This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Köhler, M.
Right arrow Articles by Hartmann, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Köhler, M.
Right arrow Articles by Hartmann, E.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, November 1999, p. 7782-7791, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Evidence for Distinct Substrate Specificities of Importin alpha  Family Members in Nuclear Protein Import

Matthias Köhler,1,2 Christian Speck,3 Marret Christiansen,4 F. Ralf Bischoff,5 Siegfried Prehn,4 Hermann Haller,1 Dirk Görlich,6 and Enno Hartmann2,7,*

Charité, Franz-Volhard-Klinik,1 and Max-Delbrück-Centrum,2 Berlin-Buch, Institut für Biochemie der Charité4 and MPI Molekulare Genetik,3 Berlin, Zentrum für Molekulare Biologie6 and Abteilung Molekulare Biologie der Mitose, Deutsches Krebsforschungszentrum,5 Heidelberg, and Abteilung Biochemie II, Zentrum Biochemie und Molekulare Zellbiologie, Georg August University Göttingen, Göttingen,7 Germany

Received 3 March 1999/Returned for modification 15 April 1999/Accepted 3 August 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Importin alpha  plays a pivotal role in the classical nuclear protein import pathway. Importin alpha  shuttles between nucleus and cytoplasm, binds nuclear localization signal-bearing proteins, and functions as an adapter to access the importin beta -dependent import pathway. In contrast to what is found for importin beta , several isoforms of importin alpha , which can be grouped into three subfamilies, exist in higher eucaryotes. We describe here a novel member of the human family, importin alpha 7. To analyze specific functions of the distinct importin alpha  proteins, we recombinantly expressed and purified five human importin alpha 's along with importin alpha  from Xenopus and Saccharomyces cerevisiae. Binding affinity studies showed that all importin alpha  proteins from humans or Xenopus bind their import receptor (importin beta ) and their export receptor (CAS) with only marginal differences. Using an in vitro import assay based on permeabilized HeLa cells, we compared the import substrate specificities of the various importin alpha  proteins. When the substrates were tested singly, only the import of RCC1 showed a strong preference for one family member, importin alpha 3, whereas most of the other substrates were imported by all importin alpha  proteins with similar efficiencies. However, strikingly different substrate preferences of the various importin alpha  proteins were revealed when two substrates were offered simultaneously.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Heavy trafficking between the nucleus and the cytoplasm takes place in eucaryote cells. Various substrates, such as different forms of RNA and many nuclear proteins, must be exported into the cytoplasm. Other proteins, such as transcription factors and ribonucleoprotein particles, must be imported into the nucleus. Nuclear transport occurs through the nuclear pore complexes (NPCs), which are about 125 MDa in size (34). Whereas smaller molecules up to 20 to 60 kDa may passively diffuse through the NPCs into the nucleus, the import of larger substrates is generally receptor mediated (12). This import process depends on the presence of specific signal sequences within the substrate. Different types of import signals exist. One such signal consists of the so-called nuclear localization signals (NLSs), which are mainly characterized by clusters of basic amino acids, predominately lysines. Depending on the numbers of their charged clusters, the NLSs may be classified into monopartite and bipartite NLSs (8, 9).

Several soluble factors of the classical nuclear protein import pathway have been identified so far, including the small GTPase Ran/TC4 (26, 30), importin alpha  (16, 20, 45), importin beta  (1, 4, 14, 19, 39), and NTF2 (31, 36), which is involved in the import and export of Ran (41). Importin alpha  functions as an adapter molecule by binding importin beta  via its amino-terminally located importin beta  binding (IBB) domain (13, 46) and by binding NLS-bearing proteins via its two NLS binding sites in the central area (5, 18). Importin beta  is the transport receptor that carries the importin alpha -NLS complex from the cytoplasm into the nuclear side of the NPC (17). Once inside the nucleus, importin beta  binds to RanGTP, which is generated within the nucleus by the chromatin-bound RanGDP/GTP exchange factor RCC1. This binding of importin beta  to RanGTP leads to the dissociation of the import complex (15). Whereas importin beta  is thought to return to the cytoplasm rapidly without other soluble factors, the export of importin alpha  is mediated by its nuclear export factor CAS, which binds to importin alpha  preferentially in the presence of RanGTP (24). In the cytoplasm, the importins are set free for another round of import by the concerted action of RanGAP1 and RanBP1.

Only one gene coding for importin beta  has been identified in the organisms analyzed thus far. In contrast to what was found for importin beta , several isoforms of importin alpha  in humans have been described. These include importin alpha 1/Rch1 (7, 45), importin alpha 5/hSRP1 (6), importin alpha 3/Qip1 (23, 42), importin alpha 4/hSRP1gamma (23, 32), importin alpha 6 (23), and, here, the newly reported importin alpha 7. Importin alpha 7 is the human homologue of the recently identified mouse importin alpha -S2 (44). Based on the sequence similarity, the importin alpha  proteins can be grouped into three subfamilies. Members of different subfamilies have about 50% sequence identity. Within one subfamily, the identity is at least 80%. Whereas several of these isoforms are also found in invertebrates, the yeast Saccharomyces cerevisiae has only one gene for importin alpha , SRP1. Why so many importin alpha  isoforms exist in higher eucaryotes has not yet been definitely answered. Although there is some tissue specificity in the expression of these proteins (23, 32, 38, 44), most isoforms are expressed within the same tissues. Initial data indicate that there may be distinct substrate specificities of different importin alpha  family members (11, 28, 33, 43). However, other data show that different importin alpha  proteins can interact with the same substrate (37, 38). We compared all of the ubiquitously expressed human importin alpha  proteins, Xenopus importin alpha 2, and yeast SRP1p in their efficiencies to promote the nuclear import of different substrates. When testing only one substrate per assay, we found that most substrates (NLS-bovine serum albumin [BSA], nucleoplasmin, P/CAF, and hnRNP K) were imported by all importin alpha  proteins with only marginal differences. The exception was the nuclear import of RCC1, which was efficient only with importin alpha 3, not with other isoforms. If two substrates are offered at the same time, the various importin alpha  proteins show striking differences in their substrate-specific import efficiencies.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Isolation of importin alpha 7 cDNA. For isolation of importin alpha 7, 5' rapid amplification of cDNA ends (RACE) and 3' RACE were performed with a HeLa Marathon Ready cDNA kit (Clontech) by using the primers AAT(C)TGTTCT(A)GCC(A)C(T)TACCC(T)TGT(C)CT, CTCTTCCGCTGGCTGGTGGTG, and TATAACAAGCCTTTATTGAGCCCT, which correspond to human cDNA clones (GenBank accession no. T08580 and U68730). Several positive clones, which harbored the proposed start codon or the proposed stop codon, were isolated and sequenced. Full-length cDNA of importin alpha 7 was obtained by using the cDNAs of the N and C termini and primers AACCCCGGCATGCAGACCATGGCGAGCCCAGGGAAAGAC and CAATTTGGATCCTAGCTGGAAGCCCTCCATGGGGGCC. Full-length cDNA of importin alpha 5/hSRP1 was obtained via PCR with the same HeLa cDNA kit and primers TTGCGCCCATGGCCACCCCAGGAAAAGAGAAC and GAAGCCGGATCCAAGCTGGAAACCTTCCATAGGA. The cloning of the other importin alpha  cDNAs has been described earlier (14, 23).

Northern blotting. Human multiple-tissue Northern blots (Clontech) were hybridized according to the manufacturer's instructions with an [alpha -32P]dATP-labeled 0.5-kbp cDNA fragment from importin alpha 7 and with a 2.0-kbp fragment of beta -actin.

Generation of antibodies and immunoblotting. The generation of antibodies against peptide sequences of importin alpha 1/Rch1, importin alpha 5/hSRP1, importin alpha 3, and importin alpha 4 was described previously (23). Two antibodies against the newly identified human importin alpha 7 were raised against peptide sequences MASPGKDNYR, representing amino acids 3 to 12 of human importin alpha 7, and PEAPMEGFQUL, representing amino acids 526 to 536. Since very similar peptides are also present in importin alpha 6, the antibodies against importin alpha 7 recognize recombinant importin alpha 6 as well. Cross-reaction of the antibodies with other importin alpha  forms was excluded by immunoblotting with the recombinantly expressed proteins. For the analysis of the tissue-specific expression of the importin alpha  forms by immunoblotting, human protein lysates (Clontech; 25 µg per lane) were separated sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-10% PAGE) and blotted. Detection was achieved by chemiluminescence (Du Pont).

CAS binding assay. Ran-[gamma -32P]GTP (50 pM) was preincubated in a mixture of 20 mM HEPES-NaOH (pH 7.2), 50 mM sodium acetate, 1 mM MgCl2, 0.5% hydrolyzed gelatin, 0.4% sodium azide, and either 1 µM CAS or mixtures of 1 µM CAS and the different importin alpha  homologous proteins. After 30 min at 15°C, 40 nM Rna1p was added and the reaction was allowed to proceed for 30 s. The hydrolysis of Ran-bound GTP was determined as released [32P]phosphate. The final reaction volume was 25 µl, and the concentrations of importin alpha  proteins are as indicated in the legends for Fig. 4 and 5.

