Previous Article
Molecular and Cellular Biology, November 1999, p. 7886-7896, Vol. 19, No. 11
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Molecular Architecture of the Mouse DNA Polymerase
-Primase Complex
Takeshi
Mizuno,1
Kumiko
Yamagishi,1
Hiroshi
Miyazawa,1,2 and
Fumio
Hanaoka1,3,*
The Institute of Physical and Chemical
Research (RIKEN), Wako, Saitama 351-0198,1
National Institute of Public Health, Meguro, Tokyo
108-8638,2 and Institute for Molecular
and Cellular Biology, Osaka University, Suita, Osaka
565-0871,3 Japan
Received 24 May 1999/Returned for modification 28 June
1999/Accepted 9 August 1999
 |
ABSTRACT |
The DNA polymerase
-primase complex is the only enzyme that
provides RNA-DNA primers for chromosomal DNA replication in eukaryotes. Mouse DNA polymerase
has been shown to consist of four subunits, p180, p68, p54, and p46. To characterize the domain structures and
subunit requirements for the assembly of the complex, we constructed eukaryotic polycistronic cDNA expression plasmids expressing pairwise the four subunits of DNA polymerase
. In addition, the constructs contained an internal ribosome entry site derived from poliovirus. The
constructs were transfected in different combinations with vectors
expressing single subunits to allow the simultaneous expression of
three or four of the subunits in cultured mammalian cells. We
demonstrate that the carboxyl-terminal region of p180 (residues 1235 to
1465) is essential for its interaction with both p68 and p54-p46 by
immunohistochemical analysis and coprecipitation studies with
antibodies. Mutations in the putative zinc fingers present in the
carboxyl terminus of p180 abolished the interaction with p68
completely, although the mutants were still capable of interacting with
p54-p46. Furthermore, the amino-terminal region (residues 1 to 329) and
the carboxyl-terminal region (residues 1280 to 1465) were revealed to
be dispensable for DNA polymerase activity. Thus, we can divide the
p180 subunit into three domains. The first is the amino-terminal domain
(residues 1 to 329), which is dispensable for both polymerase activity
and subunit assembly. The second is the minimal core domain (residues
330 to 1279), required for polymerase activity. The third is the
carboxyl-terminal domain (residues 1280 to 1465), which is dispensable
for polymerase activity but required for the interaction with the other
three subunits. Taken together, these results allow us to propose the
first structural model for the DNA polymerase
-primase complex in
terms of subunit assembly, domain structure, and stepwise formation at
the cellular level.
 |
INTRODUCTION |
In mammalian cells, six distinct DNA
polymerases,
,
,
,
,
, and
, have been cloned so far
(3, 13, 42). Among these, DNA polymerases
,
, and
are considered to be involved in chromosomal DNA replication. DNA
polymerase
is the only enzyme that is tightly coupled to DNA
primase. Therefore, DNA polymerase
has been considered to provide
RNA-DNA primers for the initiation of leading-strand synthesis as well
as Okazaki fragment synthesis on the lagging strand (12, 34,
42). By use of the simian virus 40 (SV40) in vitro DNA
replication system, it was shown that DNA polymerase
plays a role
in the initiation of DNA synthesis by providing RNA-DNA primers for
both leading-strand synthesis and lagging-strand synthesis and that DNA
polymerase
extensively elongates these primers through a polymerase
switch mechanism (40). However, even though the precise
roles of DNA polymerases
and
have been established for the SV40
DNA replication system, the way in which these enzymes function during
replication of the chromosome is still not clear. Namely, we are
ignorant about the architecture of the subunit assemblies in the
replication complexes, the way in which the activities of these
complexes are regulated, the coordination that must exist between these polymerases at the replication fork, and which DNA polymerase,
or
, participates in the elongation of the leading strand and lagging
strand (3, 4, 34).
DNA polymerases
,
,
, and
contain amino acid sequences
that are conserved among a wide range of DNA polymerases, indicating that these polymerases belong to the class B DNA polymerase family (32, 42, 44). During this decade, molecular cloning analysis has shown that the large subunits of all these DNA polymerases comprise
the catalytic activity, whereas the functions of the smaller subunits,
with the exception of the primase subunit, still remain uncertain
(12, 34, 42). However, the second-largest subunits of DNA
polymerases
,
, and
display significant homology, suggesting
that these subunits may have pivotal functions that were conserved
during evolution (2, 20). Characterization of the domain
structures and subunit requirements for complex assembly should help us
to determine the common properties and distinctive features of members
of the class B DNA polymerase family.
To understand the molecular mechanism of eukaryotic DNA replication, we
focused our attention on the DNA polymerase
-primase complex. Mouse
DNA polymerase
is made up of four subunits (22, 36, 37).
The largest subunit, p180, and the smallest subunit, p46, comprise the
DNA polymerase and DNA primase activities, respectively (8, 9,
29). The other subunits, p68 and p54, have no known enzymatic
activity. Recently, it was suggested that the replication activity of
the DNA polymerase
-primase in human cells was regulated by
cyclin-dependent kinase phosphorylation of p68, although the regulatory
mechanism was not elucidated (39). To identify the precise
functions of these subunits in cells, we exploited a cDNA expression
system using mammalian cultured cells and found that p68 facilitates
not only p180 protein synthesis through cotranslational interaction but
also translocation of p180 into the nucleus as a p180-p68 heterodimer
(23). Moreover, we found that p54 can carry p46 into the
nucleus through the so-called piggyback binding transport mechanism
(24). Thus, using the cDNA expression system in mammalian
cultured cells, we showed that interactions involving specific
combinations of p46 and p54 and of p68 and p180 are essential for the
nuclear translocation of DNA polymerase
. However, study of the
interactions among three or all of the subunits was hampered by the
difficulty in obtaining continuous expression of more than two subunits
in mammalian cells. Moreover, reconstitution of the tetrameric complex
from individually purified subunits has not been possible to date. To
characterize the subunit-subunit interactions more directly, we
designed a cDNA expression system with eukaryotic polycistronic
plasmids containing an internal ribosomal entry site (IRES) from
poliovirus and examined the interactions between these subunits in
vivo. Using triple and quadruple transfections, we were able to
determine the subcellular distribution of the four subunits in detail,
investigate the interactions among the four subunits, and resolve the
domain organization of the p180 molecule. Taken together, these results
have allowed us to postulate a structural model for the DNA polymerase
-primase complex, which succeeds in explaining its subunit assembly,
domain structure, and stepwise formation at the cellular level.
 |
MATERIALS AND METHODS |
Materials.
All restriction enzymes and Klenow fragment were
purchased from Takara (Ohtsu, Japan); phenylmethylsulfonyl fluoride was
from Sigma; Expand high-fidelity DNA polymerase and 12CA5
anti-hemagglutinin (HA) antibody were from Boehringer Mannheim; anti-T7
tag antibody was from Novagen; horseradish peroxidase-conjugated goat
anti-rabbit and anti-mouse immunoglobulin G (IgG) antibodies were from
MBL (Nagoya, Japan); fluorescein isothiocyanate (FITC)- or Texas
red-conjugated goat anti-rabbit or anti-mouse IgG antibodies were from
Vector Inc.; fetal bovine serum was from Intergen; calf serum was from HyClone; anti-six-His monoclonal antibody and cobalt-chelating Sepharose (TALON) were from Clontech. The expression vectors pcDEB
, pSRHisABC, and IRES were gifts from Y. Nakabeppu (26), S. Ohno (1), and A. Nomoto (30), respectively. DNA
polymerase
-specific hybridoma SJK132-20 was purchased from the
American Type Culture Collection (6). NIH 3T3 cells were
from T. Akiyama. Unless otherwise stated, all other chemicals and
reagents were obtained from Wako Chemicals (Osaka, Japan).
Construction of the expression vector.
cDNAs for the four
subunits of mouse DNA polymerase
-primase complex were introduced
into pcDEB
, which contains the SR
promoter (38), to
generate plasmids pSR
46, pSR
54, pSR
68, and pSR
180 as
described previously (16, 24).
