Previous Article | Next Article 
Molecular and Cellular Biology, November 1999, p. 7630-7638, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
RPH1 and GIS1 Are
Damage-Responsive Repressors of PHR1
Yeun Kyu
Jang,
Ling
Wang, and
Gwendolyn B.
Sancar*
Department of Biochemistry and Biophysics,
School of Medicine, The University of North Carolina at Chapel Hill,
Chapel Hill, North Carolina 27599-7260
Received 2 June 1999/Returned for modification 20 July
1999/Accepted 9 August 1999
 |
ABSTRACT |
The Saccharomyces cerevisiae DNA repair gene
PHR1 encodes a photolyase that catalyzes the
light-dependent repair of pyrimidine dimers. PHR1
expression is induced at the level of transcription by a variety of
DNA-damaging agents. The primary regulator of the PHR1
damage response is a 39-bp sequence called
URSPHR1 which is the binding site for a
protein(s) that constitutes the damage-responsive repressor PRP. In
this communication, we report the identification of two proteins, Rph1p
and Gis1p, that regulate PHR1 expression through
URSPHR1. Both proteins contain two putative
zinc fingers that are identical throughout the DNA binding region, and
deletion of both RPH1 and GIS1 is required to
fully derepress PHR1 in the absence of damage. Derepression of PHR1 increases the rate and extent of photoreactivation
in vivo, demonstrating that the damage response of PHR1
enhances cellular repair capacity. In vitro footprinting and binding
competition studies indicate that the sequence AG4
(C4T) within URSPHR1 is the binding
site for Rph1p and Gis1p and suggests that at least one additional DNA
binding component is present in the PRP complex.
 |
INTRODUCTION |
In the yeast Saccharomyces
cerevisiae, more than 20 different genes are induced in response
to UV radiation and a variety of chemical agents that damage DNA
(1, 16). Induction is the final step in a series of events
that includes damage recognition, signal transduction, and modification
of transcription factors regulating expression of damage-responsive
genes. Damage recognition and/or early steps in signal transduction are
carried out by proteins encoded by RAD9, RAD17,
RAD24, and MEC3, while MEC1,
RAD53, and DUN1 encode downstream protein kinases
that are required for most transcriptional induction (reviewed in
reference 48). In contrast to the components of the
signaling pathway, little is known about the transcription factors that
act as downstream effectors of the pathway.
To date, two transcriptional regulators targeted by the
MEC1/RAD53 pathway have been identified: Swi6p and Crt1p
(also known as Rfx1p). Swi6p is the regulatory subunit for the
G1-specific transcription factors MBF and SBF. In response
to methyl methanesulfonate (MMS)-generated damage, Swi6p is
phosphorylated and represses transcription of the cyclin genes
CLN1 and CLN2, thereby contributing to delay of
G1 progression (41). Crt1p represses
transcription of the RNR2, RNR3, and
RNR4 genes by binding to X boxes found in the 5' flanking
regions of these genes. Hyperphosphorylation of Crt1p in response to
DNA damage or replication stress leads to dissociation of Crt1p from
the X boxes and derepression (20). Genes containing X boxes
or binding sites for MBF or SBF make up only a small subset of the
known damage-inducible genes in yeast. Thus, additional
damage-responsive regulators remain to be identified. Of particular
interest are regulators of genes encoding DNA repair enzymes.
PHR1 encodes the apoenzyme for the DNA repair enzyme
photolyase (31). Transcription of the gene is induced in
response to a large number of different DNA-damaging agents, as well as
by passage through the diauxic shift (38, 44). Three
promoter elements control basal-level and induced expression of
PHR1 (35). An upstream activation sequence,
UASPHR1, is required for both basal-level and
induced expression and is the promoter element responsible for
induction at the diauxic shift (44). The damage response is
regulated primarily through an upstream repressing sequence,
URSPHR1, which consists of a 39-bp region
containing a 22-bp palindrome (35, 39). Mutations within the
palindrome reduce or abolish repression, as does deletion of the entire
39-bp region, while transfer of URSPHR1 into the
context of a heterologous promoter both represses expression and
confers a low level of damage inducibility (35, 39). Crude extracts from nonirradiated cells contain a protein(s), called PRP,
that binds to this region, while extracts from irradiated cells do not
(39). Efficient derepression requires a third promoter element called an upstream essential sequence which consists of three
related elements (35). In this communication, we describe the isolation and initial characterization of two damage-responsive transcriptional regulators, RPH1 and GIS1, that
control PHR1 expression by binding to
URSPHR1.
 |
MATERIALS AND METHODS |
Plasmids.
Standard recombinant DNA techniques
(25) were used to construct the plasmids described here. The
structures of all plasmids were confirmed by restriction analysis and
in many cases by DNA sequence analysis across crucial regions.
pGBS116 is a 2µm-based PHR1-lacZ reporter plasmid
described previously (35, 38). pGBS408 is a derivative of
pBM1499 (15) in which the EcoRI fragment
containing UASGAL was replaced with a 53-bp
oligonucleotide containing URSPHR1 and
several flanking nucleotides (
32 to
83 of the PHR1
promoter [35]), thus placing HIS3
expression under the control of URSPHR1. The URS
fragment was generated by PCR using oligonucleotides
EcoRI-URStop (GAAGCAGTCGAATTCAACCTTAAGG) and
EcoRI-URSbot (TGTTCTGTGAATTCAATTGTAAAGAGG) as primers and pGBS116 as the template. (Oligonucleotide
sequences are given only when they differ from the wild-type sequence,
in which case alterations are indicated in italics. Numbering is relative to the first ATG in a given open reading frame [ORF]. A
prime indicates a sequence on the noncoding strand.) pGBS116 was also
used as the template in a PCR to produce pGBS759 and pGBS723. In
pGBS759, the AG4 sequence in the RPH1 binding
site in pGBS116 was mutated to TC3G by using
oligonucleotides mURS-TC3 (TCGCTTTTACTGGCGCCACTTTTCTTCCTCGTTTTTCGAGGAAGCAGTCAAATTAAACCTTACTTTGTGAAAGTATGCTTACTT) and BglIIbot (PHR1 66'
34'). pGBS723 is
a derivative of the CEN-ARS lacZ reporter plasmid pRW95-3
(49). It was constructed by using primers
Bam-URStop (CGGGATCCACCTTAAGGGGTGAAAGTATGC)
and Bam-URSbot (CGGGATCCTGTAAAGAGGAATAAGTGTCAA) to generate a
65-bp fragment containing URSPHR1 which was
inserted into BglII-digested pRW95-3. pLG669Z contains the
CYC1 promoter fused to lacZ and has been
described previously (18).
pGBS706 and pGBS707 (Fig.
1A) are
plasmids recovered from the yeast genomic library screen described
below and contain
GAL4AD-
RPH1 translational fusions. pGBS708 (Fig.
1A) is a derivative of pGBS707
from which a 2.2-kbp
BglII fragment of yeast genomic DNA was
removed.
A size-selected yeast genomic DNA library containing
HindIII restriction
fragments from strain GBS76
(
38) inserted into pBlueScript SK(+)
was screened by colony
hybridization (
3) for clones containing
RPH1.
