Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8240-8253, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Massive Apoptosis of Thymocytes in
T-Cell-Deficient Id1 Transgenic Mice
Dongsoo
Kim,
Xiao-Cong
Peng, and
Xiao-Hong
Sun*
Department of Cell Biology, Kaplan Cancer
Center, New York University School of Medicine, New York, New York
10016
Received 5 February 1999/Returned for modification 23 March
1999/Accepted 23 August 1999
 |
ABSTRACT |
Id1 is an inhibitor of a group of basic helix-loop-helix
transcription factors, collectively called E proteins, which includes E12, E47, E2-2, and HEB. We have generated transgenic mice in which Id1
is specifically expressed in T cells. The total number of thymocytes in
these mice is less than 4% of that in wild-type mice. The majority of
the transgenic thymocytes are CD4 and CD8 double negative and bear the
cell surface markers of multipotent progenitor cells. A small number of
thymocytes, however, differentiate into CD4 or CD8 single-positive T
cells, which also display different characteristics from their
wild-type counterparts. More importantly, apoptotic cells constitute
about 50% of the total thymocytes. These apoptotic thymocytes have
rearranged their T-cell receptor genes, suggesting that they are
differentiating T cells. This finding has raised the possibility that
the T-cell deficiency in Id1 transgenic mice is the result of a massive
apoptosis of differentiating T cells triggered by Id1 expression as
opposed to a developmental block at the earliest progenitor stage. The progenitor cells accumulated in the transgenic mice might have survived
because they are not susceptible to the apoptotic signals. Despite the
massive cell death of the thymocytes at young ages, Id1 transgenic mice
frequently develop T-cell lymphoma later in their life span, and
lymphomagenesis appears to occur at different stages of T-cell
development. Taken together, our data suggest that E proteins, being
the targets of Id1, are essential regulators for normal T-cell
differentiation and tumor suppression.
 |
INTRODUCTION |
A subclass of the basic
helix-loop-helix family of transcription factors includes E12, E47,
E2-2, and HEB proteins (24, 25, 40), which are collectively
called E proteins. E12 and E47 are encoded by the E2A gene as a result
of alternative splicing (40, 55), whereas E2-2 and HEB are
products of their respective genes. Although encoded by different
genes, these E proteins are highly homologous in their DNA binding,
dimerization and trans-activation domains (36,
50). Consequently, they have similar functions; i.e., they bind
to E-box sequences and activate transcription. In lymphoid cells, the E
proteins exist predominantly as homo- or heterodimers among themselves
(4), even though they can form heterodimers with other
tissue-specific basic helix-loop-helix proteins such as MyoD and
NeuroD/BETA2 in muscle, neuronal, and pancreatic tissues (29, 41,
42). The critical role of E proteins in B-lymphocyte development
has been clearly demonstrated by the characterization of E2A-deficient
mice (3, 64). Disruption of the E2A gene leads to a block of
B-cell differentiation at the earliest stage (fraction A stage;
B220+ HSA
BP1
CD43
) (4, 22). In these mice, no rearrangement
of the immunoglobulin genes takes place and most of the B-cell-specific
genes are not expressed. In comparison, null mutation of the E2-2 or
HEB gene causes a modest impairment of B-cell development
(65), probably due to the relatively low abundance of the
E2-2 and HEB proteins expressed in the B-cell lineage. HEB is able to
rescue B-cell development in E2A-deficient mice when its cDNA is
inserted in the E2A locus so that HEB can be translated through an
internal ribosomal entry site (65). Therefore, HEB can
functionally complement E2A. Similar to strategies of disrupting the
E2A gene, we have previously generated transgenic mice in which Id1 is
specifically expressed in B cells (57). Because Id1 forms
heterodimers with E proteins and prevents them from binding to DNA, Id1
acts as a naturally occurring dominant negative inhibitor of E
proteins. In these transgenic mice, B-cell development is also blocked
at the earliest stage (57), a stage when endogenous Id1 is
expressed at a high level (32). Taken together, these
findings suggest that E proteins are essential for B-cell development.
Analogous to B-cell development, T-cell differentiation is also a
stepwise process that involves the sequential rearrangement and
expression of T-cell receptor (TCR) genes as well as the expression of
other T-cell-specific genes. Rather than developing in the bone marrow
as B cells do, the primary site for T-cell differentiation is the
thymus. The developmental stages of T cells are well characterized by
the expression of cell surface markers. In general, T cells in the
thymus can be divided into four populations: CD4 and CD8 double
negative (DN), double positive (DP), and CD4 (CD4+) or CD8
(CD8+) single positive (26). T cells in the
thymus develop from the DN to the DP stage through an intermediate
stage, termed the immature CD8 single-positive (ISP) stage. The DP
cells then differentiate into single-positive cells before exiting the
thymus. Early T-cell development at the DN stage can be further
characterized by the expression of CD44 and CD25 cell surface markers.
Multipotent progenitor cells marked as CD44+
CD25
commit to the T-cell lineage and differentiate
through the CD44+ CD25+, CD44
CD25+, and then CD44
CD25
stages. In the process, the TCR
gene is rearranged and expressed. The
chain pairs with the pre-T
chain to form a pre-TCR, which is essential for proliferation and differentiation of immature T cells.
Data from gene disruption experiments have demonstrated that lack of
any of the components that lead to the formation of pre-TCRs, as well
as the CD3 signal-transducing molecules, results in the arrest of
T-cell differentiation at the CD44
CD25+
stage (20, 35, 38, 53). However, the mechanisms that dictate
the differentiation of progenitor cells from the CD44+
CD25
stage to the CD44
CD25+
stage are less well understood. Parallel with the progression of the
developmental program are the apoptosis and antiapoptosis events that
ensure the survival of properly developed T cells and the elimination
of unwanted T cells. These events are intimately related to the
processes of TCR rearrangement and mitogenic stimulation through
TCR-mediated signaling pathways as well as other signaling pathways.
Shifting the balance between apoptosis and antiapoptosis has direct
consequences on T-cell development.
In contrast to the well-defined role of E2A gene products in B-cell
development, the role of E proteins in T-cell ontogeny is not entirely
clear. Homozygous E2A or HEB-deficient mice display moderate defects in
T-cell development (45, 63). The E2A-deficient mice have
reduced numbers of T cells in both the thymus and the spleen. The
percentage of DP thymocytes decreases by 50%, while the percentage of
DN cells and CD8+ cells increases significantly in either
E2A or HEB-deficient mice. These modest effects of E2A or HEB mutation
raise the question whether the E proteins are merely facilitators of
T-cell development or whether they are actually crucial regulators in
T-cell development but their role has not been revealed due to the
redundant function of E2A and HEB genes. Because of the neonatal death
of E2A and HEB deficient mice respectively, it has not been possible to
generate E2A and HEB double-knockout mice through simple genetic
crosses. We thus created transgenic mice in which the Id1 gene
(7), encoding the inhibitor of both E2A and HEB, is
specifically expressed in T cells. Strikingly, T-cell development in
these mice appear to be arrested at the earliest progenitor stage and
massive apoptosis of thymocytes is detected, resulting in mice with
rudimentary thymuses. This data, together with the previous findings
with B cells, thus prompts us to propose that E proteins, being the targets of the Id1 inhibitor, act as important regulators in lymphocyte commitment and differentiation in both the B- and T-cell lineages. Similar to the E2A-deficient mice (5, 63), Id1 transgenic mice also develop T-cell lymphoma, suggesting an oncogenic potential for the Id1 protein.
 |
MATERIALS AND METHODS |
Id1 transgenic mice.
The Id1 transgenic construct was
generated by inserting mouse Id1 cDNA into the BamHI site of
the vector plck-hGH (17), which contains the T-cell-specific
lck proximal promoter and the human growth hormone (hGH)
gene with introns and a polyadenylation signal. The Id1 cDNA was
modified by including a Kozak translation initiation sequence at the
ATG codon and by fusing the sequence encoding the influenza virus HA
epitope tag with the 3' end of the Id1 coding sequence. Transgenic
founders were identified by Southern blot analysis of the tail genomic
DNA. Transgenic offspring were determined by PCR of the tail genomic
DNA with the transgene-specific primers: 5'-hGH
(CGAACCACTCAGGGTCCTGTGG) and 3'-hGH (GGATTTCTGTTGTGTTTCCTCCCTG).
Flow cytometry.
Cell suspensions were prepared from the
thymus, spleen, and lymph nodes. Spleen cells were purified on Ficoll
cushions by a 30-min centrifugation at 4°C, and cells in the
supernatant were collected by centrifugation. Thymocytes were also
purified similarly. The cells were stained with antibodies for
two-color or three-color fluorescence-activated cell sorter (FACS)
analysis on a FACScan-II (Becton-Dickinson, Franklin Lakes, N.J.). The
following antibodies were purchased from Caltag Laboratories
(Burlingame, Calif.): phycoerythrin (PE)-conjugated anti-CD4 (PE-CD4),
Tri-color (TC)-CD4, fluorescein isothiocyanate (FITC)-CD8, TC-CD8,
FITC-CD3, FITC-TCR
(H57), FITC-CD24, and FITC-c-kit. FITC-TCR
(GL3), FITC-CD25, and PE-CD44 were from Pharmingen (San Diego, Calif.).
PCR for TCR rearrangement.
Thymic genomic DNA was prepared
from 106 unpurified cells by lysis at 55°C for 1 h
in 200 µl of buffer containing 10 mM Tris (pH 8.4), 50 mM KCl, 2 mM
MgCl2, 0.45% Nonidet P-40, 0.45% Tween 20, and 60 µg of
proteinase K per ml. A 1-µl volume of the DNA was subjected to PCR in
a 50-µl reaction mixture for 25 cycles (for the Id2 gene) or 30 cycles (for other genes) by denaturing at 94°C for 1 min, annealing
at 62°C for 30 s, and elongating at 72°C for 1.5 min.
One-tenth of the reaction mixture was analyzed by Southern blot
hybridization. Prehybridization was performed for 6 h at 37°C in
a buffer containing 6× SSC (pH 7.0) (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5× Denhardt solution, 0.05% sodium pyrophosphate,
0.1% sodium dodecyl sulfate, and 100 µg of sheared and denatured
salmon sperm DNA per ml. End-labeled oligonucleotide probe was added
subsequently for hybridization for 18 h at 37°C. The filters
were washed three times for 10 min each at 37°C in 6× SSC-0.05%
sodium pyrophosphate-0.1% sodium dodecyl sulfate. The final wash was
for 30 min at 37°C in 6× SSC-0.05% sodium pyrophosphate.
Quantitation was performed with a PhosphorImager (Molecular Dynamics,
Inc., Sunnyvale, Calif.).
The oligonucleotides used for TCR gene rearrangement assays were as
follows (unless specified, 3' primers were used as probes): V
3-5'
(CCTTGCAGCCTAGAAATTCAGTCC) (12), D
2-5'
(GTAGGCACCTGTGGGGAAGAAACT), J
2-3'
(TGAGAGCTGTCTCCTACTATCGATT) (2), J
2 (probe)
(GTCTACTCCAAAC TAC TC),
V
2C-5'
(ACTGTCTCTGAAGGAGCCTCTCTG),
V
F3-5' (ACCCAGACAGAAGGCCTGGTCACT), V
H-5'
(CAGAAGGTGCAGCAGAGCCCAGAA), J
TT11-3'
(GACCCTATTACTCACATACTTGGCTTG), J
TT11 (probe)
(GAAAGCAGAGTCCCAATTCCAAAG) (30), V
1-5'
(GGGGGATCCTGCCTCCTTCTAC), J
1-3'
(AAAAAGCTTACTCAACACGACTGGA), J
H (probe)
(GGAAGCTTACTTCCAACCTCTTTAGGT) (11); Id2-5'
(GAACCGAGCCTGGTGCCGCGCAGTCAGCTC), and Id2-3'
(GGCGGATCCTTATTTAGCCACAGAGTAC) (57).
RT-PCR for gene expression.
Thymic total RNAs were prepared
with Trizol (Life Technologies, Gaithersburg, Md.) as specified by the
manufacturer. First-strand cDNAs were synthesized from 10 µg of total
RNA with the oligo(dT) primer and Moloney murine leukemia virus reverse
transcriptase (RT) (Life Technologies). One-fortieth of the
first-strand cDNA reaction product was used for PCR with a reaction
volume of 25 µl. Serial dilution at 1:10 and 1:100 were also
performed to establish the linearity of the amplification.
Amplification was performed for 25 cycles (for
glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) and 30 cycles (for
other genes) by denaturing at 94°C for 45 s, annealing at 60°C
for 20 s, and elongating at 72°C for 1 m. One-fifth of each
reaction product was analyzed and quantitated by Southern blot
hybridization and PhosphorImager measurement. GAPDH signals were used
for normalization.
The oligonucleotides used for RT-PCR were as follows (unless specified,
3' primers were used as probes): GAPDH-5'
(ATGGTGAAGGTCGGTGTGAACGGATTTGGC),
GAPDH-3'
(GCATCGAAGGTGGAAGAGTGGGAGTTGCTG) (
57), pT

