Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 1999, p. 8103-8112, Vol. 19, No. 12
School of Biology, Georgia Institute of
Technology, Atlanta, Georgia 30332-0230
Received 10 May 1999/Returned for modification 29 June
1999/Accepted 30 August 1999
Propagation of the yeast protein-based non-Mendelian element
[PSI], a prion-like form of the release factor Sup35, was
shown to be regulated by the interplay between chaperone proteins
Hsp104 and Hsp70. While overproduction of Hsp104 protein cures cells of
[PSI], overproduction of the Ssa1 protein of the Hsp70
family protects [PSI] from the curing effect of Hsp104.
Here we demonstrate that another protein of the Hsp70 family, Ssb,
previously implicated in nascent polypeptide folding and protein
turnover, exhibits effects on [PSI] which are opposite
those of Ssa. Ssb overproduction increases, while Ssb depletion
decreases, [PSI] curing by the overproduced Hsp104. Both
spontaneous [PSI] formation and [PSI] induction by overproduction of the homologous or heterologous Sup35 protein are increased significantly in the strain lacking Ssb.
This is the first example when inactivation of an unrelated cellular
protein facilitates prion formation. Ssb is therefore playing a role in
protein-based inheritance, which is analogous to the role played by the
products of mutator genes in nucleic acid-based inheritance. Ssb
depletion also decreases toxicity of the overproduced Sup35 and causes
extreme sensitivity to the [PSI]-curing chemical agent
guanidine hydrochloride. Our data demonstrate that various members of
the yeast Hsp70 family have diverged from each other in regard to their
roles in prion propagation and suggest that Ssb could serve as a
proofreading component of the enzymatic system, which prevents
formation of prion aggregates.
Prions are infectious proteins which
are believed to reproduce by turning the normal protein into prion
form. The PrPSc protein, a prion isoform of the mammalian
prion protein PrP, is associated with neurodegenerative diseases such
as sheep scrapie, bovine spongiform encephalopathy (mad cow disease),
and human Creutzfeldt-Jacob disease (see reference
48 for a review). Characteristics of brain damage,
observed in prion-infected patients, resemble those observed in
patients with other types of neural inclusion diseases, such as
Alzheimer's and Huntington diseases, indicating similarities in the
mechanisms of cellular toxicity between these disorders.
In yeast and fungi, prions manifest themselves as non-Mendelian
elements inherited via the cytoplasm (58). Therefore, prion proteins serve as genetic material transmitting information about inherited traits (60). Examples of yeast and fungal
prion-based genetic elements characterized to date include
Saccharomyces cerevisiae [URE3] (1,
58) and [PSI] (15, 17, 58) and
Podospora anserina [Het-S] (14).
Among those, [PSI] element is of specific interest.
Yeast [PSI] is a prion-like polymerized derivative of the
ribosome release factor Sup35 (eRF3) (see references
34 and 59 for reviews). The
polymerized Sup35 protein (Sup35PSI) is defective in
termination of translation, resulting in translational readthrough
of termination codons (nonsense suppression). Properties of the
Sup35PSI prion aggregates, observed in vivo (44,
45) and in vitro (27, 31, 46), resemble those of
PrPSc. The N-terminal portion of the Sup35 protein
(Sup35N), which is responsible for in vivo [PSI] formation
(21) and propagation (23, 56) and for in vitro
Sup35 polymerization (27), possesses similarities to both
PrP (17, 33) and huntingtin (20). Considering that Sup35 is an evolutionarily conserved eukaryotic protein which is
essential for such an important process as translation, it seems
evident that understanding the specifics of [PSI]
formation and propagation will shed light on the general mechanisms of
protein-based infectivity and inheritance.
Considering prions as protein mutants, one could suggest the existence
of cellular protein repair systems, which would normally prevent the
appearance and propagation of such mutants. Chaperones, which are
involved in protein folding and assembly/disassembly of the
multiprotein complexes, are likely participants in such protein repair
pathways. Thus far, the yeast Sup35/[PSI] system is the
only experimental model providing direct evidence for the chaperone
role in prion propagation. We have previously shown that
[PSI] can be cured by either overproduction or
inactivation of the chaperone protein Hsp104 (11). Hsp104 is
implicated in disaggregating the heat-damaged proteins in vivo
(43) and in vitro (26). Biochemical evidence
confirms that excess Hsp104 leads to the solubilization of the
Sup35PSI aggregates in vivo (44, 45). However,
high temperature and some other stresses, which induce Hsp104 and other
heat shock proteins, do not efficiently cure cells of
[PSI] (18, 54). Further investigating this
phenomenon, we have found out that overproduction of the Ssa1 protein,
a stress-inducible member of the Hsp70 family, protects
[PSI] from curing by excess Hsp104 and increases
translational readthrough by [PSI] (39).
This suggests that prions can use cellular stress defense systems for their own advantage. As in the case of the DNA repair machinery, the
protein repair machinery can be error prone.
The yeast Hsp70 family includes several subfamilies, of which the Ssa
and Ssb subfamilies are the most extensively investigated. The Ssb
subfamily includes two essentially identical proteins, Ssb1 and Ssb2
(38), collectively designated Ssb protein. While the Ssb
subfamily was initially observed only in yeast (3), recent
data have uncovered the existence of Ssb homologs in genomes of other
eukaryotes, such as the nematode Caenorhabditis elegans (13). In contrast to Ssa, Ssb protein is not required for
viability and is not involved in response to high-temperature stress in yeast (38). Genetic and biochemical data suggest that Ssb is involved in cotranslational folding of the nascent polypeptide (38, 47) and in protein turnover (41). Ssa and
Ssb proteins are not functionally interchangeable, although the
molecular basis of their divergence remains unclear (29).
In this study, we demonstrate that in strong contrast to Ssa, the Ssb
chaperone exhibits antagonistic effects on [PSI]. Formally speaking, the Ssb Yeast strains.
