Previous Article | Next Article 
Molecular and Cellular Biology, November 1999, p. 7639-7650, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Dual Transforming Activities of the FUS (TLS)-ERG
Leukemia Fusion Protein Conferred by Two N-Terminal Domains of
FUS (TLS)
Hitoshi
Ichikawa,*
Kimiko
Shimizu,
Rieko
Katsu, and
Misao
Ohki
Radiobiology Division, National Cancer Center
Research Institute, Chuo-ku, Tokyo 104-0045, Japan
Received 25 June 1999/Returned for modification 20 July
1999/Accepted 2 August 1999
 |
ABSTRACT |
The FUS (TLS)-ERG chimeric protein associated with
t(16;21)(p11;q22) acute myeloid leukemia is structurally similar to the Ewing's sarcoma chimeric transcription factor EWS-ERG. We found that
both FUS-ERG and EWS-ERG could induce anchorage-independent proliferation of the mouse fibroblast cell line NIH 3T3. However, only
FUS-ERG was able to inhibit the differentiation into neutrophils of a
mouse myeloid precursor cell line L-G and induce its granulocyte colony-stimulating factor-dependent growth. We constructed several deletion mutants of FUS-ERG lacking a part of the N-terminal FUS region. A deletion mutant lacking the region between amino acids 1 and
173 (exons 1 to 5) lost the NIH 3T3-transforming activity but retained
the L-G-transforming activity. On the other hand, a mutant lacking the
region between amino acids 174 and 265 (exons 6 and 7) lost the
L-G-transforming activity but retained the NIH 3T3-transforming
activity. These results indicate that the N-terminal region of FUS
contains two independent functional domains required for the NIH 3T3
and L-G transformation, which we named TR1 and TR2, respectively.
Although EWS intrinsically possessed the TR2 domain, the EWS-ERG
construct employed lacked the EWS sequence containing this domain.
Since the TR2 domain is always found in chimeric proteins identified
from t(16;21) leukemia patients but not in chimeric proteins from
Ewing's sarcoma patients, it seems that the TR2 function is required
only for the leukemogenic potential. In addition, we identified three
cellular genes whose expression was altered by ectopic expression of
FUS-ERG and found that these are regulated in either a TR1-dependent or
a TR2-dependent manner. These results suggest that FUS-ERG may activate
two independent oncogenic pathways during the leukemogenic process by
modulating the expression of two different groups of genes simultaneously.
 |
INTRODUCTION |
Specific chromosomal translocations
are frequently found in hematopoietic malignancies and certain types of
solid tumors (37). The t(16;21)(p11.2;q22.2) translocation
is a recurrent chromosomal abnormality found in acute myeloid leukemia.
This translocation juxtaposes the FUS (TLS) gene
on chromosome 16 and the ERG gene on chromosome 21 and forms
the FUS-ERG fusion gene (11, 40). The
FUS gene was first discovered as a translocated gene in
myxoid liposarcoma (7, 36) and encodes an RNA-binding
protein (7). The N-terminal region of this protein is Ser,
Tyr, Gly, and Gln rich and consists of degenerative
Ser-Tyr-Gly-Gln-Gln-Ser repeats (SYGQQS repeat region), and the central
and C-terminal regions consist of three Arg-Gly-Gly triplet-rich
regions (RGG repeat region), an RNA-recognition motif (RRM), and a Zn
finger motif. The RGG repeat regions and RRM are involved in the
RNA-binding activity of this protein (35). Its heterogeneous
nuclear ribonucleoprotein-like behavior and association with a basic
transcription factor TFIID were reported (2, 4), but the
biological function of this protein is still unclear. On the other
hand, the ERG gene encodes an external transcribed spacer
(ETS) family transcription factor (39). A transcriptional
activation domain (ETA domain) is located in the N-terminal region, and
a DNA-binding domain (ETS domain) is located in the C-terminal region
(41) (see Fig. 1A). In the chimeric protein produced by the
FUS-ERG fusion gene, the ETA domain of ERG is replaced by
the FUS N-terminal region, containing the SYGQQS repeat region and the
first RGG repeat region (11, 17) (see Fig. 1A). Because the
ETS DNA-binding domain is retained, this chimeric protein is thought to
function as a transcription factor.
The FUS gene is highly related to the EWS gene
(9). The EWS protein also contains the N-terminal SYGQQS
repeat region, three RGG repeat regions, RRM, and a Zn finger motif and
shows overall amino acid sequence similarity to FUS. In addition to this structural similarity, both of these genes are translocated and
fused to transcription factor genes in several malignant tumors. FUS is fused to CHOP in myxoid liposarcoma
(7, 36) and to ERG in acute myeloid leukemia
(11, 40), as described above. EWS is fused to
FLI1, ERG, and other ETS family genes
in Ewing's sarcoma (9, 13, 14, 32, 42, 46), to
ATF1 in malignant melanoma of soft tissues (45),
to WT1 in desmoplastic round cell tumor (19), to
TEC in extraskeletal myxoid chondrosarcoma (18),
and to CHOP in myxoid liposarcoma (28). In all of
the products of these fusion genes, the N-terminal region of FUS or EWS
is fused to the DNA-binding domain of the relevant transcription factors. Thus, it is believed that these chimeric proteins alter the
expression of cellular genes, which is regulated by their original
transcription factors, resulting in characteristic tumors. In addition,
since FUS and EWS are highly homologous and since both of the
FUS-CHOP and EWS-CHOP fusion genes were found in
the same myxoid liposarcoma, FUS and EWS are expected to play the same
role in the oncogenic potential of the chimeric proteins.
Thus, we expected that FUS-ERG associated with acute myeloid leukemia
and EWS-ERG associated with Ewing's sarcoma would have the same
oncogenic potentials. However, we found that FUS-ERG differed from
EWS-ERG in its ability to inhibit the differentiation into neutrophils
of a mouse myeloid precursor cell line L-G and to induce its
granulocyte colony-stimulating factor (G-CSF)-dependent growth. Here,
we report that the N-terminal regions of FUS and EWS have two potential
domains, TR1 and TR2, which are required for NIH 3T3 and L-G
transformation, respectively, but that the TR2 domain is not contained
in the EWS-ERG chimeric protein in most cases of Ewing's sarcoma. In
addition, the TR1 and TR2 domains would appear to function as
transcriptional regulation domains which determine the specificity of
target genes of FUS-ERG and EWS-ERG.
 |
MATERIALS AND METHODS |
Construction of retroviral expression vectors for ERG, FUS-ERG,
EWS-ERG, and FUS-ERG derivatives.
ERG and FUS-ERG cDNAs were
produced by reverse transcription-PCR from total RNA of a t(16;21)
acute myeloid leukemia cell line, UTP-L12 (11). For ERG
cDNA, we used primers ERGGF-HindIII and
ERGDR-HindIII, which are capable of amplifying from
nucleotides
30 to +53 of open reading frames (ORFs) of p55 and p49
isoforms (10) and which introduce HindIII
sites at both ends. The amplified product was neither p55 nor p49 and
was a 455-amino-acid isoform which has the A81 exon but not the A72
exon defined by Duterque-Coquillaud et al. (10). At this
time, no products were obtained with primers which could amplify erg-1,
erg-2, and erg-3 isoforms (34, 38). For FUS-ERG cDNA, we
used primers FUS6F-HindIII and
ERGDR-HindIII, which are capable of amplifying
nucleotides
9 to +53 of the FUS-ERG ORF and which introduce
HindIII sites at both ends. The amplified product was a
438-amino-acid isoform, which is the smaller of the two isoforms
expected as the result of the difference in the splicing acceptor site
of FUS exon 3.
HA-FUS-ERG, HFE
FUS, HFE
ERG, HFE
1-64, HFE
1-110, and
HFE
1-173 cDNAs were produced by PCR with FUS-ERG cDNA as a
template. We used primers HAFUS9F-HindIII and
ERGDR-HindIII for HA-FUS-ERG, HAERGKF-HindIII and ERGDR-HindIII for
HFE
FUS, HAFUS9F-HindIII and
FUS16Rstop-HindIII for HFE
ERG,
HAFUS10F-HindIII and ERGDR-HindIII for
HFE
1-64, HAFUS11F-HindIII and
ERGDR-HindIII for HFE
1-110, and
HAFUS12F-HindIII and ERGDR-HindIII for
HFE
1-173; these primers introduce HindIII sites at
both ends and a hemagglutinin (HA) tag
(Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala) at the N terminus.