-5'
(CACACTGCTGGTAGATGGAAGGC),
pT

-3'
(GTCAGGAGCACATCGAGCAGAAG) (
43), V

8-5'
(ATGTACTGGTATCGGCAGGACACGG),
C

-5'
(GGATCTGAGAAATGTGACTC), C

-3' (CTGACCAGCACAGCATATAG),
C
(probe) (GTCACACAGAACATCAGTGCAG) (
27),
CD3

-5' (GAAGATGGAACACAGCGGGATTCTG),
CD3

-3'
(CTTAAGATTTCTTGTTCCGGGGCCAGT), CD3

-5'
(GTGGAACACTTTCTGGGGCATCCTG),
CD3

-3'
(GTCAGACTGCTCTCTGATTCAGGCCA), CD3

-5'
(CATGGAGCAGAGGAAGGGTCTGGCTG),
CD3

-3'
(GTTCACTTCTTCCTCAGTTGGTTTC), CD3

-5'
(GATGAAGTGGAAAGTGTCTGTTCTC),
CD3

-3'
(CTGTTAGCGAGGGGCCAGGGTCTGC), RAG1-5'
(CCAAGCTGCAGACATTCTAGCACTC),
RAG1-3'
(CAACATCTGCCTTCACGTCGATCC), RAG2-5'
(CACATCCACAAGCAGGAAGTACAC),
RAG2-3'
(GGTTCAGGGACATCTCCTACTAAG) (
13), TdT-5'
(GAAGATGGGAACAACTCGAAGAG),
TdT-3'
(CAGGTGCTGGAACATTCTGGGAG) (
31), Ku70-5'
(TGGAGAAGAAGGTCATAGCAGTGTG),
Ku70-3'
(TGGGCTTCTGAGCTTTAGTCAGTTC), Ku80-5'
(CAAGGTTGGAAGTGTGAATCCTGTTG),
Ku80-3'
(TCCTTATGGTCACTCTGTAGAGACC), IL7R

-5'
(AGCTGTTTCTGGAGAAAGTGG),
IL7R

-3'
(AACGACTTTCAGGTCAGAGGG) (
33), Ikaros-5'
(GATAGATCTATGGATGTCGATGAGGGTCAAGAC),
Ikaros-3'
(GATGAATTCTTAGCTCAGGTGGTAACGATGCTC) (
19),
c-kit-5'
(GTGTATTCACAGAGATTTGGCAGCC), and c-kit-3'
(CTGCGTAGAAGAGGCGCTGCTGC).
For endogenous Id1 expression,
Id1-5' (CCAGTGGCAGTGCCGCAGCCGCTGCAGGC)
and Id1-3'
(GTAGTGTCTTTCCCAGAGATCCCCTGG) were used. Oligonucleotide
GGCTGGAGTCCATCTGGTCCCTCAGTGC was used as a probe. For
transgenic
Id1 expression, Id1-5' and hGH-3'
(CCACAGGACCCTGAGTGGTTCG) were
used as
primers.
 |
RESULTS |
Dramatic reduction of the number of thymocytes in the Id1
transgenic mice.
To inhibit the activities of all E proteins in T
cells, we have generated transgenic mice in which the Id1 transgene is
specifically expressed in T cells. Id1 forms heterodimers with the E
proteins, but the resulting heterodimers cannot bind to DNA. We
inserted the Id1 cDNA into the plck-hGH transgenic vector
(17), which contains the proximal promoter of the
lck gene for directing T-cell specific transcription and a
portion of the hGH gene for the proper processing of mRNA by splicing
and polyadenylation. The Id1 transgenic fragment was microinjected into
pronuclei of the oocytes of FVB/N mice. Expression of the Id1 transgene
was detected in two independent founder lines (Id1-28 and Id1-29) by
RT-PCR assays with primers annealing to the Id1 and hGH sequences (data
not shown). Three other founder lines died in a non-pathogen-free
facility prior to rederivation, possibly due to their immunodeficiency.
The total numbers of thymocytes in the Id1-28 and Id1-29 mice were less than 4% of the numbers in their wild-type littermates in the first 1.5 weeks after birth (Fig. 1A). While this
low thymocyte count in the Id1-28 transgenic mice persisted throughout
adulthood, the deficit in the Id1-29 transgenic mice was subsequently
alleviated, suggesting a leakier block, probably as a result of a lower
level of Id1 expression. Therefore, further examination was carried out
by using the Id1-28 transgenic mice. Consistent with the low thymocyte
counts, the thymuses of the Id1-28 transgenic mice were rudimentary.
Histological examination revealed that the thymuses of Id1 transgenic
mice were almost devoid of the cortex, where developing T-cells are
normally found (Fig. 1B). In addition, the medulla of the thymus showed
a significant reduction in the number of lymphocytes.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Reduced cellularity in the thymuses of Id-1
transgenic mice. Unpurified viable thymocytes were counted with a
hemocytometer. The numbers of cells per thymus are the average for
n wild-type (WT) or Id1-28 and Id1-29 transgenic mice at the
indicated ages. (B). Hematoxylin and eosin stain of wild-type and
Id1-28 transgenic thymus sections.
|
|
T-cell developmental blocks in the Id1 transgenic mice.
To
examine intrathymic T-cell development, thymocytes from 1- and
5-week-old Id1-28 transgenic mice and their wild-type littermates were
first analyzed by using flow cytometry with antibodies against CD4 and
CD8 (Fig. 2A).
In contrast to the predominance of DP
cells in wild-type thymuses at both ages, the 1-week-old transgenic thymuses contained primarily DN cells, suggesting that the initial defect is at the DN stage. At the age of 5 weeks, CD4+ and
CD8+ single-positive cells appeared in the transgenic
thymuses while the DP cells were still lacking. Moreover, the
CD8+ population in the transgenic mice constitutes 20% of
the thymocytes, compared to 2.6% in wild-type mice. The appearance of
these CD4+ and CD8+ cells is not dependent on
the age of the animals but on the degree of inhibition of E-protein
function. For example, in 5-week-old homozygous transgenic mice, fewer
single positive cells were detected (data not shown), suggesting that
higher levels of Id1 expression lead to a greater inhibition of
E-protein function and a more complete block of T-cell development.


