Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8083-8093, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Telomere-Telomere Recombination Is an Efficient
Bypass Pathway for Telomere Maintenance in Saccharomyces
cerevisiae
Shu-Chun
Teng and
Virginia A.
Zakian*
Department of Molecular Biology, Princeton
University, Princeton, New Jersey 08544
Received 24 May 1999/Returned for modification 29 June
1999/Accepted 25 August 1999
 |
ABSTRACT |
Many Saccharomyces telomeres bear one or more copies of
the repetitive Y' element followed by ~350 bp of telomerase-generated C1-3A/TG1-3 repeats. Although most cells
lacking a gene required for the telomerase pathway die after 50 to 100 cell divisions, survivors arise spontaneously in such cultures. These survivors have one of two distinct patterns of telomeric DNA (V. Lundblad and E. H. Blackburn, Cell 73:347-360, 1993). The more common of the two patterns, seen in type I survivors, is tandem amplification of Y' followed by very short tracts of
C1-3A/TG1-3 DNA. By determining the structure
of singly tagged telomeres, chromosomes in type II survivors were shown
to end in very long and heterogeneous-length tracts of
C1-3A/TG1-3 DNA, with some telomeres having
12 kb or more of C1-3A/TG1-3 repeats.
Maintenance of these long telomeres required the continuous presence of
Rad52p. Whereas type I survivors often converted to the type II
structure of telomeric DNA, the type II pattern was maintained for at
least 250 cell divisions. However, during outgrowth, the structure of
type II telomeres was dynamic, displaying gradual shortening as well as
other structural changes that could be explained by continuous gene
conversion events with other telomeres. Although most type II survivors
had a growth rate similar to that of telomerase-proficient cells, their
telomeres slowly returned to wild-type lengths when telomerase was
reintroduced. The very long and heterogeneous-length telomeres
characteristic of type II survivors in Saccharomyces are
reminiscent of the telomeres in immortal human cell lines and tumors
that maintain telomeric DNA in the absence of telomerase.
 |
INTRODUCTION |
Telomeres, the protein-DNA
structures found at the natural ends of eukaryotic chromosomes, are
required to protect chromosomes from degradation and end-to-end fusion
and to facilitate their complete replication. In most organisms,
telomeric DNA consists of a short, tandemly repeated sequence that has
clusters of G residues in the strand that runs 5' to 3' toward the
chromosome end. For example, Saccharomyces chromosomes end
in ca. 350 ± 75 bp of C1-3A/TG1-3 DNA
(see Fig. 1A). In addition, many eukaryotes have middle repetitive DNA
elements or telomere-associated (TA) sequences immediately internal to
the simple repeats. In S. cerevisiae, there are two such
sequences, X and Y'. X is a heterogeneous sequence found at virtually
all telomeres (25). Y' is found in one to four tandem
copies, immediately internal to the
C1-3A/TG1-3 repeats, on about two-thirds of yeast telomeres (10, 48). There are two classes of Y'
elements, Y'-short and Y'-long, with the 5.2-kb Y'-short differing from the 6.7-kb Y'-long by a 1.5-kb internal deletion (25). When Y' is tandemly repeated, a given array consists of all Y'-long or all
Y'-short elements (24). In wild-type cells, Y' sequences can
be lost or duplicated by mitotic recombination between sister chromatids or different chromosome ends (24).
In most eukaryotes, including yeast, telomere replication is carried
out by a special reverse transcriptase, telomerase, that uses a small
C-rich stretch in its RNA component as a template for the extension of
the G-rich strand (reviewed in reference 36). The
genes encoding the RNA (TLC1) (44) and protein
catalytic subunit (EST2) (12, 22) of the
Saccharomyces telomerase have been identified. Several
additional genes, including EST1, which encodes a telomerase
RNA-associated protein (20), and CDC13, which
encodes a protein that binds telomeres in vivo (4), are also
required for telomerase replication in vivo (19, 21, 35).
When any of the yeast genes that are essential for the telomerase
pathway are deleted, the telomere length gradually shortens, chromosome
loss increases, and most cells die (see, for example, reference
28).
Telomerase is not the only mechanism that can maintain telomeric DNA.
In Drosophila, transposition of telomere-specific
retrotransposons is the major pathway for telomere maintenance
(2). Both telomerase and transposition contribute to
telomere maintenance in the green alga Chlorella
(17). Telomere-telomere recombination is thought to be the
sole mechanism for maintaining the repeats at chromosome ends in some
insects, such as the mosquito Anopheles (40) and the dipteran Chironomus (23).
Even in organisms that normally rely on telomerase,
telomerase-independent mechanisms of telomere maintenance exist.
Although most cells in S. cerevisiae (27),
Schizosaccharomyces pombe (34), and
Kluyveromyces lactis (29) that lack the gene for a telomerase component die, survivors arise relatively frequently in
all three organisms. In both S. cerevisiae and K. lactis, generation of survivors requires
RAD52-dependent recombination. In S. cerevisiae (discussed in more detail below), the survivors that have been characterized in detail have very short telomeric
C1-3A/TG1-3 tracts but long tandem arrays of
Y' DNA. In contrast, in K. lactis, survivors have long
tracts of telomeric repeats (29). S. pombe can
escape the telomerase requirement in two ways, by amplification of its
TA repeats, presumably by recombination, or by loss of both TA and
telomeric DNA followed by end-to-end fusions to generate circular
chromosomes (33). Since some human cell lines (7) and tumors (8) that lack telomerase have very long
telomeres, telomerase bypass pathways exist in mammals as well.
The generation of survivors in the absence of telomerase has been
studied most extensively in est1
strains of
Saccharomyces (27). In that pioneering study, the
authors described two types of telomerase-independent survivors based
on the pattern of restriction fragments produced after digestion with
XhoI. Type I survivors had tandem duplication of the
subtelomeric Y' element, whereas type II survivors were suggested to
arise by rearrangement and/or tandem duplication of the distal portion
of Y'. Similar type I and type II survivors were observed in
tlc1, est2, est3, and est4 strains, but the structure of DNA in these strains has not been characterized in detail (19).
We reinvestigated the structure of telomeric DNA in type II survivors
arising in a tlc1 strain. We found that cDNA-mediated recombination of Y' elements to chromosome ends occurred but its frequency was too low to support telomere maintenance in the absence of
telomerase. Likewise, type II survivors did not arise as a result of
chromosome circularization. Rather, type II survivors had very long
terminal tracts of C1-3A/TG1-3 DNA, with some
telomeres being as much as 12 kb longer than telomeres in wild-type
cells. This pattern is similar to the exceptionally long telomeres in
human tumors (8) or cultured cells (7) that lack
telomerase. The maintenance of these elongated telomeres required
Rad52p, but reintroduction of telomerase resulted in the slow loss of
telomeric DNA until all telomeres returned to wild-type lengths.
 |
MATERIALS AND METHODS |
Plasmids, yeast strains, yeast transformations, and genetic
manipulation.
All the yeast operations were performed by standard
methods (39). Yeast strains used in this study were
derivatives of YPH501 (MATa/MAT
ura3-52/ura3-52 lys2-801 amber/lys2-801 amber ade2-101 ochre/ade2-101
ochre trp1
63/trp1
63 his3
200/his3
200 leu2-
1/leu2-
1) (43). YPH501
tlc1::LEU2/TLC1 was constructed by transforming
XhoI-digested pBlue61::LEU2 (kindly
provided by D. Gottschling) (44) into YPH501 and selecting
Leu+ transformants. To complement a tlc1 strain,
a CEN plasmid containing TLC1 was made. The
full-length TLC1 gene plus 1 kb of 5'-flanking and 0.5 kb of
3'-flanking sequences was cloned into pRS317, a vector having
LYS2 as a selectable marker (43).
pRS317TLC1 was transformed into YPH501
tlc1::LEU2/TLC1 and sporulated. YPH
tlc1::LEU2 segregants carrying
pRS317TLC1 were selected by growth on complete medium
lacking leucine and lysine.
The his3AI-5', URA3, and his3AI-3'
were amplified by PCR with, respectively, his3AI-5',5'
(GGACTAGTGCTGCAGCTTTAAATATCG) and his3AI-5',3'
(CCCGCTCGAGATGGTCCTCTAGTACACTC),
URA3,5'
(CCCGCTCGAGCTTTTCAATTCAATTCATC) and
URA3,3' (CTCCCCGCGGGTAATAACTGATATAAT),
and his3AI-3',5'
(CTCCCCGCGGTGTCACTACATAAGAAC) and
his3AI-3',3' (TGCTCTAGATGGTCCTCTAGTACTCTC)
as primers (underlined segments indicate restriction sites) and
pTyhis3AI (45) as a template. To make
pSL300his3AI-URA3-his3AI,
SpeI-XhoI-digested his3AI-5',
XhoI-SacII-digested URA3, and
SacII-XbaI-digested his3AI-3' PCR-amplified fragments were cloned sequentially into the
multiple-cloning sites of pSL300 (6). The fragment for
tagging the 3' untranslated region of the Y' elements with
his3AI-URA3-his3AI was amplified by PCR with 50-bp Y'
sequences that spanned the stop codon of the Y' ORF2 at the ends of the
primers and pSL300his3AI-URA3-his3AI as a template. The
resulting Y'-his3AI-URA3-his3AI-Y' PCR-amplified fragment was transformed into the YPH
tlc1::LEU2 strain carrying pRS317TLC1. Y'-his3AI-URA3-his3AI-tagged
strains were selected on medium lacking uracil. Cells that had lost the
URA3 gene by popout recombination were selected on
5-fluoroorotic acid (5-FOA) (3). Tagging of individual
telomeres by his3AI was confirmed by Southern blot analysis
with Y' and his3AI probes as described below.
Formation of survivors.
To lose the pRS317TLC1
plasmid, cells were grown on yeast extract-peptone-dextrose (YEPD)
plates overnight and then replica plated to
-aminoadipate plates to
identify Lys
cells (11). Single colonies were
restreaked on
-aminoadipate plates. Colonies from
-aminoadipate
plates were then streaked on YEPD plates for single-colony
purification. This procedure was repeated five times on YEPD plates to
allow cellular senescence to occur and survivors to appear. The plates
were incubated at 30°C for 3 days. Survivors first appeared after
four restreaks on YEPD plates. Alternatively, survivors were obtained
by inoculating single colonies from the
-aminoadipate plates into 10 ml of YEPD medium, growing these to stationary phase by incubation at
30°C for 3 days, and then diluting the cultures 1:10,000 into fresh YEPD medium. This procedure was repeated three or four times, and then
the cells were plated on YEPD plates to identify survivor colonies.
Most survivors obtained by the liquid growth method were type II
survivors due to their faster growth compared to type I cells.
To determine if maintenance of survivors required Rad52p, YPH500
(
43) was mated to Y0025 (
12) (from R. Weinberg),
a strain
in which the
RAD52 gene was replaced with
HIS3. One copy of
TCL1 was replaced with
TRP1, and a centromere plasmid containing
URA3 and
RAD52 was introduced by transformation. This strain was
sporulated,
and
tlc1:
TRP1 rad52:
HIS3
spores containing the
RAD52 plasmid were
identified.
Suppressors were isolated as described above, and
then cells that lost
the
RAD52 plasmid were identified by their
ability to grow
on FOA
medium.
DNA preparation, enzyme digestion, Southern blot analysis, and
gel electrophoresis.
