Previous Article | Next Article 
Molecular and Cellular Biology, November 1999, p. 7782-7791, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Evidence for Distinct Substrate Specificities of
Importin
Family Members in Nuclear Protein Import
Matthias
Köhler,1,2
Christian
Speck,3
Marret
Christiansen,4
F. Ralf
Bischoff,5
Siegfried
Prehn,4
Hermann
Haller,1
Dirk
Görlich,6 and
Enno
Hartmann2,7,*
Charité,
Franz-Volhard-Klinik,1 and
Max-Delbrück-Centrum,2
Berlin-Buch, Institut für Biochemie der
Charité4 and MPI Molekulare
Genetik,3 Berlin, Zentrum für
Molekulare Biologie6 and Abteilung
Molekulare Biologie der Mitose, Deutsches
Krebsforschungszentrum,5 Heidelberg, and
Abteilung Biochemie II, Zentrum Biochemie und Molekulare
Zellbiologie, Georg August University Göttingen,
Göttingen,7 Germany
Received 3 March 1999/Returned for modification 15 April
1999/Accepted 3 August 1999
 |
ABSTRACT |
Importin
plays a pivotal role in the classical nuclear protein
import pathway. Importin
shuttles between nucleus and cytoplasm, binds nuclear localization signal-bearing proteins, and functions as an
adapter to access the importin
-dependent import pathway. In
contrast to what is found for importin
, several isoforms of
importin
, which can be grouped into three subfamilies, exist in
higher eucaryotes. We describe here a novel member of the human family,
importin
7. To analyze specific functions of the distinct importin
proteins, we recombinantly expressed and purified five human
importin
's along with importin
from Xenopus and
Saccharomyces cerevisiae. Binding affinity studies showed
that all importin
proteins from humans or Xenopus bind
their import receptor (importin
) and their export receptor (CAS)
with only marginal differences. Using an in vitro import assay based on
permeabilized HeLa cells, we compared the import substrate
specificities of the various importin
proteins. When the substrates
were tested singly, only the import of RCC1 showed a strong preference
for one family member, importin
3, whereas most of the other
substrates were imported by all importin
proteins with similar
efficiencies. However, strikingly different substrate preferences of
the various importin
proteins were revealed when two substrates
were offered simultaneously.
 |
INTRODUCTION |
Heavy trafficking between the
nucleus and the cytoplasm takes place in eucaryote cells. Various
substrates, such as different forms of RNA and many nuclear proteins,
must be exported into the cytoplasm. Other proteins, such as
transcription factors and ribonucleoprotein particles, must be imported
into the nucleus. Nuclear transport occurs through the nuclear pore
complexes (NPCs), which are about 125 MDa in size (34).
Whereas smaller molecules up to 20 to 60 kDa may passively diffuse
through the NPCs into the nucleus, the import of larger substrates is
generally receptor mediated (12). This import process
depends on the presence of specific signal sequences within the
substrate. Different types of import signals exist. One such signal
consists of the so-called nuclear localization signals (NLSs), which
are mainly characterized by clusters of basic amino acids,
predominately lysines. Depending on the numbers of their charged
clusters, the NLSs may be classified into monopartite and bipartite
NLSs (8, 9).
Several soluble factors of the classical nuclear protein import pathway
have been identified so far, including the small GTPase Ran/TC4
(26, 30), importin
(16, 20, 45), importin
(1, 4, 14, 19, 39), and NTF2 (31, 36), which is
involved in the import and export of Ran (41). Importin
functions as an adapter molecule by binding importin
via its amino-terminally located importin
binding (IBB) domain (13, 46) and by binding NLS-bearing proteins via its two NLS binding sites in the central area (5, 18). Importin
is the
transport receptor that carries the importin
-NLS complex from the
cytoplasm into the nuclear side of the NPC (17). Once inside
the nucleus, importin
binds to RanGTP, which is generated within
the nucleus by the chromatin-bound RanGDP/GTP exchange factor RCC1.
This binding of importin
to RanGTP leads to the dissociation of the
import complex (15). Whereas importin
is thought to
return to the cytoplasm rapidly without other soluble factors, the
export of importin
is mediated by its nuclear export factor CAS,
which binds to importin
preferentially in the presence of RanGTP
(24). In the cytoplasm, the importins are set free for
another round of import by the concerted action of RanGAP1 and RanBP1.
Only one gene coding for importin
has been identified in the
organisms analyzed thus far. In contrast to what was found for importin
, several isoforms of importin
in humans have been described.
These include importin
1/Rch1 (7, 45), importin
5/hSRP1 (6), importin
3/Qip1 (23, 42),
importin
4/hSRP1
(23, 32), importin
6
(23), and, here, the newly reported importin
7. Importin
7 is the human homologue of the recently identified mouse importin
-S2 (44). Based on the sequence similarity, the importin
proteins can be grouped into three subfamilies. Members of
different subfamilies have about 50% sequence identity. Within one
subfamily, the identity is at least 80%. Whereas several of these
isoforms are also found in invertebrates, the yeast Saccharomyces cerevisiae has only one gene for importin
, SRP1.
Why so many importin
isoforms exist in higher eucaryotes has not
yet been definitely answered. Although there is some tissue specificity in the expression of these proteins (23, 32, 38, 44), most
isoforms are expressed within the same tissues. Initial data indicate
that there may be distinct substrate specificities of different
importin
family members (11, 28, 33, 43). However, other
data show that different importin
proteins can interact with the
same substrate (37, 38). We compared all of the ubiquitously
expressed human importin
proteins, Xenopus importin
2, and yeast SRP1p in their efficiencies to promote the nuclear
import of different substrates. When testing only one substrate per
assay, we found that most substrates (NLS-bovine serum albumin [BSA],
nucleoplasmin, P/CAF, and hnRNP K) were imported by all importin
proteins with only marginal differences. The exception was the nuclear
import of RCC1, which was efficient only with importin
3, not with
other isoforms. If two substrates are offered at the same time, the
various importin
proteins show striking differences in their
substrate-specific import efficiencies.
 |
MATERIALS AND METHODS |
Isolation of importin
7 cDNA.