The S. cerevisiae strains used in
this study are described in Table 1. The
haploid [PSI+] strains OT55 and OT56, also
called [PSI+]1-1-74-D694 and
[PSI+]7-74-D694, respectively (21, 22,
39), and isogenic [psi
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Evidence for a Protein Mutator in Yeast: Role of the
Hsp70-Related Chaperone Ssb in Formation, Stability, and Toxicity
of the [PSI] Prion
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
derivatives manifest themselves as
mutators in regard to the protein-based hereditary system. Therefore,
two major subfamilies of the Hsp70 family, Ssa and Ssb, have
functionally diverged from each other in regard to their roles in prion
formation and propagation. Our data are in agreement with the existence
of the proofreading system, which involves Ssb protein and is aimed at
preventing formation of the prion aggregates.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
PIN+] strain OT60, also called
[psi
]-74-D694 (11, 22), were described
earlier. The haploid [PSI+] strains GT81-1C
and GT81-1D were obtained by A. Galkin as a result of sporulating and
dissecting the diploid strain GT81, constructed via
HO-mediated self-homozygotization of the haploid strain
GT56-34D (12). The [PSI+] strains
GT128, containing the ssb1
::HIS3
disruption, and GT127, containing the double
ssb1
::HIS3
ssb2
::URA3 disruption
(ssb1/2
), are derivatives of strain GT81-1C, constructed
as described below. Strain GT146 is a spontaneous Ura
derivative of strain GT127, selected on medium containing
5-fluoroorotic acid (30). The [psi
PIN+] derivatives of strains GT81-1C and GT146 were
obtained by transforming these strains with plasmid pYS-GAL104 (see
below), which bears the HSP104 gene under control of the
GAL promoter, and curing [PSI] as a result of
galactose-induced overproduction of Hsp104 as described earlier
(11, 22). The resulting [psi
]
derivatives were subsequently cured of plasmid pYS-GAL104. The [psi
pin
] derivatives of
strains GT81-1C, GT127, and GT146 were obtained by curing cells of
[PSI] and [PIN] after growth on YPD medium containing 5 mM guanidine hydrochloride (GuHCl) (22). The
haploid strain GT84-5A is isogenic to GT81-1C except that it contains the hsp104
::URA3 disruption, which
eliminates [PSI]. This strain was constructed by
sporulating and dissecting diploid strain GT84, which is a GT81
derivative with one of the HSP104 copies disrupted via
direct transplacement with the
hsp104
::URA3 allele as described above (11). All strains contain the
[PSI]-suppressible UGA mutation ade1-14, so
that [PSI+] strains are white and
Ade+, while [psi
] strains are
red and Ade
, as described previously (11).
TABLE 1.
S. cerevisiae strains used
Plasmids.
The centromeric URA3 plasmid pRS316
(53) and 2µm DNA-based multicopy plasmids YEp13, bearing
the LEU2 marker (4), and pEMBL-yex, bearing the
URA3 and LEU2-d markers (5), were
described previously. Plasmid pRS316GAL is a pRS316 derivative bearing
the galactose-inducible (GAL) promoter GAL1,10
(37). The centromeric plasmids pLA1, which contains the
HIS3 marker and GAL promoter, and pH28, which is
a pLA1 derivative bearing the HSP104 gene control of under
the GAL promoter, were described previously (39).
The centromeric plasmid pYS-GAL104 (11, 35) contains the
HSP104 gene under control of the GAL promoter and
the URA3 marker. The centromeric LEU2 plasmid
pLH105, kindly provided by S. Lindquist, contains the HSP104
gene under control of the constitutively expressed GPD
promoter. The previously described plasmids pEMBL-SUP35 (also called
pEMBL-SUP2) and pEMBL-SUP35-
Bal (also called pEMBL-SUP2-
Bal) are
pEMBL-yex derivatives which bear the complete S. cerevisiae SUP35 gene and the N-terminal 154 codons of the SUP35
gene, respectively, under control of the endogenous SUP35
promoter (55). The centromeric URA3 plasmid
CEN-GAL-SUP35 (also called pVK71) contains the complete S. cerevisiae SUP35 gene under control of the GAL promoter
(21). Plasmid pRS316GAL-SUP35Pm (12) is a
pRS316GAL derivative which contains the Pichia methanolica
SUP35 open reading frame (ORF) (32) placed under the
control of the GAL promoter. The centromeric URA3
plasmid YCp-SSB1, which is a pRS316 derivative bearing the wild-type
SSB1 gene under control of its endogenous promoter, was
kindly provided by M. Ohba (41). Plasmids pRS316GAL-SSB1#1 and pRS316GAL-SSB1#2 were constructed by PCR amplifying the
SSB1 ORF from the genome of S. cerevisiae S288C
and placing it into pRS316GAL under control of the GAL
promoter. Primers SSB1.EXT5 (5'-TACAGGATCCGTCCCAAGATCATTAC-AGTATT) and
SSB1.EXT3NEW (5'-TACAGCGGCCGCCATATATATGTGATGAATGCAG), which
are complementary to the 5' flanking region (positions
35 to
14)
and 3' flanking region (positions +1845 to +1866) of the S. cerevisiae SSB1 ORF, respectively, were used in PCR with
Pfu polymerase. These primers contain extensions bearing the
restriction sites for BamHI and NotI,
correspondingly. The PCR products were cut with BamHI and
NotI and ligated into the BamHI-NotI
cut pRS316GAL. To minimize the possible effect of PCR-generated errors,
two independent PCRs were performed, each leading to one plasmid
construct (1 or 2). Resulting plasmids pRS316GAL-SSB#1 and
pRS316GAL-SSB#2 produced identical results in all experiments described
below and are further designated pRS316GAL-SSB1. On galactose medium, either plasmid compensated for the ssb1/2
-associated
phenotypes, such as paromomycin sensitivity (Pars)
(38) and GuHCl sensitivity (Ghcs) (see below).
Western blot results confirm that yeast strains bearing any of these
plasmids exhibit increased levels of the Ssb protein on galactose
medium (40). Plasmids pBS-HIS3-I and pBS-URA3-I, used in
gene disruption experiments (see below), were constructed by inserting
the 1.7-kb fragment bearing the complete HIS3 gene and the
1.1-kb fragment bearing the complete URA3 gene, respectively, into pBluescript KS II(+) polylinker. The URA3
centromeric plasmids pUKC815 and pUKC819, which were used for the
quantitative measurement of UGA suppression, were kindly provided by
M. F. Tuite. These plasmids contain the in-frame fusions
PGK-lacZ and PGK-UGA-lacZ, respectively
(25).
Gene disruptions.
The direct PCR-mediated transplacement
protocol (2) was used to disrupt SSB1 and
SSB2 genes. Primers SSB1-BLUE.PRO
(5'-GATGT CCCAAGATCATTACAGTATTTTAATTGAACCTCACTATAGGGCGAA) and
SSB1-BLUE.TER (5'-TAAGTAATATTCATATATATGTGATGAATGCAGTCCCTCACTAAAGGGAACAA)
were designed in such a way that their 5' flanking portions were
complementary to the 5' and 3' flanks of the chromosomal
SSB1 gene, respectively. The 3' portions of the same primers
were complementary to sequences of the pBluescript KS II(+) polylinker,
located on the 5' and 3' sides, respectively, of the HIS3
insertion in plasmid pBS-HIS3-I. These primers were used to PCR amplify
the HIS3 fragment from pBS-HIS3-I in a Taq
polymerase-mediated reaction. The resulting HIS3 fragment,
which contains the complete HIS3 gene flanked by extensions
homologous to the flanks of the chromosomal copy of SSB1,
was gel purified and transformed into strain GT81-1C. Transformants were selected on His-deficient (
His) medium. The
ssb1
::HIS3 disruptants, in which the
complete SSB1 ORF is deleted and replaced by the
HIS3 gene in the same orientation, were verified by Southern hybridization as described below. One of these disruptants, GT128, was
used in further transplacement experiments employing primers SSB2-BLUE.PRO
(5'-TTTCAAGA AACCAAGAACCAATATCCTCATTAACACTCACTATAGGGCGAATT) and
SSB2-BLUE.TER
(5'-ATATATATGTGTATAACCTTAACCAGAATGACATCCCTCACTAAAGGGAACAA) to amplify the URA3 gene from plasmid pBS-URA3-I. The
resulting URA3 fragment, flanked by extensions homologous to
the 5' and 3' flanks of the chromosomal SSB2 gene in the
same orientation, was gel purified and transformed into strain GT128.
