Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8211-8218, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
In Vivo Activity of Murine De Novo
Methyltransferases, Dnmt3a and Dnmt3b
Chih-Lin
Hsieh*
Department of Urology and Department of
Biochemistry and Molecular Biology, University of Southern California,
Norris Cancer Center, Los Angeles, California 90033
Received 8 July 1999/Returned for modification 3 September
1999/Accepted 8 September 1999
 |
ABSTRACT |
The putative de novo methyltransferases, Dnmt3a and Dnmt3b, were
reported to have weak methyltransferase activity in methylating the 3'
long terminal repeat of Moloney murine leukemia virus in vitro. The
activity of these enzymes was evaluated in vivo, using a stable
episomal system that employs plasmids as targets for DNA methylation in
human cells. De novo methylation of a subset of the CpG sites on the
stable episomes is detected in human cells overexpressing the murine
Dnmt3a or Dnmt3b1 protein. This de novo methylation activity is
abolished when the cysteine in the P-C motif, which is the catalytic
site of cytosine methyltransferases, is replaced by a serine. The
pattern of methylation on the episome is nonrandom, and different
regions of the episome are methylated to different extents.
Furthermore, Dnmt3a also methylates the sequence methylated by Dnmt3a
on the stable episome in the corresponding chromosomal target.
Overexpression of human DNMT1 or murine Dnmt3b does not lead to the
same pattern or degree of de novo methylation on the episome as
overexpression of murine Dnmt3a. This finding suggests that these three
enzymes may have different targets or requirements, despite the fact
that weak de novo methyltransferase activity has been demonstrated in
vitro for all three enzymes. It is also noteworthy that both Dnmt3a and
Dnmt3b proteins coat the metaphase chromosomes while displaying a more
uniform pattern in the nucleus. This is the first evidence that Dnmt3a
and Dnmt3b have de novo methyltransferase function in vivo and the
first indication that the Dnmt3a and Dnmt3b proteins may have preferred target sites.
 |
INTRODUCTION |
CpG methylation has been associated
with reduced transcription (1, 13, 23), decreased DNase I
sensitivity (14), and decreased site-specific recombination
(8). Some of the effects of CpG methylation on chromatin
structure are mediated by binding of a methylation binding protein
(MeCP2) to methylated CpGs and recruitment of histone deacetylase
(12, 19). CpG methylation is tightly regulated during
replication and differentiation of somatic cells. A maintenance
methyltransferase (designated DNA methyltransferase 1 [DNMT1] in
humans and Dnmt1 in mice) functions during DNA replication to preserve
the methylated pattern of preexisting methylated region
(16). In general, genes lose their CpG methylation within
the promoter when they become activated, whereas genes acquire CpG
methylation after they are no longer transcribed (for reviews, see
references 2 and 22). It has been
demonstrated recently that protein binding can lead to demethylation
through a replication-dependent process within the specific binding
sites (11, 17). However, it remains unclear how regions of
DNA acquire methylation in somatic cells (de novo methylation) or over
what time intervals these changes occur, although many sequences have been reported to acquire methylation during development or the neoplastic process (25, 26).
De novo methylation is thought to establish the genomic CpG methylation
pattern shortly after implantation in mammals (for a review, see
reference 33). It is also believed to play an important role in gene regulation, X inactivation, genomic imprinting, and methylation of endogenous retroviruses and transposable elements (for a review, see reference 28). Many recent
reports indicate that alteration of DNA methylation occurs in various
tumors (25, 26). De novo methylation activity remains in
mouse embryonic stem (ES) cells with homozygous deletion of the
maintenance methyltransferase gene (Dnmt1) (15).
Based on this finding, the search for other DNMTs has been intense.
Three genes, Dnmt2, Dnmt3a, and
Dnmt3b, have been reported to have homology with the
methyltransferase motif (21, 34). There are several
alternatively spliced products of Dnmt3b, and the largest peptide is
the product of Dnmt3b1. Despite having homology to the
methyltransferase motif, Dnmt2 has not been demonstrated to have
methyltransferase activity (20). A weak de novo
methyltransferase activity was detected by incubating a DNA fragment
multiple times with crude cell extract from insect cells overexpressing
Dnmt3a or Dnmt3b1 (21). The de novo methyltransferase activity of Dnmt3a and Dnmt3b1 is shown to be lower than that of Dnmt1
in this assay (21), although Dnmt1 has a much stronger affinity for hemimethylated DNA. De novo methylation is frequently found in tumors, although DNMT1 and DNMT3a overexpression has been
reported to be much less frequent than DNMT3b overexpression in tumors
(24). Therefore, it remains unclear what role these DNMTs
play in de novo methylation in vivo.
It was reported that Dnmt3a and Dnmt3b are barely detectable in
differentiated cells and adult tissues (21). It has also been shown that DNMT1 is expressed at a higher level than DNMT3a or
DNMT3b in most human tissues (24). In many previous
experiments, the methylation status of an episomal plasmid was
maintained faithfully, most likely by DNMT1, in 293/EBNA1 cells over
many weeks (9-11). However, de novo methylation of either
an entirely unmethylated episome or the methylation-free region of a
patch-methylated episome has not been observed (9, 10). It
is clear that the de novo methyltransferase activity of DNMT1 does not
result in de novo methylation of unmethylated sequences on the episome
in 293/EBNA1 cells. Furthermore, if DNMT3a and DNMT3b are expressed at
any appreciable level in 293/EBNA1 cells, they do not functionally de
novo methylate the episome. These previous observations suggest that it
is possible to use this oriP-based episomal system to investigate whether Dnmt3a and Dnmt3b have detectable de novo methyltransferase activity in vivo.
In this study, I found that mouse Dnmt3a methylates some regions of the
episome in human cells, and some specific CpG sites on the episome
become methylated in human cells overexpressing murine Dnmt3b protein.
When the methyltransferase catalytic site of Dnmt3a and Dnmt3b is
mutated, the de novo methylation activity of these proteins is
abolished in vivo. This clearly demonstrates the de novo methylation
function of Dnmt3a and Dnmt3b in vivo. Furthermore, these proteins
appear to be different from DNMT1 in site preference and activity. I
also found that Dnmt3a methylates the same sequence on the episome and
in the chromosome in human cells. The findings in this study provide
the first clear evidence of de novo methyltransferase function of
Dnmt3a and Dnmt3b in vivo and open new experimental approaches in the
understanding of how and where Dnmt3a and Dnmt3b act in human cells.
 |
MATERIALS AND METHODS |
Plasmids.
pMT3aMyc and pMT3bMyc were constructed by cloning
the mouse Dnmt3a and Dnmt3b1 cDNAs, respectively, in frame into
pCDNA3Myc. pCDNA3Myc contains a 12-amino-acid Myc tag downstream from
the multiple cloning site of the pCDNA3 vector (Invitrogen). The mouse Dnmt3a and Dnmt3b1 coding sequences were amplified from the
translational start site to one amino acid upstream of the stop codon
from the mouse Dnmt3a cDNA clone (pMT3A) and Dnmt3b1 cDNA clone
(pMT3B), respectively (generous gift from En Li, Massachusetts General Hospital). The primers were designed such that after an
AseI/BamHI double digest, the coding sequence of
Dnmt3a can be ligated into the expression vector in frame with the
12-amino-acid Myc tag on the vector. Primers for pMT3aMyc construction
were 5'-CGCGGATCCTGCCCAGCAATGCCCTCCAG (forward) and
5'-GTGCACGCGTTCACACAAGCAAAATATTCCTTCAGC (reverse). Primers
for pMT3bMyc construction were 5'-CGCGGATCCAGGAAACAATGAAGGGAGACAG (forward) and 5'-GTGCACGCGTATTCACAGGCAAAGTAGTCCTTC (reverse).