For isolation of importin
7, 5' rapid amplification of cDNA ends (RACE) and 3' RACE were
performed with a HeLa Marathon Ready cDNA kit (Clontech) by using the
primers AAT(C)TGTTCT(A)GCC(A)C(T)TACCC(T)TGT(C)CT, CTCTTCCGCTGGCTGGTGGTG, and
TATAACAAGCCTTTATTGAGCCCT, which correspond to human cDNA
clones (GenBank accession no. T08580 and U68730). Several positive
clones, which harbored the proposed start codon or the proposed stop
codon, were isolated and sequenced. Full-length cDNA of importin
7
was obtained by using the cDNAs of the N and C termini and primers
AACCCCGGCATGCAGACCATGGCGAGCCCAGGGAAAGAC and
CAATTTGGATCCTAGCTGGAAGCCCTCCATGGGGGCC. Full-length cDNA of importin
5/hSRP1 was obtained via PCR with the same HeLa cDNA kit
and primers TTGCGCCCATGGCCACCCCAGGAAAAGAGAAC and
GAAGCCGGATCCAAGCTGGAAACCTTCCATAGGA. The cloning of the other
importin
cDNAs has been described earlier (14, 23).
Northern blotting.
Human multiple-tissue Northern blots
(Clontech) were hybridized according to the manufacturer's
instructions with an [
-32P]dATP-labeled 0.5-kbp cDNA
fragment from importin
7 and with a 2.0-kbp fragment of
-actin.
Generation of antibodies and immunoblotting.
The generation
of antibodies against peptide sequences of importin
1/Rch1, importin
5/hSRP1, importin
3, and importin
4 was described previously
(23). Two antibodies against the newly identified human
importin
7 were raised against peptide sequences MASPGKDNYR,
representing amino acids 3 to 12 of human importin
7, and
PEAPMEGFQUL, representing amino acids 526 to 536. Since very similar
peptides are also present in importin
6, the antibodies against
importin
7 recognize recombinant importin
6 as well. Cross-reaction of the antibodies with other importin
forms was excluded by immunoblotting with the recombinantly expressed proteins. For the analysis of the tissue-specific expression of the importin
forms by immunoblotting, human protein lysates (Clontech; 25 µg per
lane) were separated sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis (SDS-10% PAGE) and blotted. Detection was achieved by
chemiluminescence (Du Pont).
CAS binding assay.
Ran-[
-32P]GTP (50 pM)
was preincubated in a mixture of 20 mM HEPES-NaOH (pH 7.2), 50 mM
sodium acetate, 1 mM MgCl2, 0.5% hydrolyzed gelatin, 0.4%
sodium azide, and either 1 µM CAS or mixtures of 1 µM CAS and the
different importin
homologous proteins. After 30 min at 15°C, 40 nM Rna1p was added and the reaction was allowed to proceed for 30 s. The hydrolysis of Ran-bound GTP was determined as released
[32P]phosphate. The final reaction volume was 25 µl,
and the concentrations of importin
proteins are as indicated in the
legends for Fig. 4 and 5.
Importin
binding assay.
Equilibrium dissociation
constants (KDs) of the interaction between the
importin
's and importin
were determined by surface plasmon
resonance (SPR) measurements with a Biacore 2000 instrument. The
different importin
isoforms were diluted to a final concentration of about 100 ng/µl and immobilized on the surface of a Pioneer F1
sensor chip (Biacore AB) by the amine-coupling method described in the
Biacore manual (22). The immobilization level was 250 to 800 RU for importin
's and for BSA, which served as a control. Unreacted normal human serum was blocked for 8 min with 1 M
ethanolamin. To determine kinetic constants, sensorgrams were collected
at 22°C, an 8-µl/min flow rate, and a 2.5-Hz data collection rate. Importin
(220 µl) dissolved in HBS-EP buffer (10 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM EDTA, 0.05% P20; Biacore AB) was injected at
different concentrations (6.25 to 200 nM) by using the KINJECT command
specifying 27.5 min of association time and 6 min of dissociation time.
Subsequently, 8 µl of regeneration solution (2 M NaCl in HBS-EP
buffer) was injected. Sets of sensorgrams with analyte concentrations
of 6.25 to 200 nM and without protein for background correction were
collected. For evaluation we used BIAevaluation 3.0 software (Biacore
AB). The data were fitted with the steady-state affinity model. As a
reference, we subtracted the BSA and buffer control.
Recombinant expression and purification of the importin
proteins.
Full-length cDNAs were digested with
NcoI/BamHI (importin
5/hSRP1, importin
3),
NcoI/BglII (importin
4), and
SphI/BamHI (importin
7). The particular
restriction sites had been introduced by PCR primers. After ligation
into expression vectors (for importin
5/hSRP1, importin
3, and
importin
4, pQE60; for importin
7, pQE70; Qiagen), the resulting
constructs encoding C-terminally His-tagged proteins were verified by
DNA sequencing. Expression was performed in a culture of
Escherichia coli XL1/pSB161 at 25°C for 4 h.