Importin beta  binding assay. Equilibrium dissociation constants (KDs) of the interaction between the importin alpha 's and importin beta  were determined by surface plasmon resonance (SPR) measurements with a Biacore 2000 instrument. The different importin alpha  isoforms were diluted to a final concentration of about 100 ng/µl and immobilized on the surface of a Pioneer F1 sensor chip (Biacore AB) by the amine-coupling method described in the Biacore manual (22). The immobilization level was 250 to 800 RU for importin alpha 's and for BSA, which served as a control. Unreacted normal human serum was blocked for 8 min with 1 M ethanolamin. To determine kinetic constants, sensorgrams were collected at 22°C, an 8-µl/min flow rate, and a 2.5-Hz data collection rate. Importin beta  (220 µl) dissolved in HBS-EP buffer (10 mM HEPES [pH 7.4], 100 mM NaCl, 1 mM EDTA, 0.05% P20; Biacore AB) was injected at different concentrations (6.25 to 200 nM) by using the KINJECT command specifying 27.5 min of association time and 6 min of dissociation time. Subsequently, 8 µl of regeneration solution (2 M NaCl in HBS-EP buffer) was injected. Sets of sensorgrams with analyte concentrations of 6.25 to 200 nM and without protein for background correction were collected. For evaluation we used BIAevaluation 3.0 software (Biacore AB). The data were fitted with the steady-state affinity model. As a reference, we subtracted the BSA and buffer control.

Recombinant expression and purification of the importin alpha  proteins. Full-length cDNAs were digested with NcoI/BamHI (importin alpha 5/hSRP1, importin alpha 3), NcoI/BglII (importin alpha 4), and SphI/BamHI (importin alpha 7). The particular restriction sites had been introduced by PCR primers. After ligation into expression vectors (for importin alpha 5/hSRP1, importin alpha 3, and importin alpha 4, pQE60; for importin alpha 7, pQE70; Qiagen), the resulting constructs encoding C-terminally His-tagged proteins were verified by DNA sequencing. Expression was performed in a culture of Escherichia coli XL1/pSB161 at 25°C for 4 h. Phenylmethylsulfonyl fluoride (2 mM) was added immediately before the culture was chilled on ice. After centrifugation, the bacterial pellet was resuspended in sonification buffer (50 mM Tris-HCl [pH 7.5], 200 mM NaCl, 5 mM magnesium acetate, 5% glycerol), and bacteria were lysed by sonification. The lysate was cleared by ultracentrifugation in a 50.2 Ti rotor at 50,000 rpm for 2 h. After 20 mM imidazole was added, the supernatant was loaded onto nickel agarose. Elution of the column was performed with an imidazole gradient, and peak fractions were pooled. For importin alpha 5/hSRP1, pooled fractions were dialyzed against sonification buffer and stored at -80°C after 250 mM sucrose had been added. The other importin alpha  protein peak fractions were loaded onto a Mono Q column and eluted in 50 mM Tris-HCl (pH 7.5)-5% glycerol by using a NaCl gradient. Peak fractions were pooled again and stored at -80°C after 250 mM sucrose had been added. The concentrations of the proteins were determined via photometry at 280 nm with the molar extinction coefficient described by Edelhoch (10). Preparation of the following proteins was described earlier: C-terminally His-tagged Xenopus importin alpha 2, nucleoplasmin, nucleoplasmin core, human Ran, Schizosaccharomyces pombe Rna1p, murine RnaBP1, and NTF2 (25); NLS-BSA, Rch1, and yeast SRP1p (14); and importin beta  (17). RCC1 was expressed and purified exactly as described here for the newly identified importin alpha  proteins. Fluorescence labeling of purified import substrates was performed with fluorescein 5'-maleimide, FLUOS, or Texas red, as described earlier (24).

In vitro nuclear protein import assay. Import assays were performed as described previously (21) based on the method described by Adam et al. (2). Briefly, HeLa cells were grown on 12-mm coverslips to 40 to 80% confluence, washed once in ice-cold phosphate-buffered saline (PBS), and permeabilized for 8 min in ice-cold 20 mM HEPES-KOH (pH 7.5)-110 mM potassium acetate-5 mM magnesium acetate-0.5 mM EGTA-250 mM sucrose-40 µg of digitonin (Sigma) per ml. Coverslips were incubated with 20 µl of import mixture for 8 min at room temperature, and reactions were stopped by fixation with 4% paraformaldehyde in PBS. After being washed in PBS and water, the coverslips were mounted with Vectorshield mounting medium (Vector) and analyzed by confocal microscopy (Leika; TCS NT). The import reaction mixtures consisted of an energy-regenerating system (0.5 mM ATP, 0.5 mM GTP, 10 mM creatine phosphate, 50 µg of creatine kinase per ml), core buffer (2 µg of nucleoplasmin core per ml, 20 mM HEPES-KOH [pH 7.5], 140 mM potassium acetate, 6 mM magnesium acetate, 250 mM sucrose), 0.5 mM EGTA, 3 µM RanGDP, 0.2 µM Rna1p, 0.3 µM RanBP1, 0.4 µM NTF2, 1 µM importin beta , a 2 µM concentration of an importin alpha  protein, and 10% reticulocyte lysate.

Nucleotide sequence accession number. The nucleotide sequence associated with importin alpha 7 has been assigned GenBank accession no. AF060543.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cloning and analysis of the distribution of human importin alpha 7 in tissue. Whereas in different mammals only one importin beta  protein has been identified so far, both humans and mice harbor at least five different importin alpha  proteins. The human homologues for most of the mouse proteins have been definitely determined. However, whether or not importin alpha -S2 (44) represents the mouse homologue of human importin alpha 6 or the homologue of a yet-unknown human importin alpha  protein was not clear. Since we wanted to investigate the functions of all human importin alpha  proteins, we screened the GenBank database and identified a partial sequence of an unknown human cDNA which displayed a high degree of homology with both human importin alpha 6 and mouse importin alpha -S2. We isolated the corresponding coding cDNA by PCR and found it to be 1,611 bp in length. The encoded protein (importin alpha 7) has about 85% identity to human importin alpha 6 and more than 99% identity to mouse importin alpha -S2 (Fig. 1A). Therefore, importin alpha 7 belongs to the SRP1-like subfamily of vertebrate importin alpha  proteins (Fig. 1B).


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Amino acid sequence of human importin alpha 7. Residues in human importin alpha 6 and mouse importin alpha -S2 that differ from those in human importin alpha 7 are indicated above or below the importin alpha 7 sequence, respectively. Epitopes used for antibody generation are underlined. (B) Alignment tree of all known importin alpha  homologues. Tree construction was performed with the CLUSTAL program. All putative complete proteins of the GenBank and Swiss-Prot databases containing arm repeats and an IBB domain were included in the analysis. The accession numbers of the proteins are (Imp, importin): Imp alpha  homologue (hom.), rice, AB006788; Imp alpha  homologue A, C. eleg., gi1707027; Srp1p, yeast, Q02821; Srp1 A, S. pombe, O14063; Srp1 B, S. pombe, AL034433; Srp1 C, A. thal., O04294; Srp1 D, A. thal., AC003114; Srp1, tomato, O22478; Srp1, rice, AB004660; Srp1 A, A. thal., AF077528; Srp1 B, A. thal., Y14615; Srp1, D. mela., AF074957; Imp alpha 6, human, O15131; Imp alpha 7, mouse, O35345; Imp alpha 7, human, AF060543; Srp1/Imp alpha 5, mouse, U34228; Srp1/Imp alpha 5, human, P52294; Imp alpha 3, C. eleg., AF040995; Imp alpha 3, D. mela., AF074958; Imp alpha 3, human, O00629; Imp alpha 3, mouse, O35343; Imp alpha 4, human, O00505; Imp alpha 4, mouse, O35344; OHO31/Imp alpha 1, D. mela., A57319; pendulin/Imp alpha 1, mouse, P52293; Rch1/Imp alpha 1, human, P52292; Imp alpha 2a, X. laev., P52170; Imp alpha 2b, X. laev., P52171; Imp alpha  homologue B, C. eleg., AF040997. C. eleg., Caenorhabditis elegans; A. thal., Arabidopsis thaliana; D. mela., Drosophila melanogaster; X. laev., Xenopus laevis; yeast, S. cerevisiae.

To determine the distribution of importin alpha 7 in tissue, we first performed RNA analysis by Northern blotting. Transcripts of 8 kbp were detectable in human poly(A)+ RNA from almost all tissues tested (Fig. 2). However, the levels of expression differed considerably. No transcript for importin alpha 7 was detectable in thymus, and the expression levels in lung, liver, small intestine, and colon were significantly lower than those of the other tissues tested, even though control hybridization with beta -actin demonstrated that comparable amounts of RNA were loaded (1.7 and 2.0 kbp). The signal at 2.4 kbp in testis is probably due to a cross-reaction with human importin alpha 6, which we previously reported to be expressed only in testis (23). Thus, in contrast to its most highly related isoform, importin alpha 6, importin alpha 7 is expressed in a variety of tissues.


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2.   Expression of importin alpha 7 mRNA in human tissues. Human multiple-tissue Northern blots were hybridized with probes specific for importin alpha 7 and beta -actin. A suggested cross-reactive band of importin alpha 6 was detected in testis at 2.4 kb. sk. muscle, skeletal muscle; sm. intest., small intestine; bl. leuk., peripheral blood leukocytes.