HFE
ETS cDNA was produced by ligation between the N-terminal fragment
of the HA-FUS-ERG cDNA, which has the upstream end digested with
HindIII and the downstream end digested with
BamHI and treated with the Klenow fragment of DNA polymerase
I, and the C-terminal fragment, which was digested with
Eco47III and HindIII.
For EWS-ERG, HFE
174-265, HFE
111-265, HFE
67-265, and
HFE
FUS+W265-333 cDNAs, the respective N-terminal parts and the
common ERG C-terminal part were separately produced by reverse
transcription-PCR from total RNA of UTP-L12 or by PCR with FUS-ERG cDNA
as a template and joined later. The common C-terminal part was
amplified from UTP-L12 RNA with primers ERGFF-FspI and
ERGDR-HindIII, which are capable of amplifying from ERG
exon 9 to nucleotide +53 of the ERG ORF and which introduce an
FspI site at the upstream end and a HindIII
site at the downstream end. The N-terminal part of EWS-ERG was
amplified from UTP-L12 RNA with primers EWS1F-HindIII
and EWS1R-ScaI, which are capable of amplifying from
nucleotide
26 of the EWS ORF to EWS exon 7 and which introduce an
HindIII site at the upstream end and a ScaI
site at the downstream end. The N-terminal parts for HFE
174-265,
HFE
111-265, and HFE
67-265 were amplified from FUS-ERG cDNA with
primers HAFUS9F-HindIII and FUS12R-BsrBI,
HAFUS9F-HindIII and FUS11R-BsrBI, and
HAFUS9F-HindIII and FUS10R-BsrBI,
respectively, all of which introduce a HindIII site at
the upstream end and a BsrBI site at the downstream end as
well as a HA tag at the N terminus. The N-terminal part of HFE
FUS+W265-333 was amplified from UTP-L12 RNA with primers
HAEWS4F-HindIII and EWS3R-BsrBI, which could
introduce a HindIII site at the upstream end and a
BsrBI site at the downstream end as well as a HA tag at the
N terminus. The N-terminal part and the C-terminal part were digested
with appropriate restriction enzymes and ligated.
We used a retroviral expression vector, pLNCX (25) for
preparation of retroviruses. The cDNAs of ERG, FUS-ERG, EWS-ERG, and
FUS-ERG derivatives were digested with HindIII and
cloned into a HindIII site of pLNCX. These cDNA inserts
were all confirmed by nucleotide sequencing.
The sequences of primers we used are as follows (restriction sites
which we introduced are underlined): ERGDR-HindIII
(AAGCTTTGTGGCGATGGGCTGGTG), ERGGF-HindIII (AAGCTTGATTGCATTATGGCCAGC), ERGFF-FspI
(TGCGCAGTGGCCAGATCCAGCTT),
EWS1F-HindIII
(AAGCTTGAGAGAACGAGGAGGAAG), EWS1R-ScaI
(AGTACTGCTGCTGCCCGTAGCTGCTGC),
EWS3R-BsrBI
(CCGCTCCAGGCTTATTGAGCCACCT), FUS6F-HindIII
(AAGCTTGCTTGCTTGCCTGTGCGC),
FUS7R-BsrBI
(CCGCTCCAAATTTATTGAAGCCACCAC), FUS10R-BsrBI
(CCGCTCCATAGCTGTTCTGGCTCTG),
FUS11R-BsrBI
(CCGCTCCCGAGGTGCTGCTGGGA), FUS12R-BsrBI
(CCGCTCCACCTCCACCTCCACCT),
FUS16Rstop-HindIII
(AAGCTTTTAGCCACCAAATTTATTGAAGCCAC), HAERGKF-HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCGGCAGTGGCCAGATCCAGCTT), HAEWS4F- HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCAGTTCATTCCGACAGGACCAC), HAFUS9F- HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCGCCTCAAACGATTATACCCAAC), HAFUS10F- HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCTATGGAACTCAGTCAACTCCCC), HAFUS11F- HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCAGTTACGGTAGCAGTTCTCAGA), and HAFUS12F- HindIII
(AAGCTTAGGCCTCTAGACCATGGCATACCCATACGACGTGCCTGACTACGCCTCCGGTAACTATGGCCAAGATCAATC).
Retrovirus production and cell culture.
For production of
retroviruses, we used BOSC23 cells (29). Cells were cultured
in Dulbecco's modified Eagle's medium supplemented with 10% fetal
calf serum and were transfected with pLNCX-derived expression vectors
by the calcium phosphate precipitation method. After a 48- to 72-h
culture, supernatants were saved as retrovirus solutions. L-G cells
(15) were cultured in RPMI 1640 medium supplemented with
10% fetal calf serum, 0.1 ng of recombinant mouse interleukin-3 (IL-3)
(a generous gift from Kirin Brewery Co.) per ml, and 50 µM
-mercaptoethanol. Infection was carried out by adding the retrovirus
solutions to L-G cell cultures, and the infected cells were selected
with 1 mg of G418 per ml. When L-G cells were exposed to G-CSF, the
cells maintained in the presence of IL-3 were washed twice with
phosphate-buffered saline (PBS) and incubated in medium containing 10 ng of recombinant human G-CSF (a generous gift from Chugai
Pharmaceutical Co.) per ml in place of IL-3. Viable cells were counted
with a Coulter counter. Nuclear morphologies were observed after
staining with May-Gruenwald's solution and Giemsa's solution (Merck).
NIH 3T3 cells were cultured in Dulbecco's modified Eagle's medium
supplemented with 10% calf serum. Infection was carried out by adding
the retrovirus solutions to NIH 3T3 cell cultures, and the infected
cells were selected with 0.4 mg of G418 per ml. For the colony
formation assay, cells were trypsinized and plated into soft agar
medium containing 0.3% agarose (5 × 103 cells/60-mm
plate). After 2 weeks of incubation, the macroscopically visible
colonies were counted.
Immunoblotting analysis.
Cells were harvested and suspended
in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
sample buffer (62.5 mM Tris-HCl [pH 6.8], 2% SDS, 5%
-mercaptoethanol, 10% glycerol) at 2 × 107
cells/ml. After boiling and centrifugation, 10 µl of cleared lysates
(2 × 105 cells equivalent) was electrophoresed in
SDS-10% polyacrylamide gels, and transferred to nitrocellulose
membranes (Hybond ECL; Amersham). The membranes were blocked at 4°C
overnight with 5% skim milk dissolved in PBS containing 0.1% Tween-20
(PBS-T), incubated at room temperature for 2 h with 1 µg of
anti-ERG antibody (C-20; Santa Cruz) per ml or 0.1 µg of anti-HA
antibody (3F10; Boehringer Mannheim) per ml dissolved in PBS-T, and
then incubated at room temperature for 1 h with appropriate
horseradish peroxidase-conjugated second antibodies dissolved in PBS-T.
The antibody-bound proteins were detected with ECL Western blotting
detection reagents (Amersham).
mRNA differential display.
Total RNAs were prepared by the
acid guanidinium thiocyanate-phenol-chloroform method (6)
from L-G cells cultured in the presence of IL-3 and purified by
phenol-chloroform extraction and ethanol precipitation. mRNA
differential display screening was performed by the method of Ito et
al. (12). cDNAs were synthesized by using four oligo(dT)
primers (GT15MN; M = A + C + G; N = A, C, G, or T) and SuperScript II reverse transcriptase (Gibco BRL). PCR-amplification was carried out between the same oligo(dT) primers and arbitrary 10-mers (Operon Technologies) by using Taq DNA
polymerase (Boehringer Mannheim) with 1 cycle of denaturation at 94°C
for 3 min, annealing at 40°C for 5 min, and extension at 72°C for 5 min followed by 24 cycles of denaturation at 95°C for 15 s, annealing at 40°C for 2 min, and extension at 72°C for 1 min. The
PCR products were separated by gel electrophoresis in 6%
polyacrylamide gels, stained with SYBR green I (Molecular Probes), and
detected with FluorImager SI (Molecular Dynamics). The bands whose
intensities were altered were cut out of the gel, reamplified by PCR,
cloned into pGEM-T vector (Promega), and sequenced.
Northern hybridization analysis.