A single replacement of cysteine at position 706 of Dnmt3a and position
657 of Dnmt3b1 by a serine was made to abolish the cytosine
methyltransferase catalytic site. Mutant plasmid pMT3aMut was
constructed by amplifying sequences upstream and downstream of the
catalytic site separately, using the same primers for pMT3aMyc and two
mutant primers with the base substitution and 20 bases of overlap. The
mutant primer for the mutated site and the upstream sequence is
5'-CAATGGAGAGGTCATTGGAGGGACTGCC, and the mutant
primer for the mutated site and the downstream sequence is
5'-GGCAGTCCCTCCAATGACCT (the mutated site is
underlined). Mutant plasmid pMT3bMut was constructed similarly to
pMT3aMut by using the primers 5'-GGAAGCCCATCCAATGATCT and CGTTAGAGAGATCATTGGATGGGCTTCC (the
mutated site is underlined). After the upstream and downstream
sequences were amplified separately, the products were gel purified,
mixed, and amplified again, using the same forward and reverse primers
for wild-type plasmid construction. The final PCR products were
digested and cloned into the pCDNA3myc vector as described above. The
mutation was confirmed by sequencing both strands of the insert, and
the expression of full-length proteins was confirmed by immunostaining
of cells after transient transfection.
Several plasmids were used as the assay plasmids in transfection
studies. pCLH22 (
15) has
oriP, the EBNA1 gene, a
luciferase
reporter gene driven by the Rous sarcoma virus long terminal
repeat
(RSV LTR), a hygromycin resistance gene driven by the herpes
simplex
virus thymidine kinase gene promoter, and the necessary
prokaryotic
replication and selection sequences. pCLH22 was generated
by inserting
the RSV LTR and luciferase gene between
oriP
and the hygromycin
resistance gene on p220.2 (
3), such that
the only difference
between these two plasmids is the lack of the RSV
LTR and the
luciferase gene on p220.2. p22

EBNA1 is pCLH22 with the
EBNA1
sequence deleted by a
ClaI/
NsiI double
digest. Cytomegalovirus
(CMV) promoter-containing DNMT1 expression
vector pCMV-HMT, containing
the cDNA of human DNA methyltransferase
from nucleotides 315 to
5054 (EMBL accession no.
X63692), was obtained
from S. Baylin's
laboratory (Johns Hopkins University). This vector
was constructed
prior to the knowledge of further 5' sequences of DNMT1
(
32)
and therefore contains the short form of DNMT1; the
short form
of DNMT1 cDNA used here has been shown to have the same
activity
as the full-length DNMT1 (
32). This expression
vector has been
characterized and used for integration experiments
previously
(
27).
Cell lines and transfection.
The 293/EBNA1 cell line has
been described previously (9). The 3a and 3b cell lines were
generated by cotransfection of linearized pMT3aMyc and pMT3bMyc,
respectively, with a puromycin expression vector at a ratio of 10:1
into 293/EBNA1 cells. Twelve independent puromycin-resistant cell
clones were isolated and expanded from each transfection. Each cell
clone was given a unique identification by appending a hyphenated
number to the 3a or 3b prefix; for example, 3a-5 is a cell clone
expressing the Dnmt3a protein. Expression of the Myc-tagged proteins
was examined by immunofluorescent staining and Western blotting using a
monoclonal anti-Myc antibody. Throughout this study, the calcium
phosphate transfection method (9, 29) was used. All
transfections were done in duplicate or triplicate for each experiment,
and all experiments were performed multiple times.
Episome recovery and analysis.
Each time the transfected
cells reached confluence, 2.5% of the cells were replated into a
100-mm-diameter plate, and the remaining cells were harvested for
plasmid DNA extraction by the Hirt method (7). All
transfection experiments were carried out without any selection for the
episomal plasmid.
DNA harvested from each transfection was digested with restriction
enzymes to determine the methylation status. The digested
DNA was
fractionated on 1% agarose gels, Southern transferred
onto nylon
membranes, and probed with either the entire plasmid
or a specific
fragment of the plasmid. The Southern blots were
analyzed with a
phosphorimager (GS525; Bio-Rad).
Genomic DNA extraction and analysis.
High-molecular-weight
DNA was harvested from 293/EBNA1 cells, two Dnmt3a-expressing cell
clones (3a-5 and 3a-11), and two Dnmt3a-expressing cell clones (3b-9
and 3b-11), using the standard proteinase K-phenol-chloroform method.
Approximately 5 µg of DNA was double digested with
HindIII and HhaI. The digested DNA was fractionated on a 0.8% agarose gel and Southern transferred onto a
nylon membrane. The Southern filter was probed with the EBNA1 DNA
fragment, and the Southern blot was analyzed with a phosphorimager.
Immunostaining and Western blotting.
The cells were seeded
onto 22- by 22-cm coverslips 2 days before immunostaining, which was
carried out according to the standard protocol (5). In
brief, the cells were washed with phosphate-buffered saline (PBS) and
fixed with 1.5% paraformaldehyde in PBS before permeabilization with a
buffer containing 0.25% gelatin, 0.01% saponin, and 0.1% NP-40 in
PBS (buffer A). After being permeabilized, the cells were incubated
with a monoclonal anti-Myc antibody in buffer A without NP-40 for
1 h. The cells were then washed with buffer A without NP-40, and
the final detection step was done by incubating the cells with
fluorescein isothiocyanate-conjugated goat anti-mouse immunoglobulin G
(Boehringer Mannheim Biochemicals). The staining was viewed with an
Olympus BX60 epifluorescence microscope.
Crude extracts from 5 × 10
6 293/EBNA1, 3a-5, 3a-11,
3b-9, and 3b-11 cells were prepared by lysing the cells in 150 µl of
lysis
buffer containing 50 mM Tris (pH 8.0), 150 mM NaCl, 1% NP-40,
0.5% deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and protease
inhibitors. After the debri was pelleted by centrifugation, 50
µl of
4× reducing loading buffer was added to the lysate; 20 µl
of the
lysate from each cell line was heated at 55°C for 15 min
before
loaded onto an SDS-7% polyacrylamide gel with a positive
control.
Western blotting was done according to the standard protocol
(
4), using the anti-Myc monoclonal antibody and enhanced
chemiluminescence
nonradioactive detection
system.
 |
RESULTS |
Overexpression of murine Dnmt3a and Dnmt3b in human cells.
It
was of interest to overexpress the Dnmt3a and Dnmt3b1 proteins to
determine whether they could methylate DNA in vivo and to determine
their specificities. The 293/EBNA1 cells were cotransfected with a
puromycin expression vector and either pMT3aMyc or pMT3bMyc; 12 and 18 puromycin-resistant cell clones were isolated from cells transfected
with pMT3aMyc and pMT3bMyc, respectively, 10 days after selection.
Expression of the Myc-tagged Dnmt3a and Dnmt3b1 proteins was examined
by immunofluorescent staining using a monoclonal anti-Myc antibody
(data not shown). Nine and four clones were identified as Dnmt3a and
Dnmt3b positive, respectively. It is noteworthy that the integrated
Dnmt3b was expressed at a much lower level in all clones than the
integrated Dnmt3a, although they were expressed equally well in
transient transfections (Fig. 1A). Both
proteins coated the metaphase chromosomes while displaying a more
uniform pattern in the nucleus (Fig. 1A). Two independent cell clones,
3a-5 and 3a-11, for Dnmt3a protein, and two independent cell clones,
3b-9, and 3b-11, for Dnmt3b1 protein were further analyzed and used for
transfection studies. Expression of the tagged protein was further
confirmed by Western blotting using the monoclonal anti-Myc antibody
(Figure 1B). These results demonstrate the expression of tagged
proteins in these cells.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 1.
Dnmt3a and Dnmt3b expression in 293/EBNA1 cells. (A)
Immunofluorescent staining of 293/EBNA1 cells transiently transfected
with pMT3aMyc, pMT3bMyc, pMT3aMut, or pMT3bMut. Arrowheads indicate
cells with no Myc-tagged protein expression. (B) Western blot of
Myc-tagged Dnmt3a and Dnmt3b protein harvested from 3a-5, 3a-11, and
3b-11 cell clones. The solid arrowhead indicates the Dnmt3a protein,
and the open arrowhead indicates the Dnmt3b protein.
|
|
De novo methyltransfase activity of Dnmt3a and Dnmt3b in vivo.