Protein expression pattern of soluble factors involved in importin-dependent protein transport. Thus far, several groups have investigated the distribution of different importin alpha  isoforms in tissue (23, 32, 38, 44). In contrast, little is known about the distribution of the shuttling transport factors, importin beta , CAS, and Ran in tissue. Therefore, we compared the expression levels of all known human shuttling transport factors of the classical import pathway by immunoblot analysis of protein lysates obtained from various tissues. Only NTF2, which was recently shown to transport Ran into the nucleus (41), was not included in our study. First, we generated antibodies against importin alpha 7, CAS, and Ran. Antibodies that specifically recognize the other factors (importin alpha 1/Rch1, importin alpha 5/hSRP1, importin alpha 3, importin alpha 4, and importin beta ) had been obtained previously (17, 23). Antibodies for importin alpha 7 were raised against two different peptides which correspond to the amino terminus and the carboxy terminus of the protein. Due to the high sequence similarity of the proteins, these antibodies were found to recognize recombinant importin alpha 6 as well but do not cross-react with other importin alpha  proteins (data not shown).

By analyzing lysates of different human tissues by immunoblotting, we detected all transport factors in the investigated tissues (Fig. 3). In agreement with the mRNA analysis, importin alpha 7 protein was found in all tissues tested. In terms of total protein concentration, the expression levels of importin alpha , importin beta , CAS, and Ran vary between the different tissues and were low in spleen and liver. However, these variations were not always uniform. For example, in ovary and lung, where importin alpha  proteins are quite abundant, the expression levels of the other factors are not elevated. Testis and brain contain the highest relative amounts of CAS, but not of importin alpha  proteins. In the heart, the Ran levels were lowest, while the other factors were present in average amounts. A reason for the lack of correlation could be that these factors are also involved in functions other than the importin alpha -dependent protein transport process. This is well established for Ran (29) and importin beta  (21), but not for CAS. In several tissues, the relative expression levels of particular importin alpha  proteins differed from those of other importin alpha  forms, as has been reported earlier (23). Notably, the antibodies against importin alpha 7 and importin alpha 4 detect several proteins in the range of 60 kDa which are not present in all tissues. In both cases, these bands are recognized by two independent antibodies raised against the extreme N terminus and C terminus, respectively (data not shown), which probably reflects the existence of modified or alternatively spliced versions of these proteins.


View larger version (64K):
[in this window]
[in a new window]
 
FIG. 3.   Expression of the shuttling transport factors of the classical nuclear import pathway in human tissues at the protein level. Twenty-five micrograms of total protein lysates was loaded per lane, separated by SDS-PAGE, and probed by immunoblotting with the antibodies against importin alpha 1/Rch1, importin alpha 3, importin alpha 4, importin alpha 5/hSRP1, importin alpha 7, importin beta , CAS, and Ran. imp, importin; sm. intest., small intestine.

Binding affinities between importin alpha  proteins and their carriers importin beta  and CAS. To investigate the properties of the various importin alpha 's during protein import, we recombinantly expressed and purified the five ubiquitously expressed human isoforms, as well as Xenopus importin alpha 2 and the only yeast importin alpha  homologue, SRP1p (Fig. 4A). We first wanted to investigate if there were differences in binding to the nuclear import factor importin beta  or in binding to CAS, the nuclear export factor of importin alpha .



View larger version (104K):
[in this window]
[in a new window]
 
FIG. 4.   (A) Purified recombinant importin alpha  proteins migrate between 50 and 60 kDa. Solutions (7.5 µl, 2 µM) of each recombinantly expressed and purified importin alpha  protein were separated by SDS-PAGE and stained with Coomassie blue. imp, importin; Xen, Xenopus; ySRP1, yeast SRP1p. (B) Determination of the binding affinities of importin alpha 1/Rch1 (RCH1), importin alpha 5/hSRP1 (hSRP1), and importin alpha 3 to CAS. (C) Determination of the binding affinities of importin alpha 4, importin alpha 7, Xenopus importin alpha 2 (importin alpha  Xen), and yeast SRP1p (ySrp1p) to human CAS. Ran-[gamma -32P]GTP (50 pM) was preincubated either with 1 µM CAS or with mixtures of 1 µM CAS and the different importin alpha  homologous proteins. After 30 min at 15°C, 40 nM Rna1p (the S. pombe homologue of RanGAP1) was added and the reaction was allowed to proceed for 30 s. Hydrolysis of Ran-bound GTP was determined as released [32P]phosphate.

To quantitate the binding affinities of the different importin alpha  proteins to CAS, we employed the fact that the binding affinity of CAS for RanGTP is greatly enhanced in the presence of importin alpha  proteins. Furthermore, the binding results in protection against activation of Ran/TC4 GTPase by RanGAP1 (24). We preincubated 50 pM Ran-[gamma -32P]GTP either with 1 µM human CAS or with mixtures of 1 µM human CAS and the different importin alpha  homologous proteins. After 30 min at 15°C, we added 40 nM Rna1p for 30 s and determined the hydrolysis of Ran-bound GTP as released [32P]phosphate. As can be seen in Fig. 4B, we found that importin alpha 5/hSRP1, importin alpha 1/Rch1, and importin alpha 3 bind CAS with high affinity within the same range (KD < 2 nM) (Fig. 4B). The binding affinity of Xenopus importin alpha 2 was only marginally weaker (KD > 3 nM) (Fig. 4C). However, in comparison to the human isoforms importin alpha 7 and importin alpha 4 (KD > 5 nM), the binding affinity of Xenopus importin alpha 2 to CAS was even higher. Only yeast SRP1p showed a binding affinity to CAS characterized by much less efficiency (KD > 20 nM).

The binding of the different importin alpha  proteins to importin beta  was analyzed with the Biacore 2000 instrument. We immobilized the recombinant importin alpha  proteins and BSA (as a control) on sensor chips and injected various concentrations of recombinant importin beta  (6.25 to 200 nM). We measured the SPR response and calculated the equilibrium KD from the results. Thus, we found that all importin alpha  proteins tested were able to bind importin beta  very efficiently (Table 1). The differences between the human importin alpha  proteins for binding importin beta  that we detected were only marginal. The highest binding affinities to importin beta  were found for importins alpha 4 and alpha 7 (5 nM). The lowest binding affinity was detected for importin alpha 3 (18 nM). Interestingly, Xenopus importin alpha 2 and yeast SRP1 showed no marked differences in their binding affinities to importin beta  in comparison to the human isoforms (3 and 5 nM, respectively). In contrast, BSA was not able to bind importin beta  significantly, demonstrating that the binding of the alpha  importins to importin beta  is specific.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Binding affinities of importin alpha  proteins to importin beta a

Comparison of the import efficiencies of different importin alpha  proteins in vitro by using standard substrates. To analyze the specific functions of the different importin alpha  proteins, we wanted to compare their import efficiencies in parallel by a defined in vitro nuclear import assay. First, we established that all recombinant proteins were able to import the standard substrates simian virus 40 large-T antigen-NLS-BSA and Xenopus nucleoplasmin. Import assays were generally performed in the presence of reticulocyte lysate, which improved the efficiency of protein import. In the absence of importin alpha , the reticulocyte lysate had no effect on the nuclear import of any substrate tested. Presently, we cannot decide whether this improvement of import efficiency by reticulocyte lysate is due to unspecific protein-protein interactions or caused by as-yet-unknown specific import factors. Fractionation of reticulocyte lysate showed that several fractions display this effect, but no fraction was as stimulating as the total lysate. Hemoglobin, the most abundant protein of reticulocyte lysate, did not enhance the import efficiency.

A typical result for the different importin alpha  proteins is shown in Fig. 5. We found that all recombinant importin alpha  proteins, including the hitherto-uninvestigated importin alpha 7, were able to import both substrates. However, there were clear differences in the import efficiencies of the different importin alpha  proteins. For NLS-BSA, the best import efficiencies were found with importin alpha 5/hSRP1, importin alpha 3, alpha 7, and Xenopus importin alpha 2. The effect of importin alpha 4 was mildly weaker, but still stronger than that of importin alpha 1/Rch1. The weakest import efficiency on NLS-BSA was displayed by yeast SRP1p, although the nuclear accumulation of the labeled substrate was still evident in comparison to that of the negative control, which was performed without adding any importin alpha  protein. The pattern for nuclear import of nucleoplasmin was similar to the one for NLS-BSA. Importin alpha 5/hSRP1 showed the strongest effect on nuclear import of nucleoplasmin, followed by importin alpha 3, alpha 4, and Xenopus importin alpha 2. The import efficiencies of importin alpha 1/Rch1 and importin alpha 7 were mildly weaker, and that of yeast SRP1p was again the weakest. The negative control showed a typical pattern, with a few cells displaying a weak nuclear staining which is most likely due to leaky nuclear envelopes. However, most of the nuclei are clearly negative, in contrast to the results of all import assays with one of the importin alpha  proteins added to the import reaction mixture.