Phenylmethylsulfonyl fluoride (2 mM) was added immediately before the
culture was chilled on ice. After centrifugation, the bacterial pellet
was resuspended in sonification buffer (50 mM Tris-HCl [pH 7.5], 200 mM NaCl, 5 mM magnesium acetate, 5% glycerol), and bacteria were lysed
by sonification. The lysate was cleared by ultracentrifugation in a
50.2 Ti rotor at 50,000 rpm for 2 h. After 20 mM imidazole was
added, the supernatant was loaded onto nickel agarose. Elution of the
column was performed with an imidazole gradient, and peak fractions
were pooled. For importin
5/hSRP1, pooled fractions were dialyzed
against sonification buffer and stored at
80°C after 250 mM sucrose
had been added. The other importin
protein peak fractions were
loaded onto a Mono Q column and eluted in 50 mM Tris-HCl (pH 7.5)-5%
glycerol by using a NaCl gradient. Peak fractions were pooled again and stored at
80°C after 250 mM sucrose had been added. The
concentrations of the proteins were determined via photometry at 280 nm
with the molar extinction coefficient described by Edelhoch
(10). Preparation of the following proteins was described
earlier: C-terminally His-tagged Xenopus importin
2,
nucleoplasmin, nucleoplasmin core, human Ran, Schizosaccharomyces
pombe Rna1p, murine RnaBP1, and NTF2 (25); NLS-BSA,
Rch1, and yeast SRP1p (14); and importin
(17). RCC1 was expressed and purified exactly as described here for the newly identified importin
proteins. Fluorescence labeling of purified import substrates was performed with fluorescein 5'-maleimide, FLUOS, or Texas red, as described earlier
(24).
In vitro nuclear protein import assay.
Import assays were
performed as described previously (21) based on the method
described by Adam et al. (2). Briefly, HeLa cells were grown
on 12-mm coverslips to 40 to 80% confluence, washed once in ice-cold
phosphate-buffered saline (PBS), and permeabilized for 8 min in
ice-cold 20 mM HEPES-KOH (pH 7.5)-110 mM potassium acetate-5 mM
magnesium acetate-0.5 mM EGTA-250 mM sucrose-40 µg of digitonin
(Sigma) per ml. Coverslips were incubated with 20 µl of import
mixture for 8 min at room temperature, and reactions were stopped by
fixation with 4% paraformaldehyde in PBS. After being washed in PBS
and water, the coverslips were mounted with Vectorshield mounting
medium (Vector) and analyzed by confocal microscopy (Leika; TCS NT).
The import reaction mixtures consisted of an energy-regenerating system
(0.5 mM ATP, 0.5 mM GTP, 10 mM creatine phosphate, 50 µg of creatine
kinase per ml), core buffer (2 µg of nucleoplasmin core per ml, 20 mM
HEPES-KOH [pH 7.5], 140 mM potassium acetate, 6 mM magnesium acetate,
250 mM sucrose), 0.5 mM EGTA, 3 µM RanGDP, 0.2 µM Rna1p, 0.3 µM
RanBP1, 0.4 µM NTF2, 1 µM importin
, a 2 µM concentration of
an importin
protein, and 10% reticulocyte lysate.
Nucleotide sequence accession number.
The nucleotide
sequence associated with importin
7 has been assigned GenBank
accession no. AF060543.
 |
RESULTS |
Cloning and analysis of the distribution of human importin
7 in
tissue.
Whereas in different mammals only one importin
protein
has been identified so far, both humans and mice harbor at least five
different importin
proteins. The human homologues for most of the
mouse proteins have been definitely determined. However, whether or not
importin
-S2 (44) represents the mouse homologue of human
importin
6 or the homologue of a yet-unknown human importin
protein was not clear. Since we wanted to investigate the functions of
all human importin
proteins, we screened the GenBank database and
identified a partial sequence of an unknown human cDNA which displayed
a high degree of homology with both human importin
6 and mouse
importin
-S2. We isolated the corresponding coding cDNA by PCR and
found it to be 1,611 bp in length. The encoded protein (importin
7)
has about 85% identity to human importin
6 and more than 99%
identity to mouse importin
-S2 (Fig.
1A). Therefore, importin
7 belongs to
the SRP1-like subfamily of vertebrate importin
proteins (Fig. 1B).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Amino acid sequence of human importin 7. Residues
in human importin 6 and mouse importin -S2 that differ from those
in human importin 7 are indicated above or below the importin 7
sequence, respectively. Epitopes used for antibody generation are
underlined. (B) Alignment tree of all known importin homologues.
Tree construction was performed with the CLUSTAL program. All putative
complete proteins of the GenBank and Swiss-Prot databases containing
arm repeats and an IBB domain were included in the analysis. The
accession numbers of the proteins are (Imp, importin): Imp homologue (hom.), rice, AB006788; Imp homologue A, C. eleg., gi1707027; Srp1p, yeast, Q02821; Srp1 A, S. pombe, O14063; Srp1 B, S. pombe, AL034433; Srp1 C,
A. thal., O04294; Srp1 D, A. thal., AC003114;
Srp1, tomato, O22478; Srp1, rice, AB004660; Srp1 A, A. thal., AF077528; Srp1 B, A. thal., Y14615; Srp1,
D. mela., AF074957; Imp 6, human, O15131; Imp 7,
mouse, O35345; Imp 7, human, AF060543; Srp1/Imp 5, mouse, U34228;
Srp1/Imp 5, human, P52294; Imp 3, C. eleg., AF040995;
Imp 3, D. mela., AF074958; Imp 3, human, O00629; Imp
3, mouse, O35343; Imp 4, human, O00505; Imp 4, mouse, O35344;
OHO31/Imp 1, D. mela., A57319; pendulin/Imp 1, mouse,
P52293; Rch1/Imp 1, human, P52292; Imp 2a, X. laev.,
P52170; Imp 2b, X. laev., P52171; Imp homologue B,
C. eleg., AF040997. C. eleg.,
Caenorhabditis elegans; A. thal.,
Arabidopsis thaliana; D. mela., Drosophila
melanogaster; X. laev., Xenopus laevis;
yeast, S. cerevisiae.