Total RNAs (5 µg) were
electrophoresed in a formaldehyde-1% agarose gel and transferred to a
nylon membrane (Hybond N+; Amersham) by standard methods.
Hybridization was carried out at 42°C overnight in hybridization
mixture (6× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate], 50% formamide, 1% SDS, 1× Denhardt's solution, 10%
dextran sulfate, 100 µg of denatured herring testis DNA per ml). The
membranes were washed three times at 65°C in washing buffer (0.1×
SSC, 0.1% SDS), and the hybridized transcripts were observed with a
BAS2000 image analyzer (Fuji Film).
In vitro transcription-translation and electrophoretic mobility
shift assay.
For synthesis of HA-FUS-ERG, HFE
1-173, HFE
FUS,
HFE
174-265, and HFE
ETS proteins, the corresponding cDNAs, which
were cloned in the pLNCX expression vectors, were digested with
HindIII and recloned into a HindIII site
of pSP64poly(A). By using these vectors, an in vitro
transcription-translation reaction was carried out with the TnT SP6
quick-coupled transcription-translation system (Promega). The in
vitro-translated extracts were diluted with mock extract to equalize
the concentrations of the synthesized proteins as judged by the
intensity of the bands in immunoblotting analysis with anti-ERG. E74
oligonucleotide probe was prepared by annealing of synthetic
oligonucleotides E74F (AATAACCGGAAGTAACTC) and E74R
(GAGTTACTTCCGGTTATT) and by 32P labelling with
T4 polynucleotide kinase and [
-32P]ATP. Mutant E74
oligonucleotide competitor was prepared by annealing of synthetic
oligonucleotides E74Fm (AATAACCCCAAGTAACTC) and E74Rm (GAGTTACTTGGGGTTATT). 32P-labelled E74
oligonucleotide (50 pmol) and 0.5 to 2 µl of the diluted extracts
were incubated with 10 nmol of mutant E74 oligonucleotide competitor in
20 µl of binding buffer [20 mM Tris-HCl (pH 8.0), 2 mM
MgCl2, 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 10%
glycerol, 100 µg of bovine serum albumin per ml, 50 µg of
poly(dI-dC) per ml] at room temperature for 20 min, and complexes were
separated by electrophoresis in 4% polyacrylamide gels. The shifted
bands were observed with a BAS2000 image analyzer.
Nucleotide sequence accession number. The sequence of
C14G220 has been assigned accession no. AB028209.
 |
RESULTS |
FUS-ERG transforms L-G myeloid precursor cells.
The t(16;21)
leukemia-associated chimeric protein FUS-ERG structurally resembles the
Ewing's sarcoma-associated chimeric protein EWS-ERG. To investigate
the role of FUS-ERG in leukemogenesis by comparison with ERG and
EWS-ERG, we constructed recombinant retroviruses to express these
proteins (Fig. 1A). Concerning FUS-ERG and EWS-ERG, some variants attributable to differences in their translocational breakpoints have been described (17, 46). We
used the smallest forms of these proteins containing FUS exons 1 to 5 or EWS exons 1 to 7 fused to ERG exon 9. In addition, ERG has several
splicing isoforms, as reported by Rao et al. (38), Duterque-Coquillaud et al. (10), and Prasad et al.
(34). We used a 455-amino-acid isoform (see Materials and
Methods), since this form was mainly expressed in the t(16;21) leukemia
cells which we examined.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
FUS-ERG but not EWS-ERG inhibits the differentiation of
L-G cells into neutrophils and induces their G-CSF-dependent
proliferation. (A) Structures of ERG, FUS-ERG, and EWS-ERG. The ETA
domain, ETS domain, SYGQQS repeat region, and RGG repeat region are
indicated. The N-terminal 282-amino-acid region of ERG was replaced by
the N-terminal 265-amino-acid region of FUS and the N-terminal
264-amino-acid region of EWS in FUS-ERG and EWS-ERG, respectively. (B)
Immunoblot analysis of ERG, FUS-ERG, and EWS-ERG expression in infected
L-G cells. Whole-cell extracts were fractionated by SDS-PAGE, and the
bands of ERG, FUS-ERG, and EWS-ERG proteins were detected with anti-ERG
antibody (arrowheads). The relatively slower migration of FUS-ERG and
EWS-ERG, which have lower molecular weights than ERG, may be due to
high Gly, Ser, and Gln contents of their N-terminal regions
(35). (C) Growth curves of the infected L-G cells in the
presence of 10 ng of G-CSF per ml. The relative numbers of viable cells
are indicated. (D) Nuclear morphology of the infected cells. The cells
cultured in the presence of G-CSF for 6 days were stained with
May-Gruenwald's and Giemsa's solutions.
|
|
A mouse myeloid precursor cell line, L-G, has been used successfully to
investigate the leukemogenic function of the fusion gene associated
with acute myeloid leukemia (16). L-G cells proliferate in
the presence of IL-3 and differentiate into mature neutrophils when
G-CSF is added to medium in place of IL-3 (15). We used this
cell line to analyze the effects of ERG, FUS-ERG, and EWS-ERG on
myeloid-cell differentiation. L-G cells were infected with retroviruses
to express these proteins, and the infected cells were selected by G418
resistance. The expression of the ERG, FUS-ERG, and EWS-ERG proteins in
the infected cells was confirmed by immunoblotting analysis with
anti-ERG antibody (Fig. 1B). The cells expressing ERG, FUS-ERG, and
EWS-ERG proliferated in the presence of IL-3 and died in the absence of
cytokines, like control cells infected with a mock retrovirus (data not
shown). In the presence of G-CSF, the control and EWS-ERG-expressing
cells did not proliferate (Fig. 1C) but morphologically differentiated
into mature neutrophils (Fig. 1D). In contrast, the FUS-ERG-expressing cells proliferated exponentially in response to G-CSF (Fig. 1C) without
differentiating into neutrophils (Fig. 1D). These results indicated
that FUS-ERG possessed a transformation activity that inhibited the
differentiation of L-G cells into neutrophils and induced their
G-CSF-dependent proliferation. This was in contrast to EWS-ERG, which
possessed no such activity. The ERG-expressing cells displayed an
intermediate phenotype, as shown by their weak proliferation and
sporadic differentiation (Fig. 1C and D).
To determine the contribution of the N-terminal FUS and C-terminal ERG
regions of FUS-ERG in the L-G-transforming activity, we constructed
HA-tagged deletion mutants lacking parts of the chimeric protein (Fig.
2A) and introduced them into L-G cells by
infecting the cells with recombinant retroviruses. The expression of
these mutant proteins in the infected cells was confirmed by immunoblot
analysis with anti-HA antibody (Fig. 2B). The cells expressing
HA-tagged FUS-ERG proliferated without differentiating in the presence
of G-CSF (Fig. 2C and D), like the cells expressing FUS-ERG without the
tag, indicating that HA tagging did not inhibit the L-G-transforming
activity. On the other hand, the cells expressing the FUS (amino acids
1 to 265)-deleted mutant HFE
FUS or the ERG (amino acids 266 to
438)-deleted mutant HFE
ERG did not proliferate (Fig. 2C) and
morphologically differentiated into mature neutrophils (Fig. 2D and
data not shown), like the control cells. These results indicated that
both of the FUS and ERG regions are required for the transformation
activity of FUS-ERG to inhibit the differentiation and stimulate the
G-CSF-dependent proliferation of L-G cells. In addition, we constructed
a mutant lacking amino acids 303 to 343 within the ETS DNA-binding
domain (Fig. 2A). The cells expressing this mutant HFE
ETS also did
not proliferate (Fig. 2C) and morphologically differentiated into
mature neutrophils in the presence of G-CSF (data not shown). Although
this mutant lacks a part of the ETS domain which contains the nuclear
localization signal, this protein was still localized to the nucleus
(data not shown). Thus, these results suggested that the DNA-binding
activity of the ETS domain is required and FUS-ERG functions as a
chimeric transcription factor in the transformation of L-G cells.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
The FUS N-terminal region and the ERG ETS domain are
necessary for transformation of L-G cells. (A) Structures of
HA-FUS-ERG, HFE FUS, HFE ERG, and HFE ETS. Amino acids 1 to 265, 266 to 438, and 303 to 343 of FUS-ERG are deleted in HFE FUS,
HFE ERG, and HFE ETS, respectively. (B) Immunoblot analysis of
HA-FUS-ERG, HFE FUS, HFE ERG, and HFE ETS expression in the
infected L-G cells. Whole-cell extracts were fractionated, and the
bands of HA-FUS-ERG, HFE FUS, HFE ERG, and HFE ETS proteins were
detected with anti-HA antibody (arrowheads). (C) Growth curves of the
infected L-G cells in the presence of 10 ng of G-CSF per ml. (D)
Nuclear morphology of the HFE FUS-expressing L-G cells. The cells
cultured in the presence of G-CSF for 6 days were stained with
May-Gruenwald's and Giemsa's solutions.
|
|
FUS amino acids 174 to 265 corresponding to exons 6 and 7 are
required to transform L-G cells.