Plasmid pGBS716 (Fig.
1B) was isolated in this screen and
contains the
entire
RPH1 ORF and approximately 1,500 bp of 5'
and 3'
flanking sequences. pGBS737 (Fig.
1B) contains
TRP1 flanked
by 557 bp of
RPH1 coding sequence and 473 bp of
RPH1 3' flanking
sequence and was used for targeted
disruption of
RPH1. pGBS712
contains the 3.8-kbp
HindIII fragment from pGBS716 cloned into
the
HindIII site of pRS415 (
42). PCR
amplification using primers
096Eco
top (
GIS1

604


585) and 096Eco
bot (
GIS1
4078'

4059') and
GBS76 (
38) genomic DNA yielded a 4.5-kbp
GIS1-containing fragment
which was cloned into the
EcoO109I site in pBlueScript SK(+),
generating pGBS718 (Fig.
1C). pGBS718

CT contains a 2.4-kbp
MscI-
BglII
fragment from pGBS718 inserted into the
BamHI and
HincII sites
of pBlueScript SK(+). Subsequently, a 186-bp
PstI-
Eco47III fragment
was deleted from this
construct and a 975-bp
Eco47III-
PstI fragment
containing
HIS3 from pJJ217 (
22) was inserted,
yielding pGBS742
(Fig.
1C). pDB81 (a kind gift from Hans Ronne)
contains the entire
GIS1 gene, including promoter sequences.
A
GIS1-containing
MluI-
SacI
fragment
from pDB81 was inserted into unique
SmaI and
SacI
sites
in pRS415, yielding pGBS207.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Restriction maps of yeast chromosomal inserts in
selected plasmids used in cloning and disruption of YER169w
(RPH1) and YDR096w (GIS1). Arrows
indicate the direction of transcription of genes indicated by boxes.
(A) Sketch of the region of chromosome V carrying YER169w
and adjacent genes which were included in the
GAL4AD-YER169w fusions that activated the
URSPHR1 reporter constructs. The chromosomal DNA
carried by plasmids pGBS706, pGBS707, and pGBS708 are indicated by the
black lines beneath the map. (B) Restriction map of the yeast
chromosomal DNA fragments carried by pGBS716 and by the derivative
plasmid pGBS737 which was used to disrupt YER169w. (C)
Restriction map of the 4.6-kbp chromosomal DNA fragment carried by
pGBS718 and of the gene disruption in plasmid pGBS742. Among the
SspI and Eco47III sites in the fragments, only
those sites used in subcloning and directed homologous recombination
are shown. Restriction sites in parentheses were lost during
subcloning.
|
|
Plasmids expressing glutathione
S-transferase (GST)-Rph1p
fusion proteins were constructed in pGEX18 (
30). pGBS727
contains
a 0.9-kbp
EcoRI-
BglII fragment from
RPH1 (Fig.
1B) subcloned into
pBlueScript SK(+). pGBS731,
which expresses the C-terminal third
of Rph1p fused to GST (Rph1p-CT),
was constructed by inserting
a 0.9-kbp
EcoRI-
XbaI
fragment from pGBS727 into pGEX18. pGST169w
contains the entire
RPH1 ORF fused to GST. The plasmid was constructed
in two
steps. The first 340 bp of the coding sequence of
RPH1 were
amplified in a PCR using
PFU polymerase, primers GBT169-Bam
CG
GGATCCCGATGACGAAACTAATC) and GBT169-BglII
(GA
AGATCTTCCGGAGGCACATAGTCC),
and pGBS716 as the
template. After digestion with
BamHI and
BglII,
the PCR product was subcloned into
BamHI-digested pGBS716.
The
resulting plasmid, pGBS733, contains
RPH1 flanked by a
unique
BamHI site 6 nucleotides 5' to the first ATG and a
SalI site immediately
3' to the yeast genomic insert. In the
second step, this
BamHI-
SalI
fragment was ligated
to pGEX18 digested with the same
enzymes.
pGBS763 carries a portion of
RAD2 and was constructed by
insertion of a 1.9-kbp
EcoO109I-
SacI fragment
from pNF2005 (
28)
into pBlueScript SK(+). A 2.0-kbp fragment
containing the
LEU2 gene from pJJ283 (
22),
flanked by a filled-in
HindIII site and
a
BamHI site, was ligated into
BglII-
EcoRV-digested pGBS763, yielding
the
RAD2 knockout plasmid
pGBS764.
Strains.
The parental S. cerevisiae strains used
in this study are listed in Table 1 and
were constructed and propagated by using standard techniques. RE1006
was transformed with PvuII-digested pGBS408, thereby
targeting insertion of the URSPHR1-HIS3 reporter
gene to LYS2. Ura+ transformants were
subsequently subjected to selection on 5-fluoroorotic acid, and stable
Ura
derivatives were tested by Southern analysis to
confirm integration of the reporter at LYS2 and loss of
URA3. The resulting strain, GBS157, was transformed with the
lacZ reporter plasmid pGBS723, generating GBS1659. Strain
GBS1391 carries a marked disruption of RPH1 and was
constructed by transforming YPH499 with a 1.8-kbp BamHI-MluI fragment from pGBS737 (Fig. 1B).
Replacement of RPH1 was confirmed by PCR of DNA from
Trp+ transformants using primer KO169-5' (RPH1
174
193) in combination with KOTRP-5' (TRP1 305'
285')
or KO169-out (RPH1 2966'
2948'). A marked disruption of
GIS1 was constructed by transforming YPH500 with a 1.5-kbp
SspI fragment from pGBS742 (Fig. 1C), yielding strain
GBS1396. Gene replacement was verified in His+
transformants by PCR using primers KO096-5' (RPH1
1033
1050) and KO096-3' (RPH1 2234'
2215') or KOHIS-5'
(HIS3 611
628). GBS1406 is a diploid strain obtained by
mating GBS1391 and GBS1396. Strains GBS1734, GBS1736, and GBS1738 are
haploid meiotic segregants of GBS1406. Strains GBS1867, GBS1869,
GBS1872, and GBS1875 contain marked deletions of rad2 and
were constructed by transforming YPH499, GBS1734, GBS1736, and GBS1738,
respectively, with a 3.5-kbp EcoO109I-SacI
fragment from pGBS764, selecting for Leu+ transformants.
Replacement of rad2 was confirmed by PCR using primers
KO-rad2-5' (RAD2 5
14) and KO-rad2-3' (RAD2
1889'
1872'). All other strains are derivatives of these and were
constructed by transformation with various plasmids as indicated in the
figure legends.
Library screening.
The GAL4AD fusion
yeast genomic library constructed by Paetkau and coworkers
(29) was screened for genes encoding proteins that bind to
URSPHR1. This library consists of
high-copy-number LEU2 plasmids carrying the Gal4
transcriptional activation domain fused to random yeast genomic DNA
fragments. We used three libraries covering all three possible reading
frames to transform GBS1659 and screened Leu+
His+ transformants for increased
-galactosidase activity
by using a nonlethal colony assay (13). Plasmids from
positive clones were recovered in Escherichia coli DH5
and used to transform naive GBS1659 to confirm the Leu+
His+ phenotype and increased
-galactosidase production.