|
|
To determine the distribution of importin
7 in tissue, we first
performed RNA analysis by Northern blotting. Transcripts of 8 kbp were
detectable in human poly(A)+ RNA from almost all tissues
tested (Fig. 2). However, the levels of
expression differed considerably. No transcript for importin
7 was
detectable in thymus, and the expression levels in lung, liver, small
intestine, and colon were significantly lower than those of the other
tissues tested, even though control hybridization with
-actin
demonstrated that comparable amounts of RNA were loaded (1.7 and 2.0 kbp). The signal at 2.4 kbp in testis is probably due to a
cross-reaction with human importin
6, which we previously reported
to be expressed only in testis (23). Thus, in contrast to
its most highly related isoform, importin
6, importin
7 is expressed in a variety of tissues.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of importin 7 mRNA in human tissues. Human
multiple-tissue Northern blots were hybridized with probes specific for
importin 7 and -actin. A suggested cross-reactive band of
importin 6 was detected in testis at 2.4 kb. sk. muscle, skeletal
muscle; sm. intest., small intestine; bl. leuk., peripheral blood
leukocytes.
|
|
Protein expression pattern of soluble factors involved in
importin-dependent protein transport.
Thus far, several groups
have investigated the distribution of different importin
isoforms
in tissue (23, 32, 38, 44). In contrast, little is known
about the distribution of the shuttling transport factors, importin
, CAS, and Ran in tissue. Therefore, we compared the expression
levels of all known human shuttling transport factors of the classical
import pathway by immunoblot analysis of protein lysates obtained from
various tissues. Only NTF2, which was recently shown to transport Ran
into the nucleus (41), was not included in our study. First,
we generated antibodies against importin
7, CAS, and Ran. Antibodies
that specifically recognize the other factors (importin
1/Rch1,
importin
5/hSRP1, importin
3, importin
4, and importin
)
had been obtained previously (17, 23). Antibodies for
importin
7 were raised against two different peptides which
correspond to the amino terminus and the carboxy terminus of the
protein. Due to the high sequence similarity of the proteins, these
antibodies were found to recognize recombinant importin
6 as well
but do not cross-react with other importin
proteins (data not shown).
By analyzing lysates of different human tissues by immunoblotting, we
detected all transport factors in the investigated tissues (Fig.
3). In agreement with the mRNA analysis,
importin
7 protein was found in all tissues tested. In terms of
total protein concentration, the expression levels of importin
,
importin
, CAS, and Ran vary between the different tissues and were
low in spleen and liver. However, these variations were not always
uniform. For example, in ovary and lung, where importin
proteins
are quite abundant, the expression levels of the other factors are not
elevated. Testis and brain contain the highest relative amounts of CAS, but not of importin
proteins. In the heart, the Ran levels were lowest, while the other factors were present in average amounts. A
reason for the lack of correlation could be that these factors are also
involved in functions other than the importin
-dependent protein
transport process. This is well established for Ran (29) and
importin
(21), but not for CAS. In several tissues, the relative expression levels of particular importin
proteins differed from those of other importin
forms, as has been reported earlier (23). Notably, the antibodies against importin
7 and
importin
4 detect several proteins in the range of 60 kDa which are
not present in all tissues. In both cases, these bands are recognized by two independent antibodies raised against the extreme N terminus and
C terminus, respectively (data not shown), which probably reflects the
existence of modified or alternatively spliced versions of these
proteins.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of the shuttling transport factors of the
classical nuclear import pathway in human tissues at the protein level.
Twenty-five micrograms of total protein lysates was loaded per lane,
separated by SDS-PAGE, and probed by immunoblotting with the antibodies
against importin 1/Rch1, importin 3, importin 4, importin
5/hSRP1, importin 7, importin , CAS, and Ran. imp, importin;
sm. intest., small intestine.
|
|
Binding affinities between importin
proteins and their carriers
importin
and CAS.
To investigate the properties of the various
importin
's during protein import, we recombinantly expressed and
purified the five ubiquitously expressed human isoforms, as well as
Xenopus importin
2 and the only yeast importin
homologue, SRP1p (Fig. 4A). We first
wanted to investigate if there were differences in binding to the
nuclear import factor importin
or in binding to CAS, the nuclear
export factor of importin
.


View larger version (104K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Purified recombinant importin proteins migrate
between 50 and 60 kDa. Solutions (7.5 µl, 2 µM) of each
recombinantly expressed and purified importin protein were
separated by SDS-PAGE and stained with Coomassie blue. imp, importin;
Xen, Xenopus; ySRP1, yeast SRP1p. (B) Determination of the
binding affinities of importin 1/Rch1 (RCH1), importin 5/hSRP1
(hSRP1), and importin 3 to CAS. (C) Determination of the binding
affinities of importin 4, importin 7, Xenopus importin
2 (importin Xen), and yeast SRP1p (ySrp1p) to human CAS.
Ran-[ -32P]GTP (50 pM) was preincubated either with 1 µM CAS or with mixtures of 1 µM CAS and the different importin homologous proteins. After 30 min at 15°C, 40 nM Rna1p (the S. pombe homologue of RanGAP1) was added and the reaction was allowed
to proceed for 30 s. Hydrolysis of Ran-bound GTP was determined as
released [32P]phosphate.
|
|
To quantitate the binding affinities of the different importin
proteins to CAS, we employed the fact that the binding affinity of CAS
for RanGTP is greatly enhanced in the presence of importin
proteins. Furthermore, the binding results in protection against activation of Ran/TC4 GTPase by RanGAP1 (24). We
preincubated 50 pM Ran-[
-32P]GTP either with 1 µM
human CAS or with mixtures of 1 µM human CAS and the different
importin
homologous proteins. After 30 min at 15°C, we added 40 nM Rna1p for 30 s and determined the hydrolysis of Ran-bound GTP
as released [32P]phosphate. As can be seen in Fig. 4B, we
found that importin
5/hSRP1, importin
1/Rch1, and importin
3
bind CAS with high affinity within the same range
(KD < 2 nM) (Fig. 4B). The binding affinity of Xenopus importin
2 was only marginally weaker
(KD > 3 nM) (Fig. 4C). However, in
comparison to the human isoforms importin
7 and importin
4
(KD > 5 nM), the binding affinity of
Xenopus importin
2 to CAS was even higher. Only yeast
SRP1p showed a binding affinity to CAS characterized by much less
efficiency (KD > 20 nM).