Transformants were selected on
Ura medium. One, containing a double
ssb1
::HIS3 ssb2
::URA3
(ssb1/2
) disruption, was verified by Southern
hybridization as described below. This ssb1/2
strain and
its derivatives exhibited slow growth at low temperature (20 to 25°C)
and sensitivity to the aminoglycoside antibiotics paromomycin and
hygromycin, as described previously (38).
Media and growth conditions. Standard yeast media, cultivation conditions, and standard procedures for yeast growth, sporulation, micromanipulation, and tetrad analysis were used (30). Gal medium contained 2% galactose instead of glucose. Gal+Raf medium contained 2% galactose and 2% raffinose instead of glucose. Transformation was performed according to a modified Li+ protocol (30). Yeast cultures were grown at 30°C unless specified otherwise. Liquid cultures were grown on a shaker, normally at 200 to 250 rpm, with a liquid/flask volume ratio of 1:5 or more.
[PSI] curing assays.
To assay for
[PSI] curing by the overproduced Hsp104, yeast cultures
bearing the GAL-HSP104 construct or matching controls were
grown to 2 × 106 to 1 × 107
cells/ml in liquid synthetic glucose medium selective for the plasmid(s), washed twice with H2O, and inoculated into the
corresponding synthetic Gal+Raf medium at the starting concentration of
2.5 × 105 to 5 × 105 cells/ml.
Aliquots were taken before and after incubation (usually 22 to 24 h) and plated onto the solid synthetic glucose medium selective for the
plasmid(s). The colonies grown after 4 to 5 days were velveteen replica
plated onto YPD and
Ade medium. [PSI+]
colonies were identified by white color on YPD and growth on
Ade
medium after 4 to 6 days of incubation.
[PSI] induction assays.
The plate assays for
[PSI] induction were performed as described previously
(21). Yeast transformants bearing plasmid CEN-GAL-SUP35 or
pRS316GAL-SUP35Pm, or matching control plasmid pRS316GAL, were grown on
glucose
Ura medium and velveteen replica plated onto
Ura and
Ura/Gal media. After 3 to 4 days of incubation, each plate was
velveteen replica plated onto glucose
Ade medium. [PSI] induction was detected as heterogeneous growth on
Ade medium after 7 to 10 days of incubation. To assay [PSI] induction
quantitatively, transformants bearing the CEN-GAL-SUP35 plasmid were
grown in the synthetic glucose
Ura medium, washed twice with
H2O, and inoculated into the
Ura/Gal+Raf medium at the
starting concentration 105 cells/ml. The aliquots were
taken before incubation and after various periods of incubation and
plated onto the glucose
Ura medium. The colonies grown after 4 to 5 days were velveteen replica plated onto the YPD and
Ade media.
[PSI+] colonies were identified by white color
on YPD medium and growth on
Ade medium after 6 to 8 days of incubation.
Quantitation of the spontaneous [PSI]
formation.
To measure the frequencies of the spontaneous
[PSI] formation, yeast strains were streaked out on YPD
medium at 30°C to obtain single colonies originating from individual
cells; 11 to 12 colonies were analyzed for each strain. The whole
colony was resuspended in 200 µl of H2O; 10 µl of each
solution was taken to perform serial dilutions in H2O, and
the rest of each solution was plated onto
Ade medium. A 1/10 aliquot
of the first (1/10) dilution was taken for further serial dilutions,
while the rest of the 1/10 dilution was also plated on
Ade medium.
Further serial dilutions were plated on YPD medium in order to
determine the concentrations of viable cells (CFU). Ade+
colonies were counted on
Ade plates following 10 days of incubation at 30°C. Numbers of Ade+ colonies in undiluted cultures
and 1/10 dilutions were roughly proportional to the degree of dilution,
suggesting that residual growth on
Ade medium is minimal and has no
significant effect on the frequency of Ade+ derivatives.
For each sample, the numbers of Ade+ colonies detected in
the undiluted culture and in 1/10 dilution were summed to determine the
total number of Ade+ derivatives in the sample. Median
frequencies of the Ade+ colonies were calculated for each
strain and shown in Table 2. [PSI] formation rates were calculated according to the
formula R = f/ln(NR), where R is
rate of [PSI] formation, f is the observed frequency of [PSI+] colonies, and N
is number of cells in the culture. This approach is based on the
formula used previously for measuring spontaneous mutation rates
(24).
|
DNA and protein analysis.
Standard protocols were used for
DNA isolation, restriction digestion, ligation, and Escherichia
coli transformation (49). Oligonucleotides were
purchased from Gibco BRL. Restriction endonucleases were purchased from
New England Biolabs and Gibco BRL. Polymerases were purchased from
Gibco BRL, Promega, and Stratagene. The thermal cycler was from
Ericomp. Southern hybridization was with a chemiluminescent probe as
described in the Amersham protocol. The 1.9-kb
BamHI-SacII fragment of plasmid pRS316GAL-SSB1,
labeled by the random priming procedure, was used as a probe. It
hybridizes to both SSB1 and SSB2 genes due to
high homology between their ORFs. The chromosome DNA was cut with
SacII to produce a 2.8-kb fragment corresponding to the
SSB1 gene and large (>20-kb) fragment corresponding to the
SSB2 gene. These bands were both absent in the double
ssb1
::HIS3 ssb2
::URA3
disruptant. Additional digests with XbaI and with XbaI plus SacII were also analyzed to confirm
disruptions. The blot was also probed with the labeled
HSP104 gene used as a DNA loading control. Proteins were
isolated as described previously (39) and subjected to
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Antibodies specific to the Hsp104, Hsp26, Hsp82, and Sup35 proteins
were kindly provided by S. Lindquist. Antibodies specific to Ssa
protein were kindly provided by E. Craig. Reactions with antibodies
specific to Ssb protein were performed by M. Patino in S. Lindquist's lab. Reactions with antibodies were detected by using
the ECL (enhanced chemiluminescence) detection system according to the
Amersham protocol. Relative amounts of proteins were determined by
densitometry where necessary by using the Image Tool program as
described previously (39). The amounts of proteins and times
of exposure were kept within the linear range of the ECL detection
system, determined on the basis of our previous data.
-Galactosidase activity assays.