FUS-ERG transformed L-G cells,
whereas EWS-ERG did not. To identify a critical region within the
N-terminal FUS region for the transformation of L-G cells, we
constructed several mutants with deletions from the N-terminal or
C-terminal end of the FUS region (Fig.
3A). The deletions in these mutants
corresponded approximately to the exon-intron structures of the
FUS gene, as shown in Fig. 3A. These mutants were introduced
into L-G cells by infection with retroviruses, and the transformation
phenotypes of the infected cells were examined. The expression of these
mutant proteins in the infected cells was confirmed by immunoblot
analysis with anti-HA antibody (Fig. 3B). The N-terminal deletion
mutants HFE
1-64, HFE
1-110, and HFE
1-173 stimulated the
G-CSF-dependent proliferation (Fig. 3C) and inhibited the
differentiation (Fig. 3D and data not shown), while the growth rates of
the cells expressing these mutants were decreased to some extent by
these deletions. The HFE
1-173-expressing cells proliferated at
almost the same growth rate as the ERG-expressing cells did (Fig. 1C
and 3C), but their differentiation was likely to be inhibited more
strongly (see Fig. 1D and 3D). On the other hand, the C-terminal
deletion mutants HFE
174-265, HFE
111-265, and HFE
67-265
neither stimulated the G-CSF-dependent proliferation (Fig. 3C) nor
inhibited differentiation (Fig. 3D and data not shown), like HFE
FUS,
a mutant lacking all of the FUS region. These results indicated that
the region between amino acids 174 and 265 is critical for the
L-G-transforming activity. This region corresponds to FUS exons 6 and 7 and contains a part of the SYGQQS repeat region and all of the first
RGG repeat region (Fig. 3A).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
FUS amino acids 174 to 265 are necessary for
transformation of L-G cells. (A) Structures of HA-FUS-ERG deletion
mutants lacking parts of the N-terminal FUS portion. The deletions of
these mutants nearly correspond to the exon-intron structure of the FUS
gene, as indicated. (B) Immunoblot analysis of the expression of
HA-FUS-ERG N-terminal deletion mutants in the infected L-G cells.
Whole-cell extracts were fractionated, and the bands of these deletion
mutants were detected with anti-HA antibody (arrowheads).
HFE 1-110-expressing cells generated two major bands. It is likely
that the smaller one was a C-terminus-truncated protein, since it could
not be detected with anti-ERG antibody. (C) Growth curves of the
infected L-G cells in the presence of 10 ng of G-CSF per ml. (D)
Nuclear morphology of the HFE 1-173- and HFE 174-265-expressing
L-G cells. The cells cultured in the presence of G-CSF for 6 days were
stained with May-Gruenwald's and Giemsa's solutions.
|
|
FUS amino acids 1 to 173, corresponding to exons 1 to 5, are
required to transform NIH 3T3 cells.
The Ewing's
sarcoma-associated chimeric transcription factor EWS-FLI1 and its
artificial derivative FUS-FLI1 were reported to induce
anchorage-independent growth of fibroblast cells in agar medium when a
mouse fibroblast cell line, NIH 3T3, was used (20, 23, 24,
44). We examined such an activity of ERG, FUS-ERG, EWS-ERG, and
some FUS-ERG mutants. NIH 3T3 cells were infected with recombinant
retroviruses, and the infected cells were selected by their G418
resistance. The expression of these proteins was confirmed by
immunoblot analysis with anti-ERG or anti-HA antibody (data not shown).
The infected cells were plated in soft agar medium, and macroscopically
visible colonies were counted after 2 weeks of culture. The cells
expressing FUS-ERG and EWS-ERG efficiently formed colonies, while the
cells expressing ERG did not, like control cells infected with a mock
retrovirus (Table 1). The cells
expressing HFE
FUS, HFE
ERG, and HFE
ETS also did not form
colonies (Table 1). These results indicated that, like EWS-FLI1 and
FUS-FLI1, both FUS-ERG and EWS-ERG have the transformation potential to
induce colony formation of NIH 3T3 cells in soft agar medium and that
this NIH 3T3-transforming activity requires both the N-terminal FUS
region and the ETS DNA-binding domain.
HFE
1-173 and HFE
174-265 were also introduced into NIH 3T3 cells
by using the retrovirus vector. The cells expressing HFE
174-265 formed colonies as efficiently as wild-type FUS-ERG did, while the
cells expressing HFE
1-173 did not (Table 1). Accordingly, HFE
1-173, which transformed L-G cells, did not transform NIH 3T3
cells, and HFE
174-265, which did not transform L-G cells, transformed NIH 3T3 cells. These results indicated that the region between amino acids 1 and 173, which corresponds to FUS exons 1 to 5, contains a functional domain required for the NIH 3T3-transforming activity but not for the L-G-transforming activity, and that the region
between amino acids 174 and 265, which corresponds to FUS exons 6 and
7, contains another functional domain required for the L-G-transforming
activity but not for the NIH 3T3-transforming activity. Because the ETS
DNA-binding domain is always required for these transformation
activities, these two domains may function as transcriptional
regulation domains. We have named these domains TR1 and TR2
(transforming regulation domain 1 and 2).
EWS amino acids 266 to 337, corresponding to exons 8 and 9, possess
the TR2 function.
EWS-ERG transformed NIH 3T3 cells but not L-G
cells, while FUS-ERG transformed both types of cells. FUS and EWS
exhibit similarity not only at the amino acid sequence level but also
in their exon-intron structures (1, 26, 33). FUS exons 6 and
7 corresponded to EWS exons 8 and 9 (Fig.
4A), and these two regions contain the
first RGG repeat region. The EWS-ERG construct which we used contained
only EWS exons 1 to 7. Thus, to examine whether EWS has a domain
required for the L-G transformation, we constructed a mutant,
HFE
FUS+W266-337 (Fig. 4A), in which EWS amino acids 266 to 337, corresponding to EWS exons 8 and 9, were fused to the C-terminal ERG
portion, and examined its transformation potential in L-G cells. The
cells expressing HFE
FUS+W266-337 proliferated exponentially in
response to G-CSF (Fig. 4C) without differentiating into mature
neutrophils (Fig. 4D). This result indicated that EWS possesses the TR2
function between amino acids 266 and 337. It is likely that EWS-ERG
failed to transform L-G cells in the above experiment because it lacked
this region.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
EWS amino acids 266 to 337 are functional for
transformation of L-G cells. (A) Structures of FUS, EWS, and
HFE FUS+W266-337. The SYGQQS repeat region, RGG repeat region, RRM,
and Zn finger motif are indicated. FUS exons 6 and 7 and EWS exons 8 and 9 are structurally conserved (1, 26, 33). In
HFE FUS+W266-337, EWS amino acids 266 to 337, which correspond to
exons 8 and 9, were joined to the C-terminal ERG portion. (B)
Immunoblot analysis of HA-FUS-ERG, HFE 1-173, HFE FUS+W266-337,
and HFE FUS expression in the infected L-G cells. Whole-cell extracts
were fractionated, and the bands of HA-FUS-ERG, HFE 1-173,
HFE FUS+W266-337, and HFE FUS proteins were detected with anti-HA
antibody (arrowheads). (C) Growth curves of the infected L-G cells in
the presence of 10 ng of G-CSF per ml. (D) Nuclear morphology of the
HFE FUS+W266-337-expressing L-G cells. The cells cultured in the
presence of G-CSF for 6 days were stained with May-Gruenwald's and
Giemsa's solutions.
|
|
Alteration of cellular gene expression induced by FUS-ERG.