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5.   All importin alpha  proteins can import standard substrates with monopartite (NLS-BSA) and bipartite NLS (nucleoplasmin) in vitro. HeLa cells were grown on coverslips and permeabilized for 8 min with digitonin. Coverslips were incubated with 20 µl of import mixture for 8 min. Reactions were stopped by fixation with 4% paraformaldehyde. The coverslips were mounted and analyzed by confocal microscopy. The import reaction mixtures consisted of an energy-regenerating system, nucleoplasmin core buffer, 3 µM RanGDP, 0.2 µM Rna1p, 0.3 µM RanBP1, 0.4 µM NTF2, 1 µM importin beta , a 2 µM concentration of the indicated importin alpha  protein, and 10% reticulocyte lysate. (A) Importin alpha -dependent nuclear import of Texas red-labeled nucleoplasmin. alpha 3, importin alpha 3; alpha 4, importin alpha 4; alpha 7, importin alpha 7; Xen alpha 2, Xenopus importin alpha 2; ySRP1, yeast SRP1p; no alpha , no importin alpha  added to the import reaction mixture. (B) Importin alpha -dependent nuclear import of fluorescein-labeled simian virus 40 large-T antigen coupled to NLS-BSA.

Importin alpha -dependent nuclear import of hnRNP K, P/CAF, and RCC1. We next analyzed the abilities of the various importin alpha  proteins to mediate the import of three functionally completely different human proteins, namely, the shuttling RNA-binding protein hnRNP K containing a nuclear shuttling domain which confers bidirectional transport across the nuclear envelope and also a classical NLS (27), the stimulator of the Rous sarcoma virus promoter P/CAF (40), and Ran's major GDP/GTP exchange factor, the chromatin-bound protein RCC1, which is exclusively located inside the nucleus (3, 35). First, we added the fluorescein-labeled proteins as single substrates into the import assay reaction mixtures (Fig. 6A, 7A, and 8A). We found that both hnRNP K and P/CAF were imported by most of the importin alpha  proteins very efficiently (Fig. 6A and 7A). Similar to the results of assays testing the import of the standard substrates NLS-BSA and nucleoplasmin, the efficiencies of the import reactions differed slightly depending on the importin alpha  protein used. Importin alpha 1/Rch1, Xenopus importin alpha 2, importin alpha 3, and importin alpha 5/hSRP1 showed the best stimulation of the nuclear import of hnRNP K, whereas importins alpha 4, alpha 7, and yeast SRP1p displayed a somewhat weaker effect. For P/CAF, these differences were even less pronounced. Here, the pattern after import with importin alpha 1/Rch1 was somewhat more heterogeneous and the effects of importin alpha 4 and yeast SRP1p were weaker than those of the other importin alpha  isoforms. In contrast to what was found for hnRNP K and P/CAF, when RCC1 was added as the only substrate to the import reaction mixture, we found striking differences in its nuclear import depending on the importin alpha  protein used in the import assay (Fig. 8A). While importin alpha 3 proved to behave as a very good import factor for RCC1, the effect of importin alpha 4 was moderate, and the other importin alpha  proteins had hardly any effect at all.


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 6.   Importin alpha -dependent nuclear import of hnRNP K. In vitro nuclear import of fluorescein-labeled hnRNP K was performed as described above (see Materials and Methods and legend for Fig. 5) either in the absence (A) or in the presence (B, right panels) of Texas red-labeled nucleoplasmin by using the importin alpha  proteins indicated. (B) Left panels, hnRNP K staining; right panels, nucleoplasmin (NPL) staining. alpha 3, importin alpha 3, alpha 4, importin alpha 4; alpha 7, importin alpha 7; Xen alpha 2, Xenopus importin alpha 2; ySRP1, yeast SRP1p; no alpha , no importin alpha  added to the import reaction mixture.


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 7.   Importin alpha -dependent nuclear import of P/CAF. In vitro nuclear import of fluorescein-labeled P/CAF was performed as described above (see Materials and Methods and legend for Fig. 5) either in the absence (A) or in the presence (B, right panels) of Texas Red-labeled nucleoplasmin (NPL) by using the importin alpha  proteins indicated. (B) Left panels, P/CAF staining; right panels, nucleoplasmin staining. alpha 3, importin alpha 3; alpha 4, importin alpha 4; alpha 7, importin alpha 7; Xen alpha 2, Xenopus importin alpha 2; ySRP1, yeastSRP1p; no alpha , no importin alpha  added to the import reaction mixture.


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 8.   Importin alpha -dependent nuclear import of RCC1. In vitro nuclear import of fluorescein-labeled RCC1 was performed as described above (see Materials and Methods and legend for Fig. 5) either in the absence (A) or in the presence (B, right panels) of Texas red-labeled nucleoplasmin (NPL) by using the importin alpha  proteins indicated. (B) Left panels, hnRNP K staining; right panels, nucleoplasmin staining. alpha 3, importin alpha 3; alpha 4, importin alpha 4; alpha 7, importin alpha 7; Xen alpha 2, Xenopus importin alpha 2; ySRP1, yeast SRP1p; no alpha , no importin alpha  added to the import reaction mixture.

In living cells many substrates are present in the cytoplasm and may compete for transport into the nucleus by a particular importin alpha  protein. Therefore, we wondered whether or not good import substrates might be efficient competitors in our import assays. Thus, we repeated the import reactions with fluorescein-labeled hnRNP K, P/CAF, and RCC1, adding in every case Texas red-labeled nucleoplasmin as well, which has been shown to be imported by all importin alpha  proteins (Fig. 5). If hnRNP K was combined with nucleoplasmin, importins alpha 4 and alpha 7 had a weaker effect on the nuclear import of hnRNP K than importin alpha 5/hSRP1, importin alpha 3, and importin alpha 1/Rch1 (Fig. 6B). These findings were similar to what we found with hnRNP K alone (Fig. 6A). However, in contrast to the single-substrate assay, in this two-substrate assay, yeast SRP1p was as efficient as importin alpha 5/hSRP1 and importin alpha 1/Rch1 in transporting hnRNP K into the cell nucleus. Surprisingly, Xenopus importin alpha 2 now had no effect at all on the nuclear import of hnRNP K. This finding clearly demonstrates that the relative effect on nuclear import of hnRNP K by a particular importin alpha  isoform can be decreased if another competing substrate is present. These changes were found to be even more dramatic if fluorescein-labeled P/CAF was added to the import assay mixtures together with Texas red-labeled nucleoplasmin (Fig. 7B). Only importin alpha 3 was able to import P/CAF very efficiently in the presence of nucleoplasmin. In contrast, the effect of all other importin alpha  proteins on the nuclear transport of P/CAF was greatly diminished (importin alpha 5/hSRP1, importin alpha 4, importin alpha 7, yeast SRP1p) or even abolished (importin alpha 1/Rch1 and Xenopus importin alpha 2) if nucleoplasmin was added to the assay mixture. A comparison of the various patterns found for nuclear import of nucleoplasmin (Fig. 5, 6B, 7B, and 8B) indicates that good import substrates can strongly compete for each other depending on the particular importin alpha  protein present in the assay system. Whereas, in the presence of hnRNP K, Xenopus importin alpha 2 is the most efficient transport factor for nucleoplasmin, importin alpha 5/hSRP1 becomes the best import-stimulating isoform for nucleoplasmin if RCC1 is added to the import reaction mixture, and the effect of Xenopus importin alpha 2 on nucleoplasmin import is much weaker (compare Fig. 6B with Fig. 8B). It should be noted that different settings of the confocal microscope were used for single- and double-labeling experiments, i.e., one cannot directly compare the intensities between these different types of experiments. This can be seen if, e.g., one compares the negative controls in Fig. 6A and B. Within one experimental series, the settings had of course been identical for all combinations of a given substrate with the indicated import factors.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The classical nuclear protein import pathway is mediated by the alpha  and beta  subunits of importin. Importin alpha  functions as an adapter molecule by binding both importin beta  and the NLS-bearing import substrate. While only one importin beta  isoform has been found in humans thus far, six human genes for importin alpha  exist, including that for importin alpha 7, newly described here. Some of these importin alpha  isoforms may even occur in different versions. We found partial cDNAs in the database corresponding to importin alpha 6 and importin alpha 7, which may represent alternatively spliced mRNAs. Those cDNAs would code for proteins with amino termini three amino acids shorter or longer than those published, respectively. As reported previously (23, 32, 38, 44) and now confirmed in more detail here, the relative expression levels of a particular importin alpha  form may vary between different tissues, indicating a special demand of different cell types for specific importin alpha 's. Nevertheless, all human importin alpha  proteins can be found in various tissues with the exception of importin alpha 6, which has thus far been found only in testis. Even more striking, these proteins are expressed simultaneously in many cell lines, such as HeLa cells or human umbilical vein epithelial cells (reference 23 and data not shown).

The radiation of ancestral importin alpha  genes into different orthologues probably occurred several times during evolution (Fig. 1B). Most of the known importin alpha  forms, such as the six mammalian importin alpha 's, belong to one of three main subgroups, which differ from one another in about 50% of their amino acids. However, several other species such as C. elegans and rice possess additional importin alpha -like proteins differing in more than 75% of their amino acids from those isoforms of the main subgroups. Most species examined so far possess at least one protein which belongs to the SRP1-like subgroup. Humans have three different SRP1-like proteins, namely, importin alpha 5, importin alpha 6, and the newly reported importin alpha 7. In contrast to the diversity found in other organisms, Schizosaccharomyces pombe has two genes coding for importin alpha  proteins and S. cerevisiae has only one importin alpha  gene, SRP1. This indicates that one importin alpha  isoform alone may be sufficient to fulfill the basic requirements of a eucaryotic cell.