IRES-derived polycistronic expression plasmids were constructed with
poliovirus IRES (30). Restriction enzyme sites were introduced by PCR with two primers:
5'-CCGAGCTCTAGAGGCCCACGTGGCGGCTA-3' and
5'-GGAGCGCTAGCAAACAGATAGATAATGA-3'. The 650-bp PCR product was digested with XbaI and NheI and subcloned
into XbaI-digested pSR
54 (pSR
IRES-54). The 1.6-kb
BglII-EcoRV-digested pSR
46 was filled in with
Klenow enzyme. Then, pSR
IRES-54 was digested with XbaI,
filled in with Klenow enzyme, and ligated with the blunt-ended fragment
containing the cDNA for p46. The resultant plasmid containing the cDNAs
of both p54 and p46 was designated pI-pri. To coexpress HA-tagged p46
with p54, an HA tag was introduced into the amino terminus of p46 by
PCR with the primers
5'-GAGA TCTAGATGTACCCATACGACGTTCCTGACTACGCGGAGCCATTTGA TCCTGCGGA-3'
and 5'-GCTGTTTTCTCTCGAGATCTTTTTG-3'. The PCR
products were digested with XbaI and
HindIII and were used to replace the original fragment
in pSR
46. The resulting construct was designated pSR
46-HA. Then,
the 2.2-kb XhoI-KpnI-digested pSR
54 containing the cDNA for p54 and the 650-bp
KpnI-NheI-digested PCR product containing the
IRES were subcloned into XhoI-XbaI-digested
pSR
46-HA, and the resulting plasmid was designated pI-pri(HA). To
express the nuclear-translocation-deficient p54-p46, the amino-terminal nuclear localization signal (NLS) of p54 was disrupted by site-directed mutagenesis as described previously (24). The resulting
plasmid was designated pI-pri(-NLS).
The ScaI-BalI-digested PCR fragment containing
the IRES and a 2.0-kb SmaI-digested pSR
68 containing the
cDNA for p68 were subcloned into the EcoRV site of
pSR
180. The plasmid encoding the two cDNAs for p180 and p68 was
designated pI-pol.
.
For the six-His-tagged mutants, PCR fragments were subcloned into
pSRHisABC expression plasmids containing triple tags (six-His tag, T7 tag, and Express tag) under the control of the SR
promoter (1). For construction of six-His-tagged full-length p180
(H-p180), a 4.2-kb EcoRI-EcoRV fragment of
pSR
180 was blunt ended with Klenow enzyme. pSRHisC was digested with
BglII, blunt ended with Klenow enzyme, and ligated with the
blunt-ended fragment containing the cDNA for p180. For the construction
of the amino-terminal and the carboxyl-terminal truncation mutants,
H-core, H-
N400, and H-
N600, the initiation methionine and
restriction enzyme sites were introduced by PCR with the same 3'
primer, 5'-GCATTTGAATGGATCCTAATCCTTGTATT-3', and different
5' primers, 5'-AGTTCTAGATATCATGAGTAATCTCCCATTG-3', 5'-GGAGATCTATGAAATTTGACCTAAA-3', and
5'-GGAGATCTAAAGAA-3'. To construct H-
C200, the 2.5-kb
fragment of BamHI-digested H-core fragment was subcloned
into BglII-digested pSRHisC. H-
C was constructed by PCR
with the primers 5'-GCATTTGAATGGATCCTAATCCTTGTATT-3' and 5'-AAGCCGGGACACCATTG-3'. The PCR products were digested with
BamHI and subcloned into BamHI-digested
pSR
180. Then, Aor51HI-MluI-digested fragment
containing a carboxyl-terminal deletion mutant of p180 was filled in
with Klenow enzyme and subcloned into PvuII-digested pSRHisC. To construct the amino-terminal deletion mutant H-
N, a 1.4-kb BalI-KpnI-digested H-p180 fragment
was subcloned into the BalI-KpnI-digested H-core.
To express the carboxyl-terminal fragment (residues 1235 to 1465),
PCR-amplified products obtained with primers
5'-GATGGATCCGATGCTGTACTCATT-3' and
5'-GGCCTCCTTGGATCCTTCCCG-3' were digested with
BamHI and subcloned into BglII-digested pSRHisB.
Mutants with cysteine residues replaced with alanine residues in the
putative zinc fingers were constructed by PCR by the overlap extension
technique (15). The following primer sets were used to
introduce mutations: H-AZ, 5'-CTTTGTCCTTCATGTGGAACTGAAAATATTTAT-3' and 5'-GGCCTCCTTGGATCCTTCCCG-3'; and H-ZA,
5'-CTGTGTCCAGTCTGCATGAAAGCTGTGCTTAGA-3' and
5'-GGCCTCCTTGGATCCTTCCCG-3'. The double mutant H-AA was
constructed by PCR with H-AZ as template DNA and primers for H-ZA.
The identity of each of these constructs was confirmed by DNA
sequencing on an Applied Biosystems 377A automatic DNA sequencer.
Cell culture and transfection.
COS-1 cells, which are
derived from the African green monkey kidney cell line CV-1 by
transformation with an origin-defective SV40 virus, were grown in
Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum in a 5% CO2 incubator. NIH 3T3 cells were
cultured in medium supplemented with 10% calf serum instead of fetal
bovine serum. Transfection was performed by electroporation as
described elsewhere (31). The level of protein expression was analyzed 48 h after transfection unless otherwise indicated.
DNA polymerase assay.
The DNA polymerase assay was carried
out as described previously (36). Briefly, 5 µg of protein
was incubated for 1 h at 37°C with 0.5 mg of DNase I-activated calf
thymus DNA per ml in a buffer containing 20 mM Tris-HCl (pH 8.0); 10%
glycerol; 60 mM KCl; 5 mM MgCl2; 3.3 mM 2-mercaptoethanol;
0.2 mg of bovine serum albumin per ml; 100 µM (each) dATP, dCTP, and
dGTP; and 50 µM [3H]dTTP (0.1 Ci/mmol). The
incorporation of [3H]dTMP was measured with a Whatman
DE81 paper disc as described elsewhere (35).
Glycerol density gradient sedimentation.
Proteins were
extracted from NIH 3T3 cells with 0.3 M KCl in extraction buffer as
described previously (37). Aliquots containing 200 µg of
protein in 50 µl were layered onto 2 ml of a linear 15 to 35%
glycerol gradient in a buffer containing 25 mM potassium phosphate (pH
7.5), 300 mM KCl, 1 mM MgCl2, and 0.5% Triton X-100. Centrifugation was at 55,000 rpm for 16 h at 4°C (Beckman
TLS-55), and 30 fractions were collected from the top of the gradient. Western blot analysis of each fraction was done with antibodies specific for each subunit (23, 24).
Indirect immunofluorescence staining.
Cells were grown on
chamber slides (Nunc) coated with poly-L-lysine, washed
with phosphate-buffered saline (PBS), and fixed with 3.7% formaldehyde
in PBS for 10 min on ice. Cells were then washed with PBS and
permeabilized sequentially with 50, 75, and 95% ethanol on ice for 5 min each. The slides were then blocked with PBS containing 5% normal
goat serum (blocking buffer) for 30 min at room temperature; incubated
with anti-p46 (0.4 µg/ml), anti-p54 (0.3 µg/ml), anti-p68 (1.3 µg/ml), or anti-p180 (diluted 1:3,000) antibody in blocking buffer
for 1 h at room temperature; and washed three times with PBS for 5 min each time. Cells were then incubated with FITC-conjugated secondary
antibody for 1 h at room temperature, washed three times with PBS,
and preserved in Vectorshield (Vector Inc.). DNA staining was performed
by adding 1 µg of bis-benzimide (Hoechst 33258) per ml
into the final PBS wash. The samples were examined with an Olympus
PROVIS AX70 fluorescence microscope. For double staining studies,
SJK132-20 monoclonal antibody (ascitic fluid), anti-HA antibody, and
Texas red-conjugated secondary antibody were used at a 1:400 dilution,
5 µg/ml, and 1.5 µg/ml, respectively.
Preparation of cell extracts and Western blot analysis.