Genomic DNA preparation and Southern blot
analysis were performed as previously described (30). S1
nuclease and mung bean nuclease treatments were performed as specified
by the manufacturer (New England BioLabs). Two-dimensional gel
electrophoresis (5) and alkaline denaturing gel
electrophoresis (41) were performed as described previously.
For the Bal31 exonuclease digestion experiment, 70 µg of
genomic DNA from wild-type or type II survivors was digested with 3 U
of Bal31 (New England BioLabs) in a 100-µl final volume. A
14-µl volume of digested DNAs was removed every 10 min, subjected to
phenol-chloroform extraction and ethanol precipitation, and digested
with XhoI. The following probes were used for Southern hybridization: a 270-bp C1-3A fragment, a 1.5-kb
SphI-SalI fragment from the 5' end of Y', a
4.2-kb SalI-XhoI fragment from the middle region
of Y', a 341-bp XhoI-KpnI fragment from the 3'
end of Y', a 586-bp NdeI-NsiI fragment of
HIS3, a 1-kb 5'-EcoRI fragment of
PIF1, and a 350-bp PCR fragment of TLC1. Probes
were randomly labeled with the RTS-Rad prime system (Life Technologies).
For pulsed-field gel electrophoresis (PFGE), yeast chromosomal DNA
blocks were prepared by mixing equal volumes of yeast cells
from
stationary-phase cultures with 1% low-melting agarose (FMC
BioProducts) as described previously (
39). PFGE was
performed
with the contour-clamped homogeneous electric
field-dynamically
regulated CHEF-DR III system (Bio-Rad). Chromosomes
were separated
on a 1% agarose gel in 0.5× Tris-borate-EDTA (TBE)
buffer at 14°C
for 30 h at 6.0 V/cm (200 V) with a 120°
included angle and a
60- to 120-s linear switch time
ramp.
Inverse PCR, cloning and sequencing.
Portions (3 µg) of
genomic DNA from wild-type and two independently isolated type II
survivors with his3AI-tagged telomeres were digested with
XhoI. The XhoI-digested fragments were made blunt
ended by using Klenow enzyme in the presence of all four nucleotides.
Half of each reaction mixture was subjected to Southern blot analysis
to determine the size of the his3AI-tagged
XhoI-digested telomere fragments. The other half of the
reaction mixture was separated on a 0.6% gel. DNAs in the correct size
range to contain the his3AI-tagged XhoI-digested
telomere fragments were gel purified and ligated at 14°C overnight in
a total volume of 200 µl. PCR was carried out with 4 µl of the
ligation mix. The PCR conditions were 30 to 40 cycles of 30 s of
94°C denaturation, 1 min of 69°C annealing, and 3 min of 72°C
extension. The primers were P1 (5'-TAGCGACCAGCCGGAATGCTTGG-3') and P2 (5'-ACGATGTTCCCTCCACCAAAGGTG-3') facing
opposite to each other in his3AI (see Fig. 6). A further PCR
amplification step was performed with nested primers P3
(5'-AGCGCTCGTCATGGAACGCAAAC-3') and P4
(5'-CGAGAGTAGAGGTAGATGTGAGAG-3') facing opposite to each other in the Y' element (see Fig. 6). The PCR-generated products were
cloned into the pCRIITOPO vector (Invitrogene) and transformed into
Escherichia coli STAB2 cells (GIBCO-BRL). Sequencing was performed with cycle-sequencing kits (Epicentre Technologies) with
primers P3 and P4.
 |
RESULTS |
Identification of survivors in a tlc1 strain.
Although most est1 cells die, telomerase-independent
survivors appear after ~50 to 100 generations (27). This
previous study identified two types of survivors in an est1
strain that are distinguishable by their pattern of telomeric
XhoI fragments. There is a single site for XhoI
in Y' (Fig. 1A). The majority (63%) of
est1 survivors (called type I survivors in this paper) have
three major XhoI fragments that hybridize to the 3' Y' probe
(Fig. 1A), which detects the distal portion of Y'. The sizes of these
bands are ~1.3, 6.7, and 5.2 kb. The ~1.3-kb fragment is the
terminal fragment from Y' telomeres and consists mainly of Y' DNA with
a very short stretch of C1-3A/TG1-3 DNA. The
strong hybridization at 6.7 and 5.2 kb is due to tandemly repeated Y'
long and Y' short elements, respectively (Fig. 1A). In contrast,
XhoI digestion of DNA from type II survivors yields many
differently sized XhoI fragments that hybridize to both
C1-3A/TG1-3 and 3' Y' probes but not to
probes from other regions of Y' (27). The pattern of
telomeric XhoI fragments varies among independent type II
survivors. The authors concluded that telomeres of type II survivors
sustain substantial Y' deletions and rearrangements, possibly
containing tandem duplications of the distal segment of Y'
(27).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
(A). Telomeric and subtelomeric structure of S. cerevisiae. C1-3A/TG1-3 DNA is shown in
black. The Y'-long element is between a ~50- to 100-bp internal
stretch of C1-3A/TG1-3 DNA (26,
46) and a 300- to 400-bp terminal
C1-3A/TG1-3 tract. The two open reading
frames in Y' are shown as striped boxes, and their direction of
transcription is indicated by the arrow. The position of the 0.9-kb
his3AI insert is shown as a triangle. The deleted region in
Y'-short is indicated by brackets (25). The 3' end of Y' is
shown as an open rectangle. The solid lines indicate the restriction
fragments used as probes. Restriction sites used for Southern blot
analysis are as follows: P, SphI; S, SalI; E,
EcoRI; X, XhoI; K, KpnI. (B).
Telomeres of tlc1 survivors show two distinct patterns.
Genomic DNA from the wild type, senescing tlc1 cells, two
independent type I tlc1 survivors, and two independent type
II tlc1 survivors was digested with XhoI,
fractionated through 1% agarose, and analyzed by Southern blotting
with a C1-3A/TG1-3 probe. Size markers are in
kilobases.
|
|
To further understand telomerase-independent mechanisms for telomere
maintenance in
S. cerevisiae, a strain lacking
TLC1,
the gene encoding the RNA component of telomerase was
created.
This strain contained a
LYS2 CEN plasmid harboring
the wild-type
TLC1 gene to complement the chromosomal
tlc1 deletion. Cells that
lost the
TLC1 plasmid
were identified and then restreaked multiple
times to obtain survivors.
Although most
tlc1 cells died, faster-growing
survivor cells
appeared after ca. 100 to 125 generations (data
not shown). Genomic DNA
from 24 independent survivors, as well
as from wild-type and
early-passage
tlc1 strains, was isolated,
digested with
XhoI, and analyzed by Southern blotting with a
C
1-3A/TG
1-3 probe. Most (21 of 24) survivors
were type I (two examples are
shown in Fig.
1B, lanes type I), and
three were type II (lanes
type II). Additional type II survivors were
obtained in independent
experiments.
The growth characteristics of nine type I and nine type II survivors
were analyzed by restreaking each survivor 10 times on
YEPD plates. The
growth rate of most type II survivors and wild-type
colonies was
similar, whereas type I survivors grew more slowly
and their growth
rate fluctuated in different restreaks (see,
for example, Fig.
2), with
senescing cells reappearing at different
times during outgrowth. Type I
and type II survivors from an
est1 strain had similar growth
properties (
27). We conclude that
the survivors obtained in
a
tlc1 strain were indistinguishable
from those obtained in
an
est1 strain.
Survivors require the continuous presence of Rad52p.
Survivors
are not obtained in either rad52 est1 strain (27)
or rad52 tlc1 strains (18). To determine if
Rad52p is required to maintain survivors in cells lacking telomerase,
we isolated eight independent type I and eight independent type II
survivors in a rad52
tlc1 strain carrying a RAD52
URA3 plasmid. After survivors were generated, cells that lost the
RAD52 plasmid were identified by their ability to grow on
plates containing 5-FOA. Type I survivors grew very poorly or not at
all, even on the first restreak after loss of the RAD52
plasmid (Fig. 2). Although type II
tlc1 rad52 survivors divided more times than type I
tlc1 rad52 survivors did, they formed heterogeneously sized
colonies similar to those seen in senescent tlc1 cells and
stopped growing altogether after one to three restreaks (Fig. 2). Thus,
RAD52 function is needed continuously to maintain both type
I and type II survivors.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 2.
The maintenance of type I and type II survivors requires
Rad52p. Eight independent type I and type II survivors were isolated in
a rad52 tlc1 strain carrying a plasmid bearing the
RAD52 gene. After survivors were characterized, the
RAD52 plasmid was lost and cells were streaked onto rich
medium. Shown here are cells from one type I and one type II survivor
with (left) or without (right) the RAD52 plasmid. The plate
is the first restreak after plasmid loss. Some type II survivors grew
on the first restreak but not on subsequent streaks. This figure also
demonstrates that type II survivors grew faster than type I survivors
(compare streaks of +pRAD52 for type I and type II).
|
|
Telomeres of tlc1 survivors are not maintained through
cDNA-mediated recombination.
Drosophila telomeres consist of
retrotransposons (1, 17). Y' elements share several
structural features with retrotransposons, such as having two
overlapping open reading frames that are in different frames but
oriented in the same direction (14, 25). Moreover, many
integrated copies of retrotransposons have truncated 5' ends due to
premature termination of reverse transcription (14), a
situation that could explain the proposed tandem duplication of just
the 3' end of Y' (27). In yeast, a chromosome without a
telomere is seen as a double-strand break (42) and
retrotransposons are able to repair chromosomal breaks (31,
45). The RAD52 dependence for generating survivors
would be explained if Y' cDNAs were added to chromosome ends by
homologous recombination. These considerations led us to test if type
II survivors are generated by RNA-mediated transposition of Y' DNA.
To test this possibility, we first tagged the 3' end of Y' elements
with the
his3AI marker (
13) (Fig.
3). The
his3AI gene
is
designed to detect reverse transcription-mediated events in
yeast. In
his3AI, the
HIS3 ORF is interrupted by a 104-bp
artificial
intron (AI) that is oriented opposite to the direction of
HIS3 transcription. Transcription of the
his3AI
gene results in a nonspliceable
RNA. The
his3AI gene was
inserted within Y' such that transcription
from the Y' promoter
generates a transcript containing antisense
HIS3 sequences
interrupted by the AI intron in a spliceable orientation.
Reverse
transcription of the spliced RNA, followed by either recombination
or
transposition of the
HIS3 cDNA, will generate
His
+ colonies.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
The his3AI gene can be used to detect reverse
transcriptase-mediated addition of Y' to chromosome ends. The
his3AI gene was inserted within the 3' end of Y' (Fig. 1A).
The his3AI gene is transcribed from the Y' promoter to
generate an antisense HIS3 transcript having the
AI intron in a spliceable orientation. If this transcript is
spliced and reverse transcribed, it will generate a cDNA containing an
uninterrupted HIS3 gene flanked on either side by Y'
sequences. This Y' DNA can direct the recombination of the cDNA to a
chromosome end. HIS3 gene expression is detected by growth
on plates lacking histidine. The deleted region in Y'-short is denoted
by brackets. Restriction sites used for Southern blot analysis are
indicated: S, SalI; X, XhoI. ds,
double-stranded.
|
|
Both wild-type and
tlc1 strains that contained
TLC1 on a plasmid were transformed with a construct having
the
his3AI marker
inserted into the middle of the 0.9-kb 3'
end of Y' DNA at the
downstream boundary of ORF2 (Fig.
3).