The binding of the different importin
proteins to importin
was
analyzed with the Biacore 2000 instrument. We immobilized the
recombinant importin
proteins and BSA (as a control) on sensor
chips and injected various concentrations of recombinant importin
(6.25 to 200 nM). We measured the SPR response and calculated the
equilibrium KD from the results. Thus, we found that all importin
proteins tested were able to bind importin
very efficiently (Table 1). The
differences between the human importin
proteins for binding
importin
that we detected were only marginal. The highest binding
affinities to importin
were found for importins
4 and
7 (5 nM). The lowest binding affinity was detected for importin
3 (18 nM). Interestingly, Xenopus importin
2 and yeast SRP1
showed no marked differences in their binding affinities to importin
in comparison to the human isoforms (3 and 5 nM, respectively). In
contrast, BSA was not able to bind importin
significantly,
demonstrating that the binding of the
importins to importin
is
specific.
Comparison of the import efficiencies of different importin
proteins in vitro by using standard substrates.
To analyze the
specific functions of the different importin
proteins, we wanted to
compare their import efficiencies in parallel by a defined in vitro
nuclear import assay. First, we established that all recombinant
proteins were able to import the standard substrates simian virus 40 large-T antigen-NLS-BSA and Xenopus nucleoplasmin. Import
assays were generally performed in the presence of reticulocyte lysate,
which improved the efficiency of protein import. In the absence of
importin
, the reticulocyte lysate had no effect on the nuclear
import of any substrate tested. Presently, we cannot decide whether
this improvement of import efficiency by reticulocyte lysate is due to
unspecific protein-protein interactions or caused by as-yet-unknown
specific import factors. Fractionation of reticulocyte lysate showed
that several fractions display this effect, but no fraction was as
stimulating as the total lysate. Hemoglobin, the most abundant protein
of reticulocyte lysate, did not enhance the import efficiency.
A typical result for the different importin
proteins is shown in
Fig. 5. We found that all recombinant
importin
proteins, including the hitherto-uninvestigated importin
7, were able to import both substrates. However, there were clear
differences in the import efficiencies of the different importin
proteins. For NLS-BSA, the best import efficiencies were found with
importin
5/hSRP1, importin
3,
7, and Xenopus
importin
2. The effect of importin
4 was mildly weaker, but still
stronger than that of importin
1/Rch1. The weakest import efficiency
on NLS-BSA was displayed by yeast SRP1p, although the nuclear
accumulation of the labeled substrate was still evident in comparison
to that of the negative control, which was performed without adding any importin
protein. The pattern for nuclear import of nucleoplasmin was similar to the one for NLS-BSA. Importin
5/hSRP1 showed the strongest effect on nuclear import of nucleoplasmin, followed by
importin
3,
4, and Xenopus importin
2. The import
efficiencies of importin
1/Rch1 and importin
7 were mildly
weaker, and that of yeast SRP1p was again the weakest. The negative
control showed a typical pattern, with a few cells displaying a weak
nuclear staining which is most likely due to leaky nuclear envelopes. However, most of the nuclei are clearly negative, in contrast to the
results of all import assays with one of the importin
proteins
added to the import reaction mixture.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
All importin proteins can import standard substrates
with monopartite (NLS-BSA) and bipartite NLS (nucleoplasmin) in vitro.
HeLa cells were grown on coverslips and permeabilized for 8 min with
digitonin. Coverslips were incubated with 20 µl of import mixture for
8 min. Reactions were stopped by fixation with 4% paraformaldehyde.
The coverslips were mounted and analyzed by confocal microscopy. The
import reaction mixtures consisted of an energy-regenerating system,
nucleoplasmin core buffer, 3 µM RanGDP, 0.2 µM Rna1p, 0.3 µM
RanBP1, 0.4 µM NTF2, 1 µM importin , a 2 µM concentration of
the indicated importin protein, and 10% reticulocyte lysate. (A)
Importin -dependent nuclear import of Texas red-labeled
nucleoplasmin. 3, importin 3; 4, importin 4; 7, importin
7; Xen 2, Xenopus importin 2; ySRP1, yeast SRP1p;
no , no importin added to the import reaction mixture. (B)
Importin -dependent nuclear import of fluorescein-labeled simian
virus 40 large-T antigen coupled to NLS-BSA.
|
|
Importin
-dependent nuclear import of hnRNP K, P/CAF, and
RCC1.
We next analyzed the abilities of the various importin
proteins to mediate the import of three functionally completely
different human proteins, namely, the shuttling RNA-binding protein
hnRNP K containing a nuclear shuttling domain which confers
bidirectional transport across the nuclear envelope and also a
classical NLS (27), the stimulator of the Rous sarcoma virus
promoter P/CAF (40), and Ran's major GDP/GTP exchange
factor, the chromatin-bound protein RCC1, which is exclusively located
inside the nucleus (3, 35). First, we added the
fluorescein-labeled proteins as single substrates into the import assay
reaction mixtures (Fig. 6A,
7A, and
8A). We found that both hnRNP K and P/CAF
were imported by most of the importin
proteins very efficiently
(Fig. 6A and 7A). Similar to the results of assays testing the import
of the standard substrates NLS-BSA and nucleoplasmin, the efficiencies of the import reactions differed slightly depending on the importin
protein used. Importin
1/Rch1, Xenopus importin
2,
importin
3, and importin
5/hSRP1 showed the best stimulation of
the nuclear import of hnRNP K, whereas importins
4,
7, and yeast
SRP1p displayed a somewhat weaker effect. For P/CAF, these differences
were even less pronounced. Here, the pattern after import with importin
1/Rch1 was somewhat more heterogeneous and the effects of importin
4 and yeast SRP1p were weaker than those of the other importin
isoforms. In contrast to what was found for hnRNP K and P/CAF, when
RCC1 was added as the only substrate to the import reaction mixture, we
found striking differences in its nuclear import depending on the
importin
protein used in the import assay (Fig. 8A). While importin
3 proved to behave as a very good import factor for RCC1, the effect
of importin
4 was moderate, and the other importin
proteins had
hardly any effect at all.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
Importin -dependent nuclear import of hnRNP K. In
vitro nuclear import of fluorescein-labeled hnRNP K was performed as
described above (see Materials and Methods and legend for Fig. 5)
either in the absence (A) or in the presence (B, right panels) of Texas
red-labeled nucleoplasmin by using the importin proteins indicated.
