INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

A subclass of the basic helix-loop-helix family of transcription factors includes E12, E47, E2-2, and HEB proteins (24, 25, 40), which are collectively called E proteins. E12 and E47 are encoded by the E2A gene as a result of alternative splicing (40, 55), whereas E2-2 and HEB are products of their respective genes. Although encoded by different genes, these E proteins are highly homologous in their DNA binding, dimerization and trans-activation domains (36, 50). Consequently, they have similar functions; i.e., they bind to E-box sequences and activate transcription. In lymphoid cells, the E proteins exist predominantly as homo- or heterodimers among themselves (4), even though they can form heterodimers with other tissue-specific basic helix-loop-helix proteins such as MyoD and NeuroD/BETA2 in muscle, neuronal, and pancreatic tissues (29, 41, 42). The critical role of E proteins in B-lymphocyte development has been clearly demonstrated by the characterization of E2A-deficient mice (3, 64). Disruption of the E2A gene leads to a block of B-cell differentiation at the earliest stage (fraction A stage; B220⁺ HSA BP1 CD43) (4, 22). In these mice, no rearrangement of the immunoglobulin genes takes place and most of the B-cell-specific genes are not expressed. In comparison, null mutation of the E2-2 or HEB gene causes a modest impairment of B-cell development (65), probably due to the relatively low abundance of the E2-2 and HEB proteins expressed in the B-cell lineage. HEB is able to rescue B-cell development in E2A-deficient mice when its cDNA is inserted in the E2A locus so that HEB can be translated through an internal ribosomal entry site (65). Therefore, HEB can functionally complement E2A. Similar to strategies of disrupting the E2A gene, we have previously generated transgenic mice in which Id1 is specifically expressed in B cells (57). Because Id1 forms heterodimers with E proteins and prevents them from binding to DNA, Id1 acts as a naturally occurring dominant negative inhibitor of E proteins. In these transgenic mice, B-cell development is also blocked at the earliest stage (57), a stage when endogenous Id1 is expressed at a high level (32). Taken together, these findings suggest that E proteins are essential for B-cell development.

Analogous to B-cell development, T-cell differentiation is also a stepwise process that involves the sequential rearrangement and expression of T-cell receptor (TCR) genes as well as the expression of other T-cell-specific genes. Rather than developing in the bone marrow as B cells do, the primary site for T-cell differentiation is the thymus. The developmental stages of T cells are well characterized by the expression of cell surface markers. In general, T cells in the thymus can be divided into four populations: CD4 and CD8 double negative (DN), double positive (DP), and CD4 (CD4⁺) or CD8 (CD8⁺) single positive (26). T cells in the thymus develop from the DN to the DP stage through an intermediate stage, termed the immature CD8 single-positive (ISP) stage. The DP cells then differentiate into single-positive cells before exiting the thymus. Early T-cell development at the DN stage can be further characterized by the expression of CD44 and CD25 cell surface markers. Multipotent progenitor cells marked as CD44⁺ CD25 commit to the T-cell lineage and differentiate through the CD44⁺ CD25⁺, CD44 CD25⁺, and then CD44 CD25 stages. In the process, the TCR  gene is rearranged and expressed. The  chain pairs with the pre-T  chain to form a pre-TCR, which is essential for proliferation and differentiation of immature T cells. Data from gene disruption experiments have demonstrated that lack of any of the components that lead to the formation of pre-TCRs, as well as the CD3 signal-transducing molecules, results in the arrest of T-cell differentiation at the CD44 CD25⁺ stage (20, 35, 38, 53). However, the mechanisms that dictate the differentiation of progenitor cells from the CD44⁺ CD25 stage to the CD44 CD25⁺ stage are less well understood. Parallel with the progression of the developmental program are the apoptosis and antiapoptosis events that ensure the survival of properly developed T cells and the elimination of unwanted T cells. These events are intimately related to the processes of TCR rearrangement and mitogenic stimulation through TCR-mediated signaling pathways as well as other signaling pathways. Shifting the balance between apoptosis and antiapoptosis has direct consequences on T-cell development.