Transformants were screened
by Southern blotting to obtain strains that
had a single
his3AI-tagged
telomere. Since different
telomeres have zero to four copies of
Y', the
his3AI marker
could insert within either an internal or
a terminal Y' element. We
recovered eight wild-type strains, of
which three had the
his3AI gene inserted within an internal Y'
and five had it
inserted within a terminal Y'. We recovered 14
tlc1 strains
containing the
TLC1 plasmid, comprising 4 tagged
at an
internal Y' element and 10 tagged at a terminal Y'
element.
We selected for loss of the
TLC1 plasmid in
tlc1
cells containing a
his3AI-tagged telomere by using the
liquid assay described
in Materials and Methods. The liquid culture
scheme favored the
isolation of type II survivors because of their
growth advantage
compared to type I survivors. Indeed, Southern blot
analysis revealed
that most survivors (24 of 24 examined) had the
XhoI restriction
pattern diagnostic for type II survivors
(data not shown). The
cultures were then plated onto YEPD plates to
determine the total
cell number and onto complete plates lacking
histidine to determine
the fraction of His
+ cells. If type
II survivors are generated via a cDNA intermediate,
the majority of
them should have a His
+ phenotype. Three
tlc1
His
+ colonies were recovered from a total of 4.2 × 10
9 postsenescent
tlc1 cells. No
His
+ colonies were identified in 6.6 × 10
9 wild-type cells. The three His
+ colonies
from the
tlc1 survivors contained a 0.8-kb
XhoI-
NdeI
fragment that hybridized to the
HIS3 probe but not to a probe
for
AI, as expected
if the His
+ phenotype resulted from cDNA-mediated movement
of
HIS3 to a chromosome
end. In addition, these strains
contained one or more copies of
a 0.9-kb
XhoI-
NdeI fragment that hybridized to both the
HIS3 and
AI probes, as expected for the original
his3AI locus. We conclude
that cDNA-mediated movement of a
his3AI-tagged Y' occurred but
at too low a rate to explain
the formation of type II survivors.
A similarly small number of
His
+ cells was found among type I
survivors.
Terminal but not internal Y' elements are altered during generation
of type II survivors.
We used strains having a single
his3AI-tagged telomere to determine the structure of
telomeric DNA in type II survivors. Twelve independent tlc1
strains (strains 1 to 12), each with a single his3AI-tagged
Y' element, were generated. Of the 12 strains, 3 (strains 1, 2, and 6)
had his3AI at an internal Y'. Strain 1 was marked at an
internal Y'-short element, and strains 2 and 6 were marked at an
internal Y'-long element. The nine other tlc1 strains had
his3AI inserted within a terminal Y' element. Each of the 12 strains was diluted into liquid YEPD medium to generate survivors. Two
different survivors (a and b) from each of the 12 strains were examined
in detail.
Genomic DNA was prepared from each of the 24 survivors, digested with
XhoI, and examined by Southern blotting with probes
for
telomeric C
1-3A/TG
1-3 DNA (Fig.
4A), the 3' end
of Y' (Fig.
4B), the 5'
and middle parts of Y' (data not shown),
and
his3AI (Fig.
4C). The telomeric and 3' Y' probes detected
multiple irregularly sized
bands that ranged in size from ~1.5
to 10 kb in each of the 24 strains. Most
XhoI fragments hybridized
to both the
telomeric and 3' Y' probe (Fig.
4A and B) but not
to the 5' or middle
regions of Y' (data not shown). Like type
I survivors, some (but not
all [see also Fig.
1]) of the type
II survivors had elevated levels
of tandem Y'-long and Y'-short
elements compared to the starting
wild-type strain (Fig.
4B).
The hybridization pattern reported here is
identical to that described
previously for type II survivors
(
27). Thus, 24 of 24 recovered
survivors were type II
survivors. Given the growth advantage of
type II over type I survivors
and the method used to generate
survivors, the predominance of type II
survivors was expected.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 4.
Southern blot analysis of telomeric DNA in independent
type II survivors. (A to C) Two tlc1 survivors (named a and
b) from each of 12 independent tlc1 strains (strains 1 to
12) with a single his3AI-tagged Y' element were collected.
Genomic DNA from each was digested with XhoI, fractionated
through a 1% agarose gel, and analyzed by Southern blotting. The
filter was hybridized sequentially with a
C1-3A/TG1-3 (A), 3' Y' (B), or
his3AI (C) probe. Most fragments smaller than 5.2 kb that
hybridized to the C1-3A/TG1-3 probe (A) also
hybridized to the 3' Y' probe. Fragments in panel A that did not
hybridize to the Y' probe are marked with asterisks. Size markers are
in kilobases. (D) Interchromosomal recombination in telomerase-minus
S. cerevisiae. Chromosomes from two sets of type II
survivors (strains 3 a, 3 b, 10 a, and 10 b) and
their parent strains (strains 3 and 10) were separated by PFGE. Size
markers (in kilobases) are shown on the left. Chromosome numbers are
shown on the right (9). (E). Inter-Y' recombination in
telomerase-minus S. cerevisiae. Genomic DNAs from the same
sets of samples in panel D were digested with SalI. After
transfer to a nylon filter, the filters in panels D and E were
hybridized with the his3AI probe.
|
|
To determine the fate of individual telomeres during survivor
formation, the same blot was hybridized with a
his3AI probe
(Fig.
4C). The sizes of the
his3AI-hybridizing sequences in
survivors
obtained from
tlc1 strains with
his3AI
inserted into an internal
Y' (strains 1, 2, and 6) were unchanged
compared to the starting
tlc1 strain. These bands had the
size expected for insertion into
Y'-short (strain 1, a and b) or the
size expected for insertion
into Y'-long (strains 2 and 6, a and b).
These data suggest that
during formation of type II survivors, internal
Y' elements were
not subjected to major
rearrangements.
The pattern of
his3AI hybridization in the 18 survivors
obtained from
tlc1 strains that had
his3AI
inserted at a terminal
Y' was diverse. Of the 18 survivors, 12 still
had a single
his3AI-tagged
telomere, 1 had no tagged
telomere (strain 11 a), and 5 had two
or more
his3AI
tags (strains 9 a, 10 a and b, and 12 a and b).
In no case
did the two survivors obtained from the same starting
tlc1
strain have the same structure. The only consistent feature
was that
the tagged Y' in the survivor was almost always larger
than the tagged
Y' fragment in the parental
tlc1 strain (the position
of the
parent band is marked terminal Y'-
his3AI in Fig.
4C). These
data indicate that the structure of terminal Y' elements is usually
altered during the formation of a type II
survivor.
To obtain a better understanding of the kinds of changes that can occur
during formation of type II survivors, we used PFGE
to determine the
chromosomal location of the
his3AI tag in four
independent
type II survivors as well as in their parent strains
(Fig.
4D). In
strain 3, there was a single copy of
his3AI inserted
within
a terminal Y' element on either chromosome VII or XV (these
chromosomes
comigrate in PFGE [
9]). In this case, the telomere
lengthening that accompanied the transition to a type II survivor
did
not involve movement of
his3AI to a different chromosome,
since the positions of
his3AI in the two survivors were the
same
as in the starting strain (Fig.
4D). Strain 10 also had a single
copy of
his3AI within a terminal Y' element, this time on
chromosome
VI. Both strain 10 survivors retained
his3AI on
chromosome VI
but in addition had
his3AI on other
chromosomes (two new copies
of
his3AI in survivor 10 a,
on chromosomes VII and IV or XII;
one new copy in survivor 10 b,
on chromosome IV or XII). Digestion
with
SalI can be used to
determine if
his3AI was inserted into
Y'-short or Y'-long
(Fig.
1A). In strain 3 and its two survivors,
his3AI was
embedded in Y'-long (Fig.
4E). However, during generation
of survivors
10 a and 10 b, the
his3AI tag moved not only to a
new chromosome but also from a Y'-short to a Y'-long element (Fig.
4E).
These results indicate that both intra- and interchromosomal
events
occur during generation of type II
survivors.
The his3AI sequences are still near the physical end of
the chromosome in type II survivors.
Since the his3AI
sequences were invariably on larger XhoI fragments in type
II survivors than in the starting strain (Fig. 4C), it is possible that
they were no longer at the ends of linear chromosomes. For example,
chromosome ends without a telomere could fuse to form a circular
chromosome, as seen in telomerase-minus S. pombe
(33). If the his3AI marker were at the physical
end of a chromosome in type II survivors, it would be sensitive to digestion by the exonuclease Bal 31. To address this
possibility, genomic DNA was prepared from a wild-type strain with
his3AI inserted within a terminal Y' (Fig.
5A, left) and from four independent type
II survivors (analysis of survivor 3 b is shown in Fig. 5A, right). DNA was digested with Bal 31 with samples removed at
10-min intervals. The DNA was then digested with XhoI,
subjected to electrophoresis, and analyzed by hybridization to a
his3AI probe. Since the his3AI hybridizing
sequences shortened at the same rate in both wild-type and type II
survivor 3 b DNA, his3AI sequences were near a free end
in the 3 b survivor. However, it took longer to degrade the his3AI sequences in the 3 b survivor DNA than in its
parent strain, suggesting that in the type II survivor, the
his3AI sequences were further from the physical end of the
chromosome, a result consistent with the larger size of this fragment.
Hybridization of the same blot with the internal PIF1 probe
demonstrated that nontelomeric sequences were not Bal 31 sensitive (Fig. 5A). Similar results were obtained with three other
type II survivors (data not shown). These data argue that the
alterations in his3AI-bearing restriction fragments that
accompanied the generation of type II survivors do not alter the
telomere-proximal location of the tag.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
The his3AI gene remains near a free
chromosome end and embedded within Y' DNA in type II survivors. (A)
Genomic DNA from the wild-type strain and a type II survivor (survivor
3 b in Fig. 4C) was digested with Bal 31 exonuclease
for increasing lengths of time. Samples were removed at 10-min
intervals, subjected to phenol-chloroform extraction and ethanol
precipitation, and digested with XhoI. Digested DNAs were
fractionated in a 0.7% agarose gel and analyzed by Southern
hybridization with, sequentially, a his3AI probe (top) and
an internal probe (the PIF1 gene) (bottom). (B) Genomic DNA
from two sets of type II survivors (strains 3 b, 3 a, 10 a, and 10 b) and their parent strains (strains 3 and 10) were
digested with XhoI (X) and EcoRI (E) separately.
Digested DNA was fractionated in a 0.7% agarose gel and analyzed by
Southern hybridization with a his3AI probe. Size markers are
in kilobases.
|
|
The his3AI sequences are still embedded in Y' DNA in
type II survivors and have a local structure very similar to that of
the starting strain.
The Bal 31 data suggest that the
his3AI sequences in a type II survivor were on a terminal
XhoI fragment but were further from the chromosome end than
in the parental tlc1 strain. Restriction enzyme analysis was
used to demonstrate that the DNA surrounding the his3A gene
in different type II survivors had the characteristics expected for Y'
DNA. Genomic DNA from each of four survivors (strains 3 a, 3 b, 10 a, and 10 b in Fig. 4C) as well as DNA from their parent strains (strains 3 and 10) was digested with five different restriction enzymes, SalI, HindIII,
EcoRI, BglII, and KpnI, all of which
have recognition sites within Y' and/or his3AI DNA (see Fig.