Although the identity of the primary sequences of the importin alpha  isoforms including the IBB domain varies between 50 and 85%, the proteins do not differ dramatically in their interactions with their transport receptors CAS and importin beta . The human importin alpha  proteins bind CAS with a KD between 2 and 5 nM. These differences are small and could be caused by variations in the quality of the protein purification process. Whereas the binding affinity of Xenopus importin alpha 2 turned out to be in the same range as that of the human importin alpha  forms, yeast SRP1p showed a clearly less efficient binding affinity to CAS (KD > 20 nM). Since yeast SRP1p is less homologous to the human importin alpha  proteins than Xenopus importin alpha 2 is, the weaker binding affinity of yeast SRP1p to human CAS was not surprising. No binding to Crm1/exportin was observed. These results fit with recently reported data from Herold et al., who found similar binding affinities of importin alpha 1/Rch1, importin alpha 5/hSRP1, and importin alpha 4 to CAS but not to Crm1 in two-hybrid studies (18). The KDs for the interactions between importin beta  and the various importin alpha  forms in the Biacore assay are also in a nanomolar range (between 3 and 18 nM). These differences are unlikely to have an influence on the in vitro assay, where the proteins are present in micromolar concentrations. Again, these small differences may be caused by variations in the quality of the protein purification process. In addition, the coupling of the proteins to the sensor chips may impair the importin alpha  forms to different extents.

The simultaneous existence of several highly divergent importin alpha  proteins in a given cell led to the question whether they might be specialized in their efficiency to transport different nuclear proteins. Several experiments clearly support this hypothesis. Sekimoto et al. recently reported that intracellular injection of antibodies against importin alpha 5/hSRP1, but not against importin alpha 1/Rch1, can inhibit nuclear import of the transcription factor Stat1 (43). Fisher et al. reported that the Epstein-Barr virus protein EBNA1 interacts with importin alpha 1/Rch1 but not with importin alpha 5/hSRP1 in the yeast two-hybrid system (11). By pull-down assays with different NLS-BSA conjugates, Nadler et al. showed that importin alpha 1/Rch1 and importin alpha 5/hSRP1 share distinct binding affinities for various NLSs (33). Finally, Miyamoto et al. demonstrated that the efficiency of nuclear import of different NLS-reporter protein conjugates in vitro may depend on the importin alpha  protein present in the assay (28). Thus, earlier studies indicated that there might exist substrate specificities for the different importin alpha  proteins. Therefore, we compared the import activities of all known ubiquitously expressed human importin alpha  proteins on different artificial and natural substrates by using a defined in vitro import system. For comparison we also included frog importin alpha 2, a paralogue of human importin alpha 1/Rch1, and yeast SRP1p in our study. Most substrates were imported with about the same efficiency by all importin alpha  isoforms, if they are added as single substrates to the assay. Nevertheless, significant differences between the different isoforms were detectable, and the nuclear import of RCC1, a protein that is strictly localized within the nucleus, showed a very strong dependence on the presence of one particular importin alpha  isoform (importin alpha 3). The addition of two differently labeled substrates into one import reaction mixture clearly demonstrated that those differences are unlikely to be caused by variations in the quality of purification of the recombinant proteins. For example, the very strong effect of importin alpha 1/Rch1 on the nuclear import of hnRNP K demonstrates that its weak import efficiency on nucleoplasmin in the same assay reaction is not due to a functionally inactive protein. Only yeast SRP1p usually showed a weak import efficiency, probably because its evolutionary distance from the human proteins fostered an impaired interaction with the mammalian substrates in our import assays.

It is unlikely that differences in binding affinity between substrate and importin alpha  are the main reason for the observed effects in the import assay. Although experiments using SPR demonstrate that RCC1 binds significantly better to importin alpha 3 and alpha 4 (KDs ~9 nM) than to the other isoforms (KDs ~18 to 30 nM) while nucleoplasmin shows no significant differences in its binding to the various importin alpha  forms (KDs ~4 to 8 nM) (data not shown), these differences are too small to have an influence on the in vitro import assay where substrates and importin alpha 's are present in micromolar concentrations.

Some of our results disagree with data obtained by other groups. Nachury et al. (32) reported that importin alpha 4/hSRP1gamma had a weaker efficiency to import NLS-BSA in vitro than importin alpha 1/Rch1. We could not detect those differences. In contrast to Nachury et al. (32), who obtained importin alpha 4 from HeLa cells via vaccinia virus infection and importin alpha 1/Rch1 from E. coli, we purified all importin alpha  proteins from the same system (E. coli), which might explain those differences. Moreover, Miyamoto et al. (28) reported that a CBP80-allophycocyanin fusion protein becomes imported in their in vitro import system by importin alpha 1/Rch1 and by importin alpha 5/SRP1 but not by importin alpha 3/Qip1. In our hands, recombinant human cap binding protein is imported by all human importin alpha  proteins tested (data not shown). This finding demonstrates that artificial NLS fusion proteins and their corresponding full-length proteins may behave quite differently in the import assay system and that testing the functional activity of the purified import factors is very important for comparison of their efficiencies. Furthermore, the source of the recombinant proteins might influence the result to some extent.

If one adds two substrates simultaneously, the preference of a particular importin alpha  for a certain substrate can get more clear-cut. For example, if nucleoplasmin and P/CAF are added to one import reaction mixture at the same time, importin alpha 3 is still able to import P/CAF very efficiently. This result is in clear contrast to those for the other importin alpha  proteins, although all of them can still import nucleoplasmin. The situation for RCC1 is similar. This protein is transported efficiently as a single added substrate into the nucleus only by importin alpha 3 and to a less efficient extent by importin alpha 4, which is highly homologous to importin alpha 3. The addition of nucleoplasmin as a second substrate enhances these differences between the members of the importin alpha 3/alpha 4 subfamily and members of the other subfamilies. This observation indicates that one level of the import efficiency regulation in the cell may be the competition between import substrates for their "preferred" importin alpha  form. However, the results of our in vitro studies cannot predict to what extent this concurrence happens in living cells and whether or not different importin alpha  proteins can substitute for each other in vivo.


    ACKNOWLEDGMENTS

We thank E. Bürger, B. Nentwig, and A. Wittstruck for technical help and M. Wellner and D. Fiedler for sequencing. We also thank C. Maasch for assistance with the Biacore instrument, J. Francke for purifying nucleoplasmin, S. Thiel for assistance with immunoblottings, and K. Ribbeck for detailed introduction into the import assay system. The expression clone for hnRNP K was a kind gift from Dirk Ostarek. Finally, we are grateful to F. C. Luft for critical reading of the manuscript.

This work was supported by the Deutsche Forschungsgemeinschaft (DFG KO 1950/1-1).