View larger version (51K):
[in this window]
[in a new window]
|
FIG. 2.
FACS analyses of cells from Id1 transgenic mice. (A) CD4
and CD8 profiles of the wild-type and transgenic littermates at the
indicated ages. The percentage of each cell population is shown in each
quadrant. (B) Further analysis of CD4+ and CD8+
single-positive thymocytes. Thymocytes from 5-week-old mice were
stained with TC-CD4 and PE-CD8 together with FITC-conjugated antibodies
as indicated. The CD4+ and CD8+ populations
were defined as shown in panel A. The expression of each indicated cell
surface marker is plotted as fluorescence intensity versus cell number
(different scales were used for wild-type and transgenic cells). The
profiles of the wild-type mice are shown as thick lines, and those of
the Id1 transgenic mice are shown as thin lines. (C) Analyses of
Ficoll-purified spleen cells from 5-week-old mice as described in panel
B. The percentage of CD4+ and CD8+
single-positive cells are shown on top of the boxes.
|
|
We have further characterized the CD4
+ and CD8
+
single-positive thymocytes that emerged in the 5-week-old transgenic
mice. In
the CD4
+ cells, expression of CD3 was somewhat
decreased while expression
of CD44 was dramatically increased compared
to the expression
in their wild-type counterparts (Fig.
2B). The
majority of the
CD4
+ cells appeared to be


T cells
rather than


T cells. Staining
for CD5 and CD24 markers revealed
heterogeneous populations in
CD4
+ cells; i.e., some cells
are CD5
+ or CD24

, characteristic of more
mature T cells, whereas others appear
as CD5

or
CD24
+, suggesting an immature phenotype. The
CD8
+ cells, which represent an unusually large population
of thymocytes,
also express lower levels of CD3 and extremely high
level of CD44.
Unlike CD4
+ cells, only 30% of the
CD8
+ cells were identified as


T cells and 10% were
identified as


T cells. The remainder of the CD8
+
cells did not carry high levels of any surface TCR and were thus
suspected to be ISP cells. However, the majority of these
CD8
+ cells appeared as CD5
+ and
CD24

cells, which would tend to classify the cells as
mature T cells
rather than ISP cells. Therefore, the expression
patterns of TCR
and CD5 CD24 in the CD8
+ cells seem
uncoupled, and the mechanisms remain to be investigated.
Nevertheless,
our FACS data described above would suggest that
T-cell development in
the Id1 transgenic mice is impaired primarily
at the DN stage. However,
the single-positive cells that have
developed also display obvious
abnormalities, which would imply
that Id1 expression continues to
affect the developmental program
beyond the DN stage. Compared to the
total number of


T cells
in Id1 transgenic mice, which is
100-fold smaller than the wild-type
count, the number of


T cells
is reduced by only fivefold. Moreover,
some of the


T cells
appear to be CD8
+, which is extremely rare in wild-type
mice. This finding is generally
in agreement with that found by Blom et
al., where Id3 blocks
the development of


but not


T cells
differentiated from committed
progenitor T cells (
9).
Consistent with the findings in the transgenic thymus, the number of
peripheral T cells in the spleen was also dramatically
decreased (about
eightfold) (Fig.
2C). Similar to thymic CD4
+ and
CD8
+ single-positive cells, splenic T cells also exhibited
low levels
of CD3 and TCR

and a high level of CD44 surface
expression.
Moreover, there was also a small but distinct population of
CD8
+ cells that had much lower levels of cell surface TCR

, perhaps
corresponding to


T cells. Despite the unusually
high percentage
of CD8
+ cells in the thymus, the ratio of
CD4
+ and CD8
+ cells in the spleens of
transgenic mice appeared similar to that
in their wild-type
littermates.
It has been shown that overexpression of Id3 in bipotential progenitor
cells from human thymus inhibits the differentiation
of the T-cell
lineage under appropriate culture conditions while
stimulating the
differentiation of the NK cell lineage (
23).
However, we
have not detected any significant increase in the
number of NK cells in
either the thymuses or spleens of the Id1
transgenic mice (data not
shown). This may be due to the different
mechanisms used in human and
mouse hematopoiesis, different functions
of Id1 and Id3, different
promoters for Id expression, or different
experimental systems, i.e.,
in fetal thymic organ culture and
in
mice.
Further characterization of the DN cells in the transgenic
mice.
The FACS analysis in Fig. 2A suggested that the T-cell
developmental defect in the transgenic mice occurred primarily at the DN stage. To further define the developmental stages of the DN transgenic cells, thymocytes that were negative for anti-CD4 and anti-CD8 staining were examined for c-kit, CD44, CD24, and CD25 expression (Fig. 3). In wild-type mice,
the DN cells were characterized predominantly as c-kit
CD44
CD24+, with CD25 being positive or
negative. In contrast, the majority of DN cells in 1-week-old
transgenic mice appeared to be c-kit+ CD44+
CD24
CD25
, which marks multipotent
progenitor cells (51, 62). At 4 weeks later, while the
wild-type cells exhibited indistinguishable characteristics from the
1-week-old cells, the transgenic DN cells progressed to a stage
displaying cell surface markers as c-kit
CD44+ CD24+ CD25
and remained at
this stage throughout adulthood. It thus appears that the major
rate-limiting steps in T-cell development in the Id1 transgenic mice
might involve the commitment of lymphoid progenitor cells to the T-cell
lineage and the initial differentiation of committed T cells.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Further characterization of CD4 and CD8 DN cells.
Thymocytes from wild-type (WT) and transgenic littermates at the
indicated ages were stained with TC-CD4 and TC-CD8 together with PE-
and FITC-conjugated antibodies as indicated. The TC-negative population
was gated for these analyses.
|
|
TCR rearrangement in the transgenic mice.
The V(D)J
recombination of TCR genes is a crucial process during T-cell
differentiation. The majority of thymic T cells rearrange and express
the TCR 
, while a minor population of T cells bear TCR 
.
The orderly events in TCR rearrangement begin with the joining of the D
and J regions of the
chain gene of TCR followed by the V-to-DJ
recombination. The productive rearrangement of the
-chain gene,
together with the pre-T
chain, results in the formation of a
pre-TCR, which then prompts the V-to-J recombination of the
-chain
gene. Therefore, these step-by step events of TCR rearrangement have
been used as indicators for the developmental stages of T cells. The

T cells arise from progenitor T cells by rearranging TCR
and
genes prior to TCR
gene rearrangement. We have examined the
rearrangement of TCR genes in the thymocytes from the Id1 transgenic
mice to further assess their developmental status (Fig.
4).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 4.
TCR rearrangement. Total and sorted thymocytes (labeled
at the top of each panel) from wild-type and transgenic littermates at
the indicated ages were used to prepare DNA for PCR analyses.
Thymocytes from wild-type and transgenic (lanes 1 and 3) mice and their
respective 10-fold-diluted samples (lanes 2 and 4) were used in PCRs to
detect TCR rearrangement events as indicated. The PCR product of the
Id2 gene served as a control for the amount of DNA present in each
sample. The PCR products were analyzed by Southern blotting.
|
|
In the total thymocytes of 5-week-old Id1 transgenic mice, the
D

-to-J

rearrangement, which is not
believed to be
a rate-limiting step, occurred at a similar efficiency
to that
in the wild-type mice. However, the events of the
V

-to-D

J
recombination were
significantly reduced (Fig.
4), most probably
as a result of the lack
of T cells that had reached the developmental
stage necessary to
undergo V-to-DJ rearrangement. Surprisingly,
although the
CD4
+ or CD8
+ single-positive T cells
constituted about 40% of the thymocytes
in the 5-week-old transgenic
mice, a very low frequency of rearrangement
in the

locus was
detected by using three 5' primers binding
to different
V

regions and two 3' primers corresponding to
different
J

regions (Fig.
4 and data not shown). It remains
to be
verified whether this low frequency is due to the intrinsic
defect in
TCR

rearrangement, or because the single-positive
cells in the
transgenic mice are not all


T cells but also include


and
immature T
cells.
To further examine the CD8 single-positive cells which represent an
abnormally large population in the transgenic mice, we
have isolated
these cells from wild-type and transgenic mice by
using a cell sorter
and compared the gene rearrangement in various
TCR loci (Fig.
4B).
While the frequency of D

-J

rearrangement
was comparable between wild-type and transgenic cells, that of
V

-D

J

rearrangement in the
transgenic cells was
much lower than in the wild-type cells. Like the
finding in total
thymocytes, rearrangement at the

locus in the transgenic cells
was detected at a very low frequency
compared to that in the wild-type
cells. These low frequencies of TCR

and

rearrangement might
be explained by the small fraction
(about 30%) of


T cells in
the CD8
+ population (Fig.
2A).
In contrast to the

and

loci, rearrangement of the

locus in
the transgenic mice did not appear to be inhibited. Compared
to the
total thymocytes in their wild-type littermates, the frequency
of
V

-to-D

J

recombination was
increased dramatically
in the transgenic mice. Since purified DN cells
from wild-type
and transgenic mice showed similar efficiencies of
V

-to-J
rearrangement (Fig.
4C), the
relative increase in the rearrangement
events in the

locus may be
partially explained by the much higher
percentage of DN cells in the
transgenic mice. Moreover, in the
CD8
+ cells of transgenic
mice, V

-J

rearrangement was readily
detectable in the transgenic sample but not the wild-type sample,
most
probably due to the presence of