1A for the locations of the sites). Digested DNA was analyzed by
Southern blotting with a his3AI probe. The data obtained
with EcoRI are shown in Fig. 5B. The XhoI
fragments that hybridized to the his3AI probe were larger in
each type II survivor than the 2.1-kb XhoI fragment produced
in the parent tlc1 strains (Fig. 5B). For example, in
survivor 3 b, a 3.5-kb XhoI fragment hybridized to
his3AI, whereas in survivor 3 a, a 2.4-kb
XhoI fragment hybridized to his3AI (Fig. 5B).
There is an EcoRI site in the Y' element 2.6 kb internal to
the XhoI site (Fig. 1A). If his3AI were still embedded in the same place in Y' in survivor strains, his3AI
should hybridize to a 6.1-kb EcoRI fragment in survivor
3 b (3.5 + 2.6 kb) and a 5-kb EcoRI fragment in
survivor 3 a (2.4 + 2.6 kb), exactly the pattern seen (Fig.
5B). Likewise, in survivors 10 a and b, the EcoRI
fragment(s) that hybridized to his3AI were 2.6 kb larger
than the his3AI-hybridizing XhoI fragments. Since this result was obtained with five of five restriction enzymes, the
his3AI fragments in type II survivors behaved as if they
were embedded within Y' DNA. Thus, we found no evidence for
rearrangement or deletion of Y' elements on the tagged telomeres of
type II survivors.
One explanation for the structure of telomeres in type II survivors is
that their sequence is similar to that of the starting
strain but their
structure is altered in a manner that reduces
their mobility in agarose
gels. For example, type II survivors
might have telomeres with very
long single-stranded TG
1-3 tails, as seen in
cdc13-1 cells at semipermissive temperatures
(
15), and these single-stranded tails might form secondary
structures
that reduced fragment mobility. However, the mobility of
his3AI-tagged
telomeres did not change after treatment with
the single-strand-specific
S1 or mung bean nucleases (data not shown).
Moreover, analysis
by both two-dimensional (
5) and alkaline
denaturing (
41)
gel electrophoresis revealed no difference
between telomeres of
type II survivors and wild-type cells (data not
shown). Thus,
there was no evidence for any change in the structure of
Y' (Fig.
5B) or in the physical structure of the chromosome end. We
conclude
that the slower migration of the terminal
XhoI
fragments from
his3AI-tagged telomeres in type II survivors
(Fig.
4C) is probably
due to the addition of DNA distal to the tagged
Y'
element.
C1-3A/TG1-3 DNA is distal to Y' on
his3AI-tagged telomeres in type II survivors.
An
inverse PCR strategy (37) (Fig.
6) was used to obtain the sequence of the
DNA to either side of his3AI in two type II survivors,
3 a and b, as well as in the parental tlc1 strain (Fig. 6). Genomic DNA from each of the three strains was digested with XhoI, and the restriction fragments were rendered blunt
ended by treatment with the Klenow fragment of DNA polymerase I. The his3AI XhoI fragments from the parent (2.1 kb), survivor
3 a (2.4 kb), and survivor 3 b (3.5 kb) strains were gel
purified and treated with ligase. Because the DNA was dilute, ligation
generated intramolecular circles. The circularized XhoI
fragments were subjected to PCR amplification with primers P1 and P2,
which are 395 bp apart and facing in opposite directions within the
his3AI gene (Fig. 6). For each strain, a PCR product of the
expected size was obtained but only in ligase-treated DNA (data not
shown). Since there were other ligase-independent PCR products in the
first PCR amplification, we did an additional PCR amplification on the
products of the first reaction by using nested primers P3 and P4. P3
annealed at the very 3' end of Y', just upstream of the telomeric
C1-3A/TG1-3 telomeric tract. P4 annealed just
downstream of the XhoI site in Y' and was oriented toward
the XhoI site (Fig. 6). Again, PCR fragments of the
appropriate size were obtained. These PCR products hybridized to a
C1-3A/TG1-3 probe (data not shown). Because
the PCR products were from a population of DNA molecules, the exact
sequence of telomeric DNA varied from molecule to molecule. Although we
could not obtain a precise telomeric sequence from PCR-amplified DNA,
when the pool of molecules was sequenced with the P3 primer, the
products of all three strains consisted of only T and G residues. When
the P4 primer was used, 45 bp of Y' sequence was followed by DNA
consisting of only A and C residues (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Inverse PCR strategy to determine the sequence of the
DNA flanking the his3AI gene in type II survivors. Wild-type
and tlc1 strains with TLC1 on a plasmid and
containing a single his3AI tag were identified and then
allowed to lose the TLC1 plasmid. The black box represents
the telomeric C1-3A/TG1-3 tract present
before survivors were formed. The DNA added to the his3AI
gene during the formation of type II survivors is indicated by the
question mark. Genomic DNA from the wild type and type II survivors was
digested with XhoI and made blunt ended by treatment with
Klenow enzyme in the presence of all four nucleotides. The
his3AI-tagged XhoI-digested telomere fragments
were gel purified and intramolecularly ligated. Ligated telomeric
fragments were subjected to PCR amplification with primers P1 and P2.
The P1-P2 PCR products were then subjected to nested PCR amplification
with primers P3 and P4. Nested PCR products were further analyzed by
cloning and sequencing.
|
|
To determine the precise sequence of an individual telomere, we cloned
the products from the second PCR from survivor 3 a
and from its
parent
tlc1 strain prior to its losing the
TLC1
plasmid.
Whereas telomeres from the parent strain were easily
recovered,
type II survivor telomeres were clonable only in STAB2
E. coli (GIBCO-BRL), a strain used to stabilize long tracts
of repetitive
DNA. We obtained an insert of 0.6 kb, the appropriate
size for
the telomeric
his3AI fragment from survivor 3 a. Using the P3
and P4 primers, we sequenced ~100 to 200 bp from each
end of the
insert and found that it consisted solely of
C
2-3A(CA)
1-6/(TG)
1-6TG
2-3 DNA. Although we did not obtain a precise sequence for the rest
of the
tract, it had the appropriate pattern to be
C
1-3A/TG
1-3 DNA. Thus, a combination of
restriction digestion (Fig.
5B) and
sequence analysis indicates that
the structure of the
his3AI-tagged
telomere in survivor
3 a was unchanged from the same telomere
in the parent strain
except that its telomeric C
1-3A/TG
1-3 tract
was much
longer.
Type II survivors have very long tracts consisting only of
C1-3A/TG1-3 DNA.
The cloning and
sequencing results confirmed that the his3AI marker in
survivor strain 3 a was still embedded at the same site within
Y'DNA as in the starting strain and that it had ~600 bp of
C1-3A/TG1-3 DNA distal to Y'. This result
suggests that the structure of telomeres in type II survivors is
similar to that in wild-type cells except that the telomeres in type II survivors are longer and much more heterogeneous. If telomeres of type
II survivors consist solely of C1-3A/TG1-3 DNA, they should lack recognition sites for most restriction enzymes, even enzymes that cut frequently in yeast DNA. To test this
possibility, genomic DNAs from a wild-type strain (Fig.
7, lane wt), a type I survivor (lane I),
and 10 independent type II survivors (lanes II) were digested with a
mixture of AluI, HaeIII, HinfI, and
MspI. Each of these enzymes recognizes a different 4-bp
sequence, and together they are expected to reduce yeast DNA to, on
average, 96 bp. There are many sites for these enzymes within Y',
including sites 358 bp downstream of the 5' end of Y' and 42 bp
upstream of the 3' end of Y'. The DNA was analyzed by Southern blotting with a C1-3A/TG1-3 probe. If many telomeres
in type II survivors have long C1-3A/TG1-3
tracts, there will be many large fragments that hybridize to a
telomeric probe after digestion with the four enzymes.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 7.
Newly elongated telomeric fragments in type II survivors
are C1-3A/TG1-3 tracts. Genomic DNAs from a
wild-type strain, a type I survivor, and 10 type II survivors were
digested with a combination of AluI, HaeIII,
HinfI, and MspI, which cut at the AGCT, GGCC,
GANTC, and CCGG sequences, respectively; fractionated through 1.3%
agarose; and transferred to a nylon filter. The filter was hybridized
sequentially to a C1-3A/TG1-3 probe (top) and
a probe for a nontelomeric fragment (taken from a region of
TLC1 that was not deleted; serves as a control for DNA
loading). Size markers (kilobases) are shown at the left. An asterisk
marks the position of critically short telomeres.
|
|
Since the wild-type strain used for this study had telomeres of
~375 ± 75 bp, digestion with the four enzymes is expected
to
generate C
1-3A/TG
1-3 hybridizing fragments of
~375
+ 42 bp from Y'-bearing telomeres, fragments of ~0.5 kb
from tandem
Y' elements, and fragments of up to 1.1 kb from X
telomeres. Consistent
with this expectation, digestion of DNA from
wild-type cells with
the four enzymes released
C
1-3A/TG
1-3 fragments that
were mostly
smaller than 1 kb (Fig.
7). DNA from the type I survivor
yielded very
short fragments, which hybridized to a telomeric
probe. In contrast,
most fragments containing C
1-3A/TG
1-3 DNA in
type II survivors were large, ranging up to 12 kb. The
fact that these
large fragments hybridized intensely to the
C
1-3A/TG
1-3 probe provided additional
evidence that they consisted solely
of
C
1-3A/TG
1-3 DNA. We conclude that most
chromosome
ends in type II survivors bear very long and variable-length
tracts
of C
1-3A/TG
1-3 DNA. However, many of
the type II survivors
also had a subset of telomeres that were as short
as those in
type I survivors (asterisk in Fig.
7).
Type II survivors are stable over time, but their telomeres
continuously shorten.
To test whether the telomere structure in
type I and type II survivors was stable, three independent type I
survivors and 20 independent type II survivors were restreaked 10 times
on YEPD plates. DNA was prepared from different restreaks, digested
with XhoI, and analyzed by Southern blotting with a
C1-3A/TG1-3 probe (Fig.
8A). Two of the type I survivors
maintained a type I telomeric pattern throughout the restreaking
period, while the third type I survivor converted to a type II
telomeric pattern between the first and fourth restreaks (Fig. 8A, left
panel). Concomitant with this switch, the growth rate of this survivor improved and became similar to that of other type II survivors (data
not shown). Thus, type I survivors can convert to a type II pattern
during outgrowth.

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 8.
Telomeric changes in type I and type II survivors during
outgrowth and after introduction of telomerase. (A) Stability of
telomeric structure in type I and type II survivors. Two type I and two
type II survivors were restreaked 10 times on YEPD plates. Genomic DNA
from the 1st, 4th, 7th, and 10th restreaks was digested with
XhoI. Southern blot analysis was performed as in Fig. 1B.
(B) Telomeres of type II survivors are subject to continuous shortening
and gene conversion. The blot shown on the right of panel A was
stripped and rehybridized with a his3AI probe. The
his3AI marker was lost between the fourth and seventh
restreaks in the second type II survivor. (C and D) Telomere length
reverts to wild type in type I and type II survivors after
reintroduction of telomerase. Plasmid pRS317TLC1 was
transformed into both type I and type II survivors. Transformants were
restreaked multiple times. Genomic DNA from the 1st and 4th restreaks
from a type I survivor and from the 1st, 4th, 7th, 10th, 13th, 16th,
and 19th restreaks from a type II survivor was digested with
XhoI (C) or with a combination of AluI,
HaeIII, HinfI, and MspI (D);
fractionated through a 1% agarose gel; and analyzed by Southern
blotting with a C1-3A/TG1-3 probe. DNAs from
the wild type and from the two survivors before introduction of the
pRS317TLC1 plasmid were also analyzed. Similar results were
obtained with three additional type II survivors. Size markers are in
kilobases. The C1-3A/TG1-3 hybridizing
fragments in panel C that are >0.5 kb and that are absent in DNA from
the type I survivor after telomerase was reintroduced are from X
telomeres. Not all type I survivors lacked X telomeres after
reintroduction of TLC1 (data not shown).
|
|
In contrast, all 20 type II survivors retained the
XhoI
pattern of variable-length telomeric fragments characteristic of type
II survivors for ~250 cell divisions (~25 cell divisions per
restreak)
(see Fig.