    FOOTNOTES

* Corresponding author. Mailing address: Universität Göttingen, Zentrum Biochemie und Molekulare Zellbiologie, Abt. Biochemie II, Goßlerstr. 12d, 37073 Göttingen, Germany. Phone: 49 551 395989. Fax: 49 551 395958. E-mail: ennohart{at}mdc.berlin.de.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Adam, E. J., and S. A. Adam. 1994. Identification of cytosolic factors required for nuclear location sequence-mediated binding to the nuclear envelope. J. Cell Biol. 125:547-555[Abstract/Free Full Text].
2. Adam, S. A., R. Sterne-Marr, and L. Gerace. 1990. Nuclear protein import in permeabilized mammalian cells requires soluble cytoplasmic factors. J. Cell Biol. 111:807-816[Abstract/Free Full Text].
3. Bischoff, F. R., and H. Postingl. 1991. Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1. Nature 354:80-82[Medline].
4. Chi, N. C., E. J. H. Adam, and S. A. Adam. 1995. Sequence and characterization of cytoplasmic nuclear import factor p97. J. Cell Biol. 130:265-274[Abstract/Free Full Text].
5. Conti, E., M. Uy, L. Leighton, G. Blobel, and J. Kuriyan. 1998. Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha . Cell 94:193-204[Medline].
6. Cortes, P., Y. Zheng-Sheng, and D. Baltimore. 1994. RAG-1 interacts with the repeated amino acid motif of the human homologue of the yeast protein SRP1. Proc. Natl. Acad. Sci. USA 91:7633-7637[Abstract/Free Full Text].
7. Cuomo, C. A., S. A. Kirch, J. Gyuris, R. Brent, and M. A. Oettinger. 1994. Rch1, a protein that specifically interacts with the RAG-1 recombination-activating protein. Proc. Natl. Acad. Sci. USA 91:6156-6160[Abstract/Free Full Text].
8. Dingwall, C., and R. A. Laskey. 1991. Nuclear targeting sequences---a consensus? Trends Biochem. Sci. 16:478-481[Medline].
9. Dingwall, C., A. V. Sharnick, and R. A. Laskey. 1982. A polypeptide domain that specifies migration of nucleoplasmin into the nucleus. Cell 30:449-458[Medline].
10. Edelhoch, H. 1967. Spectroscopic determination of tryptophan and tyrosine in proteins. Biochemistry 6:1948-1954[Medline].
11. Fischer, N., E. Kremmer, G. Lautscham, N. Mueller-Lantzsch, and F. A. Grässer. 1997. Epstein-Barr virus nuclear antigen 1 forms a complex with the nuclear transporter karyopherin alpha 2. J. Biol. Chem. 272:3999-4005[Abstract/Free Full Text].
12. Görlich, D. 1998. Transport into and out of the cell nucleus. EMBO J. 17:2721-2727[Medline].
13. Görlich, D., P. Henklein, R. A. Laskey, and E. Hartmann. 1996. A 41 amino acid motif in importin alpha confers binding to importin beta and hence transit into the nucleus. EMBO J. 15:1810-1817[Medline].
14. Görlich, D., S. Kostka, R. Kraft, C. Dingwall, R. A. Laskey, E. Hartmann, and S. Prehn. 1995. Two different subunits of importin cooperate to recognize nuclear localization signals and bind them to the nuclear envelope. Curr. Biol. 5:383-392[Medline].
15. Görlich, D., N. Panté, U. Kutay, U. Aebi, and F. R. Bischoff. 1996. Identification of different roles for RanGDP and RanGTP in nuclear protein import. EMBO J. 15:5584-5594[Medline].
16. Görlich, D., S. Prehn, R. A. Laskey, and E. Hartmann. 1994. Isolation of a protein that is essential for the first step of nuclear protein import. Cell 79:767-778[Medline].
17. Görlich, D., F. Vogel, A. D. Mills, E. Hartmann, and R. A. Laskey. 1995. Distinct functions for the two importin subunits in nuclear protein import. Nature 377:246-248[Medline].
18. Herold, A., R. Truant, H. Wiegand, and B. R. Cullen. 1998. Determination of the functional domain organization of the importin alpha  nuclear import factor. J. Cell Biol. 143:309-318[Abstract/Free Full Text].
19. Imamoto, N., T. Shimamoto, S. Kose, T. Takao, T. Tachibana, M. Matsubae, T. Sekimoto, Y. Shimonishi, and Y. Yoneda. 1995. The nuclear pore targeting complex binds to nuclear pores after association with a karyophile. FEBS Lett. 368:415-419[Medline].
20. Imamoto, N., T. Shimamoto, T. Takao, T. Tachibana, S. Kose, M. Matsubae, T. Sekimoto, Y. Shimonishi, and Y. Yoneda. 1995. In vivo evidence for involvement of a 58 kDa component of nuclear pore targeting complex in nuclear protein import. EMBO J. 14:3617-3626[Medline].
21. Jäkel, S., and D. Görlich. 1998. Importin beta , transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J. 17:4491-4502[Medline].
22. Johnson, B., S. Lofas, and G. Lindquist. 1991. Immobilization of proteins to a carboxymethyldextran-modified gold surface for biospecific interaction analysis in surface plasmon resonance sensors. Anal. Biochem. 198:268-277[Medline].
23. Köhler, M., S. Ansieau, S. Prehn, A. Leutz, H. Haller, and E. Hartmann. 1997. Cloning of two novel importin-alpha subunits and analysis of the expression pattern of the importin-alpha protein family. FEBS Lett. 417:104-108[Medline].
24. Kutay, U., F. R. Bischoff, S. Kostka, R. Kraft, and D. Görlich. 1997. Export of importin alpha  from the nucleus is mediated by a specific nuclear transport factor. Cell 90:1061-1071[Medline].
25. Kutay, U., E. Izaurralde, F. R. Bischoff, I. W. Mattaj, and D. Görlich. 1997. Dominant-negative mutants of importin-beta block multiple pathways of import and export through the nuclear pore complex. EMBO J. 16:1153-1163[Medline].
26. Melchior, F., B. Paschal, E. Evans, and L. Gerace. 1993. Inhibition of nuclear protein import by nonhydrolyzable analogs of GTP and identification of the small GTPase Ran/TC4 as an essential transport factor. J. Cell Biol. 123:1649-1659[Abstract/Free Full Text].
27. Michael, W. M., P. S. Eder, and G. Dreyfuss. 1997. The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein. EMBO J. 16:3587-3598[Medline].
28. Miyamoto, Y., N. Imamoto, T. Sekimoto, T. Tachibana, T. Seki, S. Tada, T. Enomoto, and Y. Yoneda. 1997. Differential modes of nuclear localization signal (NLS) recognition by three distinct classes of NLS receptors. J. Biol. Chem. 272:26375-26381[Abstract/Free Full Text].
29. Moore, M. S. 1998. Ran and nuclear transport. J. Biol. Chem. 273:22857-22860[Free Full Text].
30. Moore, M. S., and G. Blobel. 1993. The GTP-binding protein Ran/TC4 is required for protein import into the nucleus. Nature 365:661-663[Medline].
31. Moore, M. S., and G. Blobel. 1994. Purification of a Ran-interacting protein that is required for protein import into the nucleus. Proc. Natl. Acad. Sci. USA 91:10212-10216[Abstract/Free Full Text].
32. Nachury, M. V., U. W. Ryder, A. I. Lamond, and K. Weis. 1998. Cloning and characterization of hSRP1gamma , a tissue-specific nuclear transport factor. Proc. Natl. Acad. Sci. USA 95:582-587[Abstract/Free Full Text].
33. Nadler, S. G., D. Tritschler, O. K. Haffar, J. Blake, A. G. Bruce, and J. S. Cleaveland. 1997. Differential expression and sequence-specific interaction of karyopherin alpha  with nuclear localization sequences. J. Biol. Chem. 272:4310-4315[Abstract/Free Full Text].
34. Ohno, M., M. Fornerod, and I. W. Mattaj. 1998. Nucleocytoplasmic transport: the last 200 nanometers. Cell 92:327-336[Medline].
35. Ohtsubo, M., H. Okazaki, and T. Nishimoto. 1989. The RCC1 protein, a regulator for the onset of chromosome condensation, locates in the nucleus and binds to DNA. J. Cell Biol. 109:1389-1397[Abstract/Free Full Text].
36. Paschal, B. M., and L. Gerace. 1995. Identification of NTF2, a cytosolic factor for nuclear import that interacts with nuclear pore protein p62. J. Cell Biol. 129:925-937[Abstract/Free Full Text].
37. Prieve, M. G., K. L. Guttridge, J. Munguia, and M. L. Waterman. 1998. Differential importin-alpha recognition and nuclear transport by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18:4819-4832[Abstract/Free Full Text].
38. Prieve, M. G., K. L. Guttridge, J. Munguia, and M. L. Waterman. 1996. The nuclear localization signal of lymphoid enhancer factor-1 is recognized by two differentially expressed Srp1-nuclear localization sequence receptor proteins. J. Biol. Chem. 271:7654-7658[Abstract/Free Full Text].
39. Radu, A., G. Blobel, and M. S. Moore. 1995. Identification of a protein complex that is required for nuclear protein import and mediates docking of the import substrate to distinct nucleoporins. Proc. Natl. Acad. Sci. USA 92:1769-1773[Abstract/Free Full Text].
40. Reid, J. L., J. A. Bannister, P. Zegerman, M. A. Martinez-Balbás, and T. Kouzarides. 1998. E1A directly binds and regulates the P/CAF acetyltransferase. EMBO J. 17:4469-4477[Medline].
41. Ribbeck, K., G. Lipowsky, H. M. Kent, M. Stewart, and D. Görlich. 1998. NTF2 mediates nuclear import of Ran. EMBO J. 17:6587-6598[Medline].
42. Seki, T., S. Tada, T. Katada, and T. Enomoto. 1997. Cloning of a cDNA encoding novel importin-alpha homologue, Qip1: discrimination of Qip1 and Rch1 from hSrp1 by their ability to interact with DNA helicase Q1/RecQL. Biochem. Biophys. Res. Commun. 234:7633-7637.
43. Sekimoto, T., N. Imamoto, K. Nakajima, T. Hirano, and Y. Yoneda. 1997. Extracellular signal-dependent nuclear import of Stat1 is mediated by nuclear pore-targeting complex formation with NPI-1, but not Rch1. EMBO J. 16:7067-7077[Medline].
44. Tsuji, L., T. Takumi, N. Imamoto, and Y. Yoneda. 1997. Identification of novel homologues of mouse importin alpha , the alpha  subunit of the nuclear pore-targeting complex, and their tissue-specific expression. FEBS Lett. 416:30-34[Medline].
45. Weis, K., I. W. Mattaj, and A. I. Lamond. 1995. Identification of hSRP1alpha as a functional receptor for nuclear localization sequences. Science 268:1049-1053[Abstract/Free Full Text].
46. Weis, K., U. Ryder, and A. I. Lamond. 1996. The conserved amino terminal domain of hSRP1alpha is essential for nuclear protein import. EMBO J. 15:1818-1825[Medline].


