotide [Fig. 1B, beads lane]).

View larger version (18K): [in this window] [in a new window]   FIG. 1.   Scheme of the DNA binding and release assay. (A) Streptavidin-coated magnetic beads were used to bind biotinylated oligonucleotide targets. After washing, the DNA-bound beads were incubated with p53. Bound p53-DNA complexes on the beads were washed (to remove nonbound p53) and incubated in fresh buffer, with or without nucleotides, for 10 min at 37°C (or longer for time course experiments). Subsequently the released p53 (in solution) and DNA-bound p53 were analyzed by scintillation counting (for radiolabelled p53) and PAGE (15% polyacrylamide) followed by immunoblotting or autoradiography. (B) Binding of 35S-labelled p53 to magnetic beads coated with different oligonucleotides (detailed in Materials and Methods). An aliquot of beads without DNA was included as negative control (beads lane). Other lanes: CON-DNA, beads prebound with a consensus sequence-specific p53 DNA binding site; L-DNA, dsDNA containing triple insertion-deletion lesion; NL-DNA, dsDNA with blunt ends (the bottom strand of NL-DNA alone was used as ssDNA target) (see Materials and Methods). RNA was obtained by in vitro transcription from p53 cDNA under the T7 promoter by using biotinylated UTP. The faster-migrating band (below p53) represents a truncated p53 product that is routinely observed for in vitro-translated p53. wt, wild type.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Nucleotide-induced release of 35S-labelled p53 from specific (CON-DNA) and nonspecific (L-DNA) targets. (A) In vitro-translated p53 was bound to either CON-DNA or L-DNA beads as indicated and incubated in the presence of different nucleotides (Fig. 1). DNA-bound p53 and released p53 were quantitated by scintillation counting. Bars represent the percentage of released p53 with respect to released plus bound p53. (B and C) Comparison of the release of p53 from specific and nonspecific DNA targets incubated with either adenosine or guanosine nucleotides. Equal aliquots of p53 bound to DNA-beads were incubated in the presence of adenosine nucleotides (B) or guanosine nucleotides (C). (D) Release of p53 from CON-DNA-beads after incubation with different nucleotides in the presence or absence of an ATP-regenerating system. p53 released from the DNA was analyzed by PAGE (15% polyacrylamide). The control consisted of p53 released in the absence of nucleotide addition.

Tetramerization is required for nucleotide-dependent regulation of the stability of p53-DNA complexes. Our next experiments were designed to identify the domain(s) of p53 required for ATP/ADP-dependent regulation of p53-DNA interaction. For this purpose, we compared the following series of p53 constructs: Arg175His, Arg273His, a C-terminal peptide (residues 323 to 392), p53 N50 (residues 24 to 392), p53 C50 (residues 1 to 363), and p53 40NC (residues 67 to 363). Throughout this series of p53 mutants, the oligomerization domain was intact. To ask if modification of the oligomerization domain can affect ATP-induced dissociation and/or ADP stabilization of p53-DNA complexes, we also included a double mutant, M340Q/L344R, which is dimeric but retains "wild-type" p53 immunological conformation, reactive with PAb1620 and nonreactive with PAb240 (8, 31).

View larger version (64K): [in this window] [in a new window]   FIG. 3.   Release of p53 from DNA: effects of nucleotides on different p53 mutants. (A) Nucleotide-induced release of 35S-labelled p53 mutants from DNA targets (see the text for details). Equal aliquots for each p53 mutant were bound to DNA-beads and were incubated in the presence of different nucleotides as detailed in the legend to Fig. 1 and Materials and Methods. No nucleotide was added in the control lane. (B) Summary of results obtained from four independent experiments with each p53 protein. The major structural domains of p53 are also indicated. Nt, N terminus; Ct, C terminus; 4×, tetramerization domain. Sites of point mutations are indicated by crosses. *, dimeric p53 forms DNA complexes with a shorter half-life than that of wild-type p53 (see the text).