8A, right panel, for two examples). Although the
general
pattern of telomeric
XhoI fragments did not change
during subculturing
and the average telomere length remained high,
individual C
1-3A/TG
1-3-hybridizing
XhoI fragments in type II survivors appeared to shorten
slowly
over time (Fig.
8A). This shortening was especially apparent
when
these blots were reprobed with
his3AI (Fig.
8B), which
detects
a single telomere. The rate of telomere shortening in type II
survivors was ~3 bp/cell division. The
his3AI marker at
the internal
Y' of the second type II survivor was lost between the
fourth
and seventh restreaks. Thus, even though the pattern of variable
and very long telomeres characteristic of type II survivors was
maintained for at least 250 cell divisions, individual type II
telomeres continuously shorten and, as inferred from the loss
of the
his3AI tag during outgrowth, engage continuously in gene
conversion events with other
telomeres.
Normal telomere length regulation is restored in type II survivors
when TLC1 is reintroduced.
Since most cells that lack
telomerase do not form survivors, generation of survivors might require
a second event that activates a telomerase-independent telomere
maintenance pathway. If this model were true, reintroduction of
telomerase might not be sufficient to restore a wild-type pattern of
telomere structure. To determine if the telomere changes that occur in
type I and II survivors were reversible, we introduced a plasmid-borne
TLC1 gene into individual type I and type II survivors.
Transformants were restreaked multiple times, and DNA was prepared for
Southern analysis after variable number of cell divisions in the
presence of telomerase. DNA was digested with both XhoI
(Fig. 8C) and multiple 4-bp cutters (Fig. 8D). Telomeres of type I
survivors reverted to wild-type lengths soon after reintroduction of
TLC1, whereas it took many generations for type II telomeres
to return to wild-type lengths (~475 cell divisions). Similar results
were obtained with three other type II survivors. These data suggest
that generation of type II survivors does not require mutations of
genes involved in telomere length regulation.
 |
DISCUSSION |
Previous studies demonstrated that yeast cells lacking telomerase
can maintain telomeric DNA by Rad52p-dependent recombination (27). Type I survivors arise by tandem duplication of the
subtelomeric Y' element. Type II survivors were proposed to have
deleted Y' elements but were not characterized in detail
(27). To characterize the structure of telomeres in
individual type II survivors, we tagged the distal portion of Y' on
individual telomeres with the his3AI marker. We showed that
cDNA-mediated movement of Y' to chromosome ends is not a general
mechanism for generating type II survivors. We found no evidence for
deletion or rearrangement of Y' elements during the formation of type
II survivors (Fig. 3 and 5B). Although the his3AI tags
remained near a chromosome end (Fig. 5A), the terminal XhoI
fragments were invariably larger (Fig. 4C and 5A) than in the parental
strain. DNA sequencing revealed that the DNA distal of the
his3AI tag in one type II survivor consisted solely of
C1-3A/TG1-3 DNA (Fig. 6). Moreover, 10 of 10 type II survivors had heterogeneous-length
C1-3A/TG1-3 telomeric fragments that were
much longer than the C1-3A/TG1-3 tracts in
wild-type cells (Fig. 7). The simplest interpretation of these data is
that telomeres in type II survivors differ from wild-type telomeres by
having longer and irregularly extended C1-3A/TG1-3 tracts. Since type II survivors
required the continuous presence of Rad52p (Fig. 2), the long terminal tracts of C1-3A/TG1-3 DNA on type II
telomeres are probably maintained by nonreciprocal recombination
between two telomeres (38, 46, 47).
In contrast to type I survivors, which often reverted to a type II
pattern of telomeric DNA, the type II pattern of telomeres was
persistent, being maintained for at least 250 cell generations (Fig.
8A). Despite the stability of the general pattern of telomeric structure in type II survivors, individual telomeres were not static
but, rather, steadily shortened (Fig. 8A and B). Moreover, the
his3AI tags on these telomeres could be lost (Fig. 4C and 7B), duplicated (Fig. 4C to E), or transferred to a different chromosome (Fig. 4D). Since most type II survivors had a growth rate
similar to that of wild-type cells, telomere-telomere recombination must be an efficient mechanism for maintaining telomeric DNA. Nonetheless, after reintroduction of telomerase, type II telomeres slowly returned to wild-type lengths (Fig. 8D), suggesting that expression of telomerase in some way suppressed telomere-telomere recombination.
Saccharomyces telomeric
C1-3A/TG1-3 repeats are associated in vivo
with at least eight distinct proteins (4, 16). We propose
that as telomeres become critically short, the binding of one or more
of these proteins is impaired, an event that could expose the
single-stranded 3' TG1-3 tail, freeing it to invade
another telomere. Consistent with this possibility, a tlc1
strain that lacks Rif2p, an in vivo telomere binding protein (4), generates exclusively type II survivors, suggesting
that Rif2p normally inhibits telomere-telomere recombination
(45a). According to this model, telomere-telomere
recombination does not occur once telomerase is reintroduced, because
telomerase lengthens critically short telomeres, eliminating the ends
that would otherwise initiate recombination. Telomere-telomere
recombination in K. lactis is also proposed to result from
loss of telomere binding proteins (29).
Since all telomeres in a senescing strain are short, a single
telomere-telomere recombination event will at most double the size of
the recombining telomere. For a telomere to become as long as the
typical type II telomere, it must either undergo multiple recombination
events with a short telomere or invade a very long telomere. If, as we
propose, only critically short telomeres lose telomere binding proteins
and initiate telomere-telomere recombination, a short telomere cannot
become a long telomere by recombination with another short telomere,
because after a single recombination event, it will no longer be
critically short. We propose that the rate-limiting step in generating
a type II survivor is the creation of one or more telomeres that are
long enough to serve as efficient, one-step donors of telomeric DNA.
This long telomere might be generated by a series of successive
recombination events in which a critically short telomere invades a
telomere that was itself lengthened by recombination with another short
telomere. Alternatively, formation of the first long telomere might
involve a rare replication event, such as repeated replication slippage during gene conversion. If generation of a single long telomere were
rare, it would explain why type II survivors are less common than type
I. Even after type II telomeres are generated, telomere-telomere recombination must be relatively rare, since individual type II telomeres continuously shortened (Fig. 8B), presumably until they became sufficiently short to initiate recombination.
The pattern of telomere structure in Saccharomyces type II
survivors is similar to that described in telomerase-minus K. lactis cells (29). However, since K. lactis
survivors go through repeated rounds of telomere elongation, telomere
shortening, and senescence (29), their growth
characteristics are more similar to those of type I than type II
Saccharomyces survivors, perhaps because telomere-telomere
recombination is even rarer in K. lactis than in
Saccharomyces. The structure of telomeres in type II
survivors in Saccharomyces was also similar to that
described in human cells that maintain their telomeres by the
telomerase-independent alternative lengthening of telomeres (ALT)
pathway (7, 8). These cells also have very long and
heterogeneous-length telomeres. Moreover, individual telomeres in cells
maintaining telomeres by the ALT pathway are seen to both gradually
shorten and undergo rapid, one-step elongation (32).
In summary, previous work showed that linear chromosomes in
Saccharomyces could be maintained either by telomerase or by
recombination-driven amplification of subtelomeric Y' DNA
(27). Here we show that there is yet a third mechanism that
can maintain the ends of yeast chromosomes, telomere-telomere
recombination. Although this pathway appears to be as efficient as
telomerase in maintaining linear chromosomes, its occurrence is
suppressed in telomerase-proficient cells.
 |
ACKNOWLEDGMENTS |
We thank A. Ivessa, B. McCowan, E. Monson, J. Stavenhagen, A. Taggart, L. Vega, and other members of the Zakian laboratory for their
helpful comments on the manuscript.
This work was supported by U.S. Army Breast Cancer grant
DAMD17-97-1-7242 to S.-C.T. and NIH grant GM26938 to V.A.Z.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, Princeton University, Princeton, NJ 08544. Phone: (609) 258-6770. Fax: (609) 258-1701. E-mail:
vzakian{at}molbio.princeton.edu.
 |
REFERENCES |
| 1.
|
Biessman, H.,
J. M. Mason,
K. Ferry,
M. d'Hulst,
K. Valgeirsdottir,
K. L. Traverse, and M. L. Pardue.
1990.
Addition of telomere-associated HeT DNA sequences "heals" broken chromosome ends in Drosophila.
Cell
61:663-673[Medline].
|
| 2.
|
Biessman, H., and J. M. Mason.
1997.
Telomere maintenance without telomerase.
Chromosoma
106:63-69[Medline].
|
| 3.
|
Boeke, J. D.,
F. LaCroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[Medline].
|
| 4.
|
Bourns, B. D.,
M. K. Alexander,
A. M. Smith, and V. A. Zakian.
1998.
Sir proteins, Rif proteins, and Cdc13p bind Saccharomyces telomeres in vivo.
Mol. Cell. Biol.
18:5600-5608[Abstract/Free Full Text].
|
| 5.
|
Brewer, B. J., and W. L. Fangman.
1987.
The localization of replication origins on ARS plasmids in S. cerevisiae.
Cell
51:463-471[Medline].
|
| 6.
|
Brosius, J.
1992.
Compilation of superlinker vectors.
Methods Enzymol.
216:469-483[Medline].
|
| 7.
|
Bryan, T. M.,
A. Anglezou,
J. Gupta,
S. Bacchetti, and R. R. Reddel.
1995.
Telomere elongation in immortal human cells without detectable telomerase activity.
EMBO J.
14:4340-4348.
|
| 8.
|
Bryan, T. M.,
A. Englezou,
L. Dalla-Pozza,
M. A. Dunham, and R. R. Reddel.
1997.
Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines.
Nat. Med.
3:1271-1274[Medline].
|
| 9.
|
Carle, G. F., and M. V. Olson.
1985.
An electrophoretic karyotype for yeast.
Proc. Natl. Acad. Sci. USA
82:3756-3760[Abstract/Free Full Text].
|
| 10.
|
Chan, C. S. M., and B.-K. Tye.
1983.
Organization of DNA sequences and replication origins at yeast telomeres.
Cell
33:563-573[Medline].
|
| 11.
|
Chattoo, B. B.,
F. Sherman,
D. A. Atubalis,
T. A. Fiellstedt,
D. Mehnert, and M. Ogur.
1979.
Selection of lys2 mutants of the yeast S. cerevisiae by the utilization of alpha-aminoadipate.
Genetics
93:51-65[Abstract/Free Full Text].
|
| 12.
|
Counter, C. M.,
M. Meyerson,
E. N. Eaton, and R. A. Weinberg.
1997.
The catalytic subunit of yeast telomerase.
Proc. Natl. Acad. Sci. USA
94:9202-9207[Abstract/Free Full Text].
|
| 13.
|
Curcio, M. J., and D. J. Garfinkel.
1991.
Single-step selection for Ty1 element retrotransposition.
Proc. Natl. Acad. Sci. USA
88:936-940[Abstract/Free Full Text].
|
| 14.
|
Eickbush, T. H.