After transfection, COS-1 cells were washed with PBS, scraped from the
plates in PBS, centrifuged for 5 min, and resuspended in extraction
buffer as described previously (37). The insoluble materials
were separated by centrifugation. Precipitates were resuspended in
Laemmli sample buffer (17). The samples were resolved by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and transferred electrophoretically onto 0.45-µm-pore-size polyvinylidene difluoride membranes (Millipore). After incubation of
the membranes with either anti-p46 (0.13 µg/ml), anti-p54 (0.3 µg/ml), anti-p68 (0.3 µg/ml), anti-p180 (1:3,000), anti-HA
(1:1,200), anti-six-His tag (1:3,000), or anti-T7 tag (1:3,000)
antibodies in TBS (Tris-buffered saline; 50 mM Tris-HCl [pH 7.5] and
150 mM NaCl) containing 5% (wt/vol) dried milk for 1 h at room
temperature, the membranes were washed three times with TBS containing
0.05% Tween 20. The membranes were then incubated for 1 h at room
temperature with horseradish peroxidase-conjugated goat secondary
antibody in TBS containing 5% dried milk and washed again. Detection
of the protein bands was performed with the enhanced chemiluminescent reagent SuperSignal (Pierce) according to the manufacturer's
instructions. Kaleidoscope prestained standards (Bio-Rad) were used as
molecular weight standards.
Pull-down assay with six-His tags.
Fifty micrograms of COS-1
cell extracts was mixed with cobalt-chelating Sepharose (TALON;
Clontech) for 4 h at 4°C in 200 µl of PK buffer (20 mM
potassium phosphate [pH 7.5], 100 mM KCl, 0.1% NP-40, 1 mM EDTA,
10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 0.2 µg of
aprotinin per ml, 0.2 µg of leupeptin per ml, 0.1 µg of antipain
per ml, and 0.1 µg of pepstatin A per ml). After washing with PK
buffer containing 10 mM imidazole, six-His-tagged proteins were eluted
with 30 µl of PK buffer containing 200 mM imidazole and then
subjected to SDS-PAGE and Western blot analysis with anti-six-His tag
or anti-T7 tag monoclonal antibody.
Coimmunoprecipitation analysis.
Fifty micrograms of COS-1
cell extracts was immunoprecipitated with 1 µl of anti-p46 antibody
(0.13 µg) which had been preadsorbed to protein G-Sepharose
(Pharmacia) for 4 h at 4°C in 200 µl of PK buffer. After
washing with PK buffer, precipitates were dissolved with 30 µl of 2×
Laemmli sample buffer and then subjected to SDS-PAGE and Western blot
analysis with anti-six-His tag or anti-T7 tag monoclonal antibody.
 |
RESULTS |
The eukaryotic polycistronic cDNA expression system.
Although
transient transfection by electroporation of COS-1 cells with one
plasmid was very efficient and reproducible, simultaneous transfections
with three or four plasmids were very difficult, because the amount of
transfected plasmid varied from one cell to another. To overcome the
problem of multisubunit transfection, we constructed a eukaryotic
polycistronic cDNA expression plasmid containing an IRES. An IRES was
discovered at first in the picornavirus genome, where it allows the
initiation of translation in a cap-independent manner (7, 25, 28,
30). Using the IRES derived from poliovirus, we constructed
pI-pol.
, which was designed to coexpress p180 and p68 as a
heterodimer, and pI-pri, which was designed to express p54 and p46 as a
heterodimer (Fig. 1A). These plasmids are
suitable for the transfection of three or four subunits simultaneously because all of the cells expressing p180 will contain p68 and all of
the cells expressing p54 will contain p46 at constant ratios. To verify
that coexpressed p180 and p68 were assembled into a functional DNA
polymerase, we measured DNA polymerase activity. Transiently
transfected COS-1 cells were harvested at the indicated times, and the
DNA polymerase activity of the extracts was determined with activated
calf thymus DNA as a substrate. While singly expressed p180 showed a
slight increase of polymerase activity, p180 coexpressed with p68
exhibited a marked increase of activity in a time-dependent manner,
reflecting the enhanced protein synthesis of p180 in the presence of
p68 as found previously (23). When pI-pol.
expression vector was transfected, the extracts exhibited the same level of
polymerase activity as the extracts containing coexpressed p180 and p68
(Fig. 1B). Therefore, we confirmed that p180-p68 was expressed
efficiently as a functional heterodimer complex by using pI-pol.
.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
The cDNA expression system with IRES-derived expression
plasmids. (A) Constructs of IRES-derived plasmids used for the
expression of two subunits simultaneously. (B) Time course of DNA
polymerase activity in the cell extracts transfected with various
constructs. COS-1 cells were transfected with pcDEB ( ), pSR 180
alone ( ), pSR 180 and pSR 68 ( ), or pI-pol. ( );
incubated for 24, 48, and 72 h; and then lysed with a solution
containing 20 mM potassium phosphate (pH 7.5), 300 mM KCl, 10%
glycerol, 0.05% Triton X-100, and 0.1 mM EDTA. After centrifugation,
the supernatant was assayed to estimate DNA polymerase activity. Five
micrograms of protein of COS-1 extracts was incubated with
[3H]dTTP and DNase I-activated calf thymus DNA for 1 h at 37°C, and incorporation of radioactive material was measured.
(C) Subcellular distribution of transiently overexpressed subunits of
DNA polymerase -primase complex. pSR 68 (a), pSR 180 (b),
pSR 180 and pSR 68 (c), pI-pol. (d), pSR 54 (e), pSR 46-HA
(f), pSR 54 and pSR 46-HA (g), or pI-pri(HA) (h) was transfected
into COS-1 cells, and the proteins expressed were detected by
immunofluorescence analysis with anti-p68 (a, c, and d) or anti-p54 (e,
g, and h) polyclonal antibodies and FITC-conjugated anti-rabbit IgG
antibody or SJK132-20 anti-p180 monoclonal antibody (b, c, and d) or
12CA5 anti-HA tag antibody (f, g, and h) and Texas red-conjugated
anti-mouse IgG antibody. DNA was stained blue by Hoechst 33258, and
pictures were merged.
|
|
To determine the subcellular distribution of the subunits transiently
coexpressed by pI-pri and pI-pol.
, immunohistochemical experiments
were carried out. As we reported previously, p180, p68, and p46 were
predominantly localized in the cytoplasm when expressed individually
(Fig. 1C, a, b, and f) (23, 24). Only p54 was localized in
the nucleus (Fig. 1C, e) (24). In contrast, when p46 and p54
or p68 and p180 were coexpressed, each coexpressed subunit was
exclusively colocalized in the nucleus (Fig. 1C, c and g). Thus,
specific interactions between the four subunits of DNA polymerase
,
namely, between p46 and p54 and between p68 and p180, result in
translocation of all of these subunits into the nucleus. When
pI-pol.
or pI-pri(HA) was transfected, the subunits expressed by
each vector were predominantly colocalized in the nucleus (Fig. 1C, d
and h). Thus, the IRES-derived expression plasmids produced
heterodimers in the nucleus efficiently.
Simultaneous expression of three or four of the subunits of DNA
polymerase
in COS-1 cells.
Using one of the IRES-derived
plasmids (pI-pol.
and pI-pri) along with a vector expressing only a
single subunit (pSR
46, pSR
54, pSR
68, or pSR
180), we were
able to study the expression of three subunits at the same time. The
expressed proteins were analyzed by Western blotting and by
immunohistochemical techniques as described for Fig.
2A and B. Three or four subunits were
coexpressed simultaneously by using specific combinations of the
IRES-derived plasmids and single-subunit expression vectors (Fig. 2A).