In contrast to the well-defined role of E2A gene products in B-cell development, the role of E proteins in T-cell ontogeny is not entirely clear. Homozygous E2A or HEB-deficient mice display moderate defects in T-cell development (45, 63). The E2A-deficient mice have reduced numbers of T cells in both the thymus and the spleen. The percentage of DP thymocytes decreases by 50%, while the percentage of DN cells and CD8⁺ cells increases significantly in either E2A or HEB-deficient mice. These modest effects of E2A or HEB mutation raise the question whether the E proteins are merely facilitators of T-cell development or whether they are actually crucial regulators in T-cell development but their role has not been revealed due to the redundant function of E2A and HEB genes. Because of the neonatal death of E2A and HEB deficient mice respectively, it has not been possible to generate E2A and HEB double-knockout mice through simple genetic crosses. We thus created transgenic mice in which the Id1 gene (7), encoding the inhibitor of both E2A and HEB, is specifically expressed in T cells. Strikingly, T-cell development in these mice appear to be arrested at the earliest progenitor stage and massive apoptosis of thymocytes is detected, resulting in mice with rudimentary thymuses. This data, together with the previous findings with B cells, thus prompts us to propose that E proteins, being the targets of the Id1 inhibitor, act as important regulators in lymphocyte commitment and differentiation in both the B- and T-cell lineages. Similar to the E2A-deficient mice (5, 63), Id1 transgenic mice also develop T-cell lymphoma, suggesting an oncogenic potential for the Id1 protein.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Id1 transgenic mice. The Id1 transgenic construct was generated by inserting mouse Id1 cDNA into the BamHI site of the vector plck-hGH (17), which contains the T-cell-specific lck proximal promoter and the human growth hormone (hGH) gene with introns and a polyadenylation signal. The Id1 cDNA was modified by including a Kozak translation initiation sequence at the ATG codon and by fusing the sequence encoding the influenza virus HA epitope tag with the 3' end of the Id1 coding sequence. Transgenic founders were identified by Southern blot analysis of the tail genomic DNA. Transgenic offspring were determined by PCR of the tail genomic DNA with the transgene-specific primers: 5'-hGH (CGAACCACTCAGGGTCCTGTGG) and 3'-hGH (GGATTTCTGTTGTGTTTCCTCCCTG).

Flow cytometry. Cell suspensions were prepared from the thymus, spleen, and lymph nodes. Spleen cells were purified on Ficoll cushions by a 30-min centrifugation at 4°C, and cells in the supernatant were collected by centrifugation. Thymocytes were also purified similarly. The cells were stained with antibodies for two-color or three-color fluorescence-activated cell sorter (FACS) analysis on a FACScan-II (Becton-Dickinson, Franklin Lakes, N.J.). The following antibodies were purchased from Caltag Laboratories (Burlingame, Calif.): phycoerythrin (PE)-conjugated anti-CD4 (PE-CD4), Tri-color (TC)-CD4, fluorescein isothiocyanate (FITC)-CD8, TC-CD8, FITC-CD3, FITC-TCR (H57), FITC-CD24, and FITC-c-kit. FITC-TCR (GL3), FITC-CD25, and PE-CD44 were from Pharmingen (San Diego, Calif.).

PCR for TCR rearrangement. Thymic genomic DNA was prepared from 10⁶ unpurified cells by lysis at 55°C for 1 h in 200 µl of buffer containing 10 mM Tris (pH 8.4), 50 mM KCl, 2 mM MgCl₂, 0.45% Nonidet P-40, 0.45% Tween 20, and 60 µg of proteinase K per ml. A 1-µl volume of the DNA was subjected to PCR in a 50-µl reaction mixture for 25 cycles (for the Id2 gene) or 30 cycles (for other genes) by denaturing at 94°C for 1 min, annealing at 62°C for 30 s, and elongating at 72°C for 1.5 min. One-tenth of the reaction mixture was analyzed by Southern blot hybridization. Prehybridization was performed for 6 h at 37°C in a buffer containing 6× SSC (pH 7.0) (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5× Denhardt solution, 0.05% sodium pyrophosphate, 0.1% sodium dodecyl sulfate, and 100 µg of sheared and denatured salmon sperm DNA per ml. End-labeled oligonucleotide probe was added subsequently for hybridization for 18 h at 37°C. The filters were washed three times for 10 min each at 37°C in 6× SSC-0.05% sodium pyrophosphate-0.1% sodium dodecyl sulfate. The final wash was for 30 min at 37°C in 6× SSC-0.05% sodium pyrophosphate. Quantitation was performed with a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, Calif.).