Expression and purification of GST fusion proteins.
E.
coli BL21 was used for the expression of GST fusion proteins.
Cells were grown in Luria broth to an A595 of
0.5, at which point isopropyl-
-D-thiogalactopyranoside
(IPTG) was added to a final concentration of 0.5 mM and growth was
continued for 2 h at 27°C. Cells were lysed, and the
proteins were purified by glutathione affinity chromatography as
described by the manufacturer (Pharmacia). Both the fusion protein
containing only the Rph1p C-terminal region (Rph1p-CT) and the fusion
protein containing full-length Rph1p (Rph1) were proteolyzed to a
significant extent. Based upon the intensity of bands in sodium dodecyl
sulfate-polyacrylamide gels stained with Coomassie blue, we estimate
that approximately 30% of the protein in the Rph1p-CT preparations was
of the expected length while approximately 10% of the protein from the
Rph1p preparation was full length.
EMSAs and footprinting.
Radiolabeled substrate was prepared
by hybridization of oligonucleotides URStop
(PHR1
85
40) and URSbot (PHR1
40'
85') followed by end filling using Klenow fragment and
[
-32P]dATP using conditions previously described
(44). Unlabeled competitors were prepared by hybridization
of oligonucleotide pairs AG4TG (PHR1
85
65
and PHR1
65'
85') or various derivatives (see Fig. 6).
The buffer for Rph1 binding assays contained 4 mM Tris HCl (pH 8.0), 4 mM MgCl2, 40 mM NaCl, 10 µM ZnCl2, 10%
glycerol, bovine serum albumin at 100 µg/ml, 5 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, aprotinin at 10 µg/ml, soybean
trypsin inhibitor at 10 µg/ml, and leupeptin at 4 µg/ml. Rph1p or
Rph1p-CT was incubated on ice for 20 min with the various
oligonucleotides at the concentrations indicated in the figure legends.
Free and bound DNAs were separated by electrophoresis through 6%
polyacrylamide gels in 1× Tris-borate-EDTA and quantitated by
PhosphorImager analysis or an Ambis Radioanalytic System as previously
described (44).
32P-labeled substrates for footprinting were prepared by
using kinase-treated oligonucleotide UES
top
(
PHR1 
155


134) or PHR
10 (
PHR1
10'


10') as the primer in a PCR (
25) in which pGBS116
was the template. Copper phenanthroline (OP-Cu) footprinting was
performed as previously described (
39). For DNase I
footprinting,
2 ng of probe was incubated with various concentrations
of Rph1p-CT
or Rph1p at concentrations sufficient to produce 60 to 80%
bound
substrate as judged by electrophoretic mobility shift assay
(EMSA).
The binding buffer used was the same as that described above,
except that 0.5 µg of poly(dA-dT) was included. Following a 20-min
incubation on ice, 1 U of DNase I (Promega) and 1 µl of 50 mM
CaCl
2 were added, the reaction was allowed to proceed at
room
temperature for 45 s to 2 min, and then 20 µl of stop
solution
(1% sodium dodecyl sulfate, 200 mM NaCl, 20 mM EDTA, 40 µg
of
tRNA per ml) was added. The products were purified by phenol
extraction
and ethanol precipitation and displayed on 8%
polyacrylamide-7
M urea gels (
39).
In vivo expression and UV survival studies.
-galactosidase assays were performed as previously described
(44). Cells were grown in liquid YPAD or synthetic complete medium lacking appropriate components to maintain plasmid selection (40), and 1-ml samples were harvested at an
A600 of 0.1 to 0.5. The damage response was
assessed by using MMS (2.3 mM final concentration) or UV irradiation.
MMS was added to cultures at an A600 of 0.1 to
0.2, and cells were incubated at 30°C for 3 h prior to
harvesting. To correct for variations in reporter plasmid copy number,
DNA was extracted from control cultures (2), digested with
EcoRI, and subjected to Southern analysis (25).
Probe for plasmid-borne lacZ was synthesized in a PCR using
pGBS116 as the template and oligonucleotides lac-top (lacZ
571
592) and lac-bot (lacZ 2700'
2681'). Probe for the
single-copy chromosomal gene ACT1 was obtained by PCR of
YPH499 genomic DNA using the primers act-top (ACT1
405
428) and act-bot (ACT1 1414'
1393'). Probes were
labeled with either [32P]dATP (random primer method
[25]) or horseradish peroxidase (ECL; Amersham life
Science). Band intensity was determined by using a Molecular Dynamics
Storm 860 PhosphorImager and ImagQuant software.
For UV survival and photoreactivation experiments, cultures were
harvested in early log phase (
A600 of <0.3),
washed with
and suspended in phosphate-buffered saline, and irradiated
at
254 nm as previously described (
36). Following
irradiation,
aliquots of cells were transferred to culture tubes on a
tissue
culture roller drum placed 9 in. from a bank of two 15-W Cool
White fluorescent lamps. Cells were sampled at various times,
diluted,
and plated on YPAD, and surviving colonies were counted
after 3 days of
growth at 30°C in the
dark.
 |
RESULTS |
Identification of YER169w and GIS1
as putative regulators acting through URSPHR1.
We utilized the one-hybrid method to identify putative PRP-encoding
genes. URSPHR1 was inserted into the promoter regions of two reporter genes, HIS3 and lacZ, in
the reporter strain GBS1659. Because both reporter genes are devoid of
upstream activation sequences, GBS1659 is a histidine auxotroph and
produces extremely low levels of
-galactosidase regardless of
whether URSPHR1 is present. In principle,
expression of a gene encoding the DNA binding domain of PRP fused to
the transcriptional activation domain of GAL4 should confer
high-level expression of the reporter genes. We transformed GBS1659
with a series of GAL4 fusion yeast genomic libraries carried
on the 2µm LEU2 plasmids pDP4, pDP7, and pDP12
(29). Approximately two million Leu+
transformants from each library were tested for histidine prototrophy, and a total of 85 His+ Trp+ Leu+
clones were obtained. In a secondary screening for increased
-galactosidase activity using a colony color assay (13),
four of these clones (URS39, URS48, URS67, and URS72) consistently produced dark blue colonies on
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
indicator plates. Plasmids carrying the GAL4 fusion genes were rescued from these clones, and the DNA was sequenced at the 5' and
3' fusion sites. Each plasmid carried GAL4 fused in frame to
sequences from the carboxy-terminal half of yeast ORF
YER169w (17), followed by an intact copy of
ADK2 and variable amino-terminal portions of RAD3
(Fig. 1). Plasmids from transformants URS48 and URS67 were identical to
one another and were designated pGBS706; similarly, plasmids from URS39
and URS72 were identical and were designated pGBS707. To confirm that
the Gal4-Yer169w fusion protein was responsible for enhanced expression
from the reporter genes, a 2.2-kbp BglII fragment containing
the entire ADK2 gene and the RAD3 promoter and
translational start site was removed from pGBS707. The resulting
plasmid (pGBS708, Fig. 1) conferred histidine prototrophy and
high-level
-galactosidase expression on naive GBS1659, whereas the
vector alone had no effect on expression (data not shown).