When p180, p68, and p54 were expressed together, all of the subunits were colocalized in the nucleus (Fig. 2B, a to c). When the
amino-terminal NLS of p54 was disrupted by site-directed mutagenesis
(24), the nuclear localization of these three subunits did
not change (Fig. 2B, d to f). These results suggested that these three
subunits were assembled into a trimeric complex in the cytoplasm and
that the complex was then translocated into the nucleus. On the other hand, when p180, p68, and p46 were expressed together, p180-p68 was
localized in the nucleus but p46 remained in the cytoplasm (Fig. 2B, g
to i). When p68, p54, and p46 were expressed together, p54-p46 was
localized in the nucleus but p68 remained in the cytoplasm (Fig. 2B, j
to l). These results indicated that simultaneous expression of either
p180, p68, and p46 or p68, p54, and p46 did not result in the formation
of trimeric complexes in the cytoplasm. Only the dimeric complexes
p180-p68 and p54-p46 containing nuclear-translocation-proficient subunits were translocated into the nucleus, while the nonassembled subunits p46 and p68 remained in the cytoplasm. These observations indicate that DNA polymerase
is assembled by the binding of p46 to
p180-p68 via p54 and by the binding of p68 to p54-p46 via p180.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Coexpression of three or four of the subunits of DNA
polymerase in COS-1 cells. (A) Western blot analysis of transfected
COS-1 extracts. Two, three, or all of the subunits of DNA polymerase
were coexpressed in COS-1 cells. Forty-eight hours after
transfection, the cells were lysed with a solution containing 20 mM
potassium phosphate (pH 7.5), 300 mM KCl, 10% glycerol, 0.05% Triton
X-100, and 0.1 mM EDTA. Ten micrograms of protein from the extract was
subjected to SDS-PAGE followed by Western blot analysis with anti-p46,
anti-p54, anti-p68, and anti-p180 antibodies. To express p180-p54-p46,
an excess amount of pSR 180 was used because the protein level of
p180 decreased considerably in the absence of p68 (23). (B)
Subcellular distribution of three subunits of DNA polymerase coexpressed in COS-1 cells. The subunits shown by green letters were
detected by FITC-conjugated anti-mouse IgG antibodies. The other
subunits, shown by red letters, were visualized by Texas red-conjugated
anti-rabbit IgG antibody. The rightmost panels show nuclear staining by
Hoechst 33258. (C) Coexpression of the four subunits. pI-pol. was
cotransfected with pI-pri or pI-pri(-NLS), which encoded the
nuclear-translocation-deficient primase. Then, the subcellular
distribution of ectopically expressed proteins was determined. p180 was
stained by anti-p180 monoclonal antibody and FITC-conjugated anti-mouse
IgG antibody. p46 was detected by anti-p46 antibody and Texas
red-conjugated anti-rabbit IgG antibody. Nuclear staining with Hoechst
33258 is shown in panels c and f.
|
|
When p180, p54, and p46 were expressed together, unexpected results
were obtained. Although p54 and p46 can translocate as a heterodimer
into the nucleus by virtue of their NLS (Fig. 1C, h), coexpression of
p54-p46 with p180 resulted in localization of p54-p46 in the cytoplasm
(Fig. 2B, m to o). This result suggests that the NLS of primase was
occluded by the presence of p180.
We next undertook coexpression of the four subunits. When pI-pol.
and pI-pri were cotransfected into COS-1 cells, the four subunits were
colocalized in the nucleus (Fig. 2C, a to c). Similarly, when the NLS
of p54 was disrupted by site-directed mutagenesis, the four subunits
were still translocated into the nucleus (Fig. 2C, d to f). Therefore,
in the tetrameric complex, the NLS of p54 would appear to be
dispensable for translocation into the nucleus. These results suggest
that in the cytoplasm the heterodimeric complexes p54-p46 and p180-p68
could form a tetrameric complex, which was then translocated into the nucleus.
Identification of the binding domain of p180 required for the
interaction with p54-p46 by immunohistochemical analysis.
To
verify the effect of p180 on the subcellular distribution of p54-p46, a
series of deletion mutants of p180 containing six-His and T7 tags were
designed as depicted in Fig. 3A and
coexpressed with p54-p46 in COS-1 cells. An alignment of amino acid
sequences of DNA polymerase
from Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Drosophila
melanogaster, Trypanosoma brucei, humans, mice, and
Oryza sativa allowed us to choose domain boundaries for
construction of mutants with deletions (22, 44). The
subcellular distribution of the deletion mutants was determined by
immunodetection with an anti-six-His monoclonal antibody. The
expression of the transiently overexpressed proteins was confirmed by
Western analysis as shown in Fig. 3C. In the presence of six-His-tagged
p180, p54-p46 was predominantly localized in the cytoplasm (Fig. 3B, a
to c). However, when the carboxyl-terminal region of p180 was deleted
(H-
C and H-core), p54-p46 was localized in the nucleus while p180
remained in the cytoplasm (Fig. 3B, g to l). In the case of the
amino-terminal deletion mutants (H-
N), colocalization of p54-p46 and
p180 in the cytoplasm was observed (Fig. 3B, d to f). Thus, when the
carboxyl-terminal region of p180 was truncated, p54-p46 could enter the
nucleus independently of p180, indicating that the carboxyl-terminal
region of p180 is crucial for interaction with p54-p46.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of the p180 domain required for the
interaction with p54-p46. (A) Schematic representation of p180 mutant
constructs. H-p180, H- N, H- C, and H-core indicate full-length
p180 with six-His tag and T7 tag at the amino terminus,
amino-terminally deleted p180 with six-His tag and T7 tag at the amino
terminus, carboxyl-terminally deleted p180 with six-His tag and T7 tag
at the amino terminus, and both amino-terminally and
carboxyl-terminally deleted p180 with six-His tag and T7 tag at the
amino terminus, respectively. H-Zn, which contains only
carboxyl-terminal putative zinc finger regions, is also shown for the
experiments shown in Fig. 4. The seven highly conserved regions of
class B DNA polymerases are indicated by blue boxes with roman numerals
(I to VII) (32, 43). The five conserved regions in
eukaryotic DNA polymerase are indicated by light blue boxes with
letters (A to E) (22). Putative zinc finger motifs and a
putative NLS (23) are depicted by yellow boxes and a red
line, respectively. Six-His and T7 tags are shown by solid boxes.
Numbers indicate amino acid positions of p180. (B) Subcellular
distribution of ectopically expressed p180 mutants and p54-p46. H-p180
(a to c), H- N (d to f), H- C (g to i), and H-core (j to l) were
cotransfected with pI-pri into COS-1 cells, and the expressed proteins
were detected simultaneously by indirect immunofluorescence analysis
with anti-p54 polyclonal antibody and Texas red-conjugated anti-rabbit
IgG antibody or anti-six-His monoclonal antibody and FITC-conjugated
anti-mouse IgG antibody. Nuclear staining with Hoechst is shown in the
rightmost panels. (C) Western blot analysis of transiently expressed
p180 mutants. Extracts (10 µg of protein) were subjected to SDS-PAGE
followed by Western blot analysis with anti-six-His monoclonal
antibody. Lane numbers correspond to p180 mutant constructs shown in
panel A. (D) Coimmunoprecipitation assay. Extracts (50 µg of protein)
containing p54-p46 were mixed with a total of 250 µg of the extracts
described for panel C (75 µg of the extracts containing H-p180, 75 µg of the extracts containing H- N, 75 µg of the extracts
containing H- C, and 25 µg of the extracts containing H-core),
incubated on ice for 2 h, and immunoprecipitated with (lane 7) or
without (lane 6) anti-p46 antibody and protein G-Sepharose. One-third
of the precipitates were subjected to Western blot analysis with
anti-six-His monoclonal antibody. Lane 5 contains 5 µg of the input
proteins. Ab, antibody; IP, immunoprecipitation.
|
|
To verify the interaction between the carboxyl-terminal region of p180
and p54-p46, immunoprecipitation analysis was carried out. Whole-cell
extracts of cells transfected with the p180 mutant constructs were
mixed, incubated with the extract containing p54-p46 heterodimer, and
immunoprecipitated with anti-p46 antibody, and coprecipitated proteins
were detected by Western blot analysis with the anti-six-His tag
antibody. As shown in Fig. 3C, it is clear that full-length p180 and
H-
N were coprecipitated with p46, while H-
C and H-core were not.
These results are consistent with the immunohistochemical
characterization which indicated that the carboxyl-terminal region of
p180 (residues 1235 to 1485) is essential for its interaction with
p54-p46.
Identification of the interaction domain between p180 and p68.