-Galactosidase
activity was measured by using the chemiluminescence assay as described
previously (39). Expression of lacZ in the
PGK-UGA-lacZ construct is possible only if the UGA nonsense codon is read through. Efficiency of nonsense suppression was determined as the ratio between
-galactosidase activity in the strain bearing the PGK-UGA-lacZ construct (pUKC819) and
-galactosidase activity in the isogenic strain bearing the in frame
PGK-lacZ construct (pUKC815), which does not contain a
nonsense codon between the PGK and lacZ genes. At
least four independent transformants were measured for each
strain-plasmid combination.
| |
RESULTS |
|---|
|
|
|---|
Ssb overproduction increases [PSI] curing by overproduced Hsp104. We have previously shown that transient overproduction of the Hsp104 chaperone causes loss of [PSI] (11), while simultaneous overproduction of the Ssa1 protein of the Hsp70 family protects [PSI] from the curing effect of the overproduced Hsp104 (39). To check whether Ssb1 protein, which also belongs to the Hsp70 family, affects [PSI], the [PSI+] yeast strains were transformed with plasmids bearing GAL-SSB1 and GAL-HSP104 constructs, or with matching control plasmids, in all possible combinations. Resulting transformants were incubated in Gal+Raf medium, selective for the plasmids, to induce the GAL-SSB1 and GAL-HSP104 constructs. Western blotting followed by densitometry assays (not shown) confirmed that in Gal+Raf medium, transformants bearing the GAL-SSB1 constructs contained 3.8-fold more Ssb protein than the isogenic transformants bearing the matching control plasmid. [PSI] curing was assayed as described in Materials and Methods. We have observed that overproduced Ssb1 protein does not affect [PSI] propagation by itself but increases the [PSI]-curing effect of overproduced Hsp104. This increase was detected in six repeats of the experiment with three different [PSI+] strains and was therefore statistically significant. Results of the representative experiment are shown in Fig. 1A. Neither growth parameters in Gal+Raf medium (Fig. 1A) nor levels of the Hsp104 protein (Fig. 1D) were affected by Ssb1 overproduction. Therefore, the effect of overproduced Ssb1 protein on [PSI] curing by Hsp104 is opposite that of overproduced Ssa1 protein.
|
[PSI] curing by overproduced Hsp104 is decreased in
the Ssb
background.
To check whether the absence of
Ssb protein would affect [PSI], we disrupted
SSB1 and SSB2 genes in the
[PSI+] strain GT81-1C as described in
Materials and Methods. Resulting Ssb
disruptants remained
[PSI+], and [PSI] remained stable
in mitotic divisions. Moreover, [PSI] curing by both the
GAL-HSP104 construct, induced in the Gal+Raf medium
(Fig. 1B), and the constitutively expressed GPD-HSP104 construct (Fig. 1C) were less efficient in the Ssb
strain
than in the isogenic Ssb+ strain. Neither parameters of
growth in Gal+Raf medium (Fig. 1B) nor levels of the Hsp104 protein
(Fig. 1E and F) were significantly affected, suggesting that the
absence of Ssb influences [PSI] curing by Hsp104 rather
than the number of generations or Hsp104 expression. This result
confirms that Ssb protein assists in [PSI] curing by
excess Hsp104 protein.
[PSI] curing by inactivated Hsp104 is not affected in
the Ssb
background.
Inactivation of the Hsp104
protein has been shown to cure yeast cells of [PSI]
(11). We checked whether [PSI] loss, caused by
Hsp104 inactivation, requires Ssb protein. The
[PSI+] ssb1/2
strain was crossed
to the isogenic hsp104
strain GT84-5A. The resulting
diploid was sporulated and dissected. Among 19 complete tetrads
analyzed, we identified 2 which contained only two Ura+
spores each. In such tetrads, the
ssb2
::URA3 and
hsp104
::URA3 disruptions had to segregate
together. The ssb1
::HIS3 disruption was
monitored by the His+ phenotype, and the double
ssb1/2
disruptants were also verified by the
Pars phenotype. Using these approaches, we determined that
three of four Ura+ spores recovered from these two tetrads
contained all three disruptions simultaneously
(ssb1
::HIS3 ssb2
::URA3
hsp104
::URA3). One of these spore clones was
also tested by Southern hybridization to confirm the presence of all
three disruptions. All three triple disruptant spores were
[psi
], confirming that [PSI]
curing by Hsp104 inactivation does not require the presence of
Ssb protein.
Spontaneous appearance of [PSI] is increased in the
Ssb
background.
Spontaneous appearance of
[PSI] is easier to detect in strains containing the
non-Mendelian determinant [PIN], which increases the
frequency of [PSI] formation (22). We observed
that the [psi
PIN+]
Ssb
strain exhibited 1-order-of-magnitude-higher
frequency and rate of spontaneous Ade+ revertants compared
to the isogenic [psi
PIN+]
Ssb+ strain (Fig. 2A and
Table 2). In all 12 independently arisen spontaneous Ssb
Ade+ colonies tested, the Ade+ phenotype was
cured by growth in the presence of GuHCl, as described previously for
the [PSI] element (57). This finding suggests that the increased frequency of the Ade+ revertants in the
Ssb
strain is due to increased spontaneous appearance of
the [PSI] prion.
|
Nonsense suppression and [PSI] induction by the
overproduced Sup35 protein are increased in the Ssb
background.
Overproduction of the Sup35 protein causes
translational readthrough, or nonsense suppression (9),
and induces formation of [PSI] prion (10) in
[psi
PIN+] strains
(22) of S. cerevisiae. Overproduction of the
Sup35N prion-forming domain alone also induces nonsense suppression
(55) and [PSI] formation (21) in
both [psi
PIN+] and
[psi
pin
] strains
(22). We have observed that nonsense suppression by overproduced Sup35 or Sup35N in the [psi
PIN+] background (Fig. 2B) is greater in the
Ssb
strain than in the isogenic Ssb+ strain.
Nonsense suppression by overproduced Sup35N in the
[psi
pin
] background was also
increased in the Ssb
strain (not shown), indicating that
the Ssb effect is not [PIN] specific. The frequency of
[PSI] formation, induced by the transient Sup35
overproduction in the [psi
PIN+]
background, was also increased 6- to 10-fold in the strain lacking Ssb
protein (Fig. 2C and D). The growth rate of the
[psi
PIN+] Sup35 overproducer
was only slightly influenced by ssb1/2
(Fig. 2E), which
was not sufficient to explain a difference in [PSI] induction rates.
[PSI] induction by the heterologous Sup35 protein is
increased in the Ssb
background.
The sequence
variation between the prion proteins of different origins decreases the
efficiency of prion conversion in the heterologous system, which is
recognized as a species barrier in prion transmission (for a review,
see reference 48). We have shown that the highly
divergent Sup35NM domain, originated from the distantly related yeast
species Pichia methanolica (32), can form a prion
in the S. cerevisiae cellular environment (12). Moreover, overproduction of Pichia Sup35 induces formation
of the S. cerevisiae [PSI] prion; however, the
efficiency of such heterologous prion induction is much lower than that
of the homologous induction by overproduction of the endogenous
S. cerevisiae Sup35 (12). Our data (Fig. 2C)
indicate that the heterologous [PSI] induction by P. methanolica Sup35 is increased in the Ssb
background. Therefore, Ssb depletion makes Sup35 more sensitive to the
heterologous prion-inducing agents and helps to overcome the species barrier.
Effects of the Ssb protein on the suppressor efficiency of
[PSI].