Plasmid pCLH22 was transfected into 293/EBNA1, 3a-5, 3a-11, 3b-9, and
3b-11 cells and harvested 10 days after transfection. The
HhaI and HpaII single-digested plasmid DNA
harvested from transfected 293/EBNA1 cells showed the completely
digested pattern (Fig. 2). However,
several larger fragments were detected in the HhaI and
HpaII single-digested plasmid DNA, especially in the HhaI-digested DNA harvested from the transfected 3a-5 and
3a-11 cells (Fig. 2). There is a single fragment of increased size in the HhaI-digested plasmid and two fragments of increased
size in the HpaII-digested plasmid harvested from the
transfected 3b-9 and 3b-11 cells (Fig. 2). Observations for each
protein were the same in both cell clones; therefore, this result is
not the consequence of disruption of any specific endogenous gene by
Dnmt3a or Dnmt3b expression vector integration. It is important to note
that not all plasmids become methylated at these HhaI sites,
because some completely digested fragments can be detected. Several
HhaI sites in an extended region must acquire methylation to
give rise to these rather large HhaI fragments (from 2.3 to
6 kb). However, not all HhaI sites on the plasmid become
methylated, as indicated by the fact that no HhaI fragment
larger than 6 kb (the entire plasmid is 12.1 kb) and no uncut molecules
were detected. These findings clearly indicate that a fraction of the
plasmids become methylated at some of the HhaI and
HpaII sites when either Dnmt3a or Dnmt3b is overexpressed in
293/EBNA1 cells. The fact that the 3b cells appear to have a weaker
activity may be due to the lower expression or different specificity of
the protein. These observations were reproducible and consistent in
over 20 transfection experiments. This analysis suggests that Dnmt3a
and Dnmt3b can lead to de novo methylation of episomal plasmid with
some specificity in vivo.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 2.
De novo methylation of assay plasmid pCLH22 by Dnmt3a
and Dnmt3b. Shown is a Southern blot of pCLH22 DNA harvested 10 days
after transfection from 293/EBNA, 3a, and 3b cells. The DNA was
digested with restriction enzyme HhaI or HpaII,
as indicated above each lane. The probe used is the entire plasmid
pCLH22. 3a-5 and 3a-11 are cell clones with stably integrated pMT3aMyc,
and 3b-9 and 3b-11 are cell clones that harbor stably integrated
pMT3bMyc. Plasmid DNA harvested from 293/EBNA1 cells shows the complete
digestion pattern, and plasmid DNA harvested from the 3a and 3b cell
clones show some fragments of increased size.
|
|
Point mutations of Dnmt3a and Dnmt3b ablate the in vivo activity of
these two enzymes.
It is possible that the de novo methylation of
the episome observed was an indirect effect of Dnmt3a or Dnmt3b because
both proteins showed only weak de novo methyltransferase activity in vitro. To rule out this possibility, point mutations were generated within the methyltransferase catalytic domain of Dnmt3a and Dnmt3b. These mutated expression vectors can be tested in the same experimental system for de novo methyltransferase activity in vivo. It is known that
a cysteine-to-serine alteration in the P-C motif of methyltransferases destroys the catalytic activity without compromising other functions of
these proteins (18, 30, 31). A single replacement of cysteine by serine at position 706 of Dnmt3a protein and position 657 of Dnmt3b1 protein was made to alter this known catalytic site of
cytosine methylases. The mutation was confirmed by sequencing of both
strands of the plasmids after construction, and the expression of
full-length protein was detected by immunostaining of 293/EBNA1 cells
after transient transfection (Fig. 1A) as described above.
Plasmid pMT3aMut or pMT3bMut was cotransfected with the assay plasmid,
pCLH22 or p220.2, into 293/EBNA1 cells for de novo
methylation
activity. The only difference between p220.2 and pCLH22
is that the
former lacks the RSV LTR and luciferase gene. pMT3aMyc
or pMT3bMyc was
cotransfected with the assay plasmid into 293/EBNA1
cells as a positive
control, and the assay plasmid was transfected
alone into 293/EBNA1
cells as a negative control. The assay plasmid
harvested from the
negative control transfection (without cotransfection
with Dnmt3a or
Dnmt3b expression vector) was completely digested
by
HhaI or
HpaII enzyme as illustrated above (data not shown).
There
were no increased-size
HhaI fragments in the assay plasmid
cotransfected with pMT3aMut or pMT3bMut, whereas increased-size
HhaI fragments were observed in the positive control (Fig.
3).
This finding clearly demonstrates
that both Dnmt3a and Dnmt3b
possess methyltransferase activity and are
capable of de novo
methylation of the stable episome in vivo.

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 3.
Catalytic site mutants do not methylate the assay
plasmid. Shown is a Southern blot of HhaI- or
HpaII-digested plasmid DNA harvested 8 days after
transfection. Plasmid expressing wild-type (wt) Dnmt3a, mutant (mut)
Dnmt3a, wild-type Dnmt3b, or mutant Dnmt3b was cotransfected with assay
plasmid p220.2. The p220.2 DNA harvested showed a complete
HhaI and HpaII digestion pattern when
cotransfected with either pMT3aMut or pMT3bMut.
|
|
De novo methylatransferase activity of Dnmt3a and Dnmt3b is
distinct from that of DNMT1 in vivo.
It has been demonstrated that
Dnmt1 has a higher de novo methyltransferase activity than Dnmt3a and
Dnmt3b1 in vitro (21). Although episome methylation by
endogenous DNMT1 has not been observed in previous studies
(9-11), overexpression of DNMT1 may lead to episome
methylation. A DNMT1 expression vector, pCMV-HMT, with the CMV promoter
driving the human DNMT1 cDNA, was used in the following experiments.
This expression vector was chosen because it has been characterized
previously (27). Note that the CMV promoter was used in the
Dnmt3a and Dnmt3b expression vectors as well. The expression vector for
DNMT1, Dnmt3a, or Dnmt3b was cotransfected with an assay plasmid,
pCLH22 or p220.2, into 293/EBNA1 cells. Plasmid DNA harvested 12 days
after transfection showed no altered-size HhaI or
HpaII fragments when DNMT1 was cotransfected with the assay
plasmid (Fig. 4). After long exposure,
two very faint altered-size bands were observed in p220.2 DNA digested with each enzyme, and these bands were also visible in pCLH22 DNA after
much longer exposure (data not shown). These altered-size fragments may
be the result of DNMT1 de novo methylation activity when DNMT1 was
overexpressed in the cells. Similar to the findings described above,
many HhaI and HpaII fragments of increased size were detected when Dnmt3a was cotransfected with the assay plasmid, and
a few HhaI and HpaII fragments of increased size
were observed when Dnmt3b was cotransfected with the assay plasmid
(Fig. 4). This observation indicates that overexpression of human DNMT1 does not lead to de novo methylation of the episome to the same extent
as overexpression of either the murine Dnmt3a or Dnmt3b. Taken together
with previous observations that endogenous DNMT1 does not lead to
methylation of the episome over many weeks after transfection (9,
10), the findings here suggest that these three proteins may have
different targets or requirements for their de novo methylation
activity.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 4.
DNMT1, Dnmt3a, and Dnmt3b have distinct de novo
methyltransferase activities in vivo. An expression vector for human
DNMT1, murine Dnmt3a, or Dnmt3b was cotransfected into 293/EBNA1 cells
with assay plasmid pCLH22. pCLH22 DNA was harvested 12 days after
transfection and digested with restriction enzyme HhaI or
HpaII, as indicated above each lane. The increased-size
HhaI and HpaII fragments detected in pCLH22 DNA
cotransfected with either the Dnmt3a or the Dnmt3b expression vector
are the same as observed in Fig. 2. A complete digestion pattern is
observed in pCLH22 DNA cotransfected with the DNMT1 expression vector,
where only two very faint bands of increased size are detected in the
HhaI- or HpaII-digested DNA after long
exposure.
|
|
Targets of Dnmt3a and Dnmt3b de novo methylation activity on the
episome are not random.