Because the ETS DNA-binding domain is required for the transformation
of both L-G and NIH 3T3 cells by FUS-ERG, it seems likely that FUS-ERG
functions as a transcription factor to change the expression of
cellular genes. To investigate any changes in gene expression induced
by FUS-ERG, we used the mRNA differential display method (12,
21). First, total RNAs were prepared from FUS-ERG-expressing L-G
cells and control cells. Next, cDNAs were synthesized by using four
oligo(dT) primers (GT15MN, where M = A + C + G and N = A, C, G, or T) and PCR amplified between the same four
oligo(dT) primers and 160 arbitrary 10-mers (in total, 640 primer
pairs). Then the resulting PCR products were separated by gel
electrophoresis and their intensities were compared between
FUS-ERG-expressing cells and control cells. We screened about 20,000 bands with 640 primer pairs and identified 2 bands whose intensities
were enhanced or repressed by FUS-ERG expression. Cloning and
sequencing analysis of the enhanced band C14G220 and the repressed band
I20G440 revealed that I20G440 was derived from the granzyme B gene but
that C14G220 did not match any known genes in the database. We examined
the expression of these genes in L-G cells expressing ERG, FUS-ERG, EWS-ERG, HA-FUS-ERG, HFE
1-173, HFE
FUS, and HFE
174-265
(Fig. 5A). The expression of C14G220 was
up-regulated and the expression of granzyme B was down-regulated in
cells expressing FUS-ERG, EWS-ERG, or HFE
174-265, but their levels
remained unchanged in HFE
1-173-expressing cells (Fig. 5A). These
alterations of expression were confirmed by Northern hybridization
analysis (Fig. 5B).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
Alteration of cellular gene expression by FUS-ERG and
FUS-ERG mutants. (A) mRNA differential-display patterns of C14G220 and
I20G440 (granzyme B) expression in control and ERG, FUS-ERG, EWS-ERG,
and FUS-ERG mutant-expressing L-G cells. (B) Northern analysis of
C14G220, granzyme B, and G-CSF receptor expression in control and ERG,
FUS-ERG, EWS-ERG, and FUS-ERG mutant-expressing L-G cells.
Glyceraldehyde 3-phosphate dehydrogenase (G3PDH) was used as a control.
The C14G220 expression was enhanced and the granzyme B expression was
repressed in cells expressing TR1-containing constructs, FUS-ERG,
EWS-ERG, HA-FUS-ERG, and HFE 174-265. The G-CSF receptor (G-CSFR)
expression was enhanced in cells expressing TR2-containing constructs,
FUS-ERG, HA-FUS-ERG, and HFE 1-173.
|
|
In addition to mRNA differential-display screening, the expression of
some of the genes known to be involved in myeloid-cell proliferation
and differentiation was compared between the FUS-ERG-expressing and
control L-G cells by Northern hybridization analysis. We found that the
expression of the G-CSF receptor gene was enhanced approximately five-
to eightfold in FUS-ERG-expressing cells. This enhancement of
expression was also observed in HFE
1-173-expressing cells but not
in cells expressing EWS-ERG or HFE
174-265 (Fig. 5B).
The above data is summarized in Table 2.
FUS-ERG, EWS-ERG, and HFE
174-265, which contain TR1, changed the
expression of two genes identified by the mRNA differential display,
and FUS-ERG and HFE
1-173, which contain TR2, enhanced the
expression of the G-CSF receptor gene. Thus, among three genes studied,
the expression of two genes seems to be regulated in a TR1-dependent
manner and the expression of the G-CSF receptor gene seems to be
regulated in a TR2-dependent manner.
DNA-binding properties of FUS-ERG mutants.
Prasad et al.
(35) showed that ERG and FUS-ERG bind to the E74 sequence in
a sequence-specific manner in an electrophoretic mobility shift assay.
We examined the binding to the E74 sequence of some FUS-ERG mutants
with a similar experiment involving in vitro-translated proteins (Fig.
6). When a mutant E74 oligonucleotide (with a GGAA-to-CCAA change in the ETS core-binding site) was added as
a competitor, ERG and HA-FUS-ERG specifically bound to the E74
oligonucleotide, as in the previous work, while an ETS DNA-binding
domain-deleted mutant HFE
ETS did not (Fig. 6B). All of the FUS
region-deleted mutants which we examined, HFE
1-173 lacking TR1,
HFE
174-265 lacking TR2, and HFE
FUS lacking both TR1 and TR2,
bound to the E74 sequence specifically but showed different band
intensities (Fig. 6B). HFE
174-265 bound as efficiently as ERG and
HA-FUS-ERG, but HFE
1-173 and HFE
FUS bound more weakly to the E74
oligonucleotide. It seems likely that the N-terminal region of ERG and
TR1 of FUS stabilize the ETS domain-E74 complex.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 6.
Binding to the E74 sequence of FUS-ERG mutants. (A)
Immunoblot analysis of in vitro-translated ERG, HA-FUS-ERG,
HFE 1-173, HFE FUS, HFE 174-265, and HFE ETS. The in
vitro-translated extracts were diluted to equalize the concentrations
of the synthesized proteins (see Materials and Methods), and the same
amounts of the diluted extracts were fractionated by SDS-PAGE. The
bands of ERG, HA-FUS-ERG, HFE 1-173, HFE 174-265, and HFE ETS
proteins were detected with anti-ERG antibody (arrowhead). (B)
Electrophoretic mobility shift assay with in vitro-translated proteins.
32P-labelled E74 oligonucleotide and different amounts
(0.5, 1, and 2 µl) of the diluted extracts were incubated with cold
mutant E74 oligonucleotide. The protein-bound E74 oligonucleotides were
fractionated in a 4% polyacrylamide gel (arrowheads).
|
|
 |
DISCUSSION |
We have found that the t(16;21) leukemia-associated chimeric
protein FUS-ERG inhibits the differentiation of L-G cells into neutrophils and stimulates their G-CSF-dependent proliferation and, in
addition, induces the anchorage-independent growth of NIH 3T3 cells.
These two transformation activities depend on two different domains,
TR1 and TR2, located in the N-terminal FUS region of FUS-ERG. TR1,
which is located between FUS amino acids 1 and 173 (exons 1 to 5), is
required for NIH 3T3 transformation but not for L-G transformation, and
TR2, which is located between FUS amino acids 174 and 265 (exons 6 and
7), is required for L-G transformation but not for NIH 3T3 transformation.
TR1 and TR2 domains in FUS and EWS.
FUS and EWS belong to a
distinct family of RNA-binding proteins that exhibit a high degree of
similarity in their amino acid sequences and exon-intron structures.
Unlike FUS-ERG, EWS-ERG was unable to transform L-G cells in early
experiments. However, FUS-ERG and EWS-ERG had the same transformation
activities when appropriate regions of FUS and EWS were fused to the
C-terminal region of ERG. FUS exons 1 to 5 (amino acids 1 to 173)
containing TR1 correspond to EWS exons 1 to 7 (amino acids 1 to 264).
Our EWS-ERG construct containing EWS amino acids 1 to 264 was able to
transform NIH 3T3 cells, indicating the presence of the TR1 function in
EWS. FUS exons 6 and 7 (amino acids 174 to 265) containing TR2
correspond to EWS exons 8 and 9 (amino acids 265 to 335). An EWS-ERG
derivative, HFE
FUS+W265-335, containing EWS amino acids 265 to 335, was able to transform L-G cells, indicating the presence of the TR2
function in EWS. The presence of the TR1 and TR2 functions in EWS
suggests that TR1 and TR2 are conserved functional domains between FUS
and EWS, although the normal functions of these domains are still unknown.
Involvement of TR1 and TR2 domains in other malignant tumors.
Translocations of FUS and EWS are involved in
many malignant tumors including t(16;21) acute myeloid leukemia, myxoid
liposarcoma, and Ewing's sarcoma. The N-terminal regions of FUS and
EWS, which we analyzed in the chimeric proteins with ERG, are expected
to function through common or similar mechanisms when fused to other transcription factors. We summarize the translocated regions of FUS and
EWS in these tumors in Fig. 7. In most of
these tumors, the translocated regions included in the chimeric
proteins varied among patients, depending on the location of the
translocation breakpoint. FUS exons 1 to 7 or 1 to 8 were
translocated and fused to ERG in t(16;21) acute myeloid
leukemia (17). Thus, the resulting FUS-ERG chimeric proteins
always contained the TR2 domain, confirming the importance of this
domain for the leukemogenic potential of FUS-ERG. On the other hand,
FUS exons 1 to 5 or 1 to 7 were translocated and fused to
CHOP in myxoid liposarcoma (28). EWS
exons 1 to 7, 1 to 9, or 1 to 10 were translocated and fused to
FLI1 or ERG in Ewing's sarcoma (46).