RT-PCR for gene expression. Thymic total RNAs were prepared with Trizol (Life Technologies, Gaithersburg, Md.) as specified by the manufacturer. First-strand cDNAs were synthesized from 10 µg of total RNA with the oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (RT) (Life Technologies). One-fortieth of the first-strand cDNA reaction product was used for PCR with a reaction volume of 25 µl. Serial dilution at 1:10 and 1:100 were also performed to establish the linearity of the amplification. Amplification was performed for 25 cycles (for glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) and 30 cycles (for other genes) by denaturing at 94°C for 45 s, annealing at 60°C for 20 s, and elongating at 72°C for 1 m. One-fifth of each reaction product was analyzed and quantitated by Southern blot hybridization and PhosphorImager measurement. GAPDH signals were used for normalization.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Dramatic reduction of the number of thymocytes in the Id1 transgenic mice. To inhibit the activities of all E proteins in T cells, we have generated transgenic mice in which the Id1 transgene is specifically expressed in T cells. Id1 forms heterodimers with the E proteins, but the resulting heterodimers cannot bind to DNA. We inserted the Id1 cDNA into the plck-hGH transgenic vector (17), which contains the proximal promoter of the lck gene for directing T-cell specific transcription and a portion of the hGH gene for the proper processing of mRNA by splicing and polyadenylation. The Id1 transgenic fragment was microinjected into pronuclei of the oocytes of FVB/N mice. Expression of the Id1 transgene was detected in two independent founder lines (Id1-28 and Id1-29) by RT-PCR assays with primers annealing to the Id1 and hGH sequences (data not shown). Three other founder lines died in a non-pathogen-free facility prior to rederivation, possibly due to their immunodeficiency. The total numbers of thymocytes in the Id1-28 and Id1-29 mice were less than 4% of the numbers in their wild-type littermates in the first 1.5 weeks after birth (Fig. 1A). While this low thymocyte count in the Id1-28 transgenic mice persisted throughout adulthood, the deficit in the Id1-29 transgenic mice was subsequently alleviated, suggesting a leakier block, probably as a result of a lower level of Id1 expression. Therefore, further examination was carried out by using the Id1-28 transgenic mice. Consistent with the low thymocyte counts, the thymuses of the Id1-28 transgenic mice were rudimentary. Histological examination revealed that the thymuses of Id1 transgenic mice were almost devoid of the cortex, where developing T-cells are normally found (Fig. 1B). In addition, the medulla of the thymus showed a significant reduction in the number of lymphocytes.

View larger version (77K): [in this window] [in a new window]   FIG. 1.   (A) Reduced cellularity in the thymuses of Id-1 transgenic mice. Unpurified viable thymocytes were counted with a hemocytometer. The numbers of cells per thymus are the average for n wild-type (WT) or Id1-28 and Id1-29 transgenic mice at the indicated ages. (B). Hematoxylin and eosin stain of wild-type and Id1-28 transgenic thymus sections.

T-cell developmental blocks in the Id1 transgenic mice. To examine intrathymic T-cell development, thymocytes from 1- and 5-week-old Id1-28 transgenic mice and their wild-type littermates were first analyzed by using flow cytometry with antibodies against CD4 and CD8 (Fig. 2A). In contrast to the predominance of DP cells in wild-type thymuses at both ages, the 1-week-old transgenic thymuses contained primarily DN cells, suggesting that the initial defect is at the DN stage. At the age of 5 weeks, CD4⁺ and CD8⁺ single-positive cells appeared in the transgenic thymuses while the DP cells were still lacking. Moreover, the CD8⁺ population in the transgenic mice constitutes 20% of the thymocytes, compared to 2.6% in wild-type mice. The appearance of these CD4⁺ and CD8⁺ cells is not dependent on the age of the animals but on the degree of inhibition of E-protein function. For example, in 5-week-old homozygous transgenic mice, fewer single positive cells were detected (data not shown), suggesting that higher levels of Id1 expression lead to a greater inhibition of E-protein function and a more complete block of T-cell development.