If the de novo methylation activity of
Dnmt3a and Dnmt3b methylates CpG sequence randomly, any CpG sequence on
the episome should be equally likely to become methylated. It is
possible that some of the HhaI sites on the plasmid are too
close together and fragments generated by random methylation are too
small to be detected on the Southern blot when the entire plasmid is
used as a probe. However, methylation of one or two HhaI
sites in several regions of pCLH22 can result in fragments larger than
the largest completely digested HhaI fragment of 1.7 kb.
These regions include the EBNA1 gene, oriP, and the
luciferase gene. The oriP region is known to undergo
demethylation when the plasmid is methylated in vitro before
transfection (11), and therefore it is not likely to become
methylated. The EBNA1 and luciferase genes both of which are
transcribed in human cells, flank the oriP region.
Therefore, these two regions should be targeted similarly by the DNMTs
if these enzymes target CpG sites randomly or if some feature of open
chromatin structure (either due to transcription or near the
replication origin) is the only requirement. To investigate whether
this is the case, a Southern blot with HhaI-digested plasmid DNA harvested from 3a and 3b cells was hybridized sequentially with
probes containing the entire plasmid, the EBNA1 gene, and the
luciferase gene. This allows determination of whether all or some of
the HhaI fragments of increased size contain either of these
regions in the pCLH22 transfection experiments. To ensure complete
stripping of the probe after each hybridization, the Southern blot was
stripped with boiling water and stored for 2 months before the next hybridization.
With the EBNA1 probe, the completely digested bands containing any
portions of the EBNA1 region were detected in DNA harvested
from both
3a and 3b cells (Fig.
5A and C). In
addition, most,
if not all, of the increased-size
HhaI
fragments detected previously
with the entire plasmid as the probe also
hybridized to the EBNA1
probe (Fig.
2 and
5C). If the entire EBNA1
region is methylated
while two flanking
HhaI sites remained
unmethylated and digestible
by
HhaI, a 3.5-kb
HhaI fragment can be generated (Fig.
5A). Some
of the
HhaI sites within the EBNA1 region are clearly not
methylated
on a fraction of the plasmids, because a fragment smaller
than
3.5 kb is detected in plasmid DNA harvested from both 3a and 3b
cells (Fig.
5C). Although a 3.5-kb
HhaI fragment was
detected
in the DNA harvested from 3a cells with the EBNA1 probe,
several
larger fragments were also clearly visible (Fig.
5C). It is
also
noteworthy that these increased-size
HhaI fragments
detected in
the plasmid DNA harvested from 3a and 3b cells are
different.
These observations indicate that the
HhaI
fragments of increased
size from pCLH22 frequently involve the EBNA1
region and extend
beyond the EBNA1 region. It is also likely that
Dnmt3a and Dnmt3b
are dissimilar in their site preferences although
both proteins
target the same region of the assay plasmid.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5.
Methylation of a specific region of the episome. (A)
Illustration of HhaI sites and HhaI fragment
sizes within and adjacent to the EBNA1 region. (B) Illustration of
HhaI sites and fragment sizes in the luciferase gene. (C)
Southern blot of HhaI digestion of pCLH22 DNA harvested from
transfected 3a-5 and 3b-11 cells 10 days after transfection. The ENBA1
region-specific probe used for hybridization is as indicated in panel
A. All increased-size HhaI and HpaII fragments
observed in Fig. 2 are detected with this probe, as indicated with
solid lines. (D) The same Southern blot in panel C, hybridized with a
probe containing the luciferase coding region as indicated in panel B. The HhaI fragments derived from complete digestion are
indicated with arrowheads labeled with fragment sizes. Four additional
HhaI fragments were observed in the DNA harvested from 3a
cells, as indicated with lines. Two of these fragments are smaller and
two are larger than the largest completely digested band of 1.1 kb.
|
|
The Southern blot used above was stripped and then stored for 4 weeks
before being hybridized to a probe containing only the
coding region of
the luciferase gene (Fig.
5B). Smaller altered-size
HhaI
fragments were detected in the plasmid DNA harvested from
3a cells, and
no altered-size
HhaI fragment was detected in the
plasmid
DNA harvested from 3b cells (Fig.
5C). If the entire luciferase
gene
region was methylated while the two flanking
HhaI sites
remained
unmethylated and digestible by
HhaI, a 3.1-kb
HhaI fragment could
be generated (Fig.
5B). However, the
largest
HhaI fragment was
less than 3.1 kb in this
hybridization, which indicates that de
novo methylation occurring in
the luciferase gene region does
not extend much beyond the luciferase
gene. Observations based
on these sequential hybridizations indicate
that the EBNA1 gene
is more frequently part of the methylated regions
than the luciferase
gene and strongly suggest that the targets of de
novo methylation
on the episome are consistent and
nonrandom.
EBNA1 is a preferred initiation site of Dnmt3a and Dnmt3b de novo
methyltransferase activity.
Although the EBNA1 region is
frequently involved in the de novo methylated regions on the episome,
it is unclear whether methylation initiates in the EBNA1 region and
extends into adjacent regions or if it initiates outside the EBNA1
region and extends into the EBNA1 gene. To investigate this, a plasmid
lacking either the EBNA1 gene or the luciferase gene was assayed for de
novo methylation by Dnmt3a or Dnmt3b. A plasmid without the
oriP region cannot replicate in human cells and therefore
was not tested. Plasmids p22
EBNA1 and p220.2 (see Materials and
Methods for construction) were used for transfections into 3a and 3b as
described above. Patterns of increased-size HhaI fragments
similar to those observed in the pCLH22 DNA harvested from 3a and 3b
cells (Fig. 2) were detected in the p220.2 DNA harvested from these
cells (Fig. 6A). In contrast, no
HhaI fragment of increased size was observed in the
p22
EBNA1 DNA harvested from the 3a and 3b cells (Fig. 6B). If
methylation is initiated outside the EBNA1 region and then spreads into
the EBNA1 gene, the remaining region of methylation should persist when
the 2.5-kb region harboring the EBNA1 gene is excised from the plasmid.
If so, the increased-size HhaI fragments up to 3.5 kb in
length should be detected (the largest increased-size HhaI
fragment of 6 kb after subtracting the 2.5-kb excised segment). Experiments using p22
EBNA1 demonstrate that this is not the case. These findings suggest that the presence of the luciferase gene is not
essential for the initiation of de novo methylation on the plasmid and
has no effect on methylation of the EBNA1 region. Also, EBNA1 may be
the preferred initiation site of Dnmt3a and Dnmt3b de novo methylation
activity and from which methylation may spread into adjacent regions.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 6.
Lack of methylation of plasmid without the EBNA1
sequence. (A) Southern blot of HhaI-digested p220.2 (lacking
the luciferase gene) DNA harvested 10 days after transfection.
Arrowheads indicate increased-size DNA fragments detected in 3a and 3b
cells. (B) Southern blot of HhaI digestion of p22 EBNA1
DNA harvested 10 days after transfection. There is no detectable
HhaI fragment of increased size in any cells transfected
with p22 EBNA1. The entire plasmid is used as the probe in both
panels.
|
|
Integrated EBNA1 is also a target of the Dnmt3a de novo methylation
activity.
The 293/EBNA1 cell line was originally generated by
integrating the EBNA1 gene (driven by the CMV promoter) into the 293 embryonic kidney carcinoma cell line (9). All cell lines
derived from 293/EBNA1, including all 3a and 3b cell clones, contain
integrated EBNA1 at the same chromosomal site. The methylation status
of the integrated EBNA1 should be essentially identical in all of these
cell lines and therefore serve as an ideal test for whether Dnmt3a or
Dnmt3b alters it. It is uncertain whether Dnmt3b will lead to
methylation of the chromosomal EBNA1 sequence because its
methyltransferase activity is barely detectable on pCLH22 or p220.2 in
vivo. However, if EBNA1 is a target of Dnmt3a, integrated EBNA1 should
become methylated just like the EBNA1 gene on the episome.