p53 can hydrolyze ATP and GTP. Having demonstrated that ATP and GTP induce the release of p53 from p53-DNA complexes (Fig. 2), we wished to determine whether p53 has the capacity to hydrolyze ATP and/or GTP. For this purpose, we used nucleoside triphosphates radiolabelled at the -phosphate position ([-³³P]ATP) or the -phosphate position ([-³³P]GTP) and p53 purified from a baculovirus expression system (Fig. 4A) (see Materials and Methods). Radiolabelled ATP or GTP was incubated with p53 for 60 min at 37°C. The release of radiolabel was determined by TLC and autoradiography. In all cases, we observed hydrolysis of the nucleoside triphosphates, with the release of radiolabelled P_i for [-³³P]ATP (Fig. 4B) and radiolabelled GDP for [-³³P]GTP (Fig. 4C). This indicates cleavage at the - phosphoanhydride bond of the triphosphate. Hydrolysis was Mg²⁺ dependent and copurified with p53 (results not shown). Negative control incubations included an extract from the Sf9 cells infected with wild-type baculovirus and subjected to the same purification scheme as the p53-producing cell extract. These controls showed no evidence of ATP or GTP hydrolysis (Fig. 4B and C, control lanes).

View larger version (42K): [in this window] [in a new window]   FIG. 4.   p53 is able to hydrolyze ATP and GTP. (A) Recombinant p53 was purified, and increasing amounts of purified protein were separated by PAGE (15% polyacrylamide) and stained with Coomassie blue. Lanes: 1, 0.5 µg of recombinant p53; 2, 4 µg; 3, 8 µg. The positions of molecular weight standards are indicated in thousands. (B and C) Equal amounts of purified p53 were incubated in the presence of [-33P]ATP (B) or [-33P]GTP (C). Samples were incubated for 60 min at 37°C and analyzed by TLC (see Materials and Methods). The amount of labelled ATP (GTP) was 5 pM or, for a 1:5 dilution, 1 pM. The amount of the p53 added, when indicated, was approximately 5 pM (calculated for the tetrameric protein). The negative control was an equivalent aliquot of cell lysate from cells infected with wild-type virus (see the text for details). (D and E) Experiment where equal amounts (1 pM) of [-33P]ATP (D) or [-33P]GTP (E) were incubated in the presence of decreasing concentrations of purified p53, as indicated. Approximately 5 pM p53 was used as the initial concentration (lane 1), providing a protein-to-substrate ratio of 5:1 (for tetrameric protein). Arrows indicate the positions of radiolabelled substrates and products. (F) Time course analysis of the efficiency of nucleoside triphosphate hydrolysis by p53. Equal amounts of p53 were incubated in the presence of radiolabelled nucleotides (protein-to-substrate ratio, 5:1). After the indicated times, aliquots of the reaction products were loaded onto a TLC plate and the products were separated by TLC and quantitated by scintillation counting (see Materials and Methods).

1

Hydrolysis of ATP is not required for p53-DNA dissociation. Having demonstrated that p53 has intrinsic ATPase and GTPase activities (Fig. 4), we asked whether this activity is coupled with the ability of ATP and GTP to dissociate p53-DNA complexes (Fig. 2). We reasoned that if hydrolysis is required for dissociation, the ATP analogue ATP--S should not support dissociation, since this compound cannot be efficiently hydrolyzed at the - phosphoanhydride bond. However, ATP--S and ATP gave virtually identical results over a period of 60 min (Fig. 5A), indicating that ATP hydrolysis is not required for dissociation of p53-DNA complexes. This suggests that the ability of ATP to dissociate p53-DNA complexes may involve allosteric changes induced by ATP (and ATP--S) in the p53 protein.

View larger version (15K): [in this window] [in a new window]   FIG. 5.   Hydrolysis of ATP is not required for dissociation of p53-DNA complexes. (A) Time course analysis of p53 release from sequence-specific DNA. Samples were incubated with ATP, ATP--S, or ADP. Controls involve incubations without nucleotide addition. After the given times (5, 10, 20, 30, and 60 min), fractions of released and DNA-bound p53 were quantitated by scintillation counting. (B) p53-DNA complexes were initially stabilized with ADP and subsequently incubated with nucleotides as described above. For both experiments, the data represent an average of four independent experiments. "beads," control incubation of beads, to which p53 was bound without DNA and subsequently washed (see Fig. 1A and Materials and Methods) to remove unbound protein before the incubation.