(B) Left panels, hnRNP K staining; right panels, nucleoplasmin (NPL)
staining. 3, importin 3, 4, importin 4; 7, importin
7; Xen 2, Xenopus importin 2; ySRP1, yeast SRP1p;
no , no importin added to the import reaction mixture.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 7.
Importin -dependent nuclear import of P/CAF. In vitro
nuclear import of fluorescein-labeled P/CAF was performed as described
above (see Materials and Methods and legend for Fig. 5) either in the
absence (A) or in the presence (B, right panels) of Texas Red-labeled
nucleoplasmin (NPL) by using the importin proteins indicated. (B)
Left panels, P/CAF staining; right panels, nucleoplasmin staining.
3, importin 3; 4, importin 4; 7, importin 7; Xen
2, Xenopus importin 2; ySRP1, yeastSRP1p; no , no
importin added to the import reaction mixture.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 8.
Importin -dependent nuclear import of RCC1. In vitro
nuclear import of fluorescein-labeled RCC1 was performed as described
above (see Materials and Methods and legend for Fig. 5) either in the
absence (A) or in the presence (B, right panels) of Texas red-labeled
nucleoplasmin (NPL) by using the importin proteins indicated. (B)
Left panels, hnRNP K staining; right panels, nucleoplasmin staining.
3, importin 3; 4, importin 4; 7, importin 7; Xen
2, Xenopus importin 2; ySRP1, yeast SRP1p; no , no
importin added to the import reaction mixture.
|
|
In living cells many substrates are present in the cytoplasm and may
compete for transport into the nucleus by a particular importin
protein. Therefore, we wondered whether or not good import substrates
might be efficient competitors in our import assays. Thus, we repeated
the import reactions with fluorescein-labeled hnRNP K, P/CAF, and RCC1,
adding in every case Texas red-labeled nucleoplasmin as well, which has
been shown to be imported by all importin
proteins (Fig. 5). If
hnRNP K was combined with nucleoplasmin, importins
4 and
7 had a
weaker effect on the nuclear import of hnRNP K than importin
5/hSRP1, importin
3, and importin
1/Rch1 (Fig. 6B). These
findings were similar to what we found with hnRNP K alone (Fig. 6A).
However, in contrast to the single-substrate assay, in this
two-substrate assay, yeast SRP1p was as efficient as importin
5/hSRP1 and importin
1/Rch1 in transporting hnRNP K into the cell
nucleus. Surprisingly, Xenopus importin
2 now had no
effect at all on the nuclear import of hnRNP K. This finding clearly
demonstrates that the relative effect on nuclear import of hnRNP K by a
particular importin
isoform can be decreased if another competing
substrate is present. These changes were found to be even more dramatic
if fluorescein-labeled P/CAF was added to the import assay mixtures
together with Texas red-labeled nucleoplasmin (Fig. 7B). Only importin
3 was able to import P/CAF very efficiently in the presence of
nucleoplasmin. In contrast, the effect of all other importin
proteins on the nuclear transport of P/CAF was greatly diminished
(importin
5/hSRP1, importin
4, importin
7, yeast SRP1p) or
even abolished (importin
1/Rch1 and Xenopus importin
2) if nucleoplasmin was added to the assay mixture. A comparison of
the various patterns found for nuclear import of nucleoplasmin (Fig. 5,
6B, 7B, and 8B) indicates that good import substrates can strongly
compete for each other depending on the particular importin
protein
present in the assay system. Whereas, in the presence of hnRNP K,
Xenopus importin
2 is the most efficient transport factor
for nucleoplasmin, importin
5/hSRP1 becomes the best
import-stimulating isoform for nucleoplasmin if RCC1 is added to the
import reaction mixture, and the effect of Xenopus importin
2 on nucleoplasmin import is much weaker (compare Fig. 6B with Fig.
8B). It should be noted that different settings of the confocal
microscope were used for single- and double-labeling experiments, i.e.,
one cannot directly compare the intensities between these different
types of experiments. This can be seen if, e.g., one compares the
negative controls in Fig. 6A and B. Within one experimental series, the
settings had of course been identical for all combinations of a given
substrate with the indicated import factors.
 |
DISCUSSION |
The classical nuclear protein import pathway is mediated by the
and
subunits of importin. Importin
functions as an adapter molecule by binding both importin
and the NLS-bearing import substrate. While only one importin
isoform has been found in humans
thus far, six human genes for importin
exist, including that for
importin
7, newly described here. Some of these importin
isoforms may even occur in different versions. We found partial cDNAs
in the database corresponding to importin
6 and importin
7, which
may represent alternatively spliced mRNAs. Those cDNAs would code for
proteins with amino termini three amino acids shorter or longer than
those published, respectively. As reported previously (23, 32, 38,
44) and now confirmed in more detail here, the relative
expression levels of a particular importin
form may vary between
different tissues, indicating a special demand of different cell types
for specific importin
's. Nevertheless, all human importin
proteins can be found in various tissues with the exception of importin
6, which has thus far been found only in testis. Even more striking,
these proteins are expressed simultaneously in many cell lines, such as
HeLa cells or human umbilical vein epithelial cells (reference
23 and data not shown).