One possible explanation for the increased
[PSI] appearance in the Ssb
background could
be that Ssb, which is a ribosome-associated protein (38,
47), antagonizes the translational readthrough, caused by
[PSI], or prevents folding and/or facilitates destruction of the readthrough products, which likely contain the wrong amino acids inserted. In this case, the efficiency of nonsense suppression would be increased in the absence of Ssb. Therefore, some weak [PSI+] derivatives, which are not detectable
in an Ssb+ background, could become detectable in an
Ssb
background. Indeed, in some experiments the
Ssb
derivative of the [PSI+]
strain GT81-1C grew a little better than the original Ssb+
strain on
Ade medium, although this difference was difficult to
reproduce (not shown). To check it quantitatively, we measured nonsense
suppressor efficiencies by using the PGK-UGA-lacZ construct. Our results show that while the effect of ssb1/2
on UGA
suppression in the [psi
] strain was
insignificant, the level of UGA suppression by [PSI] was
increased about fivefold in the Ssb
background (Table
3). To check whether such an effect could compromise the [PSI] formation assays, we
transformed three independent spontaneous
[PSI+] derivatives of the
[psi
PIN+]
ssb1/2
strain and 11 independent
[PSI+] derivatives induced by Sup35
overproduction in the same strain with plasmid YCp-SSB1, bearing the
wild-type SSB1 gene. Our results (e.g., Fig. 2F) confirm
that all [PSI+] derivatives obtained in the
absence of Ssb remain able to grow on
Ade medium in the presence of
Ssb. Therefore, while Ssb protein appears to affect nonsense
suppression by [PSI], results of the [PSI]
formation assays cannot be explained by the Ssb effect on nonsense
suppression. Moreover, reintroduction of SSB1 caused a
detectable decrease in growth on
Ade medium only in 3 of 14 independent [PSI+] derivatives tested. We
previously reported that various strains of the [PSI]
prion could be recovered in the same genotypic background, and so
differences between these strains are apparently controlled by the
prion protein itself (21). Thus, the Ssb protein appears to
have differential effects on the different prion strains.
|
The Ssb depletion does not affect Sup35 or chaperone protein
levels.
Effects of Ssb depletion on suppression and
[PSI] formation are not readily explained by alterations
of the Sup35 protein levels or its distribution between soluble and
precipitated (that is, aggregated) fractions, since neither of these
parameters appears to be affected in the [psi
PIN+] cells lacking Ssb (Fig.
3A to C). To determine
whether ssb1/2
acts on [PSI] indirectly by
altering other chaperone levels, we compared levels of several
chaperone proteins in the isogenic Ssb+ and
Ssb
strains. Our results confirm that levels of Hsp104
protein on glucose medium are unaffected by ssb1/2
(Fig.
3D), as also shown above for Gal+Raf medium (Fig. 1E and F). Levels of
Ssa protein were also unaffected (Fig. 3D). There appeared to be a
slight increase of Hsp82 levels in the Ssb
background
(Fig. 3D); however, it has previously been shown that [PSI] is not affected by Hsp82 levels (39).
Neither Ssb+ nor Ssb
cells produced Hsp26
protein in the exponential phase, independently of whether they were
[PSI+] or [psi
]
(not shown). These data confirm that Ssb depletion does not lead to a
significant stress response, making indirect effects of
ssb1/2
on [PSI] unlikely.
|
Ssb influences toxicity of the overproduced Sup35 protein.
Overproduced Sup35 protein (8, 9, 19) or Sup35N domain
(55) inhibits growth of the [PSI+]
strains, apparently due to increased accumulation of prion aggregates. Moreover, high-copy-number plasmids, coding for Sup35 or Sup35N, are
also toxic for the [psi
PIN+]
strains, and this toxicity requires the same sequence elements as are
required for [PSI] induction, suggesting that toxicity could be related to prion formation (21, 22). We have
checked the effect of the ssb1/2
on toxicity of
overproduced Sup35 and Sup35N. Surprisingly, growth-inhibitory effects
of the overproduced Sup35 in [PSI+] strains
(Fig. 4A), as well as those of the
hyperamplified SUP35 and SUP35N plasmids in the
[psi
PIN+] strains (Fig. 4B),
were both decreased rather than increased in an Ssb
background. Thus, Ssb effects on [PSI] formation and
toxicity are opposite each other. One could suggest that the decrease
in toxicity of the overproduced Sup35 in an Ssb
background contributes to the increase in [PSI] induction
that we have observed. However, ssb1/2
influenced the
growth of moderate Sup35 overproducers, used in [PSI]
induction experiments, only slightly (Fig. 2E). Moreover, a
1-order-of-magnitude difference in percentage of
[PSI+] cells was observed between the
Ssb+ and Ssb
cultures that had undergone
equal numbers of cell divisions (Fig. 2D and E). Besides, spontaneous
[PSI] formation in the absence of Sup35 overproduction was
also greater in the Ssb
strain than in the
Ssb+ strain (Fig. 2A and Table 2), while growth rates of
the [PSI+] strains which did not overproduce
the Sup35 protein were not increased by ssb1/2
(Fig.
5B). This finding suggests that
differences in toxicity of the overproduced Sup35 or Sup35N between
Ssb+ and Ssb
strains are not sufficient to
explain the difference in frequency of [PSI] formation.
|
|
Ssb depletion causes sensitivity to GuHCl.
Since Ssb protein
assists in [PSI] curing by overproduced Hsp104, we checked
whether Ssb would effect another [PSI]-curing agent,
GuHCl. Surprisingly, we found that growth of Ssb
strains
is inhibited by the millimolar concentrations of GuHCl that are
normally used to cure [PSI] (Fig. 5). While GuHCl remained capable of curing the Ssb
strains of [PSI],
it was not possible to compare efficiencies of curing in
Ssb+ and Ssb
backgrounds due to differences
in the growth rates. Interestingly, the Ssb
[psi
] strain was slightly more sensitive to
GuHCl than the isogenic Ssb
[PSI+] strain (Fig. 5). Moreover, the
concentration of the viable cells in Ssb
[psi
] culture was decreasing upon incubation
in medium containing GuHCl (Fig. 5C), indicating that GuHCl does not
simply inhibit growth but actually kills the Ssb
[psi
] cells. The Ghcs phenotype
was complemented by the plasmid bearing the SSB1 gene (not
shown) and cosegregated with Pars, a phenotypic marker of
the double ssb1/2
disruption, in tetrad analysis (Table
4). ssb1/2
is the first
mutation shown to cause sensitivity to millimolar concentrations of
GuHCl. While we have observed that hsp104
also causes
slight sensitivity to GuHCl in the GT81-1C genotypic background
(6), the effect of ssb1/2
was much stronger
than that of hsp104
.
|
| |
DISCUSSION |
|---|
|
|
|---|
Despite significant progress in understanding propagation of preexisting prions, the mechanism of initial prion formation remains a mystery. In vitro experiments suggest that prion-forming domains tend to aggregate spontaneously (27, 31). However, this aggregation potential is apparently suppressed in vivo, since in the absence of a prion seed, the potential prion-forming proteins remain soluble and frequency of spontaneous aggregate formation is low. This suggests that spontaneous prion formation could be caused by dysfunction or imbalance of proteins, which influence the normal process of folding and suppress the aggregation potential of the prion-forming domains. Here, we demonstrate for the first time that inactivation of the chaperone protein (Ssb) may increase the frequency of spontaneous prionization of another protein (Sup35). If prion conformers are considered analogous to the mutants, this is equivalent to discovery of the mutator genes.