T cells as well as immature
single-positive cells in the CD8
+ population (Fig.
2B).
Massive cell death in the thymuses of the Id1 transgenic mice.
Another striking feature of the Id1 transgenic mice was the presence of
a large number of dead cells in the thymus as determined microscopically and by forward- and side-scatter flow cytometry analysis (Fig. 5A). The dead cells, most
probably apoptotic cells, constituted about 50% of the total
thymocytes. To further characterize the dead cells, we have separated
the dead cells from live ones by centrifugation of total thymocytes on
a Ficoll cushion. The resulting pellet contained dead cells as well as
contaminating live cells, while the supernatant had mostly live cells
as evidenced by the scatter analysis (Fig. 5A). Moreover, gel
electrophoresis of DNA isolated from total thymocytes of the transgenic
mice but not the wild-type mice showed DNA fragmentation, a
characteristic of apoptotic cells (Fig. 5B, lanes 1 and 2). The
fragmented DNA was contributed by the cells partitioned to the pellet
after centrifugation on the Ficoll cushion, whereas the DNA
prepared from cells in the supernatant appeared intact (lanes 3 and 4).
To assess the developmental status of the apoptotic cells, genomic DNA
was isolated from different fractions of cells for analysis of TCR
rearrangement. As diagrammed in Fig. 5C, total thymocytes (sample 1)
were first separated into pellet (sample 2) and supernatant (sample 5)
components. The DNA isolated from the pelleted cells was further
fractionated by gel electrophoresis into intact DNA (sample 3), which
was probably derived from contaminating live cells, and fragmented DNA,
which presumably originated from the apoptotic cells (sample 4). Cells in the supernatant were then stained with TC-CD4, TC-CD8, PE-CD44, and
FITC-CD25. By using a cell sorter, DN cells, which constituted 70% of
the thymocyte, were gated, and CD44+ CD25
cells (sample 6) and the remainder of the DN cells (sample 7) were
collected. These samples were then used to isolate DNA for PCR analysis
of TCR rearrangement.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Apoptosis in the Id1 transgenic thymus. (A) Forward- and
side-scatter analysis of thymocytes with or without Ficoll purification
as indicated. Live cells are circled. (B) Electrophoresis of DNA from
wild-type and transgenic unpurified thymocytes (lanes 1 and 2),
transgenic thymocytes in the pellet after centrifugation on Ficoll
(lane 3), and transgenic thymocytes in the supernatant (lane 4). (C)
TCR rearrangement in different fractions of thymocytes in 10-day-old
transgenic mice. The fractionation procedure is diagrammed at the top.
The different fractions are numbered 1 through 7, corresponding to the
lane numbers. The PCR product representing the germ line configuration
in D -J region is marked by an arrowhead.
|
|
Although the frequencies of TCR rearrangement at the

and

loci
were lower in the transgenic mice than in wild-type mice,
as shown in
Fig.
4, these rearrangement events were detectable
in both the live and
dead cells in the transgenic mice when PCR
amplified through additional
cycles (Fig.
5C, lanes 1 to 5). Of
particular significance was that in
the fragmented DNA (lane 4),
the TCR

locus was predominantly in the
rearranged configuration.
Rearrangement of the TCR

locus was also
detectable. This would
imply that the cells undergoing apoptosis have
committed to the
T-cell lineage and reached certain stages in T-cell
development.
In contrast to these apoptotic cells, the majority of
CD44
+ CD25

DN progenitor cells, which
constituted at least 50% of the transgenic
thymocytes, had not
undergone rearrangement in the TCR

or
locus (lane 6). The weak
signals of D

-J

rearrangement
detected in
this sample might come from a subpopulation of cells
that have
aberrantly initiated rearrangement or from the


T
cells
(
10) or from contaminating DN cells that belong to later
stages (lane 7). Whether TCR gene rearrangement triggers apoptosis
in
the transgenic thymocytes or whether apoptosis occurs only
in
differentiating T cells remains to be
determined.
Since a large number of V

-J

rearrangement
events were detected in the CD44
+ CD25

DN
cells (Fig.
5C, lane 6), it would appear that some of the


T
cells display a surface phenotype as CD44
+
CD25

. FACS analysis with antibodies against TCR


together with antibodies
against CD44 or CD25 had confirmed that the


-positive cells
were CD44
+ CD25

in both
wild-type and transgenic mice (data not shown). While
this surface
phenotype seems to be consistent with the notion
that rearrangement of
the TCR


loci precedes that of the

loci (
42),
TCR

rearrangement was detected in the CD25

cells of
the Id1 transgenic mice, where TCR

rearrangement was
not believed to
take place until the cells become CD25
+ (
62).
Whether this discrepancy is due to the expression of
Id1 transgene
remains to be determined. Similar to


T cells,


T cells
also undergo apoptosis, since V

-J

rearrangement
was also detected in the apoptotic cells. This may
explain the
fivefold reduction in the total number of


T cells in
the thymuses
of transgenic mice based on FACS analyses (data not
shown).
Gene expression in the Id1 transgenic mice.
Since the E
proteins are potent transcription activators, it is important to
examine gene expression which might be altered as a result of the loss
of E-protein activity. By using RT-PCR analysis, we compared the
expression levels of various genes important for T-cell differentiation
between transgenic mice and their wild-type littermates at the ages of
1 and 5 weeks (Table 1). We found that
expression of the genes encoding components of the pre-TCR complexes
(pre-T
, CD3
, CD3
, CD3
, and CD3
) was not dramatically inhibited except for V
expression. However, genes
involved in the rearrangement of TCR, such as the RAG1, RAG2, TdT, and Ku70 genes, were expressed at less than 15% of the wild-type levels in
1-week-old mice and their expression increased in 5-week-old mice. Ku80
expression, on the other hand, did not change dramatically in either
the 1- or 5-week-old mice. The mRNA level of Ikaros transcription factor also decreased modestly in the 1-week-old transgenic mice but increased in older mice (Table 1 and data not
shown). These results may be interpreted to mean that the lower levels
of gene expression are due to the lack of T cells which have reached
the stages when these genes are up-regulated (51).
Alternatively, these genes may be the direct targets of the E proteins,
and inhibition of E protein activities leads to lower levels of their
expression. By the same token, the genes encoding c-kit and
interleukin-7 (IL-7) receptor
, both of which are important for the
survival of progenitor T cells, appeared to be expressed at
higher-than-wild-type levels. This may also be explained by the
enrichment for the T cells at early stages in the transgenic mice.
One remarkable finding from the gene expression analysis is that the
endogenous Id1 transcript in the 1-week-old transgenic
mice was present
at a level 17-fold higher than that in their
wild-type littermates
(Table
1). Since the majority of thymocytes
in the transgenic mice at
this age belong to a population characterized
as CD4

CD8

and c-kit
+ CD44
+
CD24

CD25

, it is possible that Id1 is
normally expressed at a high level
in this population of progenitor T
cells, which are present as
an extremely minor population in the
wild-type littermates (Fig.
2A and
3). In 5-week-old mice, this
population in the transgenic
mice progressed to a stage displaying cell
surface markers such
as CD4

CD8

and
c-kit

CD44
+ CD24
+
CD25

(Fig.
3) and Id1 expression decreased to a level
comparable to
that in their wild-type littermates. Based on these
results, we
therefore propose that the endogenous Id1 gene is expressed
in
the thymus at the progenitor stage marked as CD4

CD8

and c-kit
+ CD44
+
CD24

CD25

and that its expression is
down-regulated as differentiation
proceeds. Interestingly, when Id1
down-regulation is not possible
due to ectopic Id1 overexpression, as
in the transgenic mice,
T-cell development appears to be impaired at
this progenitor stage
due to the failure of further differentiation of
the progenitor
cells or the survival of differentiated T
cells.
T-cell lymphoma in the Id1 transgenic mice.
Since disruption
of the E2A gene was found to cause T-cell lymphoma in E2A-deficient
mice (5, 63), we were interested in determining if
overexpression of Id1 could also lead to tumor formation in the
transgenic mice. Despite the severe block of T-cell development at an
early progenitor stage, adult transgenic mice developed T-cell lymphoma
at a high frequency and at an age as early as 2.5 months. Figure
6A shows the physical appearance of one
such thymic lymphoma and the histological examination of the lymphoma
and its metastatic sites. The normal histological structure of the
thymus was completely effaced and replaced by a monotonous population
of intermediate-size neoplastic lymphocytes with abundant mitotic
figures and apoptotic cells. Morphologically, this tumor resembled
Burkitt's lymphoma in humans. Although upon gross examination only the
lymph nodes and spleen appeared affected by the tumor, microscopically
all sampled organs demonstrated interstitial infiltration of neoplastic
lymphocytes.

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 6.
T-cell lymphoma in Id1 transgenic mice. (A) The
appearance of a thymic lymphoma in a 3.5-month-old mouse and
histological examination of the tumor and its metastatic sites. (B)
FACS analysis of the thymus and lymph nodes of four 4-month-old
transgenic mice numbered 1 to 4. The size of each thymus was similar to
that shown in panel A. Lymph nodes were enlarged to various degrees.
Cells were stained with antibodies against CD4 and CD8 as labeled.
|
|
Cohorts of wild-type (
n = 14) and Id1 transgenic
(
n = 12) mice were sacrificed at the age of 4 months to
examine tumor formation.
While all of the wild-type thymuses had
involuted by this age,
6 of the 12 transgenic thymuses exhibited
various degree of enlargement,
indicative of tumor formation. Four of
the transgenic mice had
thymuses as large as that shown in Fig.
6A, and
some of them displayed
apparently enlarged lymph nodes and spleens. To
further characterize
the tumor cells, cells from these thymic tumors as
well as the
affected lymph nodes and spleen were stained with
antibodies against
CD4 and CD8 for FACS analysis. Surprisingly, the
analysis revealed
profound heterogeneity in their CD4 and CD8 profiles.
Figure
6B
shows several examples of such profiles of the enlarged
thymus
and lymph nodes, which range from uniformly DN to
CD4
+ or CD8
+ single positive (Fig.
6B and data
not shown). Sometimes, the
tumors appeared to consist of a mixture of
cells with different
CD4 and CD8 profiles, as exemplified by mouse 2 (Fig.
6B). CD3
and CD44 expression on the surface of these cells has
also been
examined, but no correlation between the expression levels
and
tumor type or size was observed (data not shown). In most
instances,
the surface phenotypes of cells from the thymuses and lymph
nodes
are similar (mice 1 to 3, Fig.
6B), suggesting that the tumor
cells originating from the thymus may have migrated to the lymph
nodes
and continued to expand there. Interestingly, although the
thymus and
lymph nodes were extremely enlarged in mouse 4, the
CD4 and CD8
profiles of these organs appeared more or less normal.
This would
suggest that while T cells maintain their ability to
differentiate
normally, preneoplastic hyperproliferation might
have been occurring in
the thymus, resulting in a large number
of mature T cells being poured
out to the periphery including
the lymph nodes. It would be interesting
to investigate whether
this preneoplastic proliferation precedes all
tumor formation
or whether this condition represents a different form
of cell
transformation as a result of Id1
overexpression.
Finally, one significant observation is that the developmental stages
of the neoplastic or preneoplastic cells are all beyond
the initial
developmental block. The majority of thymocytes found
in the Id1
transgenic mice that had not developed tumors were
at the
CD44
+ CD25