To investigate the domain of p180 required for interaction with p68,
coprecipitation analysis was performed. In contrast to the p180 and
p54-p46 interaction, singly expressed p180 in COS-1 cells did not form
a complex with singly expressed p68 after mixing of the two extracts.
However, when the two subunits were coexpressed in COS-1 cells, we
found that p180 and p68 were tightly associated with each other and
formed a complex, as shown in Fig. 4A. To determine the domain of p180 necessary for the interaction with p68,
deletion mutants of p180 were constructed. Since all of the constructs
described in the previous report (23) were capable of
interacting with p68, further deletion mutants were designed, and their
interaction with p68 was studied by pull-down analysis. Cell extracts
from cells coexpressing the deletion mutants and p68 were precipitated
with cobalt-chelating Sepharose (TALON), and coprecipitation of p68 was
detected by Western blot analysis. When the carboxyl-terminal region of
p180 was deleted (H-
C and H-core), p68 did not coprecipitate, as
shown in Fig. 4B. In contrast, when H-
N was cotransfected with p68,
p68 precipitated with H-
N as well as with full-length p180.
Moreover, the carboxyl-terminal region alone (H-Zn, residues 1235 to
1465; shown in Fig. 3A, row 5) could bind tightly to p68. Thus, the
carboxyl-terminal region of p180 is both necessary and sufficient for
binding to p68.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of the p180 domain required for the
interaction with p68. (A) Extracts containing singly expressed p68 (50 µg of protein) were mixed in the presence (lanes 1 and 4) or absence
(lanes 2 and 5) of singly expressed six-His-tagged p180 (50 µg of
protein), incubated on ice for 1 h, pulled down with
cobalt-chelating Sepharose (TALON), and then eluted with a solution
containing 200 mM imidazole. Extracts containing coexpressed H-p180 and
p68 (50 µg of protein) were also pulled down in parallel (lanes 3 and
6). One-third of the eluates were subjected to Western blot analysis
with anti-p180 and anti-p68 antibodies (right panel). The left panel
shows results with 5 µg of the input proteins. TL, translation. (B)
Coprecipitation assay with p68 and six-His- and T7-tagged p180 mutants.
Extracts containing coexpressed p68 and various mutants of the six-His-
and T7-tagged p180 (50 µg of protein) were coprecipitated with
cobalt-chelating Sepharose and eluted with 200 mM imidazole. One-third
of the eluates were subjected to SDS-PAGE followed by Western blot
analysis with anti-T7 tag monoclonal antibody (upper panels) or
anti-p68 polyclonal antibody (lower panels). Precipitated protein
levels of p68 were quantitated by densitometric scanning of the blot
and are presented at the bottom as relative values compared to that of
p68 coprecipitated with H-p180. (C) H-Zn can be expressed as a soluble
form in the presence of p68. The carboxyl-terminal domain containing
two zinc finger motifs was expressed alone (lanes 1 and 4) or in the
presence of p54-p46 (lanes 2 and 5) or p68 (lanes 3 and 6). Transfected
cells were lysed with a solution containing 20 mM potassium phosphate
(pH 7.5), 300 mM KCl, 10% glycerol, 0.05% Triton X-100, and 0.1 mM
EDTA, and insoluble materials were separated by centrifugation.
Precipitates were resuspended in Laemmli sample buffer (17).
Ten micrograms of protein of the soluble fraction and 10% of the
corresponding insoluble fractions were subjected to SDS-PAGE followed
by Western blotting with anti-six-His, anti-p68, and anti-p46
antibodies. (D) Coimmunoprecipitation assay with H-Zn-p68 and
HA-tagged p46-p54. Fifty micrograms of the extracts containing
coexpressed H-Zn-p68, coexpressed p54-HA-tagged p46, and vector
control was mixed as shown on the top of the figure and
immunoprecipitated (IP) with anti-p46 antibody. One-third of the
precipitates were subjected to Western blot analysis with anti-T7,
anti-HA, and anti-p68 antibodies. Lane 1 contains 6 µg of the
extracts containing H-Zn-p68 and HA-tagged p46-p54 as input
proteins.
|
|
In the course of our cDNA expression study, we noticed that the
carboxyl-terminal fragment of p180 (H-Zn) could be expressed in a
soluble form only in the presence of p68. Singly expressed H-Zn or H-Zn
coexpressed with p54-p46 was scarcely detectable in the soluble
fraction (Fig. 4C). These results suggested that the interaction
between p68 and the carboxyl-terminal region of p180 changes the
conformation of p180, so that both are expressed as a stable complex.
Since singly expressed p180 cannot form a complex with p68, the
conformational change of the carboxyl-terminal region most likely
occurs in the presence of p68. An alternative hypothesis is that the
carboxyl-terminal region of p180 either is very hydrophobic or contains
very hydrophobic regions that reduce the solubility of this region.
Upon binding to p68, these hydrophobic residues will become part of the core.
Since we obtained soluble H-Zn-p68 subcomplex by cotransfection into
COS-1 cells, we undertook coimmunoprecipitation analysis with H-Zn-p68
and p54-p46 to verify that the carboxyl-terminal region of p180 alone
is responsible for interactions with p68 and p54-p46. Coexpressed
H-Zn-p68 and coexpressed p54 and HA-tagged p46 were mixed for 1 h
and immunoprecipitated with anti-p46 antibody, and coprecipitated
proteins were detected by Western blot analysis with the anti-T7,
anti-HA, and anti-p68 antibodies. As shown in Fig. 4D, H-Zn-p68 was
precipitated with anti-p46 antibody in the presence of p54-p46.
Therefore, we conclude that H-Zn alone can mediate the coprecipitation
of p68 and p54-p46.
Putative zinc finger motifs in the carboxyl-terminal region of p180
are required for the interaction with p68 but not with p54-p46.
The carboxyl-terminal region of p180 contains two zinc finger motifs
which are highly conserved among eukaryotic DNA polymerases including
,
,
, and
(32, 42). To assess the role of these motifs in the formation of the DNA polymerase
complex, we performed mutational analysis of the putative zinc finger motifs by replacing highly conserved cysteine residues in the zinc finger motifs with alanine residues as shown in Fig. 5A. The
interaction between the substitution mutants and p68 or p54-p46 was
assayed by coprecipitation experiments. We demonstrated that
substitution of either one of the two zinc fingers completely abolished
the interaction with p68 (Fig. 5B). In contrast, the mutant proteins
were able to associate with p54-p46 (Fig. 5C). The H-
C construct in
lanes 15 and 20 was used as a negative control for p180 interaction
with p54-p46. Therefore, we conclude that the interaction between p68
and p180 is absolutely dependent upon both of the putative zinc finger motifs, while the p54-p46 interaction occurs independently of the zinc
finger motifs. We confirmed the results of the coprecipitation studies
by an immunohistochemical analysis. When the substitution mutants were
coexpressed with p68, all of the mutants were localized in the
cytoplasm whereas wild-type p180 and p68 were colocalized in the
nucleus. In contrast, p54-p46 was localized in the cytoplasm in the
presence of the substitution mutants or wild-type p180 (data not
shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
The putative zinc finger motifs in the carboxyl-terminal
domain of p180 are required for the interaction with p68 but not with
p54-p46. (A) Schematic representation of p180 mutant constructs. Highly
conserved motifs are depicted as described in the legend to Fig. 3A.
(B) Coprecipitation assay with p68 and six-His- and T7-tagged p180
mutants. Fifty micrograms of the extracts containing p68 alone (lanes 1 and 6), coexpressed p68 and six-His-tagged p180 (lanes 2 and 7), H-AZ
(lanes 3 and 8), H-ZA (lanes 4 and 9), and H-AA (lanes 5 and 10) was
coprecipitated with cobalt-chelating Sepharose and eluted with 200 mM
imidazole. One-third of the eluates were subjected to SDS-PAGE followed
by Western blot analysis with anti-p180 and anti-p68 polyclonal
antibodies (lanes 6 to 10). The left panel contains 10 µg of the
input proteins (lanes 1 to 5). (C) Coimmunoprecipitation assay with
p54-HA-tagged p46 and six-His- and T7-tagged p180 mutants. Fifty
micrograms of the extracts containing coexpressed p54-HA-tagged p46 and
six-His- and T7-tagged p180 (lanes 11 and 16), H-AZ (lanes 12 and 17),
H-ZA (lanes 13 and 18), H-AA (lanes 14 and 19), and H- C (lanes 15 and 20) was immunoprecipitated (IP) with anti-p46 antibody. One-tenth
of the precipitates were subjected to Western blot analysis with
anti-T7 (upper panel of lanes 16 to 20) and anti-HA (lower panel of
lanes 16 to 20) monoclonal antibodies. The left panels contain 5 µg
of the input proteins (lanes 11 to 15).
|
|
Domain of p180 required for DNA polymerase activity.