View larger version (51K): [in this window] [in a new window]   FIG. 2.   FACS analyses of cells from Id1 transgenic mice. (A) CD4 and CD8 profiles of the wild-type and transgenic littermates at the indicated ages. The percentage of each cell population is shown in each quadrant. (B) Further analysis of CD4+ and CD8+ single-positive thymocytes. Thymocytes from 5-week-old mice were stained with TC-CD4 and PE-CD8 together with FITC-conjugated antibodies as indicated. The CD4+ and CD8+ populations were defined as shown in panel A. The expression of each indicated cell surface marker is plotted as fluorescence intensity versus cell number (different scales were used for wild-type and transgenic cells). The profiles of the wild-type mice are shown as thick lines, and those of the Id1 transgenic mice are shown as thin lines. (C) Analyses of Ficoll-purified spleen cells from 5-week-old mice as described in panel B. The percentage of CD4+ and CD8+ single-positive cells are shown on top of the boxes.

Further characterization of the DN cells in the transgenic mice. The FACS analysis in Fig. 2A suggested that the T-cell developmental defect in the transgenic mice occurred primarily at the DN stage. To further define the developmental stages of the DN transgenic cells, thymocytes that were negative for anti-CD4 and anti-CD8 staining were examined for c-kit, CD44, CD24, and CD25 expression (Fig. 3). In wild-type mice, the DN cells were characterized predominantly as c-kit CD44 CD24⁺, with CD25 being positive or negative. In contrast, the majority of DN cells in 1-week-old transgenic mice appeared to be c-kit⁺ CD44⁺ CD24 CD25, which marks multipotent progenitor cells (51, 62). At 4 weeks later, while the wild-type cells exhibited indistinguishable characteristics from the 1-week-old cells, the transgenic DN cells progressed to a stage displaying cell surface markers as c-kit CD44⁺ CD24⁺ CD25 and remained at this stage throughout adulthood. It thus appears that the major rate-limiting steps in T-cell development in the Id1 transgenic mice might involve the commitment of lymphoid progenitor cells to the T-cell lineage and the initial differentiation of committed T cells.

View larger version (41K): [in this window] [in a new window]   FIG. 3.   Further characterization of CD4 and CD8 DN cells. Thymocytes from wild-type (WT) and transgenic littermates at the indicated ages were stained with TC-CD4 and TC-CD8 together with PE- and FITC-conjugated antibodies as indicated. The TC-negative population was gated for these analyses.

TCR rearrangement in the transgenic mice. The V(D)J recombination of TCR genes is a crucial process during T-cell differentiation. The majority of thymic T cells rearrange and express the TCR , while a minor population of T cells bear TCR . The orderly events in TCR rearrangement begin with the joining of the D and J regions of the  chain gene of TCR followed by the V-to-DJ recombination. The productive rearrangement of the -chain gene, together with the pre-T  chain, results in the formation of a pre-TCR, which then prompts the V-to-J recombination of the -chain gene. Therefore, these step-by step events of TCR rearrangement have been used as indicators for the developmental stages of T cells. The T cells arise from progenitor T cells by rearranging TCR  and  genes prior to TCR  gene rearrangement. We have examined the rearrangement of TCR genes in the thymocytes from the Id1 transgenic mice to further assess their developmental status (Fig. 4).

View larger version (72K): [in this window] [in a new window]   FIG. 4.   TCR rearrangement. Total and sorted thymocytes (labeled at the top of each panel) from wild-type and transgenic littermates at the indicated ages were used to prepare DNA for PCR analyses. Thymocytes from wild-type and transgenic (lanes 1 and 3) mice and their respective 10-fold-diluted samples (lanes 2 and 4) were used in PCRs to detect TCR rearrangement events as indicated. The PCR product of the Id2 gene served as a control for the amount of DNA present in each sample. The PCR products were analyzed by Southern blotting.