YER169w is a 2,388-bp ORF with an unknown function that was
identified in the course of the
S. cerevisiae genome
sequencing
project (
9). It encodes a highly basic 90-kDa
protein containing,
near the carboxy terminus, a classical
C
2H
2 zinc finger followed
by a C
2HC
zinc finger (
6) (Fig.
2).
Deletion of the zinc fingers
abolishes transcriptional activation
by the Gal4-Yer169w fusion
protein in vivo (data not shown), suggesting
that the Zn fingers
are required for binding to
URS
PHR1. ORF
YER169w has
been
renamed
RPH1 (regulator of PHR1). Comparison of the
predicted
amino acid sequence of
RPH1 to all other yeast
ORFs revealed striking
homology to the protein encoded by
GIS1 (
9).
GIS1 has been
previously
isolated as an overexpression suppressor of
gig1-2 (
5), a mutation in the
SRB8 gene encoding a
subunit of the
cyclin C-dependent protein kinase complex
(
4). As is shown
in Fig.
2, the two proteins are 92.7%
identical over the 55-amino-acid
region comprising the zinc fingers of
the two proteins, 100% identical
in the regions of the zinc fingers
thought to interact with DNA,
and 34.7% identical overall. In addition
to the zinc finger region,
scattered regions of homology are found
throughout the molecules.
Two particularly interesting regions near the
amino terminus also
show 30 to 40% identity with human retinoblastoma
binding protein
2 (
14), human cDNA XE169 (
50),
the mouse
jumonji-encoded protein
(
45), and the
product of ZK593.4, a gene with an unknown function
identified during
the
Caenorhabditis elegans genome sequencing
project
(
8). While the function of this region is not known,
its
conservation across phylogenetic lines suggests it is an important
structural or functional motif.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the Rph1p and Gis1p proteins. The predicted
amino acid sequences of the proteins were aligned by using the program
WU-BLAST 2.0 (30a). Open boxes indicate the regions of homology to
RBP2, while filled boxes indicate the region containing the two zinc
finger motifs (6). The amino acids within the zinc fingers
thought to be involved in DNA binding are overlined. Asterisks indicate
identical amino acids.
|
|
RPH1 and GIS1 are required for repression
of PHR1.
We constructed targeted disruptions of
RPH1 and GIS1 to assess the effect of loss of
function on cell growth and viability and on PHR1
expression. Disruption of either RPH1 or GIS1 in
haploid strains of either mating type had no discernible effect on the viability of log-phase cells grown in YPAD at 30°C (data not shown), indicating that neither RPH1 nor GIS1 is an
essential gene under these conditions. This was confirmed by tetrad
analysis of sporulated GBS1406, a diploid strain in which a single copy
of each gene was disrupted; all four expected classes of segregants
were recovered, and there was no consistent difference in viability on
YPAD of any segregant class (data not shown). The effect of
RPH1 and GIS1 disruption on PHR1
expression was assessed by using pGBS116, which contains the intact
PHR1 promoter, including URSPHR1, fused to lacZ. As can be seen in Fig.
3A, strains containing a disruption of
either RPH1 or GIS1 displayed a modest increase in basal-level expression, as well as a decrease in the induction ratio
(defined as the ratio of damage-induced expression to basal-level expression), following treatment with the DNA-damaging agent MMS. Simultaneous disruption of both RPH1 and GIS1 had
a synergistic effect, producing a sixfold increase in basal-level
expression and a 50% decrease in the induction ratio. Both the
increase in basal-level expression and the decrease in the induction
ratio upon deletion of either or both genes are consistent with the encoded proteins acting as damage-responsive negative regulators of
PHR1. The synergistic effect observed when both genes are
disrupted suggests that the proteins are redundant with respect to
PHR1 repression. It is somewhat surprising, then, that while
multiple copies of RPH1 complement a deletion of
GIS1, multiple copies of GIS1 do not complement
an RPH1 deletion (Fig. 3). It is unlikely that this reflects
a unique requirement for RPH1 in PHR1 expression or GIS1 function, since GIS1 alone partially
restores repression in a
rph1
gis1 mutant (Fig. 3A).
At present, we believe that the failure of multiple copies of
GIS1 to complement an RPH1 deletion may be due to
differences in the expression levels of the two genes or in the
strength of repression conferred by the two proteins. RPH1
mRNA is approximately threefold more abundant in undamaged S. cerevisiae cells than is GIS1 mRNA
(19). In these experiments, extra copies of RPH1
and GIS1 are expressed from their own promoters and are
carried on centromeric plasmids that average one to two copies per
haploid genome (46). Thus, in all likelihood,
GIS1 was overexpressed only two- to threefold, a level that
is apparently insufficient to fully repress PHR1.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of deletion of RPH1 and
GIS1 on basal-level expression and damage induction of
PHR1. Strains YPH499, GBS1734, GBS1736, and GBS1738 were
transformed with a PHR1-lacZ reporter plasmid and with
pRS415, pGBS712 (RPH1), or pGBS207 (GIS1), and
the effect on expression was assessed with (cross-hatched bars) or
without (open bars) MMS treatment. The chromosomal genotypes are
indicated below the ordinate, and the induction ratio following MMS
treatment is indicated immediately above the chromosomal genotype.
Error bars show the standard deviations from three or four independent
determinations. (A) Effects on expression from a reporter plasmid
(pGBS116) that contains the intact PHR1 promoter. (B) Effect
on expression of a pGBS116 derivative (pGBS759) in which the
AG4 sequence has been mutated.
|
|
Rph1p binds to URSPHR1 in vitro.
While
the simplest interpretation of the in vivo data is that RPH1
and GIS1 encode DNA-binding proteins that recognize
sequences within URSPHR1, secondary or
indirect effects cannot be ruled out by these studies. Therefore, we
expressed the protein encoded by RPH1 in E. coli
and tested whether the purified protein binds specifically and with
high affinity to URSPHR1. EMSAs shown in Fig.
4 demonstrate that this is indeed the
case. Rph1p bound to an oligonucleotide containing
URSPHR1 (Fig. 4, lanes 2 and 8).
Sequence-specific binding was confirmed by competition studies in which
a homologous oligonucleotide competed much more efficiently for binding
of Rph1p than did a heterologous oligonucleotide (Fig. 4). Thus far,
excessive proteolysis and insolubility have made it impossible to
perform similar binding experiments with purified Gis1p.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 4.
EMSA testing the affinity and binding specificity of
Rph1p-CT for URSPHR1. 32P-labeled
URS oligonucleotide (20 nM), either without (lane 1) or incubated with
Rphp-CT (100 nM; lanes 2 to 14), was electrophoresed as described in
Materials and Methods. In lanes 3 to 7 and 9 to 14, the indicated
unlabeled competitor oligonucleotide was present during the incubation.