To
determine the minimal domain required for DNA polymerase activity,
COS-1 cells were transfected with constructs expressing the truncated
p180 listed in Fig. 6A, and extracts were
prepared at 48 h posttransfection. Five micrograms of each extract
was subjected to SDS-PAGE followed by Western blot analysis with
anti-T7 monoclonal antibody. Expression levels of the exogenous
proteins were quantitated by densitometric scanning of the blot and are presented at the bottom of Fig. 6B as relative values compared to that
of the full-length p180 (H-p180). For DNA polymerase activity, 5 micrograms of the extracts from the transfected COS-1 cells was assayed
(Fig. 6C). The activity of the extract from cells transfected with the
vector only indicates the level of endogenous DNA polymerase activity
derived from host cells. DNA polymerase activities due to the
exogenously expressed mutant p180 were obtained from the results of
Fig. 6C by subtracting the endogenous DNA polymerase activity. The
values were further normalized by the relative expression levels of
respective proteins (obtained in Fig. 6B) and indicated as percentages
of the H-p180 activity as shown in Fig. 6D. Interestingly, we were able
to detect polymerase activity for the deletion mutants H-
N and
H-
C. Moreover, polymerase activity could still be detected even when
both regions were deleted (H-core). When the sizes of the deleted
regions were further increased (H-
N400, H-
N600, and
H-
C200), DNA polymerase activity was abolished completely. According
to these results, we conclude that the minimal core domain for
polymerase activity spans residues 330 to 1279 and that the
amino-terminal region (1 to 329) and carboxyl-terminal region (1280 to
1465), including the zinc finger motifs, are dispensable for intrinsic
DNA polymerase activity.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Identification of the minimal core domain required for
DNA polymerase activity. (A) Schematic representation of p180 mutant
constructs. Highly conserved motifs are depicted as described in the
legend to Fig. 3A. (B) Western blotting. COS-1 cells were transfected
with constructs expressing the truncated p180 listed in panel A, and
extracts were prepared at 48 h posttransfection. Five micrograms
of each extract was subjected to SDS-PAGE followed by Western blot
analysis with anti-T7 monoclonal antibody. Expression levels of the
exogenous proteins were quantitated by densitometric scanning of the
blot and are presented at the bottom as relative values compared to
that of the full-length p180 (H-p180). (C) DNA polymerase activity of
transfected COS-1 extracts. Five micrograms of the extracts from the
transfected COS-1 cells was incubated with [3H]dTTP and
DNase I-activated calf thymus DNA for 1 h at 37°C, and the
incorporated radioactivity was measured. The activity of the extract
from cells transfected with the vector only indicates the level of
endogenous DNA polymerase activity derived from host cells. (D) DNA
polymerase activities due to the exogenously expressed mutant p180 were
obtained from the results shown in panel C by subtracting the
endogenous DNA polymerase activity. The values were further normalized
by the relative expression levels of respective proteins (obtained for
panel B) and indicated as percentages of the H-p180 activity.
|
|
Detection of free p68 and free p54-p46 in NIH 3T3 extracts.
To
gain insights into the endogenous profile of the mouse DNA polymerase
-primase complex, Western blot analysis was performed with
antibodies specific for each subunit. The availability of antibodies
against each subunit of DNA polymerase
enabled us to determine the
endogenous level of each subunit in the cell. Whole-cell extracts of
NIH 3T3 cells extracted with 0.3 M KCl were fractionated by 15 to 35%
glycerol gradient centrifugation and subjected to SDS-PAGE followed by
Western blot analysis. In the logarithmically growing cultures of NIH
3T3 cells, less than 5% of p180 was associated with the insoluble
fraction after extraction with 0.3 M KCl as determined by Western blot
analysis with anti-p180 antibody (data not shown). As shown in Fig.
7A, four subunits cosedimented together
around fractions 25 to 28, indicating the presence of the tetrameric
DNA polymerase
complex. Interestingly, we also observed an
additional signal for p68 in fractions 12 to 16. Singly expressed p68
in COS-1 cells sedimented to a similar position on the gradient
(23). Thus, p68 is present in two forms in NIH 3T3 cells: as
a monomer and as part of the tetrameric complex. A proportion of the
p54 and p46 subunits also sedimented as a broad peak in fractions 20 to
29, which were distinct from the fractions (25 to 28) containing the
tetrameric complex. The Western blot signals were quantified by
densitometry, and the results are presented in Fig. 7B. p54 and p46
subunits sedimented as a peak (fractions 20 to 23) in addition to the
tetrameric peak (fractions 25 to 28), strongly suggesting that a
subcomplex of primase exists in NIH 3T3 cells. We observed similar
patterns in other cell lines, including FM3A, CV-1, and COS-1
cells (data not shown).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 7.
Fractionation of the endogenous four subunits of DNA
polymerase in NIH 3T3 cells by glycerol density gradient
centrifugation. Lysates of NIH 3T3 cells (200 µg of protein) were
fractionated by 15 to 35% glycerol gradient sedimentation. The
fractions were subjected to Western blotting. Protein markers run in a
parallel gradient were chicken lysozyme (2.1 S), bovine serum albumin
(4.4 S), yeast alcohol dehydrogenase (7.4 S), and bovine catalase (11.3 S). (A) Western blotting with antibodies specific for each subunit. (B)
Densitometric analyses. Western blots were examined by scanning
densitometry, and the results are presented as percentages of the
maximum intensity of each signal.
|
|
 |
DISCUSSION |
In this report, we designed a eukaryotic polycistronic cDNA
expression system to investigate the subunit-subunit interactions and
domain structures of DNA polymerase
. We transfected three or all of
the subunits simultaneously in COS-1 cells, determined their
subcellular distribution in detail, and uncovered how the subunits are
assembled into the tetrameric complex. Moreover, we identified the
minimal domains of p180 required for DNA polymerase activity and for
interaction with p68 and p54-p46 by deletion and substitution mutation
analyses. Taken together, these results allow us to present for the
first time a model of not only DNA polymerase
subunit assembly but
also the steps leading up to complex formation. Certain elements of the
complex formation of DNA polymerase
may also be shared by other
eukaryotic replicative DNA polymerases.
Although multisubunit complexes can be coexpressed in cultured cells by
simply transfecting constructs with mixtures of plasmids expressing a
single subunit, the simultaneous expression of two or three subunits at
a constant level in one cell has been hard to obtain. We overcame this
problem by using IRES-derived expression plasmids, which allowed the
expression of two open reading frames under the control of a single
promoter and a single poly(A) signal in a polycistronic manner. We used
the IRES derived from the poliovirus type 1 Mahoney strain. This IRES
has been shown to possess strong activity for cap-independent
translation and to be less dependent on the distance between the IRES
and the initiating methionine for translation (7). This
expression system enabled us to determine the subcellular distribution
of the four subunits of DNA polymerase
in detail.
The subcellular distribution of various combinations of two, three, or
four of the subunits of DNA polymerase
is summarized in Fig.
8A. We previously found that specific
associations between p180 and p68 and between p54 and p46 were
essential for their translocation into the nucleus (Fig. 8A, a and b)
(23, 24). Here, we have extended these findings by
coexpressing three or even four of the subunits simultaneously by using
polycistronic expression plasmids (Fig. 8A, c to g). According to these
results, we found that p46 interacts with p180-p68 via p54 and that p68 interacts with p54-p46 via p180. As shown in Fig. 8A, f, p54-p46 was
localized in the cytoplasm in the presence of p180, although p54-p46
alone can enter the nucleus by virtue of the NLS. In the absence of the
carboxyl-terminal region of p180, p54-p46 was translocated into the
nucleus independently of the p180 mutants, indicating that three
subunits form a trimer through the carboxyl-terminal region of p180.