To investigate the methylation status of the EBNA1 gene in these cell
lines, genomic DNA was harvested,
HindIII/
HhaI double
digested, fractionated on
a 0.8% agarose gel, Southern transferred,
and probed with the EBNA1
coding region. There is a
HindIII site
just upstream of
the CMV promoter and another
HindIII site just
downstream of the EBNA1 sequence (Fig.
7A). Therefore, the
HindIII
digest would release the CMV-EBNA1 segment from
the integrated
construct, regardless of the copy number and how the
concatemer
was formed. There are two
HhaI sites within the
EBNA1 sequence
and none in the CMV promoter. If both
HhaI
sites were methylated
in a given copy of CMV-EBNA1, a 3.1-kb
HindIII/
HindIII fragment
would be
generated by the digestion. Various-sized fragments would
be generated
by methylation at different sites, as illustrated
in Fig.
7A. A partial
digestion pattern is expected because multiple
copies of the CMV-EBNA
construct were integrated, and different
patterns of methylation can
occur on different segments of the
integrated array. If de novo
methyltransferase activity leads
to increased methylation of the
integrated EBNA1, increased amounts
of the 3.1-, 2.5-, and 0.9-kb bands
and decreased amounts of the
2.3- and the 0.7-kb bands should be
observed.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Methylation of the EBNA1 sequence in the chromosome. (A)
Illustration of HindIII and HhaI sites within
the HindIII-to-HindIII fragment from the
CMV-EBNA1 construct inserted into 293 cells. DNA fragments generated
from the integrated construct by a
HindIII/HhaI double digestion of
unmethylated, partially methylated, and completely methylated sequences
are also illustrated. (B) Southern blot of
HindIII/HhaI double-digested genomic DNA
harvested from 293/EBNA1, 3a-5, 3a-11, 3b-9, and 3b-11 cells. The probe
used is the same EBNA1 fragment as indicated in Fig. 5A. Compared with
293/EBNA1, 3b-9, and 3b-11 cells, there is a decreasing amount of DNA
in the smaller fragments and increasing amount of DNA in the 3.1-kb
band in the DNA extracted from 3a-5 and 3a-11 cells. Lack of fragments
larger than 3.1 kb indicates complete digestion of the DNA by
HindIII. Probing of the same blot by the puromycin
sequence also indicates complete digestion by HhaI (data not
shown).
|
|
The intensities of the 2.3- and 0.7-kb fragments are reduced in the
3a-5 and 3a-11 genomic DNA, while the 3.1-kb band is stronger
than
bands from the DNA from 293/EBNA1 or 3b cells (Fig.
7B).
Quantitation
of the radioactivity in the 3.1-kb band divided by
the total
radioactivity in all five bands in each lane can be
used to assess
methylation in the EBNA1 region. This quantitation
is done within each
lane; therefore, any loading difference between
lanes is irrelevant.
This analysis revealed that 30% of the DNA
is methylated at both
HhaI sites in the EBNA1 region in 293/EBNA1
cells (30% of
total radioactivity in the lane is in the 3.1-kb
band). Six cell clones
generated for an unrelated integration
experiment using the
293/EBNA1 cells were also examined for EBNA1
gene methylation. An
average of 24.8% of the DNAs from these six
clones is methylated at
both
HhaI sites in the EBNA1 region (data
not shown); 42 and
51% of the DNAs are methylated at these two
sites in the 3a-5 and
3a-11 cells. There is no appreciable change
of the fraction of
radioactivity in the 3.1-kb fragment in the
3b-9 (28%) and 3b-11
(27%) cells, most likely due to the lack
of significant methylation
activity at these
HhaI sites as demonstrated
with the
episome. This observation indicates that overexpression
of Dnmt3a can
lead to increased methylation at the two
HhaI sites
within
the integrated EBNA1 gene and suggests that some sequence
specificity
may exist, based on the fact that EBNA1 is a target
of de novo
methylation regardless of whether it is on an episome
or integrated
into a
chromosome.
 |
DISCUSSION |
There are several major novel findings in this study. First,
overexpression of murine Dnmt3a or Dnmt3b leads to de novo methylation of episomes in human cells. Second, this de novo methylation is the
direct result of the methyltransferase functions of Dnmt3a and Dnmt3b.
Third, DNMT1, Dnmt3a, and Dnmt3b appear to have distinct methylation
specificities in vivo. Fourth, the de novo methylation activity of
Dnmt3a and Dnmt3b proteins does not methylate all CpG sites but,
rather, has preferences. Fifth, Dnmt3a can lead to de novo methylation
of the same sequence on the episome as in the chromosome.
The tagged Dnmt3a and Dnmt3b proteins are expected to be expressed at
similar levels because the two expression vectors are essentially
identical. As expected, the transiently transfected Dnmt3a and Dnmt3b
proteins are expressed at similar levels, as detected by
immunofluorescent staining of the proteins. However, expression of the
integrated Dnmt3b is much lower than that of integrated Dnmt3a, as
indicated by both immunofluorescent staining of the protein (data not
shown) and Western blotting (Fig. 1). This indicates that Dnmt3b may be
tightly regulated by the cells, and higher long-term expression may
lead to negative selection. It is noteworthy that both Dnmt3a and
Dnmt3b proteins coat the metaphase chromosomes; this suggests that they
either are DNA binding proteins or associate with other proteins that
interact with DNA.
This study provides the first evidence that Dnmt3a and Dnmt3b can lead
to DNA methylation in vivo. When Dnmt3a or Dnmt3b is overexpressed in
293/EBNA1 cells, de novo methylation of the assay plasmid is observed.
Although Dnmt3a and Dnmt3b have conserved methyltransferase domains and
possess methyltransferase activity in vitro, one can argue that the in
vivo activity observed is the result of another de novo
methyltransferase activated by Dnmt3a or Dnmt3b. This possibility is
ruled out by the experiments using the mutant Dnmt3a and Dnmt3b with
the cysteine in the catalytic site of cytosine methyltransferases
replaced by a serine. The assay plasmid remains unmethylated at all
HhaI and HpaII sites in experiments in which a
mutant Dnmt3a or mutant Dnmt3b expression vector is cotransfected. It
is clear that the de novo methylation of the assay plasmid is a direct
result of Dnmt3a and Dnmt3b methyltransferases activity in vivo. This
is the first evidence that Dnmt3a and Dnmt3b function as de novo
methyltransferases in vivo.
Dnmt3b showed a much lower activity than Dnmt3a for de novo methylation
in cells transiently or stably expressing the protein. As discussed
above, transiently transfected Dnmt3a and Dnmt3b expression levels are
comparable. Therefore, it is likely that either Dnmt3b is a weaker
methyltransferase than Dnmt3a or Dnmt3b acts on substrates different
than the assay plasmids tested. In all experiments, Dnmt3a and Dnmt3b
do not lead to methylation of all episomes (some completely digested
bands are observed). One possibility is that de novo methylation by
these two enzymes is random, and therefore some completely digested
bands can always be detected from different molecules. However, de novo
methylation of the plasmid does not appear to be random, as described
in Results. It is more likely that Dnmt3a and Dnmt3b expression levels
are reduced or accessory factors are expressed at a lower level in some
cells. Therefore, the assay plasmid in these cells does not become
methylated and gives rise to the completely digested HhaI or
HpaII fragments. This suggests that the expression level of these two proteins may be important in their targeting.