1992.
Transposing without ends: the non-LTR retrotransposable elements.
New Biol.
4:430-440[Medline].
|
| 15.
|
Garvik, B.,
M. Carson, and L. Hartwell.
1995.
Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint.
Mol. Cell. Biol.
15:6128-6138[Abstract].
|
| 16.
|
Gravel, S.,
M. Larrivee,
P. Labrecque, and R. J. Wellinger.
1998.
Yeast Ku as a regulator of chromosomal DNA end structure.
Science
280:741-744[Abstract/Free Full Text].
|
| 17.
|
Higashiyama, T.,
Y. Noutoshi,
M. Fujie, and T. Yamada.
1997.
Zepp, a LINE-like retrotransposon accumulated in the Chlorella telomeric region.
EMBO J.
16:3715-3723[Medline].
|
| 18.
|
Le, S.,
J. Moore,
J. Haber, and C. Greider.
1999.
RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase.
Genetics
152:143-152[Abstract/Free Full Text].
|
| 19.
|
Lendvay, T. S.,
D. K. Morris,
J. Sah,
B. Balasubramanian, and V. Lundblad.
1996.
Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes.
Genetics
144:1399-1412[Abstract].
|
| 20.
|
Lin, J.-J., and V. A. Zakian.
1995.
An in vitro assay for Saccharomyces telomerase requires EST1.
Cell
81:1127-1135[Medline].
|
| 21.
|
Lingner, J.,
T. R. Cech,
T. R. Hughes, and V. Lundblad.
1997.
Three Ever Shorter Telomere (EST) genes are dispensable for in vitro yeast telomerase activity.
Proc. Natl. Acad. Sci. USA
94:11190-11195[Abstract/Free Full Text].
|
| 22.
|
Lingner, J.,
T. R. Hughes,
A. Shevchenko,
M. Mann,
V. Lundblad, and T. R. Cech.
1997.
Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science
276:561-567[Abstract/Free Full Text].
|
| 23.
|
Lopez, C. C.,
L. Nielsen, and J. E. Edstrom.
1996.
Terminal long tandem repeats in chromosomes from Chironomus pallidivittatus.
Mol. Cell. Biol.
16:3285-3290[Abstract].
|
| 24.
|
Louis, E. J., and J. E. Haber.
1990.
Mitotic recombination among subtelomeric Y' repeats in Saccharomyces cerevisiae.
Genetics
124:547-559[Abstract].
|
| 25.
|
Louis, E. J., and J. E. Haber.
1992.
The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae.
Genetics
131:559-574[Abstract].
|
| 26.
|
Louis, E. J.,
E. S. Naumova,
A. Lee,
G. Naumov, and J. E. Haber.
1994.
The chromosome end in yeast: its mosaic nature and influence on recombinational dynamics.
Genetics
136:789-802[Abstract].
|
| 27.
|
Lundblad, V., and E. H. Blackburn.
1993.
An alternative pathway for yeast telomere maintenance rescues est senescence.
Cell
73:347-360[Medline].
|
| 28.
|
Lundblad, V., and J. W. Szostak.
1989.
A mutant with a defect in telomere elongation leads to senescence in yeast.
Cell
57:633-643[Medline].
|
| 29.
|
McEachern, M. J., and E. H. Blackburn.
1996.
Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomerase.
Genes Dev.
10:1822-1834[Abstract/Free Full Text].
|
| 30.
|
Monson, E. K.,
D. de Bruin, and V. A. Zakian.
1997.
The yeast Cac1 protein is required for the stable inheritance of transcriptionally repressed chromatin at telomeres.
Proc. Natl. Acad. Sci. USA
94:13081-13086[Abstract/Free Full Text].
|
| 31.
|
Moore, J. K., and J. E. Haber.
1996.
Capture of retrotransposon DNA at the sites of chromosomal double-strand breaks.
Nature
383:644-646[Medline].
|
| 32.
|
Murnane, J. P.,
L. Sabatier,
B. A. Marder, and W. F. Morgan.
1994.
Telomere dynamics in an immortal human cell line.
EMBO J.
13:4953-4962[Medline].
|
| 33.
|
Nakamura, T. M.,
J. P. Cooper, and T. R. Cech.
1998.
Two modes of survival of fission yeast without telomerase.
Science
282:493-496[Abstract/Free Full Text].
|
| 34.
|
Nakamura, T. M.,
G. B. Morin,
K. B. Chapman,
S. L. Weinrich,
W. H. Andrews,
J. Lingner,
C. B. Harley, and T. R. Cech.
1997.
Telomerase catalytic subunit homologs from fission yeast and human.
Science
277:955-959[Abstract/Free Full Text].
|
| 35.
|
Nugent, C. I.,
T. R. Hughes,
N. F. Lue, and V. Lundblad.
1996.
Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance.
Science
274:249-252[Abstract/Free Full Text].
|
| 36.
|
Nugent, C. I., and V. Lundblad.
1998.
The telomerase reverse transcriptase: components and regulation.
Genes Dev.
12:1073-1085[Free Full Text].
|
| 37.
|
Ochman, H.,
A. S. Gerber, and D. L. Hartl.
1988.
Genetic applications of an inverse polymerase chain reaction.
Genetics
120:621-623[Abstract/Free Full Text].
|
| 38.
|
Pluta, A. F., and V. A. Zakian.
1989.
Recombination occurs during telomere formation in yeast.
Nature
337:429-433[Medline].
|
| 39.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 40.
|
Roth, C. W.,
F. Kobeski,
M. F. Walter, and H. Biessmann.
1997.
Chromosome end elongation by recombination in the mosquito Anopheles gambiae.
Mol. Cell. Biol.
17:5176-5183[Abstract].
|
| 41.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 42.
|
Sandell, L. L., and V. A. Zakian.
1993.
Loss of a yeast telomere: arrest, recovery and chromosome loss.
Cell
75:729-739[Medline].
|
| 43.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 44.
|
Singer, M. S., and D. E. Gottschling.
1994.
TLC1, the template RNA component of the Saccharomyces cerevisiae telomerase.
Science
266:404-409[Abstract/Free Full Text].
|
| 45.
|
Teng, S. C.,
B. Kim, and A. Gabriel.
1996.
Retrotransposon reverse-transcriptase-mediated repair of chromosomal breaks.
Nature
383:641-644[Medline].
|
| 45a.
| Teng, S.-C., B. McCowan, and V. Zakian.
Unpublished data.
|
| 46.
|
Walmsley, R. M.,
C. S. M. Chan,
B.-K. Tye, and T. D. Petes.
1984.
Unusual DNA sequences associated with the ends of yeast chromosomes.
Nature
310:157-160[Medline].
|
| 47.
|
Wang, S.-S., and V. A. Zakian.
1990.
Telomere-telomere recombination provides an express pathway for telomere acquisition.
Nature
345:456-458[Medline].
|
| 48.
|
Zakian, V. A., and H. M. Blanton.
1988.
Distribution of telomere-associated sequences on natural chromosomes of Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:2257-2260[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1999, p. 8083-8093, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tseng, S.-F., Shen, Z.-J., Tsai, H.-J., Lin, Y.-H., Teng, S.-C.
(2009). Rapid Cdc13 turnover and telomere length homeostasis are controlled by Cdk1-mediated phosphorylation of Cdc13. Nucleic Acids Res
37: 3602-3611
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2009). Telomerase- and Rad52-Independent Immortalization of Budding Yeast by an Inherited-Long-Telomere Pathway of Telomeric Repeat Amplification. Mol. Cell. Biol.
29: 965-985
[Abstract]
[Full Text]
-
Nabetani, A., Ishikawa, F.
(2009). Unusual Telomeric DNAs in Human Telomerase-Negative Immortalized Cells. Mol. Cell. Biol.
29: 703-713
[Abstract]
[Full Text]
-
Bechard, L. H., Butuner, B. D., Peterson, G. J., McRae, W., Topcu, Z., McEachern, M. J.
(2009). Mutant Telomeric Repeats in Yeast Can Disrupt the Negative Regulation of Recombination-Mediated Telomere Maintenance and Create an Alternative Lengthening of Telomeres-Like Phenotype. Mol. Cell. Biol.
29: 626-639
[Abstract]
[Full Text]
-
Lee, J. Y., Mogen, J. L., Chavez, A., Johnson, F. B.
(2008). Sgs1 RecQ Helicase Inhibits Survival of Saccharomyces cerevisiae Cells Lacking Telomerase and Homologous Recombination. J. Biol. Chem.
283: 29847-29858
[Abstract]
[Full Text]
-
Gagos, S., Chiourea, M., Christodoulidou, A., Apostolou, E., Raftopoulou, C., Deustch, S., Jefford, C.-E., Irminger-Finger, I., Shay, J. W., Antonarakis, S. E.
(2008). Pericentromeric Instability and Spontaneous Emergence of Human Neoacrocentric and Minute Chromosomes in the Alternative Pathway of Telomere Lengthening. Cancer Res.
68: 8146-8155
[Abstract]
[Full Text]
-
Maxwell, P. H., Curcio, M. J.
(2008). Incorporation of Y'-Ty1 cDNA Destabilizes Telomeres in Saccharomyces cerevisiae Telomerase-Negative Mutants. Genetics
179: 2313-2317
[Abstract]
[Full Text]
-
Deem, A., Barker, K., VanHulle, K., Downing, B., Vayl, A., Malkova, A.
(2008). Defective Break-Induced Replication Leads to Half-Crossovers in Saccharomyces cerevisiae. Genetics
179: 1845-1860
[Abstract]
[Full Text]
-
Vernon, M., Lobachev, K., Petes, T. D.
(2008). High Rates of "Unselected" Aneuploidy and Chromosome Rearrangements in tel1 mec1 Haploid Yeast Strains. Genetics
179: 237-247
[Abstract]
[Full Text]
-
Subramanian, L., Moser, B. A., Nakamura, T. M.
(2008). Recombination-Based Telomere Maintenance Is Dependent on Tel1-MRN and Rap1 and Inhibited by Telomerase, Taz1, and Ku in Fission Yeast. Mol. Cell. Biol.
28: 1443-1455
[Abstract]
[Full Text]
-
Cesare, A. J., Groff-Vindman, C., Compton, S. A., McEachern, M. J., Griffith, J. D.
(2008). Telomere Loops and Homologous Recombination-Dependent Telomeric Circles in a Kluyveromyces lactis Telomere Mutant Strain. Mol. Cell. Biol.
28: 20-29
[Abstract]
[Full Text]
-
Makovets, S., Williams, T. L., Blackburn, E. H.
(2008). The Telotype Defines the Telomere State in Saccharomyces cerevisiae and Is Inherited as a Dominant Non-Mendelian Characteristic in Cells Lacking Telomerase. Genetics
178: 245-257
[Abstract]
[Full Text]
-
Maxwell, P. H., Curcio, M. J.
(2007). Retrosequence formation restructures the yeast genome. Genes Dev.
21: 3308-3318
[Abstract]
[Full Text]
-
Petreaca, R. C., Chiu, H.-C., Nugent, C. I.
(2007). The Role of Stn1p in Saccharomyces cerevisiae Telomere Capping Can Be Separated From Its Interaction With Cdc13p. Genetics
177: 1459-1474
[Abstract]
[Full Text]
-
Johnson, J. E., Gettings, E. J., Schwalm, J., Pei, J., Testa, J. R., Litwin, S., von Mehren, M., Broccoli, D.