Massive cell death in the thymuses of the Id1 transgenic mice. Another striking feature of the Id1 transgenic mice was the presence of a large number of dead cells in the thymus as determined microscopically and by forward- and side-scatter flow cytometry analysis (Fig. 5A). The dead cells, most probably apoptotic cells, constituted about 50% of the total thymocytes. To further characterize the dead cells, we have separated the dead cells from live ones by centrifugation of total thymocytes on a Ficoll cushion. The resulting pellet contained dead cells as well as contaminating live cells, while the supernatant had mostly live cells as evidenced by the scatter analysis (Fig. 5A). Moreover, gel electrophoresis of DNA isolated from total thymocytes of the transgenic mice but not the wild-type mice showed DNA fragmentation, a characteristic of apoptotic cells (Fig. 5B, lanes 1 and 2). The fragmented DNA was contributed by the cells partitioned to the pellet after centrifugation on the Ficoll cushion, whereas the DNA prepared from cells in the supernatant appeared intact (lanes 3 and 4). To assess the developmental status of the apoptotic cells, genomic DNA was isolated from different fractions of cells for analysis of TCR rearrangement. As diagrammed in Fig. 5C, total thymocytes (sample 1) were first separated into pellet (sample 2) and supernatant (sample 5) components. The DNA isolated from the pelleted cells was further fractionated by gel electrophoresis into intact DNA (sample 3), which was probably derived from contaminating live cells, and fragmented DNA, which presumably originated from the apoptotic cells (sample 4). Cells in the supernatant were then stained with TC-CD4, TC-CD8, PE-CD44, and FITC-CD25. By using a cell sorter, DN cells, which constituted 70% of the thymocyte, were gated, and CD44⁺ CD25 cells (sample 6) and the remainder of the DN cells (sample 7) were collected. These samples were then used to isolate DNA for PCR analysis of TCR rearrangement.

View larger version (56K): [in this window] [in a new window]   FIG. 5.   Apoptosis in the Id1 transgenic thymus. (A) Forward- and side-scatter analysis of thymocytes with or without Ficoll purification as indicated. Live cells are circled. (B) Electrophoresis of DNA from wild-type and transgenic unpurified thymocytes (lanes 1 and 2), transgenic thymocytes in the pellet after centrifugation on Ficoll (lane 3), and transgenic thymocytes in the supernatant (lane 4). (C) TCR rearrangement in different fractions of thymocytes in 10-day-old transgenic mice. The fractionation procedure is diagrammed at the top. The different fractions are numbered 1 through 7, corresponding to the lane numbers. The PCR product representing the germ line configuration in D-J region is marked by an arrowhead.

Gene expression in the Id1 transgenic mice. Since the E proteins are potent transcription activators, it is important to examine gene expression which might be altered as a result of the loss of E-protein activity. By using RT-PCR analysis, we compared the expression levels of various genes important for T-cell differentiation between transgenic mice and their wild-type littermates at the ages of 1 and 5 weeks (Table 1). We found that expression of the genes encoding components of the pre-TCR complexes (pre-T, CD3, CD3, CD3, and CD3) was not dramatically inhibited except for V expression. However, genes involved in the rearrangement of TCR, such as the RAG1, RAG2, TdT, and Ku70 genes, were expressed at less than 15% of the wild-type levels in 1-week-old mice and their expression increased in 5-week-old mice. Ku80 expression, on the other hand, did not change dramatically in either the 1- or 5-week-old mice. The mRNA level of Ikaros transcription factor also decreased modestly in the 1-week-old transgenic mice but increased in older mice (Table 1 and data not shown). These results may be interpreted to mean that the lower levels of gene expression are due to the lack of T cells which have reached the stages when these genes are up-regulated (51). Alternatively, these genes may be the direct targets of the E proteins, and inhibition of E protein activities leads to lower levels of their expression. By the same token, the genes encoding c-kit and interleukin-7 (IL-7) receptor , both of which are important for the survival of progenitor T cells, appeared to be expressed at higher-than-wild-type levels. This may also be explained by the enrichment for the T cells at early stages in the transgenic mice.

T-cell lymphoma in the Id1 transgenic mice. Since disruption of the E2A gene was found to cause T-cell lymphoma in E2A-deficient mice (5, 63), we were interested in determining if overexpression of Id1 could also lead to tumor formation in the transgenic mice. Despite the severe block of T-cell development at an early progenitor stage, adult transgenic mice developed T-cell lymphoma at a high frequency and at an age as early as 2.5 months. Figure 6A shows the physical appearance of one such thymic lymphoma and the histological examination of the lymphoma and its metastatic sites. The normal histological structure of the thymus was completely effaced and replaced by a monotonous population of intermediate-size neoplastic lymphocytes with abundant mitotic figures and apoptotic cells. Morphologically, this tumor resembled Burkitt's lymphoma in humans. Although upon gross examination only the lymph nodes and spleen appeared affected by the tumor, microscopically all sampled organs demonstrated interstitial infiltration of neoplastic lymphocytes.