DN stage. However, even the tumor
with a DN phenotype appeared
as CD44

CD25
+.
This brings up the question whether only cells that have escaped
the
initial block can be transformed or whether the neoplastic
cells are
derived from the developmentally arrested cells and
continue to
differentiate during
tumorigenesis.
 |
DISCUSSION |
Role of E and Id proteins in T-cell development.
Id1
overexpression arrests T-cell development at the progenitor stage in
the Id1 transgenic mice, a defect similar to but much more severe than
that in the E2A- or HEB-deficient mice (5, 65). Since Id1 is
an inhibitor of all E proteins (56), it is likely that it
exerts its dramatic effect by interfering with the function of multiple
E proteins which are expressed simultaneously in T cells. In fact, we
have found that expression of E47, a product of the E2A gene, can
rescue the T-cell deficiency in Id1 transgenic mice (data not shown).
Therefore, findings with the Id1 transgenic mice have demonstrated that
the E proteins collectively are as crucial for T-cell development as
they are for B-cell development. The thymocytes that accumulated in the
Id1 transgenic mice were identified as c-kit+
CD44+ CD24
CD25
or
c-kit
CD44+ CD24+
CD25
progenitor cells that have the potential to
differentiate into T, B, and NK cells (15, 51).
Interestingly, the developmental stages of these cells appear to
parallel the stage known as fraction A (B220+
CD43+ CD24
BP-1
) in bone marrow
(22), the stage at which B-cell development is blocked in
the E2A-deficient mice (4). Fraction A cells can be further
characterized based on their surface expression of the AA4.1 marker.
AA4.1+ cells are considered prepro-B cells, while
AA4.1
cells include cells expressing the NK1.1 markers
and a subset of T cells (32). Because B and T cells have
common strategies in their differentiation, the similar effect on B-
and T-cell development as a result of E-protein ablation either by gene
disruption or by overexpression of their inhibitor would suggest that E
proteins might control B- and T-cell development through similar mechanisms.
In the Id1 transgenic mice, abundant expression of the endogenous Id1
gene most probably occurs in c-kit
+ CD44
++
CD24

CD25

progenitor cells. When this
population of cells disappear in
adult mice, Id1 expression decreases
significantly. These c-kit
+ CD44
++
CD24

CD25

progenitor cells in the thymus
resemble the fraction A cells
in the bone marrow not only in their
ability to differentiate
into several lineages, as mentioned above, but
also in their high
levels of endogenous Id1 expression. The fraction A
cells, particularly
fraction A
0 cells, also express Id1 at
a high level (
32). Significantly,
when Id1 is ectopically
expressed either in the bone marrow (
57)
or the thymus, B-
or T-cell development is arrested at the stages
when the Id1 gene is
normally expressed, implying that down-regulation
of Id1 gene
expression is essential for B- and T-cell development
to
proceed.
Although the major developmental block in the transgenic mice occurs in
the DN stage, abnormalities have also been found in
the
CD4
+ or CD8
+ single-positive thymocytes. The
total number of single-positive
thymocytes in the transgenic mice is
estimated to be less than
10% of the wild-type count in animals 5 weeks of age or older.
The identities of these single-positive cells
are rather intriguing.
In the transgenic thymus, DP cells are scarce,
so where are these
single-positive cells derived from? One possibility
is that these
small populations of cells, which have escaped the
initial block,
pass through the DP stage extremely fast due to the lack
of competition
in the DP compartment. Supporting this hypothesis is
that the
number of single-positive cells correlates inversely with the
level of Id1 transgene expression; i.e., homozygous Id1 transgenic
mice
have fewer single-positive cells than the heterozygotes do.
Furthermore, the CD8
+ cells carry both the

and

chains of the CD8 coreceptor, which
would suggest a thymic origin of
these single-positive cells (data
not shown). The alternative
possibility for the source of these
single-positive cells in the
transgenic thymus is that they have
reentered the thymus from
peripheral organs. The lack of CD24
on the surface of most
CD8
+ cells and some CD4
+ cells would identify
these cells as peripheral T cells. In addition,


T cells
contribute to the CD8
+ single-positive population. To
determine the origin of these
T cells, further investigation is
necessary.
Possible mechanisms by which E proteins control lymphocyte
differentiation.
T-cell development in the Id1 transgenic mice
seems to be blocked primarily during the commitment of progenitor cells
to the T-cell lineage, since the predominant population of cells
accumulated in these mice was made up of DN cells carrying the cell
surface markers c-kit+ CD44+ CD24
CD25
or c-kit
CD44+
CD24+ CD25
, depending on the age of the
animals. This phenotype of Id1 transgenic mice is in sharp contrast to
the phenotypes of knockout mice, in which genes encoding various
proteins involved in pre-T or TCR signaling are disrupted (20, 35,
38, 53). In these mice, T-cell development is arrested at the
CD44
CD25+ DN stage. Therefore, it is
unlikely that inhibition of the expression of the genes encoding TCR
pre-T
or subunits of CD3 and impairment of TCR gene rearrangement
and expression are the crucial factors involved. Our data from analyses
of gene expression and TCR gene rearrangement would support this
notion. Indeed, we have found that expression of functionally
rearranged TCR genes in the Id1 transgenic mice could not rescue the
developmental defect (data not shown). The phenotype of the Id1
transgenic mice is also distinct from that of the IL-7 or IL-7
receptor-deficient mice, in which T-cell development is blocked
primarily at the CD44+ CD25+ DN stage (39,
47, 61). Our study has shown that expression of the IL-7 receptor
gene is not repressed by Id1. Furthermore, the phenotype of Id1
transgenic mice is different from those of the PU.1-deficient mice
(37, 52) and the mice expressing the dominant negative form
of the Ikaros protein that inhibits the function of the
Ikaros family of proteins (18). In these mice, the lymphoid lineage is lacking, suggesting that the E proteins act at
different points from the PU.1 and Ikaros transcription factors during hematopoiesis.
The apparent developmental block at the progenitor stage in the Id1
transgenic mice may be explained either by the inability
of these
progenitor cells to differentiate or by the failure of
differentiating
T cells to survive or both. It has been shown
that tumor necrosis
factor alpha and IL-1

signals can stimulate
the differentiation of
CD44
+ CD25

cells along the T-cell lineage
(
67). Whether this signaling
pathway is defective in the Id1
transgenic mice remains to be
determined. On the other hand, we have
indeed found massive apoptosis
in the Id1 transgenic thymus. The
apoptotic cells have undergone
rearrangement of their TCR