Competitor concentrations (lanes): 3 and 9, 200 nM; 4 and 10, 400 nM; 5 and 11, 1 µM; 6 and 12, 2 µM; 7 and 13, 4 µM; 14, 8 µM. Arrows
indicate the major Rph1p-URS complexes which appear as a doublet. We
believe this is due to partial proteolysis of Rph1p (see Materials and
Methods).
|
|
DNase I footprinting was used to determine the region within
URS
PHR1 that is bound by Rph1p. The 39-bp region
footprinted
by PRP contains a 22-bp palindrome, as well as flanking
sequences
(
39). Surprisingly, Rph1p protected only the 5'
portion of the
URS from attack by DNase I (Fig.
5). It should be noted that full-length
Rph1p and Rph1p-CT, which contains only the C-terminal one-third
of
Rph1p, including the zinc fingers, yielded identical DNase
I footprints
(Fig.
5A), thereby validating the use of Rph1p-CT
for DNA binding and
footprinting experiments. DNase I overestimates
the region of DNA in
intimate contact with binding proteins, and
therefore a more accurate
estimation of the DNA binding site was
obtained by using OP-Cu as a
footprinting agent. Rph1p protected
an 8-bp region, TAAGGGGT,
from attack on the top strand and a
10-bp region,
CCCCTTAAGG, on the bottom strand (Fig.
5B). The
protected
region partially overlaps the 39-bp region protected
by partially
purified PRP (
39). A likely explanation for the
smaller
footprint compared to PRP is that the latter is composed
of proteins in
addition to Rph1p and/or Gis1p. This is supported
by previous work
demonstrating that changing the four central
GC base pairs within the
URS
PHR1 palindrome to AT base
pairs abolishes
repression of
PHR1 in vivo (
35). However,
currently
we cannot rule out effects of proteolysis on the extent of
the
footprint (see Materials and Methods). That the Rph1p footprint
extends outside of the previously footprinted region may be due
to the
relatively weak OP-Cu cleavage at the boundary regions
or may reflect
conformational differences between Rph1p in isolation
versus Rph1p in a
multisubunit complex.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 5.
Footprinting of Rph1p on the PHR1
transcriptional regulatory region. Oligonucleotides containing the
PHR1 transcriptional regulatory region and labeled at the 5'
end on either the top or bottom strand were exposed to DNase I or OP-Cu
in the absence or presence of increasing concentrations of Rph1p-CT or
Rph1p as described in Materials and Methods. (A) Autoradiograms of the
partial digestion products separated on denaturing acrylamide gels. The
sequence of the oligonucleotide in the region of the footprint is shown
to the left of each autoradiogram. Lanes: , no protein added; A + G, products of a Maxam-Gilbert reaction which cleaves at A's and
G's. (B) Sequence within and surrounding the region footprinted by Prp
(gray area) and the region protected by Rph1p and Rph1p-CT from attack
by DNase I (brackets above and below the sequence) and by OP-Cu
(asterisks above and below the sequence).
|
|
Delineation of Rph1p binding specificity.
To further define
the binding specificity of Rph1p, we compared the ability of
oligonucleotides containing mutations within URSPHR1 to compete with the wild-type sequence
for binding of Rph1p in vitro. As can be seen in Fig.
6, oligonucleotides containing either a
deletion or a point mutation outside of the AG4 sequence
were still able to compete effectively for binding of Rph1p
(oligonucleotides AG4TG, URS406, and AG4TA). In
contrast, oligonucleotides containing mutations within the
AG4 sequence reduced competition to undetectable levels
(oligonucleotides CT3GTG, CT5G,
AG2AGTG, TG4TG, and AGAG2TG). The
one exception to this pattern was the oligonucleotide
AC4TG, in which the AG4 sequence was switched
to the bottom strand while retaining the same polarity. We conclude
that the AG4 sequence is both necessary and sufficient for
binding by Rph1p in vitro.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
Binding competition assays to determine the sequences
required for Rph1p binding. Radiolabeled URS oligonucleotide was
incubated with Rph1p-CT as described in the legend to Fig. 4, either in
the absence or in the presence of the indicated competing unlabeled
double-stranded oligonucleotides, and the bound and free portions of
the substrate were separated by electrophoresis and autoradiographed.
Two concentrations are shown for each competitor, 1 µM (lanes 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21) and 4 µM (lanes 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22). Lane 1 contained the substrate only, and lane
2 contained the substrate and Rph1p-CT without a competitor. Arrows
indicate the bound substrate. The sequences of the competitors are
shown below the autoradiograms. Sites changed relative to the wild-type
sequence are indicated by dots above the changed bases. The 12 bp 3' to
URSPHR1 are not shown for oligonucleotides URS
and URS406; however, they are identical.
|
|
To determine whether AG
4 is the sequence through which
Rph1p and Gis1p act in vivo, we constructed pGBS759, which contains
a
PHR1-lacZ fusion in which the AG
4 sequence in
URS
PHR1 was mutated to TC
3G, and
assayed expression of the reporter gene
in various genetic
backgrounds (Fig.
3B). This mutation reduced
induction in response to
MMS by 70 to 75% in strains with intact
RPH1 and
GIS1 genes and rendered expression of the reporter gene
almost completely insensitive to loss of either or both genes.
Together, these data strongly argue that Rph1p and Gis1p regulate
the
damage response of
PHR1 by binding to the AG
4
sequence in
URS
PHR1.
Derepression of PHR1 enhances UV survival.
To determine
whether derepression of PHR1 results in enhanced repair
capacity, we tested the survival of wild-type,
rph1,
gis1, and
rph1
gis1 strains following UV
irradiation, with or without subsequent photoreactivation. Strains
bearing deletions of rad2 were used because the effect of
photoreactivation on survival is often difficult to see in cells with
an intact nucleotide excision repair pathway. As can be seen in Fig.
7, deletion of rph1,
gis1, or both genes enhanced both the rate and extent of
light-dependent repair and the relative enhancement of survival
mirrored the enhanced PHR1 expression seen in these strains.
It should be noted that under these experimental conditions, both the
rate and extent of the light-dependent increase in survival are
decreased by the presence of 6-4 photoproducts which are lethal lesions
that are not repaired by the Phr1 photolyase (7, 32). Thus,
the survival data underestimate the extent of PHR1
derepression.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of derepression of PHR1 on the UV
survival of rad2 strains. Log-phase cells were exposed to
4.5 J of 254-nm radiation per m2 and then to
photoreactivating light as described in Materials and Methods. Samples
were taken at the indicated times and plated for survival
determination. The data points are averages from three independent
experiments, and the error bars indicate the standard deviation.
Symbols: , GBS1867 (RPH1 GIS1); , GBS1869
( rph1 GIS1); , GBS1873 (RPH1 gis1); ,
GBS1875 ( rph1 gis1).
|
|
 |
DISCUSSION |
In this work, we have identified the proteins encoded by
RPH1 and GIS1 as DNA damage-responsive repressors
of PHR1 transcription and have demonstrated that
derepression of PHR1 enhances light-dependent repair of
UV-induced DNA damage. Rph1p recognizes a single AG4 sequence found in previously defined URSPHR1,
and Rph1p binding to this site requires the two zinc fingers near the
carboxy terminus of the protein. The key residues for sequence-specific binding by zinc fingers are at positions
1, 2, 3, and 6 relative to
the beginning of the finger helix (reviewed in reference
21). These residues, and indeed all amino acids in
the helical domain of the fingers, are identical in Rph1p and Gis1p,
strongly suggesting that these two proteins recognize identical
sequences. Additionally, altering the AG4 sequence in
URSPHR1 eliminates Rph1p binding in vitro,
derepresses PHR1 expression, and almost entirely eliminates
the effects of deletion of RPH1 and GIS1 in vivo.