The radiation of ancestral importin
genes into different
orthologues probably occurred several times during evolution (Fig. 1B).
Most of the known importin
forms, such as the six mammalian importin
's, belong to one of three main subgroups, which differ from one another in about 50% of their amino acids. However, several other species such as C. elegans and rice possess additional
importin
-like proteins differing in more than 75% of their amino
acids from those isoforms of the main subgroups. Most species examined so far possess at least one protein which belongs to the SRP1-like subgroup. Humans have three different SRP1-like proteins, namely, importin
5, importin
6, and the newly reported importin
7. In
contrast to the diversity found in other organisms,
Schizosaccharomyces pombe has two genes coding for importin
proteins and S. cerevisiae has only one importin
gene, SRP1. This indicates that one importin
isoform
alone may be sufficient to fulfill the basic requirements of a
eucaryotic cell.
Although the identity of the primary sequences of the importin
isoforms including the IBB domain varies between 50 and 85%, the
proteins do not differ dramatically in their interactions with their
transport receptors CAS and importin
. The human importin
proteins bind CAS with a KD between 2 and 5 nM.
These differences are small and could be caused by variations in the
quality of the protein purification process. Whereas the binding
affinity of Xenopus importin
2 turned out to be in the
same range as that of the human importin
forms, yeast SRP1p showed
a clearly less efficient binding affinity to CAS
(KD > 20 nM). Since yeast SRP1p is less
homologous to the human importin
proteins than Xenopus importin
2 is, the weaker binding affinity of yeast SRP1p to human
CAS was not surprising. No binding to Crm1/exportin was observed. These
results fit with recently reported data from Herold et al., who found
similar binding affinities of importin
1/Rch1, importin
5/hSRP1,
and importin
4 to CAS but not to Crm1 in two-hybrid studies
(18). The KDs for the interactions
between importin
and the various importin
forms in the Biacore
assay are also in a nanomolar range (between 3 and 18 nM). These
differences are unlikely to have an influence on the in vitro assay,
where the proteins are present in micromolar concentrations. Again, these small differences may be caused by variations in the quality of
the protein purification process. In addition, the coupling of the
proteins to the sensor chips may impair the importin
forms to
different extents.
The simultaneous existence of several highly divergent importin
proteins in a given cell led to the question whether they might be
specialized in their efficiency to transport different nuclear
proteins. Several experiments clearly support this hypothesis. Sekimoto
et al. recently reported that intracellular injection of antibodies
against importin
5/hSRP1, but not against importin
1/Rch1, can
inhibit nuclear import of the transcription factor Stat1
(43). Fisher et al. reported that the Epstein-Barr virus protein EBNA1 interacts with importin
1/Rch1 but not with importin
5/hSRP1 in the yeast two-hybrid system (11). By pull-down
assays with different NLS-BSA conjugates, Nadler et al. showed that
importin
1/Rch1 and importin
5/hSRP1 share distinct binding
affinities for various NLSs (33). Finally, Miyamoto et al.
demonstrated that the efficiency of nuclear import of different
NLS-reporter protein conjugates in vitro may depend on the importin
protein present in the assay (28). Thus, earlier studies
indicated that there might exist substrate specificities for the
different importin
proteins. Therefore, we compared the import
activities of all known ubiquitously expressed human importin
proteins on different artificial and natural substrates by using a
defined in vitro import system. For comparison we also included frog
importin
2, a paralogue of human importin
1/Rch1, and yeast SRP1p
in our study. Most substrates were imported with about the same
efficiency by all importin
isoforms, if they are added as single
substrates to the assay. Nevertheless, significant differences between
the different isoforms were detectable, and the nuclear import of RCC1,
a protein that is strictly localized within the nucleus, showed a very
strong dependence on the presence of one particular importin
isoform (importin
3). The addition of two differently labeled
substrates into one import reaction mixture clearly demonstrated that
those differences are unlikely to be caused by variations in the
quality of purification of the recombinant proteins. For example, the
very strong effect of importin
1/Rch1 on the nuclear import of hnRNP
K demonstrates that its weak import efficiency on nucleoplasmin in the
same assay reaction is not due to a functionally inactive protein. Only
yeast SRP1p usually showed a weak import efficiency, probably because
its evolutionary distance from the human proteins fostered an impaired
interaction with the mammalian substrates in our import assays.
It is unlikely that differences in binding affinity between substrate
and importin
are the main reason for the observed effects in the
import assay. Although experiments using SPR demonstrate that RCC1
binds significantly better to importin
3 and
4
(KDs ~9 nM) than to the other isoforms
(KDs ~18 to 30 nM) while nucleoplasmin shows
no significant differences in its binding to the various importin
forms (KDs ~4 to 8 nM) (data not shown), these
differences are too small to have an influence on the in vitro import
assay where substrates and importin
's are present in micromolar concentrations.
Some of our results disagree with data obtained by other groups.
Nachury et al. (32) reported that importin
4/hSRP1
had a weaker efficiency to import NLS-BSA in vitro than importin
1/Rch1. We could not detect those differences. In contrast to Nachury et al.
(32), who obtained importin
4 from HeLa cells via
vaccinia virus infection and importin
1/Rch1 from E. coli, we purified all importin
proteins from the same system
(E. coli), which might explain those differences. Moreover,
Miyamoto et al. (28) reported that a CBP80-allophycocyanin
fusion protein becomes imported in their in vitro import system by
importin
1/Rch1 and by importin
5/SRP1 but not by importin
3/Qip1. In our hands, recombinant human cap binding protein is
imported by all human importin
proteins tested (data not shown).