Quite remarkably, representatives of two major cytosolic Hsp70 subfamilies, Ssa and Ssb, exhibit opposite effects on [PSI] prion. While Ssa protein assists [PSI] and protects it from curing by Hsp104, Ssb protein antagonizes [PSI] formation and assists Hsp104 in [PSI] curing. Functional divergence between Ssa and Ssb has been noted previously in other assays (29, 38). While the Ssa subfamily is essential for vegetative growth, inducible by high temperature and some other stresses, and involved in stress defense, Ssb protein is dispensable for viability and stress response and does not appear to be heat inducible. Genetic and biochemical data demonstrate an Ssb association with translating ribosomes (38), in particular with nascent polypeptide (47). It has been suggested that Ssb is involved in cotranslational protein folding (38). However, Ssb is certainly not required for this process, since its inactivation causes only slight growth deficiencies. Phenotypes associated with the double ssb1/2 deletion, i.e., cold sensitivity and sensitivity to translational inhibitors, do not contradict the role of Ssb in cotranslational folding but cannot be easily explained as a simple consequence of the protein folding defects.
Another cellular function attributed to the Ssb protein is stimulation of proteasome-dependent protein turnover (41). The prokaryotic Hsp70 homolog, DnaK, is also involved in protein degradation mediated by proteases La and ClpA/B (52). It is worth noting that ClpB, a subunit of the protease complex which converts multiprotein substrates to a form accessible for protease, is a prokaryotic homolog of the yeast Hsp104 protein (51). It has been suggested that yeast Ssb protein is responsible for proofreading of the newly synthesized and folded polypeptides and for targeting the incorrectly folded products for proteasome-mediated degradation (41). This does not rule out the possibility of Ssb being involved in the actual process of folding, since coupling of the processes of synthesis and breakdown is frequently observed in biological systems. The proofreading role for Ssb protein would be consistent with our data.
We propose that Ssb either prevents formation of the misfolded
intermediates which serve as the raw material for the initial formation
of prion aggregates, stimulates degradation of such intermediates, or
both. This is why spontaneous [PSI] formation, and
especially [PSI] formation induced by Sup35 (or Sup35N)
overproduction is increased in Ssb
cells. Ssb could also
assist Hsp104 in curing yeast cells of [PSI] by two
mechanisms: (i) decreasing the amount of the misfolded newly
synthesized Sup35 protein and therefore eliminating the substrate for
generation of the new prion polymers and (ii) refolding the misfolded
Sup35 molecules, generated due to Hsp104-mediated breakdown of
preexisting prion polymers, or targeting these molecules for
proteasome-mediated degradation and therefore preventing them from
reverting to prion form. Since we detected no significant effect of Ssb
levels on prion propagation under the normal circumstances (that is,
when Hsp104 levels are low), the latter mechanism seems more likely.
This would mean that the proofreading function of Ssb is not restricted
to the newly synthesized proteins. However, one has to remember that
Sup35 is a ribosome-binding protein, and thus at least a fraction of
the Ssb and Sup35 molecules are located close to each other. This might
enable Ssb to monitor conformation of some preexisting Sup35 molecules.
Other phenotypes of the double ssb1/2
deletion are also
consistent with the proofreading function of the Ssb protein. Both translational inhibitors, such as paromomycin and hygromycin
(42), and growth at low temperature (28) increase
translational misreading, resulting in production of the erroneous and
potentially misfolded proteins. If such proteins are not corrected or
removed by the Ssb-mediated proofreading system, they may cause
deleterious effects. Interestingly, we have observed for the first time
that Ssb
strains are extremely sensitive to the
protein-denaturing agent GuHCl. Growth in the presence of 1 to 5 mM
GuHCl has been shown to efficiently cure yeast cells of prions
[PSI] (18, 57) and [URE3]
(58) and of the non-Mendelian element [PIN]
(22), even though such low concentrations of GuHCl are not
sufficient to cause significant protein denaturing and solubilize
protein aggregates in vitro. GuHCl was shown to induce expression of
some heat shock proteins including Hsp104 (36), leading to
the hypothesis that the GuHCl effect is mediated by Hsp104 induction
(11, 36). However, Hsp104 overproduction does not appear to
cure yeast cells of [URE3] (7, 59) and
[PIN] (22). Extreme sensitivity of the
Ssb
strains to the millimolar concentrations of GuHCl
indicates that low concentrations of GuHCl can specifically target
cellular processes involving Ssb, in particular, cotranslational
protein folding. It is possible that growth in the presence of GuHCl
results in synthesis of the amorphous unfolded polypeptide products,
which are unable both to perform their normal function and convert to the prion form. If these are not corrected or targeted for degradation due to Ssb action, they are toxic for the yeast cells. Dynamics of
[PSI] loss in the presence of GuHCl confirm that GuHCl
prevents formation of new prions rather than acts on preexisting ones
(16).
Interestingly, toxicity of the overproduced Sup35 appears to decrease
in the Ssb
background, even though translational
readthrough and [PSI] induction increase. This finding
suggests that growth defects caused by the overproduced Sup35 protein
may not necessarily result directly from translational readthrough
and aggregate formation. One possibility is that prion protein
incorporated in the huge aggregates is harmless, so that aggregate
formation might in fact protect cells by localizing and
compartmentalizing prions. Proteins like Ssb, which interfere with
prion formation and/or promote interactions between prion conformer and
cellular metabolic systems (e.g., proteolysis machinery), may
inadvertently increase toxicity, since wrongly shaped prion conformers
or misfolded intermediates inhibit processes in which they become
involved. Recent data indicate that in some human neural inclusion
diseases, such as Huntington disease, aggregate formation may indeed
protect cells by localizing and inactivating the misfolded protein
rather than contribute to toxicity (50). This may also
explain why the presence of [PSI] prion slightly increases
resistance of the Ssb
strains to GuHCl (Fig. 5). This
raises the possibility of yeast prions being by-products of the
cellular processes aimed at protecting cells from the toxic effects of
misfolded and mislocalized proteins. By analogy with mutagenic DNA
repair systems, protein repair pathways, which are supposed to correct
and/or remove damaged proteins, can generate protein "mutations"
becoming reproducible in a prion-like fashion. Further experiments to
test this hypothesis are under way.