In all of these tumors except t(16;21) leukemia and malignant melanoma
of soft tissue, exons 1 to 5 of FUS or exons 1 to 7 of EWS were the
minimal common regions included in the relevant chimeric proteins,
which contain the TR1 domain but not the TR2 domain. In malignant
melanoma of soft tissue, EWS exons 1 to 8 were always
translocated and fused to ATF1, but this is probably due to
formation of an in-frame junction, because fusion of EWS
exon 7 to ATF1 results in the formation of an out-of-frame junction (45). Accordingly, the TR1 domain is always
involved in all tumor-associated FUS or EWS chimeric proteins. In
contrast, the TR2 domain is involved in only FUS-ERG of t(16;21)
leukemia. Thus, it is likely that TR1 is an effector domain that
functions in a broad spectrum of malignant tumors and that TR2 plays a
specific role in acute myeloid leukemia.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 7.
The TR2 domain is always present in FUS-ERG chimeric
protein of t(16;21) acute myeloid leukemia but not in chimeric proteins
of other malignant tumors. Translocated regions of FUS and EWS found in
myxoid liposarcoma with t(12;16) (27), acute myeloid
leukemia with t(16;21) (17), Ewing's sarcoma with t(11;22)
and t(21;22) (46), malignant melanoma of soft tissue with
t(12;22) (45), desmoplastic round-cell tumor with t(11;22)
(19), and extraskeletal myxoid chondrosarcoma with t(9;22)
(18) are summarized. Regions which are translocated and
present in chimeric proteins are indicated by bars. Ratios of the
number of relevant cases to the total number of cases are also shown on
the left. In two cases of myxoid liposarcoma, two types of FUS-CHOP
chimeric proteins containing exons 1 to 5 and exons 1 to 7 were present
at the same time. In one case of extraskeletal myxoid chondrosarcoma,
translocation occurred within exon 12 of EWS. The SYGQQS repeat region,
RGG repeat region, RRM, and Zn finger motif are indicated by hatched
boxes, as in Fig. 4. aa, amino acids.
|
|
TR1 and TR2 may function as transcriptional regulation domains to
determine target gene specificity.
Since the ETS DNA-binding
domain is absolutely required for both L-G and NIH 3T3 transformation
by FUS-ERG, it is suggested that FUS-ERG functions as a transcription
factor to alter the transcription pattern of cellular genes, which
leads to cell transformation. Actually, it was reported that both
FUS-ERG and ERG function as transcriptional activators on an artificial
promoter containing the E74 ETS-binding sequence (35).
However, FUS-ERG was unable to activate transcription from natural
promoters known to be regulated by ERG, such as those of stromelysin 1 and vimentin (3, 5), in our reporter assay system with NIH
3T3 cells, although ERG activated these promoters (11a). In
the present study, we identified three cellular genes whose expression
was altered by ectopic expression of FUS-ERG in L-G cells, although it
is unknown at present whether these genes were regulated directly or
indirectly. The expression of these genes was not affected or was only
slightly influenced by ERG (Fig. 5). In particular, the expression of
the G-CSF receptor, which was up-regulated by FUS-ERG, was instead
down-regulated by ERG. Although ERG stimulated the G-CSF-dependent
proliferation of L-G cells, it seems likely that the underlying
mechanisms and downstream target genes of ERG and FUS-ERG are
different. Concerning the downstream genes, it is more important that
the expression of granzyme B and C14G220 was not changed by a FUS-ERG
mutant lacking TR1 and that the expression of G-CSF receptor was not up-regulated by a mutant lacking TR2. These results indicated that
FUS-ERG regulates the different sets of genes in TR1- and TR2-dependent
manners (Fig. 8). TR1 and TR2 may
function as transcriptional regulation domains to determine target gene
specificity.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Model for the simultaneous activation of two oncogenic
pathways for leukemogenesis by FUS-ERG. FUS-ERG enhances (or represses)
the expression of a group of genes (represented by gene X) in a
TR1-dependent and TR2-independent manner, and these genes activate an
oncogenic pathway which causes the transformation of NIH 3T3 cells. At
the same time, FUS-ERG enhances (or represses) the expression of
another group of genes (represented by gene Y) in a TR1-independent and
TR2-dependent manner, and these genes activate another oncogenic
pathway, which causes the transformation of L-G cells. The simultaneous
regulation of different groups of genes by FUS-ERG may cause the
simultaneous activation of two different oncogenic pathways, resulting
in acute myeloid leukemia.
|
|
How do TR1 and TR2 determine the target gene specificity? As shown in
Fig. 6, all of FUS-ERG, a TR1 deletion mutant, HFE
1-173, and a TR2
deletion mutant, HFE
174-265 specifically bound to the E74 sequence.
It is known that ERG regulates genes synergistically with other
transcription factors like AP-1 (3). Thus, it is possible
that protein-protein interaction mediated by the TR1 and TR2 domains
determines the specificity of target genes regulated by FUS-ERG. On the
other hand, HFE
1-173 bound weakly to the E74 sequence compared to
HFE
174-265. Thus, it is also conceivable that HFE
1-173 may bind
to other target sequences better than HFE
174-265 does. The
alteration of binding specificity can explain the difference in target
gene specificity between the FUS-ERG mutants lacking TR1 and TR2.
Prasad et al. (35) reported that FUS fusion to ERG causes a
slight reduction of the binding-sequence specificity of the ETS domain
of ERG. This reduction may reflect TR2-dependent modulation of the
binding specificity. Recently, Perrotti et al. (31) reported
that FUS functions as a downstream effector of the BCR-ABL chimeric
tyrosine kinase associated with chronic myeloid leukemia and represses
the expression of the G-CSF receptor gene. Thus, it is possible that
FUS-ERG dominant-negatively represses the function of FUS, resulting in
up-regulation of the G-CSF receptor gene. However, this seems unlikely,
because the ETS DNA-binding domain is required for the G-CSF receptor
up-regulation (data not shown).
Enhanced expression of the G-CSF receptor.
In this study, we
found that the expression of the G-CSF receptor is enhanced by FUS-ERG.
The AML1-MTG8 chimeric protein, which is associated with t(8;21) acute
myeloid leukemia and has a similar L-G-transforming activity
(16), also enhances the G-CSF receptor expression
(40a). G-CSF is a cytokine known to stimulate the
proliferation of myeloid precursor cells. The enhanced expression of
the G-CSF receptor in L-G cells induces their G-CSF-dependent proliferation like FUS-ERG and AML1-MTG8, although it does not inhibit
the differentiation (40a). In addition, proliferation of a
t(16;21) leukemia cell line, YNH-1, is stimulated by G-CSF (43). These findings suggest that the G-CSF receptor is one of target genes responsible for the oncogenic activity of FUS-ERG and
that overexpression of the G-CSF receptor and resulting enhanced G-CSF
signalling may contribute to the leukemogenesis of the t(16;21) leukemia.
Simultaneous activation of two independent oncogenic pathways by
FUS-ERG.
FUS-ERG can inhibit the differentiation and stimulate the
G-CSF-dependent proliferation of L-G cells as well as induce the anchorage-independent growth of NIH 3T3 cells. Recently, Pereira et al.
(30) reported that FUS-ERG has the potential to enhance the
proliferative and self-renewal capacity of myeloid progenitor cells.
The relation of this potential to the transforming activities that we
identified is not known, because its structural requirement has not
been reported. On the other hand, the requirement of distinct domains
for L-G- and NIH 3T3-transforming activities suggests that these
activities reflect independent oncogenic potentials of FUS-ERG and that
FUS-ERG simultaneously activates two independent oncogenic pathways in
t(16;21) leukemia cells (Fig. 8).
As described above, AML1-MTG8 has a similar L-G-transforming activity.