(2007). Whole-Genome Profiling in Liposarcomas Reveals Genetic Alterations Common to Specific Telomere Maintenance Mechanisms. Cancer Res.
67: 9221-9228
[Abstract]
[Full Text]
-
Pike, B. L., Heierhorst, J.
(2007). Mdt1 Facilitates Efficient Repair of Blocked DNA Double-Strand Breaks and Recombinational Maintenance of Telomeres. Mol. Cell. Biol.
27: 6532-6545
[Abstract]
[Full Text]
-
Mutiu, A. I., Hoke, S. M. T., Genereaux, J., Hannam, C., MacKenzie, K., Jobin-Robitaille, O., Guzzo, J., Cote, J., Andrews, B., Haniford, D. B., Brandl, C. J.
(2007). Structure/Function Analysis of the Phosphatidylinositol-3-Kinase Domain of Yeast Tra1. Genetics
177: 151-166
[Abstract]
[Full Text]
-
Yu, E. Y., Steinberg-Neifach, O., Dandjinou, A. T., Kang, F., Morrison, A. J., Shen, X., Lue, N. F.
(2007). Regulation of Telomere Structure and Functions by Subunits of the INO80 Chromatin Remodeling Complex. Mol. Cell. Biol.
27: 5639-5649
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2007). Control of the yeast telomeric senescence survival pathways of recombination by the Mec1 and Mec3 DNA damage sensors and RPA. Nucleic Acids Res
35: 822-838
[Abstract]
[Full Text]
-
Otterlei, M., Bruheim, P., Ahn, B., Bussen, W., Karmakar, P., Baynton, K., Bohr, V. A.
(2006). Werner syndrome protein participates in a complex with RAD51, RAD54, RAD54B and ATR in response to ICL-induced replication arrest. J. Cell Sci.
119: 5137-5146
[Abstract]
[Full Text]
-
Tseng, S.-F., Lin, J.-J., Teng, S.-C.
(2006). The telomerase-recruitment domain of the telomere binding protein Cdc13 is regulated by Mec1p/Tel1p-dependent phosphorylation. Nucleic Acids Res
34: 6327-6336
[Abstract]
[Full Text]
-
Dreesen, O., Cross, G. A. M.
(2006). Telomerase-Independent Stabilization of Short Telomeres in Trypanosoma brucei.. Mol. Cell. Biol.
26: 4911-4919
[Abstract]
[Full Text]
-
Tsai, H.-J., Huang, W.-H., Li, T.-K., Tsai, Y.-L., Wu, K.-J., Tseng, S.-F., Teng, S.-C.
(2006). Involvement of Topoisomerase III in Telomere-Telomere Recombination. J. Biol. Chem.
281: 13717-13723
[Abstract]
[Full Text]
-
Azam, M., Lee, J. Y., Abraham, V., Chanoux, R., Schoenly, K. A., Johnson, F. B.
(2006). Evidence that the S.cerevisiae Sgs1 protein facilitates recombinational repair of telomeres during senescence. Nucleic Acids Res
34: 506-516
[Abstract]
[Full Text]
-
Hansen, K. R., Ibarra, P. T., Thon, G.
(2006). Evolutionary-conserved telomere-linked helicase genes of fission yeast are repressed by silencing factors, RNAi components and the telomere-binding protein Taz1. Nucleic Acids Res
34: 78-88
[Abstract]
[Full Text]
-
Steinberg-Neifach, O., Lue, N. F.
(2006). Modulation of telomere terminal structure by telomerase components in Candida albicans.. Nucleic Acids Res
34: 2710-2722
[Abstract]
[Full Text]
-
Muntoni, A., Reddel, R. R.
(2005). The first molecular details of ALT in human tumor cells. Hum Mol Genet
14: R191-R196
[Abstract]
[Full Text]
-
Iyer, S., Chadha, A. D., McEachern, M. J.
(2005). A Mutation in the STN1 Gene Triggers an Alternative Lengthening of Telomere-Like Runaway Recombinational Telomere Elongation and Rapid Deletion in Yeast. Mol. Cell. Biol.
25: 8064-8073
[Abstract]
[Full Text]
-
Ghosal, G., Muniyappa, K.
(2005). Saccharomyces cerevisiae Mre11 is a high-affinity G4 DNA-binding protein and a G-rich DNA-specific endonuclease: implications for replication of telomeric DNA. Nucleic Acids Res
33: 4692-4703
[Abstract]
[Full Text]
-
Lillard-Wetherell, K., Combs, K. A., Groden, J.
(2005). BLM Helicase Complements Disrupted Type II Telomere Lengthening in Telomerase-Negative sgs1 Yeast. Cancer Res.
65: 5520-5522
[Abstract]
[Full Text]
-
Chen, Y.-B., Yang, C.-P., Li, R.-X., Zeng, R., Zhou, J.-Q.
(2005). Def1p Is Involved in Telomere Maintenance in Budding Yeast. J. Biol. Chem.
280: 24784-24791
[Abstract]
[Full Text]
-
Li, S., Crothers, J., Haqq, C. M., Blackburn, E. H.
(2005). Cellular and Gene Expression Responses Involved in the Rapid Growth Inhibition of Human Cancer Cells by RNA Interference-mediated Depletion of Telomerase RNA. J. Biol. Chem.
280: 23709-23717
[Abstract]
[Full Text]
-
Groff-Vindman, C., Cesare, A. J., Natarajan, S., Griffith, J. D., McEachern, M. J.
(2005). Recombination at Long Mutant Telomeres Produces Tiny Single- and Double-Stranded Telomeric Circles. Mol. Cell. Biol.
25: 4406-4412
[Abstract]
[Full Text]
-
Jiang, W.-Q., Zhong, Z.-H., Henson, J. D., Neumann, A. A., Chang, A. C.-M., Reddel, R. R.
(2005). Suppression of Alternative Lengthening of Telomeres by Sp100-Mediated Sequestration of the MRE11/RAD50/NBS1 Complex. Mol. Cell. Biol.
25: 2708-2721
[Abstract]
[Full Text]
-
Fasching, C. L., Bower, K., Reddel, R. R.
(2005). Telomerase-Independent Telomere Length Maintenance in the Absence of Alternative Lengthening of Telomeres-Associated Promyelocytic Leukemia Bodies. Cancer Res.
65: 2722-2729
[Abstract]
[Full Text]
-
Topcu, Z., Nickles, K., Davis, C., McEachern, M. J.
(2005). Abrupt disruption of capping and a single source for recombinationally elongated telomeres in Kluyveromyces lactis. Proc. Natl. Acad. Sci. USA
102: 3348-3353
[Abstract]
[Full Text]
-
Malkova, A., Naylor, M. L., Yamaguchi, M., Ira, G., Haber, J. E.
(2005). RAD51-Dependent Break-Induced Replication Differs in Kinetics and Checkpoint Responses from RAD51-Mediated Gene Conversion. Mol. Cell. Biol.
25: 933-944
[Abstract]
[Full Text]
-
Lin, C.-Y., Chang, H.-H., Wu, K.-J., Tseng, S.-F., Lin, C.-C., Lin, C.-P., Teng, S.-C.
(2005). Extrachromosomal Telomeric Circles Contribute to Rad52-, Rad50-, and Polymerase {delta}-Mediated Telomere-Telomere Recombination in Saccharomyces cerevisiae. Eukaryot Cell
4: 327-336
[Abstract]
[Full Text]
-
Maxwell, P. H., Coombes, C., Kenny, A. E., Lawler, J. F., Boeke, J. D., Curcio, M. J.
(2004). Ty1 Mobilizes Subtelomeric Y' Elements in Telomerase-Negative Saccharomyces cerevisiae Survivors. Mol. Cell. Biol.
24: 9887-9898
[Abstract]
[Full Text]
-
Cesare, A. J., Griffith, J. D.
(2004). Telomeric DNA in ALT Cells Is Characterized by Free Telomeric Circles and Heterogeneous t-Loops. Mol. Cell. Biol.
24: 9948-9957
[Abstract]
[Full Text]
-
Lillard-Wetherell, K., Machwe, A., Langland, G. T., Combs, K. A., Behbehani, G. K., Schonberg, S. A., German, J., Turchi, J. J., Orren, D. K., Groden, J.
(2004). Association and regulation of the BLM helicase by the telomere proteins TRF1 and TRF2. Hum Mol Genet
13: 1919-1932
[Abstract]
[Full Text]
-
d'Adda di Fagagna, F., Teo, S.-H., Jackson, S. P.
(2004). Functional links between telomeres and proteins of the DNA-damage response. Genes Dev.
18: 1781-1799
[Abstract]
[Full Text]
-
Razak, Z. R. A., Varkonyi, R. J., Kulp-McEliece, M., Caslini, C., Testa, J. R., Murphy, M. E., Broccoli, D.
(2004). p53 Differentially Inhibits Cell Growth Depending on the Mechanism of Telomere Maintenance. Mol. Cell. Biol.
24: 5967-5977
[Abstract]
[Full Text]
-
Edmonds, D., Breitkreutz, B.-J., Harrington, L.
(2004). A genome-wide telomere screen in yeast: The long and short of it all. Proc. Natl. Acad. Sci. USA
101: 9515-9516
[Full Text]
-
Bechter, O. E., Zou, Y., Walker, W., Wright, W. E., Shay, J. W.
(2004). Telomeric Recombination in Mismatch Repair Deficient Human Colon Cancer Cells after Telomerase Inhibition. Cancer Res.
64: 3444-3451
[Abstract]
[Full Text]
-
Underwood, D. H., Carroll, C., McEachern, M. J.
(2004). Genetic Dissection of the Kluyveromyces lactis Telomere and Evidence for Telomere Capping Defects in TER1 Mutants with Long Telomeres. Eukaryot Cell
3: 369-384
[Abstract]
[Full Text]
-
Maringele, L., Lydall, D.
(2004). EXO1 Plays a Role in Generating Type I and Type II Survivors in Budding Yeast. Genetics
166: 1641-1649
[Abstract]
[Full Text]
-
Bertuch, A. A., Lundblad, V.
(2004). EXO1 Contributes to Telomere Maintenance in Both Telomerase-Proficient and Telomerase-Deficient Saccharomyces cerevisiae. Genetics
166: 1651-1659
[Abstract]
[Full Text]
-
Enomoto, S., Glowczewski, L., Lew-Smith, J., Berman, J. G.
(2004). Telomere Cap Components Influence the Rate of Senescence in Telomerase-Deficient Yeast Cells. Mol. Cell. Biol.
24: 837-845
[Abstract]
[Full Text]
-
Scholes, D. T., Kenny, A. E., Gamache, E. R., Mou, Z., Curcio, M. J.
(2003). Activation of a LTR-retrotransposon by telomere erosion. Proc. Natl. Acad. Sci. USA
100: 15736-15741
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2003). Mitotic Cyclins Regulate Telomeric Recombination in Telomerase-Deficient Yeast Cells. Mol. Cell. Biol.
23: 9162-9177
[Abstract]
[Full Text]
-
Tsukamoto, M., Yamashita, K., Miyazaki, T., Shinohara, M., Shinohara, A.
(2003). The N-Terminal DNA-Binding Domain of Rad52 Promotes RAD51-Independent Recombination in Saccharomyces cerevisiae. Genetics
165: 1703-1715
[Abstract]
[Full Text]
-
Lydall, D.
(2003). Hiding at the ends of yeast chromosomes: telomeres, nucleases and checkpoint pathways. J. Cell Sci.