Molecular and Cellular Biology, November 1999, p. 7782-7791, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Gontan, C., Guttler, T., Engelen, E., Demmers, J., Fornerod, M., Grosveld, F. G., Tibboel, D., Gorlich, D., Poot, R. A., Rottier, R. J. (2009). Exportin 4 mediates a novel nuclear import pathway for Sox family transcription factors. JCB 185: 27-34 [Abstract] [Full Text]  
  • Kosugi, S., Hasebe, M., Matsumura, N., Takashima, H., Miyamoto-Sato, E., Tomita, M., Yanagawa, H. (2009). Six Classes of Nuclear Localization Signals Specific to Different Binding Grooves of Importin {alpha}. J. Biol. Chem. 284: 478-485 [Abstract] [Full Text]  
  • Sangiambut, S., Keelapang, P., Aaskov, J., Puttikhunt, C., Kasinrerk, W., Malasit, P., Sittisombut, N. (2008). Multiple regions in dengue virus capsid protein contribute to nuclear localization during virus infection. J. Gen. Virol. 89: 1254-1264 [Abstract] [Full Text]  
  • Theodore, M., Kawai, Y., Yang, J., Kleshchenko, Y., Reddy, S. P., Villalta, F., Arinze, I. J. (2008). Multiple Nuclear Localization Signals Function in the Nuclear Import of the Transcription Factor Nrf2. J. Biol. Chem. 283: 8984-8994 [Abstract] [Full Text]  
  • Ratan, R., Mason, D. A., Sinnot, B., Goldfarb, D. S., Fleming, R. J. (2008). Drosophila Importin {alpha}1 Performs Paralog-Specific Functions Essential For Gametogenesis. Genetics 178: 839-850 [Abstract] [Full Text]  
  • Reid, St. P., Valmas, C., Martinez, O., Sanchez, F. M., Basler, C. F. (2007). Ebola Virus VP24 Proteins Inhibit the Interaction of NPI-1 Subfamily Karyopherin {alpha} Proteins with Activated STAT1. J. Virol. 81: 13469-13477 [Abstract] [Full Text]  
  • Terry, L. J., Shows, E. B., Wente, S. R. (2007). Crossing the Nuclear Envelope: Hierarchical Regulation of Nucleocytoplasmic Transport. Science 318: 1412-1416 [Abstract] [Full Text]  
  • Hood, F. E., Clarke, P. R. (2007). RCC1 isoforms differ in their affinity for chromatin, molecular interactions and regulation by phosphorylation. J. Cell Sci. 120: 3436-3445 [Abstract] [Full Text]  
  • Melen, K., Kinnunen, L., Fagerlund, R., Ikonen, N., Twu, K. Y., Krug, R. M., Julkunen, I. (2007). Nuclear and Nucleolar Targeting of Influenza A Virus NS1 Protein: Striking Differences between Different Virus Subtypes. J. Virol. 81: 5995-6006 [Abstract] [Full Text]  
  • Nitahara-Kasahara, Y., Kamata, M., Yamamoto, T., Zhang, X., Miyamoto, Y., Muneta, K., Iijima, S., Yoneda, Y., Tsunetsugu-Yokota, Y., Aida, Y. (2007). Novel Nuclear Import of Vpr Promoted by Importin {alpha} Is Crucial for Human Immunodeficiency Virus Type 1 Replication in Macrophages. J. Virol. 81: 5284-5293 [Abstract] [Full Text]  
  • Knudsen, N. O., Nielsen, F. C., Vinther, L., Bertelsen, R., Holten-Andersen, S., Liberti, S. E., Hofstra, R., Kooi, K., Rasmussen, L. J. (2007). Nuclear localization of human DNA mismatch repair protein exonuclease 1 (hEXO1). Nucleic Acids Res 0: gkl1166v1-11 [Abstract] [Full Text]  
  • Bian, X.-L., Rosas-Acosta, G., Wu, Y.-C., Wilson, V. G. (2007). Nuclear Import of Bovine Papillomavirus Type 1 E1 Protein Is Mediated by Multiple Alpha Importins and Is Negatively Regulated by Phosphorylation near a Nuclear Localization Signal. J. Virol. 81: 2899-2908 [Abstract] [Full Text]  
  • Friedrich, B., Quensel, C., Sommer, T., Hartmann, E., Kohler, M. (2006). Nuclear Localization Signal and Protein Context both Mediate Importin {alpha} Specificity of Nuclear Import Substrates. Mol. Cell. Biol. 26: 8697-8709 [Abstract] [Full Text]  
  • Nishi, M., Kawata, M. (2006). Brain Corticosteroid Receptor Dynamics and Trafficking: Implications from Live Cell Imaging. Neuroscientist 12: 119-133 [Abstract]  
  • Arnold, M., Nath, A., Wohlwend, D., Kehlenbach, R. H. (2006). Transportin Is a Major Nuclear Import Receptor for c-Fos: A NOVEL MODE OF CARGO INTERACTION. J. Biol. Chem. 281: 5492-5499 [Abstract] [Full Text]  
  • Stallings, C. L., Duigou, G. J., Gershon, A. A., Gershon, M. D., Silverstein, S. J. (2006). The Cellular Localization Pattern of Varicella-Zoster Virus ORF29p Is Influenced by Proteasome-Mediated Degradation. J. Virol. 80: 1497-1512 [Abstract] [Full Text]  
  • Stallings, C. L., Silverstein, S. (2005). Dissection of a Novel Nuclear Localization Signal in Open Reading Frame 29 of Varicella-Zoster Virus. J. Virol. 79: 13070-13081 [Abstract] [Full Text]  
  • Umeda, M., Izaddoost, S., Cushman, I., Moore, M. S., Sazer, S. (2005). The Fission Yeast Schizosaccharomyces pombe Has Two Importin-{alpha} Proteins, Imp1p and Cut15p, Which Have Common and Unique Functions in Nucleocytoplasmic Transport and Cell Cycle Progression. Genetics 171: 7-21 [Abstract] [Full Text]  
  • Liu, L., McBride, K. M., Reich, N. C. (2005). STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-{alpha}3. Proc. Natl. Acad. Sci. USA 102: 8150-8155 [Abstract] [Full Text]  
  • Fagerlund, R., Kinnunen, L., Kohler, M., Julkunen, I., Melen, K. (2005). NF-{kappa}B Is Transported into the Nucleus by Importin {alpha}3 and Importin {alpha}4. J. Biol. Chem. 280: 15942-15951 [Abstract] [Full Text]  
  • Sakakida, Y., Miyamoto, Y., Nagoshi, E., Akashi, M., Nakamura, T. J., Mamine, T., Kasahara, M., Minami, Y., Yoneda, Y., Takumi, T. (2005). Importin {alpha}/{beta} Mediates Nuclear Transport of a Mammalian Circadian Clock Component, mCRY2, Together with mPER2, through a Bipartite Nuclear Localization Signal. J. Biol. Chem. 280: 13272-13278 [Abstract] [Full Text]  
  • Zhong, H., Takeda, A., Nazari, R., Shio, H., Blobel, G., Yaseen, N. R. (2005). Carrier-independent Nuclear Import of the Transcription Factor PU.1 via RanGTP-stimulated Binding to Nup153. J. Biol. Chem. 280: 10675-10682 [Abstract] [Full Text]  
  • Bhatti, M. M., Sullivan, W. J. Jr. (2005). Histone Acetylase GCN5 Enters the Nucleus via Importin-{alpha} in Protozoan Parasite Toxoplasma gondii. J. Biol. Chem. 280: 5902-5908 [Abstract] [Full Text]  
  • Quensel, C., Friedrich, B., Sommer, T., Hartmann, E., Kohler, M. (2004). In Vivo Analysis of Importin {alpha} Proteins Reveals Cellular Proliferation Inhibition and Substrate Specificity. Mol. Cell. Biol. 24: 10246-10255 [Abstract] [Full Text]  
  • Wang, W., Yang, X., Kawai, T., de Silanes, I. L., Mazan-Mamczarz, K., Chen, P., Chook, Y. M., Quensel, C., Kohler, M., Gorospe, M. (2004). AMP-activated Protein Kinase-regulated Phosphorylation and Acetylation of Importin {alpha}1: INVOLVEMENT IN THE NUCLEAR IMPORT OF RNA-BINDING PROTEIN HuR. J. Biol. Chem. 279: 48376-48388 [Abstract] [Full Text]  
  • Banninger, G., Reich, N. C. (2004). STAT2 Nuclear Trafficking. J. Biol. Chem. 279: 39199-39206 [Abstract] [Full Text]  
  • Nishinaka, Y., Masutani, H., Oka, S.-i., Matsuo, Y., Yamaguchi, Y., Nishio, K., Ishii, Y., Yodoi, J. (2004). Importin {alpha}1 (Rch1) Mediates Nuclear Translocation of Thioredoxin-binding Protein-2/Vitamin D3-up-regulated Protein 1. J. Biol. Chem. 279: 37559-37565 [Abstract] [Full Text]  
  • Ploski, J. E., Shamsher, M. K., Radu, A. (2004). Paired-Type Homeodomain Transcription Factors Are Imported into the Nucleus by Karyopherin 13. Mol. Cell. Biol. 24: 4824-4834 [Abstract] [Full Text]  
  • Furuta, M., Kose, S., Koike, M., Shimi, T., Hiraoka, Y., Yoneda, Y., Haraguchi, T., Imamoto, N. (2004). Heat-shock induced nuclear retention and recycling inhibition of importin {alpha}. GENES CELLS 9: 429-441 [Abstract] [Full Text]  