The BCR-ABL chimeric protein associated with chronic myelogenous
leukemia transforms a mouse fibroblast cell line, Rat-1
(22). It is still unknown whether the L-G
transformation by FUS-ERG and AML1-MTG8 occurs through the
same mechanism. In addition, it is likely that the fibroblast cell
transformation activities of FUS-ERG and BCR-ABL reflect the different
oncogenic potentials, since BCR-ABL does not transform NIH 3T3 cells
(8). However, the similarity in the transformation
activities between FUS-ERG and other leukemia chimeric proteins
suggests the importance of these two transformation activities of
FUS-ERG in leukemogenesis. Kong et al. (17) reported that
t(16;21) acute myeloid leukemia has a very poor prognosis compared to
other types of leukemia. The simultaneous activation of two pathways
may explain this poor prognosis.
 |
ACKNOWLEDGMENTS |
We thank A. D. Miller for providing pLNCX vector, D. Baltimore for providing BOSC23 cells, T. Honjo for providing L-G cells, Y. Sakamoto for providing NIH 3T3 cells, and T. Ito for making suggestions about the mRNA differential-display technique.
This work was supported in part by a Grant-in-Aid for Scientific
Research on Priority Areas from the Ministry of Education, Science, and
Culture; by a grant from the Special Coordination Funds for the
Promotion of Science and Technology from the Science and Technology
Agency; by a Grant-in-Aid for the 2nd Term Comprehensive 10-year
Strategy for Cancer Control and a Research Grant on Human Genome and
Gene Therapy from the Ministry of Health and Welfare; and by the
Program for Promotion of Fundamental Studies in Health Sciences of the
Organization for Drug ADR Relief, R&D Promotion, and Product Review of Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Radiobiology
Division, National Cancer Center Research Institute, 5-1-1 Tsukiji,
Chuo-ku, Tokyo 104-0045, Japan. Phone: 81-3-3542-2511, ext. 4754. Fax: 81-3-3542-0688. E-mail: hichikaw{at}ncc.go.jp.
 |
REFERENCES |
| 1.
|
Åman, P.,
I. Panagopoulos,
C. Lassen,
T. Fioretos,
M. Mencinger,
H. Toresson,
M. Höglund,
A. Forster,
T. H. Rabbitts,
D. Ron,
N. Mandahl, and F. Mitelman.
1996.
Expression patterns of the human sarcoma-associated genes FUS and EWS and the genomic structure of FUS.
Genomics
37:1-8[Medline].
|
| 2.
|
Bertolotti, A.,
Y. Lutz,
D. J. Heard,
P. Chambon, and L. Tora.
1996.
hTAFII68, a novel RNA/ssDNA-binding protein with homology to the pro-oncoproteins TLS/FUS and EWS is associated with both TFIID and RNA polymerase II.
EMBO J.
15:5022-5031[Medline].
|
| 3.
|
Butticè, G.,
M. Duterque-Coquillaud,
J. P. Basuyaux,
S. Carrère,
M. Kurkinen, and D. Stéhelin.
1996.
Erg, an Ets-family member, differentially regulates human collagenase1 (MMP1) and stromelysin1 (MMP3) gene expression by physically interacting with the Fos/Jun complex.
Oncogene
13:2297-2306[Medline].
|
| 4.
|
Calvio, C.,
G. Neubauer,
M. Mann, and A. I. Lamond.
1995.
Identification of hnRNP P2 as TLS/FUS using electrospray mass spectrometry.
RNA
1:724-733[Abstract].
|
| 5.
|
Chen, J. H.,
C. Vercamer,
Z. Li,
D. Paulin,
B. Vandenbunder, and D. Stehelin.
1996.
PEA3 transactivates vimentin promoter in mammary epithelial and tumor cells.
Oncogene
13:1667-1675[Medline].
|
| 6.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 7.
|
Crozat, A.,
P. Åman,
N. Mandahl, and D. Ron.
1993.
Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma.
Nature
363:640-644[Medline].
|
| 8.
|
Daley, G. Q.,
J. McLaughlin,
O. N. Witte, and D. Baltimore.
1987.
The CML-specific P210 bcr/abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts.
Science
237:532-535[Abstract/Free Full Text].
|
| 9.
|
Delattre, O.,
J. Zucman,
B. Plougastel,
C. Desmaze,
T. Melot,
M. Peter,
H. Kovar,
I. Joubert,
P. de Jong,
G. Rouleau,
A. Aurias, and G. Thomas.
1992.
Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumors.
Nature
359:162-165[Medline].
|
| 10.
|
Duterque-Coquillaud, M.,
C. Niel,
S. Plaza, and D. Stehelin.
1993.
New human erg isoforms generated by alternative splicing are transcriptional activators.
Oncogene
8:1865-1873[Medline].
|
| 11.
|
Ichikawa, H.,
K. Shimizu,
Y. Hayashi, and M. Ohki.
1994.
An RNA-binding protein gene, TLS/FUS, is fused to ERG in human myeloid leukemia with t(16;21) chromosomal translocation.
Cancer Res.
54:2865-2868[Abstract/Free Full Text].
|
| 11a.
| Ichikawa, H. Unpublished data.
|
| 12.
|
Ito, T.,
K. Kito,
N. Adati,
Y. Mitsui,
H. Hagiwara, and Y. Sakaki.
1994.
Fluorescent differential display: arbitrarily primed RT-PCR fingerprinting on an automated DNA sequencer.
FEBS Lett.
351:231-236[Medline].
|
| 13.
|
Jeon, I.-S.,
J. N. Davis,
B. S. Braun,
J. E. Sublett,
M. F. Roussel,
C. T. Denny, and D. N. Shapiro.
1995.
A variant Ewing's sarcoma translocation (7;22) fuses the EWS gene to the ETS gene ETV1.
Oncogene
10:1229-1234[Medline].
|
| 14.
|
Kaneko, Y.,
K. Yoshida,
M. Handa,
Y. Toyoda,
H. Nishihira,
Y. Tanaka,
Y. Sasaki,
S. Ishida,
F. Higashino, and K. Fujinaga.
1996.
Fusion of an ETS-family gene, EIAF, to EWS by t(17;22)(q12;q12) chromosome translocation in an undifferentiated sarcoma of infancy.
Genes Chromosomes Cancer
15:115-121[Medline].
|
| 15.
|
Kinashi, T.,
K. H. Lee,
M. Ogawa,
K. Tohyama,
K. Tashiro,
R. Fukunaga,
S. Nagata, and T. Honjo.
1991.
Premature expression of the macrophage colony-stimulating factor receptor on a multipotential stem cell line does not alter differentiation lineages controlled by stromal cells used for coculture.
J. Exp. Med.
173:1267-1279[Abstract/Free Full Text].
|
| 16.
|
Kitabayashi, I.,
K. Ida,
F. Morohoshi,
A. Yokoyama,
N. Mitsuhashi,
K. Shimizu,
N. Nomura,
Y. Hayashi, and M. Ohki.
1998.
The AML1-MTG8 leukemic fusion protein forms a complex with a novel member of the MTG8(ETO/CDR) family, MTGR1.
Mol. Cell. Biol.
18:846-858[Abstract/Free Full Text].
|
| 17.
|
Kong, X.-T.,
K. Ida,
H. Ichikawa,
K. Shimizu,
M. Ohki,
N. Maseki,
Y. Kaneko,
M. Sako,
Y. Kobayashi,
A. Tojou,
I. Miura,
H. Kakuda,
T. Funabiki,
K. Horibe,
H. Hamaguchi,
Y. Akiyama,
F. Bessho,
M. Yanagisawa, and Y. Hayashi.
1997.
Consistent detection of TLS/FUS-ERG chimeric transcripts in acute myeloid leukemia with t(16;21)(p11;q22) and identification of a novel transcript.
Blood
90:1192-1199[Abstract/Free Full Text].
|
| 18.
|
Labelle, Y.,
J. Zucman,
G. Stenman,
L.-G. Kindblom,
J. Knight,
C. Turc-Carel,
B. Dockhorn-Dworniczak,
N. Mandahl,
C. Desmaze,
M. Peter,
A. Aurias,
O. Delattre, and G. Thomas.
1995.
Oncogenic conversion of a novel orphan nuclear receptor by chromosome translocation.
Hum. Mol. Genet.
4:2219-2226[Abstract/Free Full Text].
|
| 19.
|
Ladanyi, M., and W. Gerald.
1994.
Fusion of the EWS and WT1 genes in the desmoplastic small round cell tumor.
Cancer Res.