De novo methylation by Dnmt3a and Dnmt3b can occur through several
possible pathways. (i) De novo methylation could initiate at a specific
site, and the methyltransferase could track along the DNA (in a
processive manner) and methylate other CpG sites on the plasmid until
the enzyme falls off, perhaps at preferred exit sites. (ii) There are
multiple target sites for de novo methylation on the plasmid, and
accessibility to the site dictates how frequent methylation is
initiated at the site. (iii) De novo methylation has no sequence
specificity; however, the methyltransferases must compete with
transcriptional machinery for access to the DNA. Therefore, regions
with stronger transcription are less accessible to the
methyltransferases and acquire methylation less frequently. It has been
demonstrated that CpG methylation sites exist upstream of the H19 gene
at a very low frequency in the homozygote Dnmt1 knockout ES cells, and
the neighboring CpG sites become methylated more frequently in the
rescued ES cells (28). Therefore, one could propose that
endogenous DNMT1 can spread methylation into adjacent DNA after Dnmt3a
or Dnmt3b initiates de novo methylation at a specific site. However,
this is highly unlikely (at least on the episome) because it has been
clearly documented in a previous study (10) that focal
methylation does not spread into adjacent DNA on the episome in the
same cell line used in this study. Therefore, it is not likely that
DNMT1 is responsible for spreading methylation from a specific site on
the episome that becomes de novo methylated by Dnmt3a or Dnmt3b. In
this study, most of the increased-size HhaI fragments
contain the EBNA1 region, but only one fragment contains the luciferase
gene region. Also, plasmids lacking the EBNA1 gene do not become
methylated to the same extent as plasmids harboring the EBNA1 gene.
Moreover, the integrated EBNA1 gene becomes more methylated in 3a-5 and
3a-11 cells than in the parental cell line, 293/EBNA1. There may be
sequence-mediated features within the EBNA1 gene region that determine
this specificity because the integrated EBNA1 gene is driven by the
much stronger human CMV promoter, and the EBNA1 gene is surrounded by
different sequences on the episome and in the chromosome. These
findings suggest that the EBNA1 gene is the preferred target or the
initiation site on the plasmid for de novo methylation by Dnmt3a or
Dnmt3b. No uncut molecule is detected when assay plasmid is digested
with either HhaI or HpaII, and the largest
HhaI fragments observed are approximately 6 and 3.5 kb in
pCLH22 (a 12.1-kb plasmid) harvested from 3a and 3b cells,
respectively. This indicates that every molecule has at least one, and
most likely more than one, CpG site that is not methylated by Dnmt3a or
Dnmt3b and can be digested by HhaI or HpaII.
Multiple increased-size HhaI fragments containing the EBNA1
region were detected in the plasmid DNA harvested from 3a cells,
indicating that de novo methylation takes place through various
distances from the EBNA1 region on different molecules. This suggests
that Dnmt3a can fall off at different sites on different molecules.
This study provides the first evidence that de novo methylation
activity of Dnmt3a and Dnmt3b has some specificity and favors the first
two possible pathways discussed above.
The specificity of target site selection by the DNMT may be due to some
virus-specific signal or unique sequence feature (including sequence-mediated feature) in the EBNA1 gene. I am currently designing new experiments utilizing this episomal system to define the
specificity and requirements of the de novo methylation activity as
well as to understand the pathway of the de novo methylation. This
study demonstrates the de novo methylation activity of Dnmt3a and
Dnmt3b in vivo, demonstrates some specificity of this activity, and
demonstrates that the de novo methylation activity can act on the same
sequence on the episome and in the chromosome. The biochemical assay of Dnmt3a and Dnmt3b proteins has been difficult because of the weak in
vitro activity of these two proteins; possibly other factors are
required to enhance this activity. Therefore, the observation of de
novo methylation activity in vivo using the episomal system opens up
the possibility of answering many questions. Using this in vivo assay
system, we can address the following questions: what is the signal for
de novo methylation targeting; how fast can de novo methylation occur;
what endogenous sequence can be affected by the de novo methylation
activity; and what other factors may play a role in Dnmt3a and Dnmt3b activity?
 |
ACKNOWLEDGMENTS |
I thank M. R. Lieber, B. Tracy, and D. Van Den Berg for
critical reading of the manuscript. I thank E. Li for his generous gift
of the Dnmt3a and Dnmt3b cDNA clones. I also thank T. Bestor for
suggesting the Dnmt3a and Dnmt3b mutant experiment.
This work was supported by NIH grant GM54781 and the Aresty endowment fund.
 |
FOOTNOTES |
*
Mailing address: Department of Urology and Department
of Biochemistry and Molecular Biology, University of Southern
California, 1441 Eastlake Ave., Rm. 5420, Norris Cancer Center, Mail
Stop 73, Los Angeles, CA 90033. Phone: (323) 865-0567. Fax: (323)
865-3019. E-mail: hsieh_c{at}froggy.hsc.usc.edu.
 |
REFERENCES |
| 1.
|
Bird, A. P.
1992.
The essentials of DNA methylation.
Cell
70:5-8[Medline].
|
| 2.
|
Cedar, H.
1988.
DNA methylation and gene activity.
Cell
53:3-4[Medline].
|
| 3.
|
DuBridge, R. B.,
P. Tang,
H. C. Hsia,
P.-M. Leong,
J. H. Miller, and M. P. Calos.
1987.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle vector.
Mol. Cell. Biol.
7:379-387[Abstract/Free Full Text].
|
| 4.
|
Grawunder, U.,
D. G. Schatz,
T. M. J. Leu,
A. Rolink, and F. Melchers.
1996.
The half-life of RAG-1 protein in precursor B cells is increased in the absence of RAG-2 expression.
J. Exp. Med.
183:1731-1737[Abstract/Free Full Text].
|
| 5.
|
Grawunder, U.,
N. Finnie,
S. P. Jackson,
B. Riwar, and R. Jessberger.
1996.
Expression of DNA-dependent protein kinase holoenzyme upon induction of lymphocyte differentiation and V(D)J recombination.
Eur. J. Biochem.
241:931-940[Medline].
|
| 6.
|
Hasse, A., and W. A. Schulz.
1994.
Enhancement of reporter gene de novo methylation by DNA fragments from the alpha-fetoprotein control region.
J. Biol. Chem.
269:1821-1826[Abstract/Free Full Text].
|
| 7.
|
Hirt, B.
1967.
Selective extraction of polyoma DNA from infected mouse cultures.
J. Mol. Biol.
26:365-369[Medline].
|
| 8.
|
Hsieh, C.-L., and M. R. Lieber.
1992.
CpG methylated minichromosomes become inaccessible for V(D)J recombination after undergoing replication.
EMBO J.
11:315-325[Medline].
|
| 9.
|
Hsieh, C.-L.
1994.
Dependence of transcriptional repression on CpG methylation density.
Mol. Cell. Biol.
14:5487-5494[Abstract/Free Full Text].
|
| 10.
|
Hsieh, C.-L.
1997.
Stability of patch methylation and its impact in regions of transcriptional initiation and elongation.
Mol. Cell. Biol.
17:5897-5904[Abstract].
|
| 11.
|
Hsieh, C.-L.
1999.
Evidence that protein binding specifies sites of DNA demethylation.
Mol. Cell. Biol.
19:46-56[Abstract/Free Full Text].
|
| 12.
|
Jones, P. L.,
G. J. Veenstra,
P. A. Wade,
D. Vermaak,
S. U. Kass,
N. Landsberger,
J. Strouboulis, and A. P. Wolffe.
1998.
Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription.
Nat. Genet.
19:187-191[Medline].
|
| 13.
|
Kass, S. U.,
D. Pruss, and A. P. Wolffe.
1997.
How does DNA methylation repress transcription?
Trends Genet.
13:444-449[Medline].
|
| 14.
|
Keshet, I.,
J. Lieman-Hurwitz, and H. Cedar.
1986.
DNA methylation affects the formation of active chromatin.
Cell
44:535-543[Medline].
|
| 15.
|
Lei, H.,
S. P. Oh,
M. Okano,
R. Juttermann,
K. A. Goss,
R. Jaenisch, and E. Li.
1996.
De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells.