Together with the observation that both RPH1 and
GIS1 must be deleted to fully derepress PHR1
expression, the data indicate that RPH1 and GIS1
are functionally redundant with respect to PHR1 repression.
Several pairs of transcription factors that recognize identical
sequences have been identified in yeast; however, functional redundancy
of the type seen for RPH1 and GIS1 is unusual.
The repressors Mig1p and Mig2p regulate SUC2 expression, but
unlike Rph1p and Gis1p, Mig1p alone is sufficient to confer complete repression and Mig2p activity is only seen in strains lacking Mig1p
(24). Ace2p and Swi5p activate the CTS1 and HO
promoters, respectively, and can substitute for one another only when
present in high copy number or in specific genetic backgrounds
(11, 12). Perhaps the closest parallel to the functional
redundancy of RPH1 and GIS1 is the situation
observed with Msn2p and Msn4p, two activators of the multistress
response in yeast that bind to the STRE (stress response element)
(26, 37). While deletion of MSN2 reduces
expression from an STRE-driven reporter gene by 80% (37),
deletion of both genes is required to observe the full repertoire of
phenotypes associated with loss of the multistress response (17,
26). A further similarity among Msn2p, Msn4p, Rph1p, and Gis1p is
that each of these proteins binds specifically to the sequence
AG4 (26, 37, and this work). Preliminary
results indicate that deletion of RPH1 and GIS1
derepresses basal-level expression from an STRE-driven reporter gene
(33). This suggests either that there is cross talk between
the multistress response and the RPH1/GIS1 DNA damage
response pathway or that deletion of RPH1 and
GIS1 produces a signal that activates the stress response pathway.
An important question that remains to be addressed is whether
RPH1 and GIS1 regulate DNA damage-responsive
genes in addition to PHR1. The AG4 sequence
recognized by these proteins occurs much too often in the yeast genome
for a search based simply on this sequence to be meaningful.
Nevertheless, it is probably significant that one or more
AG4 sequences are found within 500 bp of the translational
start site of half of the 28 known damage-inducible DNA repair and
metabolism genes of yeast (PHR1, RAD5,
RAD6, RAD7, RAD16, RAD27,
RAD51, RAD54, DUN1, REV3,
RFX1 [CRT1], RNR2, RNR3, and RNR4 [1, 16, 20, 23, 27, 43, 47]),
while less than 20% of noninducible repair genes contain this
sequence. Since most of these damage-responsive genes are not induced
by heat shock, it is unlikely that the AG4 sequence is
targeted by Msn2p and Msn4p in these promoters. The availability of
MSN2, MSN4, RPH1, and GIS1
deletion mutants makes it possible to test directly whether
RPH1 and GIS1 control a damage response regulon
and whether MSN2 and MSN4 contribute to this response.
Repression by RPH1 and GIS1 differs in at least
two respects from that mediated by CRT1, a homolog of the
mammalian RFX family of DNA binding proteins and the only other
characterized regulator of damage-inducible DNA repair genes in yeast
(20). Despite the fact that the canonical RFX-X box contains
the AG4 sequence recognized by Rph1p and Gis1p, none of the
Crt1p binding sites thus far identified contain the AG4
sequence. In addition, repression by Crt1p requires the corepressors
Ssn6p and Tup1p. In contrast, repression by RPH1 and
GIS1 is TUP1 -independent (10).
Another striking difference is that derepression of
CRT1-regulated genes requires both the
RAD53 and DUN1 protein kinases (20)
while derepression of PHR1 requires RAD53 but not
DUN1 (34). Thus, it appears not only that there
are multiple damage-responsive transcriptional regulators but also that
the signal transduction pathway differs to some extent, depending upon
the target. This conclusion is consistent with studies by Kiser and
Weinert (23) that suggested that at least four
transcriptional pathways are activated by the damage response in yeast.
URSPHR1 was originally identified by OP-Cu
footprinting as a 39-bp region that is bound by a protein or proteins present in partially purified extracts from nonirradiated cells and
absent from extracts from UV-irradiated cells (39). The binding site for Rph1p identified in the current studies lies at the
extreme 5' end of URSPHR1 and includes only 2 bp
of a 22-bp palindrome which we have previously shown to be required for
repression of PHR1 (35). Taken together, these results indicate that an additional protein(s) is bound to
URSPHR1 in vivo. This may explain the residual
damage response of PHR1 when both RPH1 and
GIS1 are deleted (Fig. 3). In addition, the fact that
mutations in the palindrome abolish repression (35) indicates that the protein functions synergistically with Rph1p and
Gis1p to repress transcription of PHR1. Experiments are in progress to identify additional components of the repressor complex and
to determine the mechanisms that govern loss of DNA binding in response
to damage.
 |
ACKNOWLEDGMENTS |
We gratefully acknowledge Hans Ronne for providing
plasmids containing functional copies of GISI and for
sharing information prior to publication. We thank Errol Friedberg,
Louise Prakash, and Aziz Sancar for providing plasmids.
This work was supported by grant GM35123 from the National Institute of
General Medical Sciences.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Biophysics, CB# 7260, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7260. Phone: (919) 966-2077. Fax:
(919) 966-2852. E-mail: GwendolynSancar{at}med.unc.edu.
Present address: Department of Molecular Biology, College of
Natural Science, Seoul National University, Seoul 151-742, South Korea.
 |
REFERENCES |
| 1.
|
Aboussekhra, A.,
J. E. Vialard,
D. E. Morrison,
M. A. de la Torre-Ruiz,
L. Cernakova,
F. Fabre, and N. F. Lowndes.
1996.
A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription.
EMBO J.
15:3912-3922[Medline].
|
| 2.
|
Adams, A.,
D. E. Gottschling,
C. A. Kaiser, and T. Stearns.
1997.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 3.
|
Adzuma, K.,
T. Ogawa, and H. Ogawa.
1984.
Primary structure of the RAD52 gene in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:2735-2744[Abstract/Free Full Text].
|
| 4.
| Balciunas, D., and H. Ronne. 1999. Personal
communication.
|
| 5.
|
Balciunas, D., and H. Ronne.
1995.
Three subunits of the RNA polymerase II mediator complex are involved in glucose repression.
Nucleic Acids Res.
23:4421-4425[Abstract/Free Full Text].
|
| 6.
|
Bohm, S.,
D. Frishman, and H. W. Mewes.
1997.
Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins.
Nucleic Acids Res.
25:2464-2469[Abstract/Free Full Text].
|
| 7.
|
Brash, D. E.,
W. A. Franklin,
G. B. Sancar,
A. Sancar, and W. A. Haseltine.
1985.