54:2837-2840[Abstract/Free Full Text].
|
| 20.
|
Lessnick, S. L.,
B. S. Braun,
C. T. Denny, and W. A. May.
1995.
Multiple domains mediate transformation by the Ewing's sarcoma EWS/FLI-1 fusion gene.
Oncogene
10:423-431[Medline].
|
| 21.
|
Liang, P., and A. B. Pardee.
1992.
Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science
257:967-971[Abstract/Free Full Text].
|
| 22.
|
Lugo, T. G., and O. N. Witte.
1989.
The BCR-ABL oncogene transforms Rat-1 cells and cooperates with v-myc.
Mol. Cell. Biol.
9:1263-1270[Abstract/Free Full Text].
|
| 23.
|
May, W. A.,
M. L. Gishizky,
S. L. Lessnick,
L. B. Lunsford,
B. C. Lewis,
O. Delattre,
J. Zucman,
G. Thomas, and C. T. Denny.
1993.
Ewing sarcoma 11;22 translocation produces a chimeric transcription factor that requires the DNA-binding domain encoded by FLI1 for transformation.
Proc. Natl. Acad. Sci. USA
90:5752-5756[Abstract/Free Full Text].
|
| 24.
|
May, W. A.,
S. L. Lessnick,
B. S. Braun,
M. Klemsz,
B. C. Lewis,
L. B. Lunsford,
R. Hromas, and C. T. Denny.
1993.
The Ewing's sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1.
Mol. Cell. Biol.
13:7393-7398[Abstract/Free Full Text].
|
| 25.
|
Miller, A. D.,
D. G. Miller,
J. V. Garcia, and C. M. Lynch.
1993.
Use of retroviral vectors for gene transfer and expression.
Methods Enzymol.
217:581-599[Medline].
|
| 26.
|
Morohoshi, F.,
Y. Ootsuka,
K. Arai,
H. Ichikawa,
S. Mitani,
N. Munakata, and M. Ohki.
1998.
Genomic structure of the human RBP56/hTAFII68 and FUS/TLS genes.
Gene
221:191-198[Medline].
|
| 27.
|
Panagopoulos, I.,
N. Mandahl,
F. Mitelman, and P. Åman.
1995.
Two distinct FUS breakpoint clusters in myxoid liposarcoma and acute myeloid leukemia with the translocations t(12;16) and t(16;21).
Oncogene
11:1133-1137[Medline].
|
| 28.
|
Panagopoulos, I.,
M. Höglund,
F. Mertens,
N. Mandahl,
F. Mitelman, and P. Åman.
1996.
Fusion of the EWS and CHOP genes in myxoid liposarcoma.
Oncogene
12:489-494[Medline].
|
| 29.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1994.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 30.
|
Pereira, D. S.,
C. Dorrell,
C. Y. Yto,
O. I. Gan,
B. Murdoch,
V. N. Rao,
J.-P. Zou,
E. S. P. Reddy, and J. E. Dick.
1998.
Retroviral transduction of TLS-ERG initiates a leukemogenic program in normal human hematopoietic cells.
Proc. Natl. Acad. Sci. USA
95:8239-8244[Abstract/Free Full Text].
|
| 31.
|
Perrotti, D.,
S. Bonatti,
R. Trotta,
R. Martinez,
T. Skorski,
P. Salomoni,
E. Grassilli,
R. V. Iozzo,
D. R. Cooper, and B. Calabretta.
1998.
TLS/FUS, a pro-oncogene involved in multiple chromosomal translocations, is a novel regulator of BCR/ABL-mediated leukemogenesis.
EMBO J.
17:4442-4455[Medline].
|
| 32.
|
Peter, M.,
J. Couturier,
H. Pacquement,
J. Michon,
G. Thomas,
H. Magdelenat, and O. Delattre.
1997.
A new member of the ETS family fused to EWS in Ewing tumors.
Oncogene
14:1159-1164[Medline].
|
| 33.
|
Plougastel, B.,
J. Zucman,
M. Peter,
G. Thomas, and O. Delattre.
1993.
Genomic structure of the EWS gene and its relationship to EWSR1, a site of tumor-associated chromosome translocation.
Genomics
18:609-615[Medline].
|
| 34.
|
Prasad, D. D. K.,
V. N. Rao,
L. Lee, and E. S. P. Reddy.
1994.
Differentially spliced erg-3 product functions as a transcriptional activator.
Oncogene
9:669-673[Medline].
|
| 35.
|
Prasad, D. D. K.,
M. Ouchida,
L. Lee,
V. N. Rao, and E. S. P. Reddy.
1994.
TLS/FUS fusion domain of TLS/FUS-erg chimeric protein resulting from the t(16;21) chromosomal translocation in human myeloid leukemia functions as a transcriptional activation domain.
Oncogene
9:3717-3729[Medline].
|
| 36.
|
Rabbitts, T. H.,
A. Forster,
R. Larson, and P. Nathan.
1993.
Fusion of the dominant negative transcription regulator CHOP with a novel gene FUS by translocation t(12;16) in malignant liposarcoma.
Nat. Genet.
4:175-180[Medline].
|
| 37.
|
Rabbitts, T. H.
1994.
Chromosomal translocations in human cancer.
Nature
372:143-149[Medline].
|
| 38.
|
Rao, V. N.,
T. S. Papas, and E. S. P. Reddy.
1987.
erg, a human ets-related gene on chromosome 21: alternative splicing, polyadenylation, and translation.
Science
237:635-639[Abstract/Free Full Text].
|
| 39.
|
Reddy, E. S. P.,
V. N. Rao, and T. S. Papas.
1987.
The erg gene: a human gene related to the ets oncogene.
Proc. Natl. Acad. Sci. USA
84:6131-6135[Abstract/Free Full Text].
|
| 40.
|
Shimizu, K.,
H. Ichikawa,
A. Tojo,
Y. Kaneko,
N. Maseki,
Y. Hayashi,
M. Ohira,
S. Asano, and M. Ohki.
1993.
An ets-related gene, ERG, is rearranged in human myeloid leukemia with t(16;21) chromosomal translocation.
Proc. Natl. Acad. Sci. USA
90:10280-10284[Abstract/Free Full Text].
|
| 40a.
| Shimizu, K. Unpublished data.
|
| 41.
|
Siddique, H. R.,
V. N. Rao,
L. Lee, and E. S. P. Reddy.
1993.
Characterization of the DNA binding and transcriptional activation domains of the erg protein.
Oncogene
8:1751-1755[Medline].
|
| 42.
|
Sorensen, P. H. B.,
S. L. Lessnick,
D. Lopez-Terrada,
X. F. Liu,
T. J. Triche, and C. T. Denny.
1994.
A second Ewing's sarcoma translocation, t(21;22), fuses the EWS gene to another ETS-family transcription factor, ERG.
Nat. Genet.
6:146-151[Medline].
|
| 43.
|
Yamamoto, K.,
H. Hamaguchi,
K. Nagata,
M. Kobayashi,
F. Tanimoto, and M. Taniwaki.
1997.
Establishment of a novel human acute myeloblastic leukemia cell line (YNH-1) with t(16;21), t(1;16) and 12q13 translocations.
Leukemia
11:599-608[Medline].
|
| 44.
|
Zinszner, H.,
R. Albalat, and D. Ron.
1994.
A novel effector domain from the RNA-binding protein TLS or EWS is required for oncogenic transformation by CHOP.
Genes Dev.
8:2513-2526[Abstract/Free Full Text].
|
| 45.
|
Zucman, J.,
O. Delattre,
C. Desmaze,
A. L. Epstein,
G. Stenman,
F. Speleman,
C. D. M. Fletchers,
A. Aurias, and G. Thomas.
1993.
EWS and ATF-1 gene fusion induced by t(12;22) translocation in malignant melanoma of soft parts.
Nat. Genet.
4:341-345[Medline].
|
| 46.
|
Zucman, J.,
T. Melot,
C. Desmaze,
J. Ghysdael,
B. Plougastel,
M. Peter,
J. M. Zucker,
T. J. Triche,
D. Sheer,
C. Turc-Carel,
P. Ambros,
V. Combaret,
G. Lenoir,
A. Aurias,
G. Thomas, and O. Delattre.
1993.
Combinatorial generation of variable fusion proteins in the Ewing family of tumors.
EMBO J.
12:4481-4487[Medline].
|
Molecular and Cellular Biology, November 1999, p. 7639-7650, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.