This finding demonstrates that artificial NLS fusion proteins and their
corresponding full-length proteins may behave quite differently in the
import assay system and that testing the functional activity of the
purified import factors is very important for comparison of their
efficiencies. Furthermore, the source of the recombinant proteins might
influence the result to some extent.
If one adds two substrates simultaneously, the preference of a
particular importin
for a certain substrate can get more clear-cut.
For example, if nucleoplasmin and P/CAF are added to one import
reaction mixture at the same time, importin
3 is still able to
import P/CAF very efficiently. This result is in clear contrast to
those for the other importin
proteins, although all of them can
still import nucleoplasmin. The situation for RCC1 is similar. This
protein is transported efficiently as a single added substrate into the
nucleus only by importin
3 and to a less efficient extent by
importin
4, which is highly homologous to importin
3. The
addition of nucleoplasmin as a second substrate enhances these
differences between the members of the importin
3/
4 subfamily and
members of the other subfamilies. This observation indicates that one
level of the import efficiency regulation in the cell may be the
competition between import substrates for their "preferred"
importin
form. However, the results of our in vitro studies cannot
predict to what extent this concurrence happens in living cells and
whether or not different importin
proteins can substitute for each
other in vivo.
 |
ACKNOWLEDGMENTS |
We thank E. Bürger, B. Nentwig, and A. Wittstruck for
technical help and M. Wellner and D. Fiedler for sequencing. We also thank C. Maasch for assistance with the Biacore instrument, J. Francke
for purifying nucleoplasmin, S. Thiel for assistance with immunoblottings, and K. Ribbeck for detailed introduction into the
import assay system. The expression clone for hnRNP K was a kind gift
from Dirk Ostarek. Finally, we are grateful to F. C. Luft for
critical reading of the manuscript.
This work was supported by the Deutsche Forschungsgemeinschaft (DFG KO
1950/1-1).
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Universität Göttingen, Zentrum Biochemie und Molekulare
Zellbiologie, Abt. Biochemie II, Goßlerstr. 12d, 37073 Göttingen, Germany. Phone: 49 551 395989. Fax: 49 551 395958. E-mail: ennohart{at}mdc.berlin.de.
 |
REFERENCES |
| 1.
|
Adam, E. J., and S. A. Adam.
1994.
Identification of cytosolic factors required for nuclear location sequence-mediated binding to the nuclear envelope.
J. Cell Biol.
125:547-555[Abstract/Free Full Text].
|
| 2.
|
Adam, S. A.,
R. Sterne-Marr, and L. Gerace.
1990.
Nuclear protein import in permeabilized mammalian cells requires soluble cytoplasmic factors.
J. Cell Biol.
111:807-816[Abstract/Free Full Text].
|
| 3.
|
Bischoff, F. R., and H. Postingl.
1991.
Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1.
Nature
354:80-82[Medline].
|
| 4.
|
Chi, N. C.,
E. J. H. Adam, and S. A. Adam.
1995.
Sequence and characterization of cytoplasmic nuclear import factor p97.
J. Cell Biol.
130:265-274[Abstract/Free Full Text].
|
| 5.
|
Conti, E.,
M. Uy,
L. Leighton,
G. Blobel, and J. Kuriyan.
1998.
Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin .
Cell
94:193-204[Medline].
|
| 6.
|
Cortes, P.,
Y. Zheng-Sheng, and D. Baltimore.
1994.
RAG-1 interacts with the repeated amino acid motif of the human homologue of the yeast protein SRP1.
Proc. Natl. Acad. Sci. USA
91:7633-7637[Abstract/Free Full Text].
|
| 7.
|
Cuomo, C. A.,
S. A. Kirch,
J. Gyuris,
R. Brent, and M. A. Oettinger.
1994.
Rch1, a protein that specifically interacts with the RAG-1 recombination-activating protein.
Proc. Natl. Acad. Sci. USA
91:6156-6160[Abstract/Free Full Text].
|
| 8.
|
Dingwall, C., and R. A. Laskey.
1991.
Nuclear targeting sequences a consensus?
Trends Biochem. Sci.
16:478-481[Medline].
|
| 9.
|
Dingwall, C.,
A. V. Sharnick, and R. A. Laskey.
1982.
A polypeptide domain that specifies migration of nucleoplasmin into the nucleus.
Cell
30:449-458[Medline].
|
| 10.
|
Edelhoch, H.
1967.
Spectroscopic determination of tryptophan and tyrosine in proteins.
Biochemistry
6:1948-1954[Medline].
|
| 11.
|
Fischer, N.,
E. Kremmer,
G. Lautscham,
N. Mueller-Lantzsch, and F. A. Grässer.
1997.
Epstein-Barr virus nuclear antigen 1 forms a complex with the nuclear transporter karyopherin 2.
J. Biol. Chem.
272:3999-4005[Abstract/Free Full Text].
|
| 12.
|
Görlich, D.
1998.
Transport into and out of the cell nucleus.
EMBO J.
17:2721-2727[Medline].
|
| 13.
|
Görlich, D.,
P. Henklein,
R. A. Laskey, and E. Hartmann.
1996.
A 41 amino acid motif in importin alpha confers binding to importin beta and hence transit into the nucleus.
EMBO J.
15:1810-1817[Medline].
|
| 14.
|
Görlich, D.,
S. Kostka,
R. Kraft,
C. Dingwall,
R. A. Laskey,
E. Hartmann, and S. Prehn.
1995.
Two different subunits of importin cooperate to recognize nuclear localization signals and bind them to the nuclear envelope.
Curr. Biol.
5:383-392[Medline].
|
| 15.
|
Görlich, D.,
N. Panté,
U. Kutay,
U. Aebi, and F. R. Bischoff.
1996.
Identification of different roles for RanGDP and RanGTP in nuclear protein import.
EMBO J.
15:5584-5594 |