Escherichia coli DNA photolyase reverses cyclobutane pyrimidine dimers but pyrimidine-pyrimidone (6-4) photoproducts.
J. Biol. Chem.
260:11438-11441[Abstract/Free Full Text], No. 21.
|
| 8.
| C. elegans Genome Project. November 1998, posting
date. C. elegans genome database website. [Online.]
http://www.sanger.ac.uk/Projects/C_elegans. [15 September 1999, last
date accessed.]
|
| 9.
| Cherry, J. M., C. Adler, C. Ball, S. Dwight, S. Chervitz, G. Juvik, T. Roe, S. Weng, and D. Botstein. 25 August
1999, posting date. Saccharomyces Genome Database. [Online.]
http://genome-www.stanford.edu/Saccharomyces/. [15 September 1999, last date accessed.]
|
| 10.
|
DeRisi, J. L.,
V. R. Iyer, and P. O. Brown.
1997.
Exploring the metabolic and genetic control of gene expression on a genomic scale.
Science
278:680-686[Abstract/Free Full Text].
|
| 11.
|
Dohrmann, P. R.,
G. Butler,
K. Tamai,
S. Dorland,
J. R. Greene,
D. J. Thiele, and D. J. Stillman.
1992.
Parallel pathways of gene regulation: homologous regulators SWI5 and ACE2 differentially control transcription of HO and chitinase.
Genes Dev.
6:93-104[Abstract/Free Full Text].
|
| 12.
|
Dohrmann, P. R.,
W. P. Voth, and D. J. Stillman.
1996.
Role of negative regulation in promoter specificity of the homologous transcriptional activators Ace2p and Swi5p.
Mol. Cell. Biol.
16:1746-1758[Abstract].
|
| 13.
|
Duttweiler, H. M.
1996.
A highly sensitive and non-lethal -galactosidase plate assay for yeast.
Trends Genet. Sci.
12:340-341.
|
| 14.
|
Fattaey, A. R.,
K. Helin,
M. S. Dembski,
N. Dyson,
E. Harlow,
A. Vuocolo,
M. G. Hanobik,
K. M. Haskell,
A. Oloff,
D. Defeo-Jones, and R. E. Jones.
1993.
Characterization of the retinoblastoma binding proteins RBP1 and RBP2.
Oncogene
8:3149-3156[Medline].
|
| 15.
|
Flick, J. S., and M. Johnston.
1990.
Two systems of glucose repression of the GAL1 promoter in Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:4757-4769[Abstract/Free Full Text].
|
| 16.
|
Friedberg, E. C.,
G. C. Walker, and W. Siede (ed.).
1995.
DNA repair and mutagenesis, 595-631.
ASM Press, Washington, D.C.
|
| 17.
|
Gorner, W.,
E. Durchschlag,
M. T. Martinez-Pastor,
F. Estruch,
G. Ammerer,
B. Hamilton,
H. Ruis, and C. Schuller.
1998.
Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity.
Genes Dev.
12:586-597[Abstract/Free Full Text].
|
| 18.
|
Guarente, L., and M. Ptashne.
1981.
Fusion of Escherichia coli lacZ to the cytochrome c gene of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
78:2199-2203[Abstract/Free Full Text].
|
| 19.
|
Holstege, F. C. P.,
E. G. Jennings,
J. J. Wyrick,
T. I. Lee,
C. J. Hengartner,
M. R. Green,
T. R. Golub,
E. S. Lander, and R. A. Young.
1998.
Dissecting the regulatory circuit of a eukaryotic genome.
Cell
95:717-728[Medline].
|
| 20.
|
Huang, M.,
Z. Zhou, and S. Elledge.
1998.
The DNA replication and damage checkpoint pathways induce transcription by induction of the Crt1 repressor.
Cell
94:595-605[Medline].
|
| 21.
|
Jamieson, A. C.,
H. Wang, and S. H. Kim.
1996.
A zinc finger directory for high-affinity DNA recognition.
Proc. Natl. Acad. Sci. USA
93:12834-12839[Abstract/Free Full Text].
|
| 22.
|
Jones, J. S., and L. Prakash.
1990.
Yeast Saccharomyces cerevisiae selectable markers in pUC18.
Yeast
6:363-366[Medline].
|
| 23.
|
Kiser, G. L., and T. A. Weinert.
1996.
Distinct roles of yeast MEC and RAD checkpoint genes in transcriptional induction after DNA damage and implications for function.
Mol. Biol. Cell
7:703-718[Abstract].
|
| 24.
|
Lutfiyya, L. L., and M. Johnston.
1996.
Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression.
Mol. Cell. Biol.
16:4790-4797[Abstract].
|
| 25.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 26.
|
Martinez-Pastor, M. T.,
G. Marchler,
C. Schuller,
A. Marchler-Bauer,
H. Ruis, and F. Estruch.
1996.
The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress-response element (STRE).
EMBO J.
15:2227-2235[Medline].
|
| 27.
|
McDonald, J. P.,
A. S. Levine, and R. Woodgate.
1998.
The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism.
Genetics
147:1557-1568[Abstract].
|
| 28.
|
Nicolet, C. M.,
J. M. Chenevert, and E. C. Friedberg.
1985.
The RAD2 gene of Saccharomyces cerevisiae: nucleotide sequence and transcript mapping.
Gene
36:225-234[Medline].
|
| 29.
|
Paetkau, D. W.,
J. A. Riese,
W. S. MacMorran,
R. A. Woods, and R. D. Gietz.
1994.
Interaction of the yeast RAD7 and SIR3 proteins: implications for DNA repair and chromatin structure.
Genes Dev.
8:2035-2045[Abstract/Free Full Text].
|
| 30.
|
Park, C.-H.,
D. Mu,
J. T. Reardon, and A. Sancar.
1995.
The general transcription-repair factor TFIIH is recruited to the excision repair complex by the XPA protein independent of the TFIIE transcription factor.
J. Biol. Chem.
270:4896-4902[Abstract/Free Full Text].
|
| 30a.
| Saccharomyces cerevisiae WU-Blast 2 Website. 1998, copyright date. [Online.] Washington University.
http://genome-www2.stanford.edu/cgi-bin/SGD/nph-blast2sgd. [15
September 1999, last date accessed.]
|
| 31.
|
Sancar, G. B.
1985.
Sequence of the Saccharomyces cerevisiae PHR1 gene and homology of the PHR1 photolyase to E. coli photolyase.
Nucleic Acids Res.
13:8231-8246[Abstract/Free Full Text].
|
| 32.
|
Sancar, G. B.
1990.
DNA photolyases: physical properties, action mechanism, and roles in dark repair.
Mutat. Res.
236:147-160[Medline].
|
| 33.
| Sancar, G. B. 1999. Unpublished data.
|
| 34.
| Sancar, G. B. 1999. Unpublished data.
|
| 35.
|
Sancar, G. B.,
R. Ferris,
F. W. Smith, and B. Vandeberg.
1995.
Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.
Nucleic Acids Res.
21:4320-4328.
|
| 36.
|
Sancar, G. B., and F. W. Smith.
1989.
Interactions between yeast photolyase and nucleotide excision repair proteins in Saccharomyces cerevisiae and Escherichia coli.