Development
122:3195-3205[Abstract].
|
| 16.
|
Leohnardt, H., and T. H. Bestor.
1993.
Structure, function and regulation of mammalian DNA methyltransferase, p. 109-119.
In
J. P. Jost, and H. P. Saluz (ed.), DNA methylation: molecular biology and biological significance. Birkhauser Verlag, Basel, Switzerland
|
| 17.
|
Matsuo, K.,
J. Silke,
O. Georgiev,
P. Marti,
N. Giovannini, and D. Rungger.
1998.
An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA.
EMBO J.
17:1446-1453[Medline].
|
| 18.
|
Mi, S., and R. J. Roberts.
1993.
The DNA binding affinity of HhaI methyltase is increased by a single amino acid substitution in the catalytic center.
Nucleic Acids Res.
21:2459-2464[Abstract/Free Full Text].
|
| 19.
|
Nan, X.,
H. H. Ng,
C. A. Johnson,
C. D. Laherty,
B. M. Turner,
R. N. Eisenman, and A. Bird.
1998.
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.
Nature
393:386-389[Medline].
|
| 20.
|
Okano, M.,
S. Xie, and E. Li.
1998.
Dnmt2 is not required for de novo and maintenance methylation of viral DNA in embryonic stem cells.
Nucleic Acids Res.
26:2536-2540[Abstract/Free Full Text].
|
| 21.
|
Okano, M.,
S. Xie, and E. Li.
1998.
Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases.
Nat. Genet.
19:219-220[Medline].
|
| 22.
|
Razin, A., and T. Kafri.
1994.
DNA methylation from embryo to adult.
Prog. Nucleic Acid Res. Mol. Biol.
48:53-81[Medline].
|
| 23.
|
Razin, A.
1998.
CpG methylation, chromatin structure and gene silencing a three-way connection.
EMBO J.
17:4905-4908[Medline].
|
| 24.
|
Robertson, K. D.,
E. Uzvolgyi,
G. Liang,
C. Talmadge,
J. Sumegi,
F. A. Gonzales, and P. A. Jones.
1999.
The human DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues and overexpression in tumors.
Nucleic Acids Res.
27:2291-2298[Abstract/Free Full Text].
|
| 25.
|
Schmutte, C., and P. A. Jones.
1998.
Involvement of DNA methylation in human carcinogenesis.
Biol. Chem.
379:377-388.
|
| 26.
|
Schulz, W. A.
1998.
DNA methylation in urological malignancies.
Int. J. Oncol.
13:151-167[Medline].
|
| 27.
|
Vertino, P. M.,
R. W. C. Yen,
J. Gao, and S. B. Baylin.
1996.
De novo methylation of Cpt island sequences in human fibroblasts overexpressing DNA (cytosine-5)-methyltransferase.
Mol. Cell. Biol.
16:4555-4565[Abstract].
|
| 28.
|
Warnecke, P. M.,
D. Biniszkiewicz,
R. Jaenisch,
M. Frommer, and S. J. Clark.
1998.
Sequence-specific methylation of the mouse H19 gene in embryonic cells deficient in the Dnmt-1 gene.
Dev. Genet.
22:111-121[Medline].
|
| 29.
|
Wigler, M.,
R. Sweet,
G. K. Sim,
B. Wold,
A. Pellicer,
E. Lacy,
T. Maniatis,
S. Silverstein, and R. Axel.
1979.
Transformation of mammalian cells with genes from prokaryotes and eukaryotes.
Cell
16:777-785[Medline].
|
| 30.
|
Wilke, K.,
E. Rauhut,
M. Noyer-Weidner,
R. Lauster,
B. Pawlek,
B. Behrens, and T. A. Trautner.
1988.
Sequential order of target-recognizing domains in multispecific DNA-methyltransferases.
EMBO J.
7:2601-2609[Medline].
|
| 31.
|
Wyszynski, M. W.,
S. Gabbara, and A. S. Bhagwat.
1992.
Substitutions of a cysteine conserved among DNA cytosine methylases result in a variety of phenotypes.
Nucleic Acids Res.
20:319-326[Abstract/Free Full Text].
|
| 32.
|
Yoder, J. A.,
R. W. C. Yen,
P. M. Vertino,
T. H. Bestor, and S. B. Baylin.
1996.
New 5' regions of the murine and human genes for DNA (cytosine-5)-methyltransferase.
Biol. Chem.
271:31092-31097[Abstract/Free Full Text].
|
| 33.
|
Yoder, J. A.,
C. P. Walsh, and T. H. Bestor.
1997.
Cytosine methylation and the ecology of intragenomic parasites.
Trends Genet.
13:335-340[Medline].
|
| 34.
|
Yoder, J. A., and T. H. Bestor.
1998.
A candidate mammalian DNA methyltransferase related to pmt1p of fission yeast.
Hum. Mol. Genet.
7:279-284[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1999, p. 8211-8218, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yamagata, Y., Asada, H., Tamura, I., Lee, L., Maekawa, R., Taniguchi, K., Taketani, T., Matsuoka, A., Tamura, H., Sugino, N.
(2009). DNA methyltransferase expression in the human endometrium: down-regulation by progesterone and estrogen. Hum Reprod
24: 1126-1132
[Abstract]
[Full Text]
-
Yamagata, Y., Maekawa, R., Asada, H., Taketani, T., Tamura, I., Tamura, H., Ogane, J., Hattori, N., Shiota, K., Sugino, N.
(2009). Aberrant DNA methylation status in human uterine leiomyoma. Mol Hum Reprod
15: 259-267
[Abstract]
[Full Text]
-
Niemann, H., Tian, X C., King, W A., Lee, R. S F
(2008). Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning. Reproduction
135: 151-163
[Abstract]
[Full Text]
-
Damelin, M., Bestor, T. H.
(2007). Biological Functions of DNA Methyltransferase 1 Require Its Methyltransferase Activity. Mol. Cell. Biol.
27: 3891-3899
[Abstract]
[Full Text]
-
Li, F., Papworth, M., Minczuk, M., Rohde, C., Zhang, Y., Ragozin, S., Jeltsch, A.
(2007). Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes. Nucleic Acids Res
35: 100-112
[Abstract]
[Full Text]
-
Xie, Z.-H., Huang, Y.-N., Chen, Z.-X., Riggs, A. D., Ding, J.-P., Gowher, H., Jeltsch, A., Sasaki, H., Hata, K., Xu, G.-L.
(2006). Mutations in DNA methyltransferase DNMT3B in ICF syndrome affect its regulation by DNMT3L. Hum Mol Genet
15: 1375-1385
[Abstract]
[Full Text]
-
Lin, H., Yamada, Y., Nguyen, S., Linhart, H., Jackson-Grusby, L., Meissner, A., Meletis, K., Lo, G., Jaenisch, R.
(2006). Suppression of Intestinal Neoplasia by Deletion of Dnmt3b. Mol. Cell. Biol.
26: 2976-2983
[Abstract]
[Full Text]
-
Oka, M., Rodic, N., Graddy, J., Chang, L.-J., Terada, N.
(2006). CpG Sites Preferentially Methylated by Dnmt3a in Vivo. J. Biol. Chem.
281: 9901-9908
[Abstract]
[Full Text]
-
Ray, D., Wu, A., Wilkinson, J. E., Murphy, H. S., Lu, Q., Kluve-Beckerman, B., Liepnieks, J. J., Benson, M., Yung, R., Richardson, B.
(2006). Aging in heterozygous dnmt1-deficient mice: effects on survival, the DNA methylation genes, and the development of amyloidosis.. Journals of Gerontology Series A: Biological Sciences and Medical Sciences
61: 115-124
[Abstract]
[Full Text]
-
Datta, J., Majumder, S., Bai, S., Ghoshal, K., Kutay, H., Smith, D. S., Crabb, J. W., Jacob, S. T.
(2005). Physical and Functional Interaction of DNA Methyltransferase 3A with Mbd3 and Brg1 in Mouse Lymphosarcoma Cells. Cancer Res.