and

loci, suggesting that apoptosis
occurs after the initiation of T-cell
differentiation. Several
possible molecular mechanisms involved in
triggering apoptosis
in Id1 transgenic mice may be proposed. First, Id1
might inhibit
E-protein-activated expression of genes involved in
cellular antiapoptotic
functions, rendering the differentiating T cells
highly susceptible
to apoptosis. However, since apoptosis occurs in at
least 50%
of the thymocytes, there would have to be an active
mechanism
that causes apoptosis in the differentiating T cells by
default
and that is normally suppressed by cellular antiapoptotic
functions.
Second, developmental blocks at various stages may lead to
apoptosis
of immature T
cells.
Alternatively, Id1 expression might indirectly trigger apoptosis in the
transgenic mice. How would Id1 cause apoptosis? Id1
has been known to
stimulate cell growth in nonlymphoid cells (
6,
21,
49). We
have attempted to test if Id1 transgenic thymocytes
are more
proliferative than their wild-type counterparts but have
found no
significant difference in their abilities to incorporate
bromodeoxyuridine in vivo (data not shown). However, if excessive
proliferation leads to cell death, we may not have been able to
detect
any changes in the live population of cells. Obviously,
it is extremely
difficult to examine the proliferative status
of dead cells, even
though proliferation might have taken place
before the cells died. If
Id1 overexpression indeed alters the
proliferative state of
differentiating T cells, it might be incompatible
with the
differentiation process occurring in the cells. For example,
one of the
major events taking place during T-cell development
is the
rearrangement of TCR genes. V(D)J recombination reactions
are likely to
be carried out in cells in the resting state (
34,
46,
59).
If Id1 overexpression places cells in the wrong phase
of the cell cycle
or prevents the necessary cell cycle arrest
for TCR rearrangement,
rearrangement of the TCR genes which involves
the cutting and joining
of DNA strands might appear to cells as
DNA damage, thus triggering
apoptosis. In support of this hypothesis,
we have found that the
majority of apoptotic cells have undergone
gene rearrangement whereas
the surviving DN cells have not rearranged
their TCR genes. This
hypothesis is currently being tested experimentally
by eliminating the
V(D)J recombination reactions in the Id1 transgenic
mice.
The proliferative effect of Id1 could also lead to the overstimulation
of T cells and create a situation analogous to that
of negative
selection in the thymus, which results in apoptosis
of the thymocytes
(
26). Supporting this hypothesis, the Id1-expressing
single-positive T cells in the thymus and spleen also carry high
levels
of the CD44 surface marker, which serves as an indication
of T-cell
activation.
Mechanisms of T-cell lymphomagenesis.
The Id proteins are
essential for the G1-to-S-phase transition in the cell
cycle of fibroblasts, as shown by experiments with antisense
oligonucleotides (6, 21). Conversely, E2A proteins have been
found to block cell cycle progression at the G1-to-S-phase transition (48), perhaps by activating the transcription of the gene encoding the cyclin-dependent kinase inhibitor
p21CIP/WAF1 (49). Furthermore, we have shown
that in a human T-cell lymphoblastic leukemia cell line, Jurkat,
restoration of E2A activity, which is inhibited by the aberrant
expression of the Tal1 oncogene, leads to cell growth arrest
and apoptosis (45). It is therefore not surprising that
overexpression of Id1 or disruption of the E2A gene leads to T-cell
lymphomagenesis (5, 63). The molecular mechanisms leading to
tumor formation, however, remain to be determined. Lack of p21 gene
expression is unlikely to be solely responsible for lymphomagenesis in
the Id1 transgenic mice, because p21 is normally not expressed at a
high level in T cells and the p21-deficient mice do not develop
lymphomas (14).
The proliferative effect of Id1 is probably a major contributor to
lymphomagenesis. However, tumor formation might require
a second hit.
The second hit may result from spontaneous genetic
mutations causing
the repression of tumor suppressor genes or
the activation of
oncogenes. It may simply be due to growth stimulation
by lymphokines
that are present during normal T-cell development.
Furthermore, the
second hit could also be created by Id1 overexpression,
which may lead
to alteration of the expression of growth-regulating
genes or to
genetic instability. The heterogeneous phenotypes
of the Id1 transgenic
lymphomas with regard to their developmental
stages would suggest that
the second hit may occur at various
stages in T-cell development and
may have diverse tumorigenic
potentials.
It will also be interesting to determine whether the tumorigenic effect
and the ability of Id1 to block T-cell development
are mediated through
similar mechanisms. Perhaps it is because
of the proliferative effect
of Id1 that massive apoptosis of developing
thymocytes occurs and
T-cell lymphoma develops. An excellent example
of proteins with such
dual functions is the c-
myc oncogene, which
is oncogenic in
certain situations (
58) but apoptotic under
other
circumstances (
16). Overexpression of c-
myc in T
cells
does cause T-cell lymphoma (
8,
28,
54). In fact, Bain
et
al. (
5) have suggested that c-
myc expression
is elevated in
the lymphomas found in E2A-deficient mice. High levels
of c-
myc expression have also been detected in the lymphomas
from the Id1
transgenic mice (data not shown). However, whether
c-
myc expression
is a causal factor in lymphomagenesis
induced by Id1 overexpression
remains to be
determined.
 |
ACKNOWLEDGMENTS |
We are grateful to Sankar Ghosh for discussion and critical
reading of the manuscript. We thank Yang Liu, Stanislav Vukmanovic, and
Alan Frey for advice and John Hirst of the cell-sorting facility of
Kaplan Cancer Center for excellent assistance in cell-sorting analyses.
The Id1 transgenic mice were produced by the Transgenic Facility of
Rockefeller University and the facility of the Kaplan Cancer Center at
NYU School of Medicine.
This work was supported by grants from NIH (1R01AI33597 and
1R01CA77553), the American Cancer Society (RPG-98-247-01-LBC), and the
Life and Health Insurance Fund. X.H.S. is an Irma T. Hirschl Trust Scholar.
 |
FOOTNOTES |
*
Corresponding author. Present address: Oklahoma Medical
Research Foundation, 825 Northeast 13th St., Oklahoma City, OK 73104. Phone: (405) 271-2864. Fax: (405) 271-7128. E-mail:
XH-Sun{at}omrf.ouhsc.edu.
 |
REFERENCES |
| 1.
|
Amsen, D., and A. M. Kruisbeek.
1998.
Thymocyte selection: not by TCR alone.
Immunol. Rev.
165:209-229[Medline].
|
| 2.
|
Anderson, S. J.,
K. M. Abraham,
T. Nakayama,
A. Singer, and R. M. Perlmutter.
1992.
Inhibition of T-cell receptor -chain gene rearrangement by overexpression of the non-receptor protein tyrosine kinase p56lck.
EMBO J.
11:4877-4886[Medline].
|
| 3.
|
Bain, G.,
E. C. Robanus Maandag,
D. J. Izon,
D. Amsen,
A. M. Kruisbeek,
B. Weintraub,
I. Krop,
M. S. Schlissel,
A. J. Feeney,
M. van Roon,
M. van der Valk,
H. P. J. te Riele,
A. Berns, and C. Murre.
1994.
E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements.
Cell
79:885-892[Medline].
|
| 4.
|
Bain, G.,
E. C. Robanus Maandag,
H. P. te Riele,
A. J. Feeney,
A. Sheehy,
M. Schlissel,
S. A. Shinton,
R. R. Hardy, and C. Murre.
1997.
Both E12 and E47 allow commitment to the B cell lineage.
Immunity
6:145-154[Medline].
|
| 5.
|
Bain, G.,
I. Engel,
E. C. Robanus Maandag,
H. P. te Riele,
J. R. Voland,
L. L. Sharp,
J. Chun,
B. Huey,
D. Pinkel, and C. Murre.
1997.
E2A deficiency leads to abnormalities in alphabeta T-cell development and to rapid development of T-cell lymphomas.
Mol. Cell. Biol.
17:4782-4791[Abstract].
|
| 6.
|
Barone, V. M.,
R. Pepperkok,
F. A. Peverali, and L. Philipson.
1994.
Id proteins control growth induction in mammalian cells.
Proc. Natl. Acad. Sci. USA
91:4985-4988[Abstract/Free Full Text].
|
| 7.
|
Benezra, R.,
R. L. Davis,
D. Lockshon,
D. L. Turner, and H. Weintraub.
1990.
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins.
Cell
61:49-59[Medline].
|
| 8.
|
Benvenisty, N.,
D. M. Ornitz,
G. L. Bennett,
B. G. Sahagan,
A. Kuo,
R. D. Cardiff, and P. Leder.
1992.
Brain tumours and lymphomas in transgenic mice that carry HTLV-I LTR/c-myc and Ig/tax genes.
Oncogene
7:2399-2405[Medline].
|
| 9.
|
Blom, B.,
M. H. Heemskerk,
M. C. Verschuren,
J. J. van Dongen,
A. P. Stegmann,
A. Q. Bakker,
F. Couwenberg,
P. C. Res, and H. Spits.
1999.
Disruption of alphabeta but not of gammadelta T cell development by overexpression of the helix-loop-helix protein Id3 in committed T cell progenitors.
EMBO J.
18:2793-2802[Medline].
|
| 10.
|
Burtrum, D. B.,
S. Kim,
E. C. Dudley,
A. C. Hayday, and H. T. Petrie.
1996.
TCR gene recombination and alpha beta-gamma delta lineage divergence: productive TCR-beta rearrangement is neither exclusive nor preclusive of gamma delta cell development.
J. Immunol.
157:4293-4296[Abstract].
|