ADP-p53-DNA complexes can be dissociated by protein-protein interaction. The results shown in Fig. 2, 3, and 5 indicate that ADP stabilizes p53-DNA complexes. This was investigated further by gel shift analysis with in vitro-translated p53 and radiolabelled CON-DNA. The anti-p53 monoclonal antibody PAb421 is routinely added to stabilize p53-DNA complexes for gel shift analysis (12). We now asked if ADP can substitute for PAb421 to give stable p53-DNA complexes detectable by a gel shift assay. Our results show that ADP stabilizes the p53-DNA complexes and that the effect is concentration dependent, with no further increase observed between 2.5 and 5.0 mM ADP (Fig. 6A, lanes 1 to 4).

View larger version (38K): [in this window] [in a new window]   FIG. 6.   Stabilization of the p53-CON-DNA complex by ADP and comparison of wild-type tetrameric p53 with dimeric p53. (A) Gel mobility shift assay of wild-type (wt) p53-CON-DNA complexes in the presence of increasing amounts of ADP (lanes 1 to 4, as indicated) or with a constant amount of ADP (5 mM; lanes 5 to 9). Where relevant, the addition of different monoclonal antibodies or 10 mM ATP is indicated. Upper bands in lanes with PAb421 and PAb248 represent antibody supershifts of the p53-DNA complexes. (B) Gel mobility shift assay of dimeric p53 complexed with CON-DNA in the presence of 5 mM ADP (lane 10) or PAb421 (lane 11). Results obtained in the absence of ADP and PAb421 are equivalent to those obtained in the presence of ADP. The faster-migrating band, below the p53-DNA complexes, is derived from a component present in the rabbit reticulocyte lysate. It is routinely observed in negative control translations (without mRNA [not shown]) and is reduced by addition of certain hybridoma supernatants, including PAb1620.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

p53 functions as a molecular switch. Our present results demonstrate that ATP and ADP have opposing effects on the interaction of p53 with DNA: ATP dissociates p53-DNA complexes, whereas ADP blocks dissociation (Fig. 2 and 6). We also show that p53 has ATPase activity and that this activity is not coupled to the dissociation of p53-DNA complexes (Fig. 4 and 5). Although ATP can dissociate p53-DNA complexes, it does not block the binding of p53 to ssDNA (38). We now show that ATP is able to induce only partial release of p53 from dsDNA (sequence-specific or nonspecific with mismatches). Considering the amounts of ATP in the reaction mixture (up to 5 mM) relative to DNA (100 pmol) and p53 (approximately 10 pmol for purified protein and in the femtomolar range for in vitro translated p53), we cannot explain the ATP-induced release of p53 by competition between ATP and DNA for the DNA-binding surface on p53. These overall observations lead us to suggest that the ATPase activity of p53 may serve to convert ATP-p53 to ADP-p53 and thus promote stable DNA binding (represented schematically in Fig. 7). The DNA-bound form of p53 can subsequently be dissociated by ATP, possibly by an allosteric mechanism (see below). In this model, the ATP- and ADP-bound p53 represent the off and on forms of p53 for DNA binding, respectively.

View larger version (21K): [in this window] [in a new window]   FIG. 7.   Schematic representation of the ATP/ADP-dependent molecular switch for p53-DNA binding (see Discussion).

1

A possible mechanism of ATP/ADP-dependent modulation of p53. Our results demonstrate that ATP/ADP operate a molecular switch to regulate DNA binding by p53. We also identify p53 dimer-dimer interaction as possibly important for this regulation. As yet, we do not know how ATP influences p53 at the structural level. One possibility is that ATP binding modifies the interhelical angles within the C-terminal tetramerization domain, with knock-on effects on the overall quaternary structure of the protein and its DNA binding properties. This would be consistent with the observed variation in the angles of subunit interaction at the dimer-dimer interface of the tetramerization domain (6, 7, 17, 24, 32) and with ATP interaction at a C-terminal DNA binding site (4). It would also accommodate the hypothesis that to form a stable complex with specific DNA, p53 must switch from dihedral symmetry with low affinity for DNA binding to an asymmetric state with high-affinity binding (50). Dihedral symmetry of the p53 tetramer is provided by the oligomerization domain. We now show evidence that the quaternary structure provided by this domain is required for ATP/ADP-dependent modulation of p53-DNA stability (Fig. 3). The switch from a dihedral to an asymmetric form may help to relieve possible steric clashes between protein subunits within the tetramer, allowing tetrameric p53 to accommodate itself to the structure of the DNA site (2, 35).