Mol. Cell. Biol.
9:4767-4776[Abstract/Free Full Text].
|
| 37.
|
Schmitt, A. P., and K. McEntee.
1996.
Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5777-5782[Abstract/Free Full Text].
|
| 38.
|
Sebastian, J.,
B. Kraus, and G. B. Sancar.
1990.
Expression of the yeast PHR1 gene is induced by DNA-damaging agents.
Mol. Cell. Biol.
10:4630-4637[Abstract/Free Full Text].
|
| 39.
|
Sebastian, J., and G. B. Sancar.
1991.
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1.
Proc. Natl. Acad. Sci. USA
88:11251-11255[Abstract/Free Full Text].
|
| 40.
|
Sherman, F.
1991.
Getting started with yeast.
Methods Enzymol.
 :3-20.
|
| 41.
|
Sidorova, J. M., and L. L. Breeden.
1997.
Rad53-dependent phosphorylation of Swi6 and down-regulation of CLN1 and CLN2 transcription occur in response to DNA damage in Saccharomyces cerevisiae.
Genes Dev.
11:3032-3045[Abstract/Free Full Text].
|
| 42.
|
Sikorski, R. S., and P. Hieter.
1989.
A system for shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 43.
|
Singhal, R. K.,
D. C. Hinkle, and C. W. Lawrence.
1992.
The REV3 gene of Saccharomyces cerevisiae is transcriptionally regulated more like a repair gene than one encoding a DNA polymerase.
Mol. Gen. Genet.
236:17-24[Medline].
|
| 44.
|
Sweet, D. H.,
Y. K. Jang, and G. B. Sancar.
1997.
Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:6223-6235[Abstract].
|
| 45.
|
Takeuchi, T.,
Y. Yamazaki,
Y. Katoh-Fukui,
R. Tsuchiya,
S. Kondo,
J. Motoyama, and T. Higashinakagawa.
1995.
Gene trap capture of a novel mouse gene, jumonji, required for neural tube formation.
Genes Dev.
9:1211-1222[Abstract/Free Full Text].
|
| 46.
|
Tschumper, G., and J. Carbon.
1983.
Copy number control by a yeast centromere.
Gene
23:221-232[Medline].
|
| 47.
|
Vallen, E. A., and F. R. Cross.
1995.
Mutations in RAD27 define a potential link between G1 cyclins and DNA replication.
Mol. Cell. Biol.
15:4291-4302[Abstract].
|
| 48.
|
Weinert, T.
1998.
DNA damage and checkpoint pathways: molecular anatomy and interactions with repair.
Cell
94:555-558[Medline].
|
| 49.
|
Wolf, S. S.,
K. Roder, and M. Schweizer.
1996.
Construction of a reporter plasmid that allows expression libraries to be exploited for the one-hybrid system.
BioTechniques
20:568-574[Medline].
|
| 50.
|
Wu, J.,
J. Ellison,
E. Salido,
P. Yen,
T. Mohandas, and L. J. Shapiro.
1994.
Isolation and characterization of XE169, a novel human gene that escapes X-inactivation.
Hum. Mol. Genet.
1:153-160.
|
Molecular and Cellular Biology, November 1999, p. 7630-7638, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, N., Wu, J., Oliver, S. G.
(2009). Gis1 is required for transcriptional reprogramming of carbon metabolism and the stress response during transition into stationary phase in yeast. Microbiology
155: 1690-1698
[Abstract]
[Full Text]
-
Kim, T., Buratowski, S.
(2007). Two Saccharomyces cerevisiae JmjC Domain Proteins Demethylate Histone H3 Lys36 in Transcribed Regions to Promote Elongation. J. Biol. Chem.
282: 20827-20835
[Abstract]
[Full Text]
-
Klose, R. J., Gardner, K. E., Liang, G., Erdjument-Bromage, H., Tempst, P., Zhang, Y.
(2007). Demethylation of Histone H3K36 and H3K9 by Rph1: a Vestige of an H3K9 Methylation System in Saccharomyces cerevisiae?. Mol. Cell. Biol.
27: 3951-3961
[Abstract]
[Full Text]
-
Tu, S., Bulloch, E. M. M., Yang, L., Ren, C., Huang, W.-C., Hsu, P.-H., Chen, C.-H., Liao, C.-L., Yu, H.-M., Lo, W.-S., Freitas, M. A., Tsai, M.-D.
(2007). Identification of Histone Demethylases in Saccharomyces cerevisiae. J. Biol. Chem.
282: 14262-14271
[Abstract]
[Full Text]
-
Lai, L.-C., Kosorukoff, A. L., Burke, P. V., Kwast, K. E.
(2006). Metabolic-State-Dependent Remodeling of the Transcriptome in Response to Anoxia and Subsequent Reoxygenation in Saccharomyces cerevisiae.. Eukaryot Cell
5: 1468-1489
[Abstract]
[Full Text]
-
Coluccio, A., Bogengruber, E., Conrad, M. N., Dresser, M. E., Briza, P., Neiman, A. M.
(2004). Morphogenetic Pathway of Spore Wall Assembly in Saccharomyces cerevisiae. Eukaryot Cell
3: 1464-1475
[Abstract]
[Full Text]
-
Zhu, Y., Xiao, W.
(2004). Pdr3 is required for DNA damage induction of MAG1 and DDI1 via a bi-directional promoter element. Nucleic Acids Res
32: 5066-5075
[Abstract]
[Full Text]
-
Oshiro, J., Han, G.-S., Iwanyshyn, W. M., Conover, K., Carman, G. M.
(2003). Regulation of the Yeast DPP1-encoded Diacylglycerol Pyrophosphate Phosphatase by Transcription Factor Gis1p. J. Biol. Chem.
278: 31495-31503
[Abstract]
[Full Text]
-
Kim, E. M., Jang, Y. K., Park, S. D.
(2002). Phosphorylation of Rph1, a damage-responsive repressor of PHR1 in Saccharomyces cerevisiae, is dependent upon Rad53 kinase. Nucleic Acids Res
30: 643-648
[Abstract]
[Full Text]
-
Shim, Y. S., Jang, Y. K., Lim, M. S., Lee, J. S., Seong, R. H., Hong, S. H., Park, S. D.
(2000). Rdp1, a Novel Zinc Finger Protein, Regulates the DNA Damage Response of rhp51+ from Schizosaccharomyces pombe. Mol. Cell. Biol.
20: 8958-8968
[Abstract]
[Full Text]
-
SANCAR, A., THOMPSON, C., THRESHER, R.J., ARAUJO, F., MO, J., OZGUR, S., VAGAS, E., DAWUT, L., SELBY, C.P.
(2000). Photolyase/Cryptochrome Family Blue-light Photoreceptors Use Light Energy to Repair DNA or Set the Circadian Clock. Cold Spring Harb Symp Quant Biol
65: 157-172
[Abstract]
-
Damia, G., Sanchez, Y., Erba, E., Broggini, M.
(2001). DNA Damage Induces p53-dependent Down-regulation of hCHK1. J. Biol. Chem.
276: 10641-10645
[Abstract]
[Full Text]