| 11.
|
Carroll, A. M., and M. J. Bosma.
1991.
T-lymphocyte development in scid mice is arrested shortly after the initiation of T-cell receptor gene recombination.
Genes Dev.
5:1357-1366[Abstract/Free Full Text].
|
| 12.
|
Casanova, J. L.,
P. Romero,
C. Widmann,
P. Kourilsky, and J. L. Maryansky.
1991.
T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire.
J. Exp. Med.
174:1371-1383[Abstract/Free Full Text].
|
| 13.
|
Chun, J. M.,
D. G. Schatz,
M. A. Oettinger,
R. Jaenisch, and D. Baltimore.
1991.
The recombination activating gene-1 (RAG-1) transcript is present in the murine central nervous system.
Cell
64:189-200[Medline].
|
| 14.
|
Deng, C.,
P. Zhang,
J. W. Harper,
S. J. Elledge, and P. Leder.
1995.
Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control.
Cell
82:675-684[Medline].
|
| 15.
|
Diamond, R. A.,
S. B. K. Ward Owada-Makabe,
H. Wang, and E. V. Rothenberg.
1997.
Different developmental arrest points in RAG-2 / and SCID thymocytes on two genetic backgrounds: developmental choices and cell death mechanisms before TCR gene rearrangement.
J. Immunol.
158:4052-4064[Abstract].
|
| 16.
|
Evan, G. I.,
A. H. Wyllie,
C. S. Gilbert,
T. D. Littlewood,
H. Land,
M. Brooks,
C. M. Waters,
L. Z. Penn, and D. C. Hancock.
1992.
Induction of apoptosis in fibroblasts by c-myc protein.
Cell
69:119-128[Medline].
|
| 17.
|
Garvin, A. M.,
K. M. Abraham,
K. A. Forbush,
A. G. Farr,
B. L. Davison, and R. M. Perlmutter.
1990.
Disruption of thymocyte development and lymphomagenesis induced by SV40 T-antigen.
Int. Immunol.
2:173-180[Abstract/Free Full Text].
|
| 18.
|
Georgopoulos, K.,
M. Bigby,
J. H. Wang,
A. Molnar,
P. Wu,
S. Winandy, and A. Sharpe.
1994.
The Ikaros gene is required for the development of all lymphoid lineages.
Cell
79:143-156[Medline].
|
| 19.
|
Hahm, K.,
P. Ernst,
K. Lo,
G. S. Kim,
C. Turck, and S. T. Smale.
1994.
The lymphoid transcription factor LyF-1 is encoded by specific, alternatively spliced mRNAs derived from the Ikaros gene.
Mol. Cell. Biol.
14:7111-7123[Abstract/Free Full Text].
|
| 20.
|
Haks, M. C.,
P. Krimpenfort,
J. Borst, and A. M. Kruisbeek.
1998.
The CD3 chain is essential for development of both the TCR and TCR lineages.
EMBO J.
17:1871-1882[Medline].
|
| 21.
|
Hara, E.,
T. Yamaguchi,
H. Nojima,
T. Ide,
J. Campisi,
H. Okayama, and K. Oda.
1994.
Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts.
J. Bio. Chem.
269:2139-2145[Abstract/Free Full Text].
|
| 22.
|
Hardy, R. R.,
C. E. Carmack,
S. A. Shinton,
J. D. Kemp, and K. Hayakawa.
1991.
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J. Exp. Med.
173:1213-1225[Abstract/Free Full Text].
|
| 23.
|
Heemskerk, M. H.,
B. Blom,
G. Nolan,
A. P. Stegmann,
A. Q. Bakker,
K. Weijer,
P. C. Res, and H. Spits.
1997.
Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3.
J. Exp. Med.
186:1597-1602[Abstract/Free Full Text].
|
| 24.
|
Henthorn, P.,
M. Kiledjian, and T. Kadesch.
1990.
Two distinct transcription factors that bind the immunoglobulin enhancer µE5/ E2 motif.
Science
247:467-470[Abstract/Free Full Text].
|
| 25.
|
Hu, J.-S.,
E. N. Olson, and R. E. Kingston.
1992.
HEB, a helix-loop-helix protein related to E2A and ITF2 that can modulate the DNA-binding activity of myogenic regulatory factors.
Mol. Cell. Biol.
12:1031-1042[Abstract/Free Full Text].
|
| 26.
|
Janeway, C. A., and P. Travers.
1997.
Immunobiology: the immune system in health and disease, 3rd ed.
Current Biology Ltd./Garland Publishing, Inc., New York, N.Y
|
| 27.
|
Koyasu, S.,
L. K. Clayton,
A. Lerner,
H. Heiken,
A. Parkes, and E. L. Reinherz.
1997.
Pre-TCR signaling components trigger transcriptional activation of a rearranged TCR gene locus and silencing of the pre-TCR locus: implications for intrathymic differentiation.
Int. Immunol.
9:1475-1480[Abstract/Free Full Text].
|
| 28.
|
Leder, A.,
P. K. Pattengale,
A. Kuo,
T. A. Stewart, and P. Leder.
1986.
Consequences of widespread deregulation of the c-myc gene in transgenic mice: multiple neoplasms and normal development.
Cell
45:485-495[Medline].
|
| 29.
|
Lee, J. E.,
S. M. Hollenberg,
L. Snider,
D. L. Turner,
N. Lipnick, and H. Weintraub.
1995.
Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein.
Science
268:836-844[Abstract/Free Full Text].
|
| 30.
|
Li, Y. S.,
R. Wasserman,
K. Hayakawa, and R. R. Hardy.
1996.
Identification of the earliest B lineage stage in mouse bone marrow.
Immunity
5:527-535[Medline].
|
| 31.
|
Levin, S. D.,
S. J. Anderson,
K. A. Forbush, and R. M. Perlmutter.
1993.
A dominant-negative transgene defines a role for p56lck in thymopoieses.
EMBO J.
12:1671-1680[Medline].
|
| 32.
|
Li, Y. S.,
K. Hayakawa, and R. R. Hardy.
1993.
The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver.
J. Exp. Med.
178:951-960[Abstract/Free Full Text].
|
| 33.
|
Lin, H., and R. Grosschedl.
1995.
Failure of B-cell differentiation in mice lacking the transcription factor EBF.
Nature
376:263-267[Medline].
|
| 34.
|
Lin, W. C., and S. Desiderio.
1994.
Cell cycle regulation of V(D)J recombination-activating protein RAG-2.
Proc. Natl. Acad. Sci. USA
91:2733-2737[Abstract/Free Full Text].
|
| 35.
|
Malissen, M.,
A. Gillet,
L. Ardouin,
G. Bouvier,
J. Trucy,
P. Ferrier,
E. Vivier, and B. Malissen.
1995.
Altered T cell development in mice with a targeted mutation of the CD3-epsilon gene.
EMBO J.
14:4641-4653[Medline].
|
| 36.
|
Massari, M. E.,
P. A. Jennings, and C. Murre.
1996.
The AD1 transactivation domain of E2A contains a highly conserved helix which is required for its activity in both Saccharomyces cerevisiae and mammalian cells.
Mol. Cell. Biol.
16:121-129[Abstract].
|
| 37.
|
McKercher, S. R.,
B. E. Torbett,
K. L. Anderson,
G. W. Henkel,
D. J. Vestal,
H. Baribault,
M. Klemsz,
A. J. Feeney,
G. E. Wu,
C. J. Paige, and R. A. Maki.
1996.
Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities.
EMBO J.
15:5647-5658[Medline].
|
| 38.
|
Mombaerts, P.,
J. Iacomini,
R. S. Johnson,
K. Herrup,
S. Tonegawa, and V. E. Papaioannou.
1992.
RAG-1-deficient mice have no mature B and T lymphocytes.
Cell
68:869-877[Medline].
|
| 39.
|
Moore, T. A.,
U. von Freeden-Jeffry,
R. Murray, and A. Zlotnik.
1996.
Inhibition of gamma delta T cell development and early thymocyte maturation in IL-7 / mice.
J. Immunol.
157:2366-2373[Abstract].
|
| 40.
|
Murre, C.,
P. S. McCaw, and D. Baltimore.
1989.
A new DNA binding and dimerization motif in immunoglobin enhancer binding, daughterless, MyoD and myc proteins.
Cell
56:777-783[Medline].
|
| 41.
|
Murre, C.,
P. S. McCaw,
H. Vaessin,
M. Caudy,
L. Y. Jan,
Y. N. Jan,
C. V. Cabrera,
J. N. Buskin,
S. D. Hauschka,
A. B. Lassar,
H. Weintraub, and D. Baltimore.
1989.
Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence.
Cell
58:537-544[Medline].
|
| 42.
|
Naya, F. J.,
C. M. Stellrecht, and M. J. Tsai.
1995.
Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor.
Genes Dev.
9:1009-1019[Abstract/Free Full Text].
|
| 43.
|
Okamura, R. M.,
M. Sigvardsson,
J. Galceran,
S. Verbeek,
H. Clevers, and R. Grosschedl.
1998.
Redundant regulation of T cell differentiation and TCR gene expression by the transcription factors LEF-1 and TCF-1.
Immunity
8:11-20[Medline].
|
| 44.
|
Pardoll, D. M.,
B. J. Fowlkes,
J. A. Bluestone,
A. Kruisbeek,
W. L. Maloy,
J. E. Coligan, and R. H. Schwartz.
1987.
Differential expression of two distinct T-cell receptors during thymocyte development.
Nature
326:79-81[Medline].
|
| 45.
|
Park, S. T.,
G. P. Nolan, and X.-H. Sun.
1999.
Growth inhibition and apoptosis due to restoration of E2A activity in T cell acute lymphoblastic leukemia cells.
J. Exp. Med.
189:501-508[Abstract/Free Full Text].
|
| 46.
|
Penit, C.,
B. Lucas, and F. Vasseur.
1995.
Cell expansion and growth arrest phases during the transition from precursor (CD4 8 ) to immature (CD4+8+) thymocytes in normal and genetically modified mice.
J. Immunol.
154:5103-5113[Abstract].
|
| 47.
|
Peschon, J. J.,
P. J. Morrissey,
K. H. Grabstein,
F. J. Ramsdell,
E. Maraskovsky,
B. C. Gliniak,
L. S. Park,
S. F. Ziegler,
D. E. Williams,
C. B. Ware,
J. D. Meyer, and B. L. Davison.
1994.
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
J. Exp. Med.
180:1955-1960[Abstract/Free Full Text].
|
| 48.
|
Peverali, F. A.,
T. Ramqvist,
R. Saffrich,
R. Pepperkik,
M. V. Barone, and L. Philipson.
1994.
Regulation of G1 progression by E2A and Id helix-loop-helix proteins.
EMBO J.
13:4291-4301[Medline].
|
| 49.
|
Prabhu, S.,
A. Ignatova,
S. T. Park, and X.-H. Sun.
1997.
Regulation of the expression of cyclin-dependent kinase inhibitor, p21, by E2A and Id proteins.
Mol. Cell. Biol.
17:5888-5896[Abstract].
|
| 50.
|
Quong, M. W.,
M. E. Massari,
R. Zwart, and C. Murre.
1993.
A new transcriptional-activation motif restricted to a class of helix-loop-helix proteins is functionally conserved in both yeast and mammalian cells.
Mol. Cell. Biol.
13:792-800[Abstract/Free Full Text].
|
| 51.
|
Rothenberg, E. V.
1998.
Gene regulation in T-cell lineage conpartment, p. 337-365.
In
J. G. Monroe, and E. V. Rothenberg (ed.), Molecular biology of B-cell and T-cell development. Humana Press Inc., Totowa, N.J