Protein-based transmission of the phenotypic traits mediated by prion-like elements constitutes a new mechanism of inheritance. The very fact that several proteins of different functions and origins exhibit this phenomenon suggests a wide distribution of the protein-based systems of structural (as opposed to sequential) coding in nature. Our research uncovers the enzymatic machinery for protein-based inheritance, playing a role comparable to that of the DNA repair machinery in DNA-based inheritance. This machinery is composed of evolutionarily conserved proteins of the Hsp100 and Hsp70 families, suggesting that we are dealing with ancient phenomenon, probably having implications for organisms other than yeast.
| |
ACKNOWLEDGMENTS |
|---|
We thank A. Galkin for help with strain constructions, M. Patino for help with determining levels of the Ssb protein in the overproducer strains, R. Wegrzyn for help with some [PSI] curing assays, D. Gordenin for valuable comments on spontaneous rate measurements, and E. Craig, S. Lindquist, M. Ohba, and M. Tuite for plasmids and antibodies.
This work was supported in parts by grant R01GM58763 from the National Institute of General Medical Sciences and by grants from the Amyotrophic Lateral Sclerosis Association and the Emory-Georgia Tech Biomedical Technology Research Foundation to Y.O.C.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Parker H. Petit Institute for Bioengineering and Biosciences, Georgia Institute of Technology 315 Ferst Dr., Atlanta, GA 30332-0363. Phone: (404) 894-1157. Fax: (404) 894-0519 or 404-894-2291. E-mail: yc22{at}prism.gatech.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aigle, M., and F. Lacroute. 1975. Genetical aspects of [URE3], a non-mitochondrial cytoplasmically inherited mutation in yeast. Mol. Gen. Genet. 136:327-335[Medline]. |
| 2. |
Baudin, A.,
O. Ozier-Kalogeropoulos,
A. Denouel,
F. Lacroute, and C. Cullin.
1993.
A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:3329-3330 |
| 3. | Boorstein, W. R., T. Ziegelhoffer, and E. A. Craig. 1994. Molecular evolution of the HSP70 multigene family. J. Mol. Evol. 38:1-17[Medline]. |
| 4. | Broach, J. R., J. N. Strathern, and J. B. Hicks. 1979. Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene 8:121-133[Medline]. |
| 5. | Cesareni, G., and A. H. Murray. 1987. Plasmid vectors carrying the replication origin of filamentous single-stranded phages, p. 13-154. In J. K. Setlow (ed.), Genetic engineering: principles and methods, vol. 4. Plenum Press, New York, N.Y |
| 6. | Chernoff, Y. O., and J. Kumar. Unpublished data. |
| 7. | Chernoff, Y. O., and S. W. Liebman. Unpublished data. |
| 8. | Chernoff, Y. O., I. L. Derkach, V. L. Tikhomirova, A. R. Dagkesamanskaya, M. D. Ter-Avanesyan, and S. G. Inge-Vechtomov. 1988. Nonsense-suppression by amplification of translation protein factor gene. Dokl. Akad. Nauk 301:1227-1229. (In Russian.) |
| 9. | Chernoff, Y. O., S. G. Inge-Vechtomov, I. L. Derkach, M. V. Ptyushkina, O. V. Tarunina, A. R. Dagkesamanskaya, and M. D. Ter-Avanesyan. 1992. Dosage-dependent translational suppression in yeast Saccharomyces cerevisiae. Yeast 8:489-499[Medline]. |
| 10. | Chernoff, Y. O., I. L. Derkach, and S. G. Inge-Vechtomov. 1993. Multicopy SUP35 gene induces de-novo appearance of psi-like factors in the yeast Saccharomyces cerevisiae. Curr. Genet. 24:268-270[Medline]. |
| 11. |
Chernoff, Y. O.,
S. L. Lindquist,
B. Ono,
S. G. Inge-Vechtomov, and S. W. Liebman.
1995.
Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+].
Science
268:880-884 |
| 12. | Chernoff, Y. O., A. P. Galkin, E. Lewitin, T. A. Chernova, G. P. Newnam, and S. M. Belenkiy. Submitted for publication. |
| 13. |
Chervitz, S. A.,
L. Aravind,
G. Sherlock,
C. A. Ball,
E. V. Koonin,
S. S. Dwight,
M. A. Harris,
K. Dolinski,
S. Mohr,
T. Smith,
S. Weng,
J. M. Cherry, and D. Botstein.
1998.
Comparison of the complete protein sets of worm and yeast: orthology and divergence.
Science
282:2022-2028 |
| 14. |
Coustou, V.,
C. Deleu,
S. Saupe, and J. Begueret.
1997.
The protein product of the het-s heterokaryon incompatibility gene of the fungus Podospora anserina behaves as a prion analog.
Proc. Natl. Acad. Sci. USA
94:9773-9778 |
| 15. | Cox, B. S. 1965. PSI, a cytoplasmic suppressor of super-suppressor in yeast. Heredity 20:505-521. |
| 16. | Cox, B. S. 1993. Psi phenomena in yeast, p. 219-239. In M. N. Hall, and P. Linder (ed.), The early days of yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 17. | Cox, B. S. 1994. Prion-like factors in yeast. Curr. Biol. 4:744-748[Medline]. |
| 18. | Cox, B. S., M. F. Tuite, and C. S. McLaughlin. 1988. The PSI factor of yeast: a problem in inheritance. Yeast 4:159-178[Medline]. |
| 19. | Dagkesamanskaya, A. R., and M. D. Ter-Avanesyan. 1991. Interactions of the yeast omnipotent suppressors SUP1 (SUP45) and SUP2 (SUP35) with non-Mendelian factors. Genetics 128:513-520[Abstract]. |
| 20. | De Pace, A. H., A. Santoso, P. Hillner, and J. S. Weissman. 1998. A critical role for amino-terminal glutamine/asparagine repeats in the formation and propagation of a yeast prion. Cell 93:1241-1252[Medline]. |
| 21. | Derkatch, I. L., Y. O. Chernoff, V. V. Kushnirov, S. G. Inge-Vechtomov, and S. W. Liebman. 1996. Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144:1375-1386[Abstract]. |
| 22. | Derkatch, I. L., M. Bradley, P. Zhou, Y. O. Chernoff, and S. W. Liebman. 1997. Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae. Genetics 147:507-519[Abstract]. |
| 23. | Doel, S. M., S. J. McCready, C. R. Nierras, and B. S. Cox. 1994. The dominant PNM2-mutation which eliminates the PSI factor of Saccharomyces cerevisiae is the result of a missense mutation in the SUP35 gene. Genetics 137:659-670[Abstract]. |
| 24. |
Drake, J. W.
1991.
A constant rate of spontaneous mutation in DNA-based microbes.
Proc. Natl. Acad. Sci. USA
88:7160-7164 |
| 25. | Firoozan, M., C. Grant, J. A. B. Duarte, and M. F. Tuite. 1991. Quantitation of readthrough of termination codons in yeast using a novel gene fusion assay. Yeast 7:173-183[Medline]. |
| 26. | Glover, J. R., and S. Lindquist. 1998. Hsp104, Hsp70 and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 94:1-20[Medline]. |
| 27. | Glover, J. R., A. S. Kowal, E. C. Schirmer, M. M. Patino, J. J. Liu, and S. Lindquist. 1997. Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of Saccharomyces cerevisiae. Cell 89:811-819[Medline]. |
| 28. | Inge-Vechtomov, S. G., O. N. Tikhodeev, and V. L. Tikhomirova. 1988. Nonsense suppression in yeasts upon substitution of carbon sources and a decrease in temperature, mediated by nonchromosomal genetic determinants. Genetika 24:1159-1165[Medline]. (In Russian.) |
| 29. |
James, P.,
C. Pfund, and E. A. Craig.
1997.