116: 4057-4065
[Abstract]
[Full Text]
-
Natarajan, S., Groff-Vindman, C., McEachern, M. J.
(2003). Factors Influencing the Recombinational Expansion and Spread of Telomeric Tandem Arrays in Kluyveromyces lactis. Eukaryot Cell
2: 1115-1127
[Abstract]
[Full Text]
-
Kibe, T., Tomita, K., Matsuura, A., Izawa, D., Kodaira, T., Ushimaru, T., Uritani, M., Ueno, M.
(2003). Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer. Nucleic Acids Res
31: 5054-5063
[Abstract]
[Full Text]
-
Lowell, J. E., Roughton, A. I., Lundblad, V., Pillus, L.
(2003). Telomerase-Independent Proliferation Is Influenced by Cell Type in Saccharomyces cerevisiae. Genetics
164: 909-921
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2003). The Rad51 Pathway of Telomerase-Independent Maintenance of Telomeres Can Amplify TG1-3 Sequences in yku and cdc13 Mutants of Saccharomyces cerevisiae. Mol. Cell. Biol.
23: 3721-3734
[Abstract]
[Full Text]
-
Wu, G., Jiang, X., Lee, W.-H., Chen, P.-L.
(2003). Assembly of Functional ALT-associated Promyelocytic Leukemia Bodies Requires Nijmegen Breakage Syndrome 1. Cancer Res.
63: 2589-2595
[Abstract]
[Full Text]
-
Hahn, W. C.
(2003). Role of Telomeres and Telomerase in the Pathogenesis of Human Cancer. JCO
21: 2034-2043
[Abstract]
[Full Text]
-
Gallego, M. E., Jalut, N., White, C. I.
(2003). Telomerase Dependence of Telomere Lengthening in ku80 Mutant Arabidopsis. Plant Cell
15: 782-789
[Abstract]
[Full Text]
-
IJpma, A. S., Greider, C. W.
(2003). Short Telomeres Induce a DNA Damage Response in Saccharomyces cerevisiae. Mol. Biol. Cell
14: 987-1001
[Abstract]
[Full Text]
-
Friedman, K. L., Heit, J. J., Long, D. M., Cech, T. R.
(2003). N-terminal Domain of Yeast Telomerase Reverse Transcriptase: Recruitment of Est3p to the Telomerase Complex. Mol. Biol. Cell
14: 1-13
[Abstract]
[Full Text]
-
Symington, L. S.
(2002). Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair. Microbiol. Mol. Biol. Rev.
66: 630-670
[Abstract]
[Full Text]
-
Stavropoulos, D. J., Bradshaw, P. S., Li, X., Pasic, I., Truong, K., Ikura, M., Ungrin, M., Meyn, M. S.
(2002). The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet
11: 3135-3144
[Abstract]
[Full Text]
-
Parenteau, J., Wellinger, R. J.
(2002). Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease. Genetics
162: 1583-1594
[Abstract]
[Full Text]
-
Newbold, R. F.
(2002). The significance of telomerase activation and cellular immortalization in human cancer. Mutagenesis
17: 539-550
[Abstract]
[Full Text]
-
Seto, A. G., Livengood, A. J., Tzfati, Y., Blackburn, E. H., Cech, T. R.
(2002). A bulged stem tethers Est1p to telomerase RNA in budding yeast. Genes Dev.
16: 2800-2812
[Abstract]
[Full Text]
-
Melnikova, L., Georgiev, P.
(2002). Enhancer of terminal gene conversion, a New Mutation in Drosophila melanogaster That Induces Telomere Elongation by Gene Conversion. Genetics
162: 1301-1312
[Abstract]
[Full Text]
-
Ira, G., Haber, J. E.
(2002). Characterization of RAD51-Independent Break-Induced Replication That Acts Preferentially with Short Homologous Sequences. Mol. Cell. Biol.
22: 6384-6392
[Abstract]
[Full Text]
-
Tsai, Y.-L., Tseng, S.-F., Chang, S.-H., Lin, C.-C., Teng, S.-C.
(2002). Involvement of Replicative Polymerases, Tel1p, Mec1p, Cdc13p, and the Ku Complex in Telomere-Telomere Recombination. Mol. Cell. Biol.
22: 5679-5687
[Abstract]
[Full Text]
-
Kolodner, R. D., Putnam, C. D., Myung, K.
(2002). Maintenance of Genome Stability in Saccharomyces cerevisiae. Science
297: 552-557
[Abstract]
[Full Text]
-
Maser, R. S., DePinho, R. A.
(2002). Connecting Chromosomes, Crisis, and Cancer. Science
297: 565-569
[Abstract]
[Full Text]
-
Ohya, T., Kawasaki, Y., Hiraga, S.-I., Kanbara, S., Nakajo, K., Nakashima, N., Suzuki, A., Sugino, A.
(2002). The DNA Polymerase Domain of polepsilon Is Required for Rapid, Efficient, and Highly Accurate Chromosomal DNA Replication, Telomere Length Maintenance, and Normal Cell Senescence in Saccharomyces cerevisiae. J. Biol. Chem.
277: 28099-28108
[Abstract]
[Full Text]
-
Nautiyal, S., DeRisi, J. L., Blackburn, E. H.
(2002). The genome-wide expression response to telomerase deletion in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
99: 9316-9321
[Abstract]
[Full Text]
-
Natarajan, S., McEachern, M. J.
(2002). Recombinational Telomere Elongation Promoted by DNA Circles. Mol. Cell. Biol.
22: 4512-4521
[Abstract]
[Full Text]
-
DuBois, M. L., Haimberger, Z. W., McIntosh, M. W., Gottschling, D. E.
(2002). A Quantitative Assay for Telomere Protection in Saccharomyces cerevisiae. Genetics
161: 995-1013
[Abstract]
[Full Text]
-
Choe, W., Budd, M., Imamura, O., Hoopes, L., Campbell, J. L.
(2002). Dynamic Localization of an Okazaki Fragment Processing Protein Suggests a Novel Role in Telomere Replication. Mol. Cell. Biol.
22: 4202-4217
[Abstract]
[Full Text]
-
Craven, R. J., Greenwell, P. W., Dominska, M., Petes, T. D.
(2002). Regulation of Genome Stability by TEL1 and MEC1, Yeast Homologs of the Mammalian ATM and ATR Genes. Genetics
161: 493-507
[Abstract]
[Full Text]
-
Samper, E., Fernandez, P., Eguia, R., Martin-Rivera, L., Bernad, A., Blasco, M. A., Aracil, M.
(2002). Long-term repopulating ability of telomerase-deficient murine hematopoietic stem cells. Blood
99: 2767-2775
[Abstract]
[Full Text]
-
Lewis, L. K., Karthikeyan, G., Westmoreland, J. W., Resnick, M. A.
(2002). Differential Suppression of DNA Repair Deficiencies of Yeast rad50, mre11 and xrs2 Mutants by EXO1 and TLC1 (the RNA Component of Telomerase). Genetics
160: 49-62
[Abstract]
[Full Text]
-
McEachern, M. J., Underwood, D. H., Blackburn, E. H.
(2002). Dynamics of Telomeric DNA Turnover in Yeast. Genetics
160: 63-73
[Abstract]
[Full Text]
-
Siriaco, G. M., Cenci, G., Haoudi, A., Champion, L. E., Zhou, C., Gatti, M., Mason, J. M.
(2002). Telomere elongation (Tel), a New Mutation in Drosophila melanogaster That Produces Long Telomeres. Genetics
160: 235-245
[Abstract]
[Full Text]
-
Grossi, S., Bianchi, A., Damay, P., Shore, D.
(2001). Telomere Formation by Rap1p Binding Site Arrays Reveals End-Specific Length Regulation Requirements and Active Telomeric Recombination. Mol. Cell. Biol.
21: 8117-8128
[Abstract]
[Full Text]
-
Scholes, D. T., Banerjee, M., Bowen, B., Curcio, M. J.
(2001). Multiple Regulators of Ty1 Transposition in Saccharomyces cerevisiae Have Conserved Roles in Genome Maintenance. Genetics
159: 1449-1465
[Abstract]
[Full Text]
-
Bucholc, M., Park, Y., Lustig, A. J.
(2001). Intrachromatid Excision of Telomeric DNA as a Mechanism for Telomere Size Control in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 6559-6573
[Abstract]
[Full Text]
-
Grobelny, J. V., Kulp-McEliece, M., Broccoli, D.
(2001). Effects of reconstitution of telomerase activity on telomere maintenance by the alternative lengthening of telomeres (ALT) pathway. Hum Mol Genet
10: 1953-1961
[Abstract]
[Full Text]
-
Kraus, E., Leung, W.-Y., Haber, J. E.
(2001). Break-induced replication: A review and an example in budding yeast. Proc. Natl. Acad. Sci. USA
98: 8255-8262
[Abstract]
[Full Text]
-
Meier, B., Driller, L., Jaklin, S., Feldmann, H. M.
(2001). New Function of CDC13 in Positive Telomere Length Regulation. Mol. Cell. Biol.
21: 4233-4245
[Abstract]
[Full Text]
-
Perrem, K., Colgin, L. M., Neumann, A. A., Yeager, T. R., Reddel, R. R.
(2001). Coexistence of Alternative Lengthening of Telomeres and Telomerase in hTERT-Transfected GM847 Cells. Mol. Cell. Biol.
21: 3862-3875
[Abstract]
[Full Text]
-
Ray, A., Runge, K. W.
(2001). Yeast telomerase appears to frequently copy the entire template in vivo. Nucleic Acids Res
29: 2382-2394
[Abstract]
[Full Text]
-
Malkova, A., Signon, L., Schaefer, C. B., Naylor, M. L., Theis, J. F., Newlon, C. S., Haber, J. E.
(2001). RAD51-independent break-induced replication to repair a broken chromosome depends on a distant enhancer site. Genes Dev.
15: 1055-1060
[Abstract]
[Full Text]
-
Signon, L., Malkova, A., Naylor, M. L., Klein, H., Haber, J. E.
(2001). Genetic Requirements for RAD51- and RAD54-Independent Break-Induced Replication Repair of a Chromosomal Double-Strand Break. Mol. Cell. Biol.
21: 2048-2056
[Abstract]
[Full Text]
-
Chen, Q., Ijpma, A., Greider, C. W.
(2001). Two Survivor Pathways That Allow Growth in the Absence of Telomerase Are Generated by Distinct Telomere Recombination Events. Mol. Cell. Biol.
21: 1819-1827
[Abstract]
[Full Text]
-
Cohen, H., Sinclair, D. A.
(2001). Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase. Proc. Natl. Acad. Sci. USA
10.1073/pnas.061579598v1
[Abstract]
[Full Text]
-
Gallego, M. E., White, C. I.
(2001). RAD50 function is essential for telomere maintenance in Arabidopsis. Proc. Natl. Acad. Sci. USA
98: 1711-1716
[Abstract]
[Full Text]
-
Grandin, N., Damon, C., Charbonneau, M.
(2000). Cdc13 Cooperates with the Yeast Ku Proteins and Stn1 To Regulate Telomerase Recruitment. Mol. Cell. Biol.
20: 8397-8408
[Abstract]
[Full Text]
-
Tomaska, L., Nosek, J., Makhov, A. M., Pastorakova, A., Griffith, J. D.
(2000). Extragenomic double-stranded DNA circles in yeast with linear mitochondrial genomes: potential involvement in telomere maintenance. Nucleic Acids Res
28: 4479-4487
[Abstract]
[Full Text]