|
| 52.
|
Scott, E. W.,
M. C. Simon,
J. Anastasi, and H. Singh.
1994.
Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science
265:1573-1577[Abstract/Free Full Text].
|
| 53.
|
Shinkai, Y.,
G. Rathbun,
K. P. Lam,
E. M. Oltz,
V. Stewart,
M. Mendelsohn,
J. Charron,
M. Datta,
F. Young,
A. M. Stall, and F. W. Alt.
1992.
RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement.
Cell
68:855-867[Medline].
|
| 54.
|
Stewart, M.,
E. Cameron,
M. Campbell,
R. McFarlane,
S. Toth,
K. Lang,
D. Onions, and J. C. Neil.
1993.
Conditional expression and oncogenicity of c-myc linked to a CD2 gene dominant control region.
Int. J. Cancer
53:1023-1030[Medline].
|
| 55.
|
Sun, X.-H., and D. Baltimore.
1991.
An inhibitory domain of E12 prevents DNA binding in E12 homodimers but not in E12 heterodimers.
Cell
64:459-470[Medline].
|
| 56.
|
Sun, X.-H.,
N. G. Copeland,
N. A. Jenkins, and D. Baltimore.
1991.
Id proteins, Id1 and Id2, selectively inhibit DNA binding by one class of helix-loop-helix proteins.
Mol. Cell. Biol.
11:5603-5611[Abstract/Free Full Text].
|
| 57.
|
Sun, X.-H.
1994.
Constitutive expression of the Id1 gene impairs mouse B cell development.
Cell
79:893-900[Medline].
|
| 58.
|
Taub, R.,
I. Kirsch,
C. Morton,
G. Lenoir,
D. Swan,
S. Tronick,
S. Aaronson, and P. Leder.
1982.
Translocation of the c-myc gene into the immunoglobulin heavy chain locus in human Burkitt lymphoma and murine plasmacytoma cells.
Proc. Natl. Acad. Sci. USA
79:7837-7841[Abstract/Free Full Text].
|
| 59.
|
Tourigny, M. R.,
S. Mazel,
D. B. Burtrum, and H. T. Petrie.
1997.
T cell receptor (TCR)-beta gene recombination: dissociation from cell cycle regulation and developmental progression during T cell ontogeny.
J. Exp. Med.
185:1549-1556[Abstract/Free Full Text].
|
| 60.
|
Vacchio, M. S.,
J. D. Ashwell, and L. B. King.
1998.
A positive role for thymus-derived steroids in formation of the T-cell repertoire.
Ann. N. Y. Acad. Sci.
840:317-327[Medline].
|
| 61.
|
von Freeden-Jeffry, U.,
P. Vieira,
L. A. Lucian,
T. McNeil,
S. E. G. Burdach, and R. Murray.
1995.
Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine.
J. Exp. Med.
181:1519-1526[Abstract/Free Full Text].
|
| 62.
|
Wu, L.,
F. Livak, and H. T. Petrie.
1998.
TCR-independent development of pluripotent T-cell precursors, p. 285-303.
In
J. G. Monroe, and E. V. Rothenberg (ed.), Molecular biology of B-cell and T-cell development. Humana Press Inc., Totowa, N.J
|
| 63.
|
Yan, W.,
A. Z. Young,
V. C. Soares,
R. Kelley,
R. Benezra, and Y. Zhuang.
1997.
High incidence of T-cell tumors in E2A-null mice and E2A/Id1 double-knockout mice.
Mol. Cell. Biol.
17:7317-7327[Abstract].
|
| 64.
|
Zhuang, Y.,
P. Soriano, and H. Weintraub.
1994.
The helix-loop-helix gene E2A is required for B cell differentiation.
Cell
79:875-884[Medline].
|
| 65.
|
Zhuang, Y.,
P. Cheng, and H. Weintraub.
1996.
B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2 and HEB.
Mol. Cell. Biol.
16:2898-2905[Abstract].
|
| 66.
|
Zhuang, Y.,
R. J. Barndt,
L. Pan,
R. Kelley, and M. Dai.
1998.
Functional replacement of the mouse E2A gene with a human HEB cDNA.
Mol. Cell. Biol.
18:3340-3349[Abstract/Free Full Text].
|
| 67.
|
Zuniga-Pflucker, J. C.,
J. Di, and M. J. Lenardo.
1995.
Requirement for TNF-alpha and IL-1 alpha in fetal thymocyte commitment and differentiation.
Science
268:1906-1909[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1999, p. 8240-8253, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ji, M., Li, H., Suh, H. C., Klarmann, K. D., Yokota, Y., Keller, J. R.
(2008). Id2 intrinsically regulates lymphoid and erythroid development via interaction with different target proteins. Blood
112: 1068-1077
[Abstract]
[Full Text]
-
Swarbrick, A., Roy, E., Allen, T., Bishop, J. M.
(2008). Id1 cooperates with oncogenic Ras to induce metastatic mammary carcinoma by subversion of the cellular senescence response. Proc. Natl. Acad. Sci. USA
105: 5402-5407
[Abstract]
[Full Text]
-
Nie, L., Perry, S. S., Zhao, Y., Huang, J., Kincade, P. W., Farrar, M. A., Sun, X.-H.
(2008). Regulation of Lymphocyte Development by Cell-Type-Specific Interpretation of Notch Signals. Mol. Cell. Biol.
28: 2078-2090
[Abstract]
[Full Text]
-
Perry, S. S., Zhao, Y., Nie, L., Cochrane, S. W., Huang, Z., Sun, X.-H.
(2007). Id1, but not Id3, directs long-term repopulating hematopoietic stem-cell maintenance. Blood
110: 2351-2360
[Abstract]
[Full Text]
-
Wojciechowski, J., Lai, A., Kondo, M., Zhuang, Y.
(2007). E2A and HEB Are Required to Block Thymocyte Proliferation Prior to Pre-TCR Expression. J. Immunol.
178: 5717-5726
[Abstract]
[Full Text]
-
Birkenkamp, K. U., Essafi, A., van der Vos, K. E., da Costa, M., Hui, R. C.-Y., Holstege, F., Koenderman, L., Lam, E. W.-F., Coffer, P. J.
(2007). FOXO3a Induces Differentiation of Bcr-Abl-transformed Cells through Transcriptional Down-regulation of Id1. J. Biol. Chem.
282: 2211-2220
[Abstract]
[Full Text]
-
Wencker, M., Sausse, C., Derse, D., Gazzolo, L., Duc Dodon, M.
(2007). Human T-Cell Leukemia Virus Type 1 Tax Protein Down-Regulates Pre-T-Cell Receptor Alpha Gene Transcription in Human Immature Thymocytes. J. Virol.
81: 301-308
[Abstract]
[Full Text]
-
Yang, Y., Liou, H.-C., Sun, X.-H.
(2006). Id1 Potentiates NF-{kappa}B Activation upon T Cell Receptor Signaling. J. Biol. Chem.
281: 34989-34996
[Abstract]
[Full Text]
-
Lazorchak, A. S., Wojciechowski, J., Dai, M., Zhuang, Y.
(2006). E2A Promotes the Survival of Precursor and Mature B Lymphocytes. J. Immunol.
177: 2495-2504
[Abstract]
[Full Text]
-
Leeanansaksiri, W., Wang, H., Gooya, J. M., Renn, K., Abshari, M., Tsai, S., Keller, J. R.
(2005). IL-3 Induces Inhibitor of DNA-Binding Protein-1 in Hemopoietic Progenitor Cells and Promotes Myeloid Cell Development. J. Immunol.
174: 7014-7021
[Abstract]
[Full Text]
-
Huang, Z., Nie, L., Xu, M., Sun, X.-H.
(2004). Notch-Induced E2A Degradation Requires CHIP and Hsc70 as Novel Facilitators of Ubiquitination. Mol. Cell. Biol.
24: 8951-8962
[Abstract]
[Full Text]
-
Qi, Z., Sun, X.-H.
(2004). Hyperresponse to T-Cell Receptor Signaling and Apoptosis of Id1 Transgenic Thymocytes. Mol. Cell. Biol.
24: 7313-7323
[Abstract]
[Full Text]
-
Hata, K., Yoshimoto, T., Mizuguchi, J.
(2004). CD40 Ligand Rescues Inhibitor of Differentiation 3-Mediated G1 Arrest Induced by Anti-IgM in WEHI-231 B Lymphoma Cells. J. Immunol.
173: 2453-2461
[Abstract]
[Full Text]
-
Ferrando, A. A., Armstrong, S. A., Neuberg, D. S., Sallan, S. E., Silverman, L. B., Korsmeyer, S. J., Look, A. T.
(2003). Gene expression signatures in MLL-rearranged T-lineage and B-precursor acute leukemias: dominance of HOX dysregulation. Blood
102: 262-268
[Abstract]
[Full Text]
-
Herblot, S., Aplan, P. D., Hoang, T.
(2002). Gradient of E2A Activity in B-Cell Development. Mol. Cell. Biol.
22: 886-900
[Abstract]
[Full Text]
-
Ueda, E., Kurebayashi, S., Sakaue, M., Backlund, M., Koller, B., Jetten, A. M.
(2002). High Incidence of T-Cell Lymphomas in Mice Deficient in the Retinoid-related Orphan Receptor ROR{gamma}. Cancer Res.
62: 901-909
[Abstract]
[Full Text]
-
Wilson, J. W., Deed, R. W., Inoue, T., Balzi, M., Becciolini, A., Faraoni, P., Potten, C. S., Norton, J. D.
(2001). Expression of Id Helix-Loop-Helix Proteins in Colorectal Adenocarcinoma Correlates with p53 Expression and Mitotic Index. Cancer Res.
61: 8803-8810
[Abstract]
[Full Text]
-
Takeuchi, A., Yamasaki, S., Takase, K., Nakatsu, F., Arase, H., Onodera, M., Saito, T.
(2001). E2A and HEB Activate the Pre-TCR{alpha} Promoter During Immature T Cell Development. J. Immunol.
167: 2157-2163
[Abstract]
[Full Text]
-
Staal, F. J.T., Weerkamp, F., Langerak, A. W., Hendriks, R. W., Clevers, H. C.
(2001). Transcriptional Control of T Lymphocyte Differentiation. Stem Cells
19: 165-179
[Abstract]
[Full Text]
-
Ikawa, T., Fujimoto, S., Kawamoto, H., Katsura, Y., Yokota, Y.
(2001). Commitment to natural killer cells requires the helix-loop-helix inhibitor Id2. Proc. Natl. Acad. Sci. USA
10.1073/pnas.091537598v1
[Abstract]
[Full Text]
-
Barndt, R. J., Dai, M., Zhuang, Y.
(2000). Functions of E2A-HEB Heterodimers in T-Cell Development Revealed by a Dominant Negative Mutation of HEB. Mol. Cell. Biol.
20: 6677-6685
[Abstract]
[Full Text]
-
Wang, J., Jani-Sait, S. N., Escalon, E. A., Carroll, A. J., de Jong, P. J., Kirsch, I. R., Aplan, P. D.
(2000). The t(14;21)(q11.2;q22) chromosomal translocation associated with T-cell acute lymphoblastic leukemia activates the BHLHB1 gene. Proc. Natl. Acad. Sci. USA
97: 3497-3502
[Abstract]
[Full Text]
-
Huang, S., Brandt, S. J.
(2000). mSin3A Regulates Murine Erythroleukemia Cell Differentiation through Association with the TAL1 (or SCL) Transcription Factor. Mol. Cell. Biol.
20: 2248-2259
[Abstract]
[Full Text]
-
Norton, J.
(2000). ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J. Cell Sci.
113: 3897-3905
[Abstract]
-
Ikawa, T., Fujimoto, S., Kawamoto, H., Katsura, Y., Yokota, Y.
(2001). Commitment to natural killer cells requires the helix-loop-helix inhibitor Id2. Proc. Natl. Acad. Sci. USA
98: 5164-5169
[Abstract]
[Full Text]