65: 10891-10900
[Abstract]
[Full Text]
-
Kuhlmann, M., Borisova, B. E., Kaller, M., Larsson, P., Stach, D., Na, J., Eichinger, L., Lyko, F., Ambros, V., Soderbom, F., Hammann, C., Nellen, W.
(2005). Silencing of retrotransposons in Dictyostelium by DNA methylation and RNAi. Nucleic Acids Res
33: 6405-6417
[Abstract]
[Full Text]
-
Genereux, D. P., Miner, B. E., Bergstrom, C. T., Laird, C. D.
(2005). A population-epigenetic model to infer site-specific methylation rates from double-stranded DNA methylation patterns. Proc. Natl. Acad. Sci. USA
102: 5802-5807
[Abstract]
[Full Text]
-
Gowher, H., Liebert, K., Hermann, A., Xu, G., Jeltsch, A.
(2005). Mechanism of Stimulation of Catalytic Activity of Dnmt3A and Dnmt3B DNA-(cytosine-C5)-methyltransferases by Dnmt3L. J. Biol. Chem.
280: 13341-13348
[Abstract]
[Full Text]
-
Xiong, Y., Dowdy, S. C., Podratz, K. C., Jin, F., Attewell, J. R., Eberhardt, N. L., Jiang, S.-W.
(2005). Histone Deacetylase Inhibitors Decrease DNA Methyltransferase-3B Messenger RNA Stability and Down-regulate De novo DNA Methyltransferase Activity in Human Endometrial Cells. Cancer Res.
65: 2684-2689
[Abstract]
[Full Text]
-
Fan, T., Hagan, J. P., Kozlov, S. V., Stewart, C. L., Muegge, K.
(2005). Lsh controls silencing of the imprinted Cdkn1c gene. Development
132: 635-644
[Abstract]
[Full Text]
-
Bai, S., Ghoshal, K., Datta, J., Majumder, S., Yoon, S. O., Jacob, S. T.
(2005). DNA Methyltransferase 3b Regulates Nerve Growth Factor-Induced Differentiation of PC12 Cells by Recruiting Histone Deacetylase 2. Mol. Cell. Biol.
25: 751-766
[Abstract]
[Full Text]
-
Ge, Y.-Z., Pu, M.-T., Gowher, H., Wu, H.-P., Ding, J.-P., Jeltsch, A., Xu, G.-L.
(2004). Chromatin Targeting of de Novo DNA Methyltransferases by the PWWP Domain. J. Biol. Chem.
279: 25447-25454
[Abstract]
[Full Text]
-
Kunert, N., Marhold, J., Stanke, J., Stach, D., Lyko, F.
(2003). A Dnmt2-like protein mediates DNA methylation in Drosophila. Development
130: 5083-5090
[Abstract]
[Full Text]
-
Liu, K., Wang, Y. F., Cantemir, C., Muller, M. T.
(2003). Endogenous Assays of DNA Methyltransferases: Evidence for Differential Activities of DNMT1, DNMT2, and DNMT3 in Mammalian Cells In Vivo. Mol. Cell. Biol.
23: 2709-2719
[Abstract]
[Full Text]
-
Weissmann, F., Muyrers-Chen, I., Musch, T., Stach, D., Wiessler, M., Paro, R., Lyko, F.
(2003). DNA Hypermethylation in Drosophila melanogaster Causes Irregular Chromosome Condensation and Dysregulation of Epigenetic Histone Modifications. Mol. Cell. Biol.
23: 2577-2586
[Abstract]
[Full Text]
-
Chedin, F., Lieber, M. R., Hsieh, C.-L.
(2002). The DNA methyltransferase-like protein DNMT3L stimulates de novo methylation by Dnmt3a. Proc. Natl. Acad. Sci. USA
99: 16916-16921
[Abstract]
[Full Text]
-
Chen, T., Ueda, Y., Xie, S., Li, E.
(2002). A Novel Dnmt3a Isoform Produced from an Alternative Promoter Localizes to Euchromatin and Its Expression Correlates with Active de Novo Methylation. J. Biol. Chem.
277: 38746-38754
[Abstract]
[Full Text]
-
Tao, Q., Huang, H., Geiman, T. M., Lim, C. Y., Fu, L., Qiu, G.-H., Robertson, K. D.
(2002). Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells. Hum Mol Genet
11: 2091-2102
[Abstract]
[Full Text]
-
Deplus, R., Brenner, C., Burgers, W. A., Putmans, P., Kouzarides, T., Launoit, Y. d., Fuks, F.
(2002). Dnmt3L is a transcriptional repressor that recruits histone deacetylase. Nucleic Acids Res
30: 3831-3838
[Abstract]
[Full Text]
-
Aapola, U., Liiv, I., Peterson, P.
(2002). Imprinting regulator DNMT3L is a transcriptional repressor associated with histone deacetylase activity. Nucleic Acids Res
30: 3602-3608
[Abstract]
[Full Text]
-
Okano, M., Li, E.
(2002). Genetic Analyses of DNA Methyltransferase Genes in Mouse Model System. J. Nutr.
132: 2462S-2465
[Abstract]
[Full Text]
-
Gowher, H., Jeltsch, A.
(2002). Molecular Enzymology of the Catalytic Domains of the Dnmt3a and Dnmt3b DNA Methyltransferases. J. Biol. Chem.
277: 20409-20414
[Abstract]
[Full Text]
-
White, G. P., Watt, P. M., Holt, B. J., Holt, P. G.
(2002). Differential Patterns of Methylation of the IFN-{gamma} Promoter at CpG and Non-CpG Sites Underlie Differences in IFN-{gamma} Gene Expression Between Human Neonatal and Adult CD45RO- T Cells. J. Immunol.
168: 2820-2827
[Abstract]
[Full Text]
-
Lin, I. G., Han, L., Taghva, A., O'Brien, L. E., Hsieh, C.-L.
(2002). Murine De Novo Methyltransferase Dnmt3a Demonstrates Strand Asymmetry and Site Preference in the Methylation of DNA In Vitro. Mol. Cell. Biol.
22: 704-723
[Abstract]
[Full Text]
-
Bird, A.
(2002). DNA methylation patterns and epigenetic memory. Genes Dev.
16: 6-21
[Full Text]
-
Jost, J.-P., Oakeley, E. J., Zhu, B., Benjamin, D., Thiry, S., Siegmann, M., Jost, Y.-C.
(2001). 5-Methylcytosine DNA glycosylase participates in the genome-wide loss of DNA methylation occurring during mouse myoblast differentiation. Nucleic Acids Res
29: 4452-4461
[Abstract]
[Full Text]
-
Fang, J.-Y., Mikovits, J. A., Bagni, R., Petrow-Sadowski, C. L., Ruscetti, F. W.
(2001). Infection of Lymphoid Cells by Integration-Defective Human Immunodeficiency Virus Type 1 Increases De Novo Methylation. J. Virol.
75: 9753-9761
[Abstract]
[Full Text]
-
Aoki, A., Suetake, I., Miyagawa, J., Fujio, T., Chijiwa, T., Sasaki, H., Tajima, S.
(2001). Enzymatic properties of de novo-type mouse DNA (cytosine-5) methyltransferases. Nucleic Acids Res
29: 3506-3512
[Abstract]
[Full Text]
-
Han, L., Lin, I. G., Hsieh, C.-L.
(2001). Protein Binding Protects Sites on Stable Episomes and in the Chromosome from De Novo Methylation. Mol. Cell. Biol.
21: 3416-3424
[Abstract]
[Full Text]
-
Costello, J. F, Plass, C.
(2001). Methylation matters. J. Med. Genet.
38: 285-303
[Abstract]
[Full Text]
-
Lin, I. G., Tomzynski, T. J., Ou, Q., Hsieh, C.-L.
(2000). Modulation of DNA Binding Protein Affinity Directly Affects Target Site Demethylation. Mol. Cell. Biol.
20: 2343-2349
[Abstract]
[Full Text]