Although our coexpression system allowed us to characterize the
interaction between p54 and p180 successfully, the reason why the
p180-p54-p46 heterotrimer is localized in the cytoplasm remains
unclear. One possibility is that the NLS of p54 is located at the
interface of the binding site between p54 and p180, which could result
in inactivation of the NLS of p54 in the p180-p54-p46 heterotrimer.
Alternatively, inactivation of the NLS of p54 might result from
conformational changes in p54 induced by p180. Since the NLS of p54 has
been shown to possess strong activity as an authentic NLS and to be
resistant to conformational changes such as those resulting from
deletions and gene fusions (24), we prefer the former
possibility. However, further experiments will be needed to clarify
these points.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 8.
Schematic representations of the results of the present
study. (A) Model for the nuclear transport pathway of mouse DNA
polymerase -primase complex which shows the subcellular distribution
of two, three, or four of the coexpressed subunits of DNA polymerase
. (B) Organization of the subunit assembly of DNA polymerase .
The p180 molecule can be divided into three domains. The first is the
amino-terminal domain (residues 1 to 329), which is dispensable for
polymerase activity and subunit assembly. The second is the core domain
(residues 330 to 1279), which is sufficient for DNA polymerase
activities such as template recognition, substrate binding, and the
phosphoryl transfer reaction. The third is the carboxyl-terminal domain
(residues 1235 to 1465), which is dispensable for polymerase activity
but required for assembly of the complex. p68 binds directly to the
putative zinc finger motifs in the carboxyl-terminal domain, whereas
p54-p46 associates with the carboxyl-terminal domain independently of
the zinc finger motifs. The interaction between p46 and p180 is
mediated by p54.
|
|
In NIH 3T3 cells, we found significant amounts of free p68 and free
p54-p46 in addition to the tetrameric complex (Fig. 7). The presence of
free p68 and free p54-p46 suggests the following series of events in
the assembly of the subunit structure of the tetrameric complex. In the
absence of p180, free p68 is localized in the cytoplasm, where it
awaits p180 protein synthesis (Fig. 8A, c). Once p180 is synthesized,
p68 rapidly associates with p180 and is translocated into the nucleus,
where it binds to the p54-p46 heterodimer (Fig. 8A, e). Alternatively,
all of the binding steps could take place in the cytoplasm before
translocation of the tetrameric complex into the nucleus. Although
there exists no evidence in favor of either of these hypotheses, we
prefer the latter one, as the NLS-disrupted p54-p46 heterodimer was
found to form a complex with p180-p68 in the cytoplasm before being translocated into the nucleus (Fig. 2C). To determine the limiting step
in tetramer assembly, it will be necessary to characterize the
transcriptional regulation of each subunit, since the levels of newly
synthesized p180 and p54-p46 appear to be critical for complex
formation. Recently, it was reported that DNA polymerase
recruitment to chromatin during G1 is independent of
cdc6-dependent prereplicative complex formation (10). In
addition, it was found that loading of DNA polymerase
onto
chromatin is dependent on cdc45 (21). Thus, it is becoming
clear that loading of DNA polymerase
onto chromatin is a crucial
step for the initiation of DNA replication. However, for the moment,
the relationship between chromatin loading and nuclear translocation of
DNA polymerase
is still unclear. Therefore, further
characterization of complex formation and nuclear translocation of DNA
polymerase
should help us to understand the precise role of the
tetrameric complex of DNA polymerase
in the nucleus during
G1 phase.
To extract endogenous DNA polymerase
from NIH 3T3 cells, we
prepared whole-cell extracts with 0.3 M KCl. Although 0.3 M KCl
extraction has no effect on the assembly of the tetramer of DNA
polymerase
under in vitro conditions, we cannot rule out the
possibility that 0.3 M KCl extraction changes in the intracellular environment. To determine physiological functions of an endogenous single subunit or a subcomplex from four subunits of DNA polymerase
, further experiments will be needed.
Taking advantage of cDNA expression systems in mammalian cultured
cells, we coexpressed several mutant forms of p180 with p68 and found
that the carboxyl-terminal region of p180 is both essential and
sufficient for interaction with p68. Moreover, the putative zinc finger
motifs were shown to be essential for this interaction. Thus, these
results, as well as the immunohistochemical analysis described above,
allow us to present a model for the organization of the DNA polymerase
complex in Fig. 8B. According to this model, p46 associates with
the p54 bound to the carboxyl-terminal region of p180, and p68
interacts with the putative zinc finger motifs of p180 independently of
p54-p46. All these interactions depend on the carboxyl-terminal region
of p180. Since enzymatic activity was independent of the other subunits
and involved only the core domain, this model is consistent with the
spatial arrangement between the core domain and the nonenzymatic
subunits. Hence, we can divide the p180 molecule into three domains:
(i) the amino-terminal domain (residues 1 to 329), which is dispensable
for both polymerase activity and assembly with the other subunits; (ii)
the core domain (residues 330 to 1279), which is capable of all the
reactions involved in polymerase activity, such as template
recognition, substrate binding, and phosphoryl transfer reaction; and
(iii) the carboxyl-terminal domain (residues 1235 to 1465), which is dispensable for polymerase activity but essential for assembly of the
complex. Recently, crystallographic studies of DNA polymerase gp43 of
bacteriophage RB96, which is a member of the class B DNA polymerase
family, showed that the central region of this protein containing the
highly conserved motifs had a U or hand-like shape (41).
Thus, it is tempting to speculate that the core domain of mouse DNA
polymerase
also folds into a structure like that of gp43.
Identification of the minimal core domain in this study should
contribute to the structural characterization of class B DNA polymerase
in higher eukaryotes.
Recently, Dua et al. reported that the carboxyl-terminal region
containing the zinc finger motifs of DNA polymerase II in S. cerevisiae is essential for the interaction with DPB2
by two-hybrid analysis (11). In addition, it has been
reported that the second-largest subunits of DNA polymerases
,
,
and
share conserved motifs, implying that these subunits belong to
a superfamily (2, 20). Taken together, these observations
suggest that the putative zinc finger conserved among eukaryotic class
B DNA polymerases is the binding site of the second-largest subunit,
which is also conserved among eukaryotic class B DNA polymerases.
Characterization of the subunit assembly of DNA polymerase
was
reported previously by Copeland and Wang (9) and Longhese et
al. (19). Using the baculovirus expression system, Copeland and Wang showed that in the absence of p54, p46 cannot be copurified with p180, which suggested that p54 is important for the interaction between p46 and p180. Using temperature-sensitive mutants of DNA primase in S. cerevisiae, Longhese et al. showed that the
protein level of purified p46 decreases in proportion to that of p54, suggesting that p54 is essential for the interaction of p46 with p180.
All of these results are consistent with our above results showing that
p46 binds to p180 through p54. Our observations extend their findings
by showing that the carboxyl-terminal region of p180 is important for
the physical interaction with p54 and confirm the notion that p54
functions as the crucial tethering point of the complex. In addition,
we found that p68 is not capable of interacting with primase in vivo.
The interaction between p68 and primase has not been studied to date.
Although the interactions within the multisubunit complex are central
to our understanding of the molecular mechanism of a wide range of
enzymes, reconstitution of such complexes from individually purified
proteins has been difficult to accomplish in many cases. For example,
the Ku antigen heterodimer can be assembled into a complex only when
the two subunits are coexpressed simultaneously in insect cells
(27). Trimeric RP-A was assembled efficiently only when the
three subunits were coexpressed in bacteria or insect cells (14,
33). Coexpression of the subunits of the yeast origin recognition
complex was essential for the formation of a stable complex (5,
18). Thus, expression of subunits of protein complexes through
transcription-coupled translation has been considered to be crucial for
their stability. Therefore, in this respect our cDNA expression system
is ideal, as it allows the coordinated transcription-coupled
translation in vivo of the subunits of multisubunit complexes. Thus,
our system should be a useful tool to define the assembly of
multisubunit complexes such as the origin recognition complex, the
minichromosomal maintenance complex, RF-C, and other multisubunit DNA
polymerases in vivo.
 |
ACKNOWLEDGMENTS |
We thank Yusaku Nakabeppu for providing the pcDEB
expression
vector, Shigeo Ohno for the pSRHisABC expression plasmids, Akio Nomoto
for IRES, and Tetsu Akiyama for NIH 3T3 cells. We also thank Kaoru
Sugasawa for helpful discussions and Yasue Ichikawa at the Biodesign
DNA sequencing facility in the Institute of Physical and Chemical
Research (RIKEN) for DNA sequencing.