  • Sekiguchi, T., Todaka, Y., Wang, Y., Hirose, E., Nakashima, N., Nishimoto, T. (2004). A Novel Human Nucleolar Protein, Nop132, Binds to the G Proteins, RRAG A/C/D. J. Biol. Chem. 279: 8343-8350 [Abstract] [Full Text]  
  • Tao, M., Kruhlak, M., Xia, S., Androphy, E., Zheng, Z.-M. (2003). Signals That Dictate Nuclear Localization of Human Papillomavirus Type 16 Oncoprotein E6 in Living Cells. J. Virol. 77: 13232-13247 [Abstract] [Full Text]  
  • Mason, D. A., Mathe, E., Fleming, R. J., Goldfarb, D. S. (2003). The Drosophila melanogaster importin {alpha}3 Locus Encodes an Essential Gene Required for the Development of Both Larval and Adult Tissues. Genetics 165: 1943-1958 [Abstract] [Full Text]  
  • Zannini, L., Lecis, D., Lisanti, S., Benetti, R., Buscemi, G., Schneider, C., Delia, D. (2003). Karyopherin-{alpha}2 Protein Interacts with Chk2 and Contributes to Its Nuclear Import. J. Biol. Chem. 278: 42346-42351 [Abstract] [Full Text]  
  • Melen, K., Fagerlund, R., Franke, J., Kohler, M., Kinnunen, L., Julkunen, I. (2003). Importin {alpha} Nuclear Localization Signal Binding Sites for STAT1, STAT2, and Influenza A Virus Nucleoprotein. J. Biol. Chem. 278: 28193-28200 [Abstract] [Full Text]  
  • Lischka, P., Sorg, G., Kann, M., Winkler, M., Stamminger, T. (2003). A Nonconventional Nuclear Localization Signal within the UL84 Protein of Human Cytomegalovirus Mediates Nuclear Import via the Importin {alpha}/{beta} Pathway. J. Virol. 77: 3734-3748 [Abstract] [Full Text]  
  • Maiyar, A. C., Leong, M. L.L., Firestone, G. L. (2003). Importin-alpha Mediates the Regulated Nuclear Targeting of Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by Recognition of a Nuclear Localization Signal in the Kinase Central Domain. Mol. Biol. Cell 14: 1221-1239 [Abstract] [Full Text]  
  • Geles, K. G., Johnson, J. J., Jong, S., Adam, S. A. (2002). A Role for Caenorhabditis elegans Importin IMA-2 in Germ Line and Embryonic Mitosis. Mol. Biol. Cell 13: 3138-3147 [Abstract] [Full Text]  
  • Henderson, M. J., Russell, A. J., Hird, S., Munoz, M., Clancy, J. L., Lehrbach, G. M., Calanni, S. T., Jans, D. A., Sutherland, R. L., Watts, C. K. W. (2002). EDD, the Human Hyperplastic Discs Protein, Has a Role in Progesterone Receptor Coactivation and Potential Involvement in DNA Damage Response. J. Biol. Chem. 277: 26468-26478 [Abstract] [Full Text]  
  • Nelson, L. M., Rose, R. C., Moroianu, J. (2002). Nuclear Import Strategies of High Risk HPV16 L1 Major Capsid Protein. J. Biol. Chem. 277: 23958-23964 [Abstract] [Full Text]  
  • Mason, D. A., Fleming, R. J., Goldfarb, D. S. (2002). Drosophila melanogaster Importin {alpha}1 and {alpha}3 Can Replace Importin {alpha}2 During Spermatogenesis but Not Oogenesis. Genetics 161: 157-170 [Abstract] [Full Text]  
  • Wolff, T., Unterstab, G., Heins, G., Richt, J. A., Kann, M. (2002). Characterization of an Unusual Importin alpha Binding Motif in the Borna Disease Virus p10 Protein That Directs Nuclear Import. J. Biol. Chem. 277: 12151-12157 [Abstract] [Full Text]  
  • Franke, J., Reimann, B., Hartmann, E., Kohler, M., Wiedmann, B. (2002). Evidence for a nuclear passage of nascent polypeptide-associated complex subunits in yeast. J. Cell Sci. 114: 2641-2648 [Abstract] [Full Text]  
  • Macara, I. G. (2001). Transport into and out of the Nucleus. Microbiol. Mol. Biol. Rev. 65: 570-594 [Abstract] [Full Text]  
  • Cressman, D. E., O'Connor, W. J., Greer, S. F., Zhu, X.-S., Ting, J. P.-Y. (2001). Mechanisms of Nuclear Import and Export That Control the Subcellular Localization of Class II Transactivator. J. Immunol. 167: 3626-3634 [Abstract] [Full Text]  
  • Holaska, J. M., Black, B. E., Love, D. C., Hanover, J. A., Leszyk, J., Paschal, B. M. (2001). Calreticulin Is a Receptor for Nuclear Export. JCB 152: 127-140 [Abstract] [Full Text]  
  • Geles, K., Adam, S. (2001). Germline and developmental roles of the nuclear transport factor importin (&agr;)3 in C. elegans. Development 128: 1817-1830 [Abstract]  
  • Bertinato, J, Schild-Poulter, C, Hache, R. (2001). Nuclear localization of Ku antigen is promoted independently by basic motifs in the Ku70 and Ku80 subunits. J. Cell Sci. 114: 89-99 [Abstract]  
  • Wen, Y., Shatkin, A. J. (2000). Cap methyltransferase selective binding and methylation of GpppG-RNA are stimulated by importin-{alpha}. Genes Dev. 14: 2944-2949 [Abstract] [Full Text]  
  • Giesen, K., Radsak, K., Bogner, E. (2000). The potential terminase subunit of human cytomegalovirus, pUL56, is translocated into the nucleus by its own nuclear localization signal and interacts with importin {alpha}. J. Gen. Virol. 81: 2231-2244 [Abstract] [Full Text]  
  • Tabb, M. M., Tongaonkar, P., Vu, L., Nomura, M. (2000). Evidence for Separable Functions of Srp1p, the Yeast Homolog of Importin alpha (Karyopherin alpha ): Role for Srp1p and Sts1p in Protein Degradation. Mol. Cell. Biol. 20: 6062-6073 [Abstract] [Full Text]  
  • Nemergut, M. E., Macara, I. G. (2000). Nuclear Import of the Ran Exchange Factor, RCC1, Is Mediated by at Least Two Distinct Mechanisms. JCB 149: 835-850 [Abstract] [Full Text]  
  • Talcott, B., Moore, M. S. (2000). The Nuclear Import of RCC1 Requires a Specific Nuclear Localization Sequence Receptor, Karyopherin alpha 3/Qip. J. Biol. Chem. 275: 10099-10104 [Abstract] [Full Text]  
  • Welch, K., Franke, J., Kohler, M., Macara, I. G. (1999). RanBP3 Contains an Unusual Nuclear Localization Signal That Is Imported Preferentially by Importin-alpha 3. Mol. Cell. Biol. 19: 8400-8411 [Abstract] [Full Text]  
  • Kovac, C. R., Emelyanov, A., Singh, M., Ashouian, N., Birshtein, B. K. (2000). BSAP (Pax5)-Importin alpha 1 (Rch1) Interaction Identifies a Nuclear Localization Sequence. J. Biol. Chem. 275: 16752-16757 [Abstract] [Full Text]  
  • Fanara, P., Hodel, M. R., Corbett, A. H., Hodel, A. E. (2000). Quantitative Analysis of Nuclear Localization Signal (NLS)-Importin alpha Interaction through Fluorescence Depolarization. EVIDENCE FOR AUTO-INHIBITORY REGULATION OF NLS BINDING. J. Biol. Chem. 275: 21218-21223 [Abstract] [Full Text]  
  • Jiang, C.-J., Shoji, K., Matsuki, R., Baba, A., Inagaki, N., Ban, H., Iwasaki, T., Imamoto, N., Yoneda, Y., Deng, X.-W., Yamamoto, N. (2001). Molecular Cloning of a Novel Importin alpha Homologue from Rice, by Which Constitutive Photomorphogenic 1 (COP1) Nuclear Localization Signal (NLS)-Protein Is Preferentially Nuclear Imported. J. Biol. Chem. 276: 9322-9329 [Abstract] [Full Text]  
  • Hieda, M., Tachibana, T., Fukumoto, M., Yoneda, Y. (2001). Nuclear Import of the U1A Splicesome Protein Is Mediated by Importin alpha /beta and Ran in Living Mammalian Cells. J. Biol. Chem. 276: 16824-16832 [Abstract] [Full Text]  
  • Goodwin, D. J., Whitehouse, A. (2001). A gamma -2 Herpesvirus Nucleocytoplasmic Shuttle Protein Interacts with Importin alpha 1 and alpha 5. J. Biol. Chem. 276: 19905-19912 [Abstract] [Full Text]  
  • Catimel, B., Teh, T., Fontes, M. R. M., Jennings, I. G., Jans, D. A., Howlett, G. J., Nice, E. C., Kobe, B. (2001). Biophysical Characterization of Interactions Involving Importin-alpha during Nuclear Import. J. Biol. Chem. 276: 34189-34198 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Köhler, M.
Right arrow Articles by Hartmann, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Köhler, M.
Right arrow Articles by Hartmann, E.