Functional specificity among Hsp 70 molecular chaperones.
Science
275:387-389 |
| 30. | Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics: a Cold Spring Harbor Laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 31. |
King, C. Y.,
P. Tittmann,
H. Gross,
R. Gebert,
M. Aebi, and K. Wuthrich.
1997.
Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments.
Proc. Natl. Acad. Sci. USA
94:6618-6622 |
| 32. | Kushnirov, V. V., M. D. Ter-Avanesyan, S. A. Didichenko, V. N. Smirnov, Y. O. Chernoff, I. L. Derkach, O. N. Novikova, S. G. Inge-Vechtomov, M. A. Neistat, and I. I. Tolstorukov. 1990. Divergence and conservation of SUP2 (SUP35) gene of yeasts Pichia pinus and Saccharomyces cerevisiae. Yeast 6:461-472[Medline]. |
| 33. | Kushnirov, V. V., M. D. Ter-Avanesyan, and V. N. Smirnov. 1995. Structural and functional similarity of Sup35p and Ure2p yeast proteins and mammalian prions. Mol. Biol. 29:427-430. (In Russian.) |
| 34. |
Liebman, S. W., and I. L. Derkatch.
1999.
The yeast [PSI+] prion: making sense of nonsense.
J. Biol. Chem.
274:1181-1184 |
| 35. |
Lindquist, S., and G. Kim.
1996.
Heat-shock protein 104 expression is sufficient for thermotolerance in yeast.
Proc. Natl. Acad. Sci. USA
93:5301-5306 |
| 36. |
Lindquist, S.,
M. M. Patino,
Y. O. Chernoff,
A. S. Kowal,
M. A. Singer,
K.-H. Lee,
T. Blake, and S. W. Liebman.
1995.
The role of Hsp104 in stress tolerance and [PSI+] propagation in Saccharomyces cerevisiae.
Cold Spring Harbor Symp. Quant. Biol.
60:451-460 |
| 37. | Liu, H., J. Krizek, and A. Bretscher. 1992. Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673[Abstract]. |
| 38. | Nelson, R. J., T. Ziegelhoffer, C. Nicolet, M. Werner-Washburne, and E. A. Craig. 1992. The translation machinery and 70 kd heat shock protein cooperate in protein synthesis. Cell 71:97-105[Medline]. |
| 39. |
Newnam, G. P.,
R. D. Wegrzyn,
S. L. Lindquist, and Y. O. Chernoff.
1999.
Antagonistic interactions between yeast chaperones Hsp104 and Hsp70 in prion curing.
Mol. Cell. Biol.
19:1325-1333 |
| 40. | Newnam, G. P., Y. O. Chernoff, and M. M. Patino. Unpublished data. |
| 41. | Ohba, M. 1997. Modulation of intracellular protein degradation by SSB1-SIS1 chaperon system in yeast Saccharomyces cerevisiae. FEBS Lett. 409:307-311[Medline]. |
| 42. | Palmer, E., J. Wilhem, and F. Sherman. 1979. Phenotypic suppression of nonsense mutants in yeast by aminoglycoside antibiotics. Nature 277:148[Medline]. |
| 43. | Parsell, D. A., A. S. Kowal, M. A. Singer, and S. Lindquist. 1994. Protein disaggregation mediated by heat-shock protein Hsp104. Nature 372:475-478[Medline]. |
| 44. | Patino, M. M., J. J. Liu, J. R. Glover, and S. Lindquist. 1996. Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273:622-626[Abstract]. |
| 45. | Paushkin, S. V., V. V. Kushnirov, V. N. Smirnov, and M. D. Ter-Avanesyan. 1996. Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor. EMBO J. 15:3127-3134[Medline]. |
| 46. |
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1997.
In vitro propagation of the prion-like state of yeast Sup35 protein.
Science
277:381-383 |
| 47. | Pfund, C., N. Lopez-Hoyo, T. Ziegelhoffer, B. A. Schilike, P. Lopez-Buesa, W. A. Walter, M. Wiedmann, and E. A. Craig. 1998. The molecular chaperone Ssb from Saccharomyces cerevisiae is a component off the ribosome-nascent chain complex. EMBO J. 17:3981-3989[Medline]. |
| 48. | Prusiner, S. B., M. R. Scott, S. J. De Armond, and F. E. Cohen. 1998. Prion protein biology. Cell 93:337-348[Medline]. |
| 49. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 50. | Saudou, F., S. Finkbeiner, D. Devys, and M. E. Greenberg. 1998. Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell 95:55-66[Medline]. |
| 51. | Schirmer, E. C., J. R. Glover, M. A. Singer, and S. Lindquist. 1996. HSP100/Clp proteins: a common mechanism explains diverse functions. Trends Biochem Sci. 21:289-296[Medline]. |
| 52. | Sherman, M. Y., and A. L. Goldberg. 1992. Involvement of the chaperonine dnaK in the rapid degradation of a mutant protein in Escherichia coli. EMBO J. 11:71-77[Medline]. |
| 53. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 54. |
Singh, A.,
C. Helms, and F. Sherman.
1979.
Mutation of the non-mendelian suppressor, psi+, in yeast by hypertonic media.
Proc. Natl. Acad. Sci. USA
76:1952-1956 |
| 55. | Ter-Avanesyan, M. D., V. V. Kushnirov, A. R. Dagkesamanskaya, S. A. Didichenko, Y. O. Chernoff, S. G. Inge-Vechtomov, and V. N. Smirnov. 1993. Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein. Mol. Microbiol. 7:683-692[Medline]. |
| 56. | Ter-Avanesyan, M. D., A. R. Dagkesamanskaya, V. V. Kushnirov, and V. N. Smirnov. 1994. The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics 137:671-676[Abstract]. |
| 57. |
Tuite, M. F.,
C. R. Mundy, and B. S. Cox.
1981.
Agents that cause a high frequency of genetic change from [psi+] to [psi ] in Saccharomyces cerevisiae.
Genetics
98:691-711 |
| 58. |
Wickner, R. B.
1994.
[URE3] as an altered Ure2 protein: evidence for a prion analog in Saccharomyces cerevisiae.
Science
264:566-569 |
| 59. | Wickner, R. B., and Y. O. Chernoff. 1999. Prions of fungi: [URE3], [PSI] and [Het-s] discovered as heritable traits, p. 229-272. In S. B. Prusiner (ed.), Prion biology and diseases. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 60. |
Wickner, R. B.,
H. K. Edskes,
M. L. Maddelein,
K. L. Taylor, and H. Moriyama.
1999.
Prions of yeast and fungi: proteins as genetic material.
J. Biol. Chem.
274:555-558 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»