This work was supported by grants from the Ministry of Education,
Science, Sports, and Culture of Japan and a special grant for promotion
of research from RIKEN and the Biodesign Research Program of
RIKEN. T.M. was a special postdoctoral researcher of RIKEN.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Molecular and Cellular Biology, Osaka University, 1-3 Yamada-oka,
Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-7975. Fax:
81-6-6877-9382. E-mail: fhanaoka{at}imcb.osaka-u.ac.jp.
 |
REFERENCES |
| 1.
|
Akimoto, K.,
R. Takahashi,
S. Moriya,
N. Nishioka,
J. Takayanagi,
K. Kimura,
Y. Fukui,
S. Osada,
K. Mizuno,
S. Hirai,
A. Kazlauskas, and S. Ohno.
1996.
EGF or PDGF receptors activate atypical PKC through phosphatidylinositol 3-kinase.
EMBO J.
15:788-798[Medline].
|
| 2.
|
Aravind, L., and E. V. Koonin.
1998.
Phosphoesterase domains associated with DNA polymerases of diverse origins.
Nucleic Acids Res.
26:3746-3752[Abstract/Free Full Text].
|
| 3.
|
Baker, T. A., and S. P. Bell.
1998.
Polymerases and the replisome: machines within machines.
Cell
92:295-305[Medline].
|
| 4.
|
Bambara, R. A.,
R. S. Murante, and L. A. Henricksen.
1997.
Enzymes and reactions at the eukaryotic DNA replication fork.
J. Biol. Chem.
272:4647-4650[Free Full Text].
|
| 5.
|
Bell, S. P.,
J. Mitchell,
J. Leber,
R. Kobayashi, and B. Stillman.
1995.
The multidomain structure of Orc1p reveals similarity to regulators of DNA replication and transcriptional silencing.
Cell
83:563-568[Medline].
|
| 6.
|
Bensch, K. G.,
S. Tanaka,
S.-Z. Hu,
T. S.-F. Wang, and D. Korn.
1982.
Intracellular localization of human DNA polymerase with monoclonal antibodies.
J. Biol. Chem.
257:8391-8396[Abstract/Free Full Text].
|
| 7.
|
Borman, A. M.,
J.-L. Bailly,
M. Girard, and K. M. Kean.
1995.
Picornavirus internal ribosome entry segments: comparison of translation efficiency and the requirements for optimal internal initiation of translation in vitro.
Nucleic Acids Res.
23:3656-3663[Abstract/Free Full Text].
|
| 8.
|
Copeland, W. C., and T. S.-F. Wang.
1991.
Catalytic subunit of human DNA polymerase overproduced from baculovirus-infected insect cells. Structural and enzymological characterization.
J. Biol. Chem.
266:22739-22748[Abstract/Free Full Text].
|
| 9.
|
Copeland, W. C., and T. S.-F. Wang.
1993.
Enzymatic characterization of the individual mammalian primase subunits reveals a biphasic mechanism for initiation of DNA replication.
J. Biol. Chem.
268:26179-26189[Abstract/Free Full Text].
|
| 10.
|
Desdouets, C.,
C. Santocanale,
L. S. Drury,
G. Perkins,
M. Foiani,
P. Plevani, and J. F. X. Diffley.
1998.
Evidence for a Cdc6p-independent mitotic resetting event involving DNA polymerase .
EMBO J.
17:4139-4146[Medline].
|
| 11.
|
Dua, R.,
D. L. Levy, and J. L. Campbell.
1998.
Role of the putative zinc finger domain of Saccharomyces cerevisiae DNA polymerase in DNA replication and the S/M checkpoint pathway.
J. Biol. Chem.
273:30046-30055[Abstract/Free Full Text].
|
| 12.
|
Foiani, M.,
G. Lucchini, and P. Plevani.
1997.
The DNA polymerase -primase complex couples DNA replication, cell-cycle progression and DNA-damage response.
Trends Biochem. Sci.
22:424-427[Medline].
|
| 13.
|
Gibbs, P. E.,
W. G. McGregor,
V. M. Maher,
P. Nisson, and C. W. Lawrence.
1998.
A human homolog of the Saccharomyces cerevisiae REV3 gene, which encodes the catalytic subunit of DNA polymerase .
Proc. Natl. Acad. Sci. USA
95:6876-6880[Abstract/Free Full Text].
|
| 14.
|
Henricksen, L. A.,
C. B. Umbricht, and M. S. Wold.
1994.
Recombinant replication protein A: expression, complex formation, and functional characterization.
J. Biol. Chem.
269:11121-11132[Abstract/Free Full Text].
|
| 15.
|
Ito, W.,
H. Ishiguro, and Y. Kurosawa.
1991.
A general method for introducing a series of mutations into cloned DNA using the polymerase chain reaction.
Gene
102:67-70[Medline].
|
| 16.
|
Izumi, M.,
H. Miyazawa,
S. Harakawa,
F. Yatagai, and F. Hanaoka.
1994.
Identification of a point mutation in the cDNA of the catalytic subunit of DNA polymerase from a temperature-sensitive mouse FM3A cell line.
J. Biol. Chem.
269:7639-7644[Abstract/Free Full Text].
|
| 17.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 18.
|
Lee, D. G., and S. P. Bell.
1997.
Architecture of the yeast origin recognition complex bound to origins of DNA replication.
Mol. Cell. Biol.
17:7159-7168[Abstract].
|
| 19.
|
Longhese, M. P.,
L. Jovine,
P. Plevani, and G. Lucchini.
1993.
Conditional mutations in the yeast DNA primase genes affect different aspects of DNA metabolism and interactions in the DNA polymerase -primase complex.
Genetics
133:183-191[Abstract].
|
| 20.
|
Mäkiniemi, M.,
H. Pospjech,
S. Kilpeläinen,
M. Jokela,
M. Vihinen, and J. E. Syväoja.
1999.
A novel family of DNA-polymerase-associated B subunits.
Trends Biochem. Sci.
24:14-16[Medline].
|
| 21.
|
Mimura, S., and H. Takisawa.
1998.
Xenopus Cdc45-dependent loading of DNA polymerase onto chromatin under the control of S-phase cdk.
EMBO J.
17:5699-5707[Medline].
|
| 22.
|
Miyazawa, H.,
M. Izumi,
S. Tada,
R. Takada,
M. Masutani,
M. Ui, and F. Hanaoka.
1993.
Molecular cloning of the cDNAs for the four subunits of mouse DNA polymerase -primase complex and their gene expression during cell proliferation and the cell cycle.
J. Biol. Chem.
268:8111-8122[Abstract/Free Full Text].
|
| 23.
|
Mizuno, T.,
N. Ito,
M. Yokoi,
A. Kobayashi,
K. Tamai,
H. Miyazawa, and F. Hanaoka.
1998.
The second-largest subunit of the mouse DNA polymerase -primase complex facilitates both production and nuclear translocation of the catalytic subunit of DNA polymerase .
Mol. Cell. Biol.
18:3552-3562[Abstract/Free Full Text].
|
| 24.
|
Mizuno, T.,
T. Okamoto,
M. Yokoi,
M. Izumi,
A. Kobayashi,
T. Hachiya,
K. Tamai,
T. Inoue, and F. Hanaoka.
1996.
Identification of the nuclear localization signal of mouse DNA primase: nuclear transport of p46 subunit is facilitated by interaction with p54 subunit.
J. Cell Sci.
109:2627-2636[Abstract].
|
| 25.
|
|