View larger version (113K): [in this window] [in a new window]   FIG. 6.   T-cell lymphoma in Id1 transgenic mice. (A) The appearance of a thymic lymphoma in a 3.5-month-old mouse and histological examination of the tumor and its metastatic sites. (B) FACS analysis of the thymus and lymph nodes of four 4-month-old transgenic mice numbered 1 to 4. The size of each thymus was similar to that shown in panel A. Lymph nodes were enlarged to various degrees. Cells were stained with antibodies against CD4 and CD8 as labeled.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Role of E and Id proteins in T-cell development. Id1 overexpression arrests T-cell development at the progenitor stage in the Id1 transgenic mice, a defect similar to but much more severe than that in the E2A- or HEB-deficient mice (5, 65). Since Id1 is an inhibitor of all E proteins (56), it is likely that it exerts its dramatic effect by interfering with the function of multiple E proteins which are expressed simultaneously in T cells. In fact, we have found that expression of E47, a product of the E2A gene, can rescue the T-cell deficiency in Id1 transgenic mice (data not shown). Therefore, findings with the Id1 transgenic mice have demonstrated that the E proteins collectively are as crucial for T-cell development as they are for B-cell development. The thymocytes that accumulated in the Id1 transgenic mice were identified as c-kit⁺ CD44⁺ CD24 CD25 or c-kit CD44⁺ CD24⁺ CD25 progenitor cells that have the potential to differentiate into T, B, and NK cells (15, 51). Interestingly, the developmental stages of these cells appear to parallel the stage known as fraction A (B220⁺ CD43⁺ CD24 BP-1) in bone marrow (22), the stage at which B-cell development is blocked in the E2A-deficient mice (4). Fraction A cells can be further characterized based on their surface expression of the AA4.1 marker. AA4.1⁺ cells are considered prepro-B cells, while AA4.1 cells include cells expressing the NK1.1 markers and a subset of T cells (32). Because B and T cells have common strategies in their differentiation, the similar effect on B- and T-cell development as a result of E-protein ablation either by gene disruption or by overexpression of their inhibitor would suggest that E proteins might control B- and T-cell development through similar mechanisms.

Possible mechanisms by which E proteins control lymphocyte differentiation. T-cell development in the Id1 transgenic mice seems to be blocked primarily during the commitment of progenitor cells to the T-cell lineage, since the predominant population of cells accumulated in these mice was made up of DN cells carrying the cell surface markers c-kit⁺ CD44⁺ CD24 CD25 or c-kit CD44⁺ CD24⁺ CD25, depending on the age of the animals. This phenotype of Id1 transgenic mice is in sharp contrast to the phenotypes of knockout mice, in which genes encoding various proteins involved in pre-T or TCR signaling are disrupted (20, 35, 38, 53). In these mice, T-cell development is arrested at the CD44 CD25⁺ DN stage. Therefore, it is unlikely that inhibition of the expression of the genes encoding TCR pre-T or subunits of CD3 and impairment of TCR gene rearrangement and expression are the crucial factors involved. Our data from analyses of gene expression and TCR gene rearrangement would support this notion. Indeed, we have found that expression of functionally rearranged TCR genes in the Id1 transgenic mice could not rescue the developmental defect (data not shown). The phenotype of the Id1 transgenic mice is also distinct from that of the IL-7 or IL-7 receptor-deficient mice, in which T-cell development is blocked primarily at the CD44⁺ CD25⁺ DN stage (39, 47, 61). Our study has shown that expression of the IL-7 receptor  gene is not repressed by Id1. Furthermore, the phenotype of Id1 transgenic mice is different from those of the PU.1-deficient mice (37, 52) and the mice expressing the dominant negative form of the Ikaros protein that inhibits the function of the Ikaros family of proteins (18). In these mice, the lymphoid lineage is lacking, suggesting that the E proteins act at different points from the PU.1 and Ikaros transcription factors during hematopoiesis.

Mechanisms of T-cell lymphomagenesis. The Id proteins are essential for the G₁-to-S-phase transition in the cell cycle of fibroblasts, as shown by experiments with antisense oligonucleotides (6, 21). Conversely, E2A proteins have been found to block cell cycle progression at the G₁-to-S-phase transition (48), perhaps by activating the transcription of the gene encoding the cyclin-dependent kinase inhibitor p21^CIP/WAF1 (49). Furthermore, we have shown that in a human T-cell lymphoblastic leukemia cell line, Jurkat, restoration of E2A activity, which is inhibited by the aberrant expression of the Tal1 oncogene, leads to cell growth arrest and apoptosis (45). It is therefore not surprising that overexpression of Id1 or disruption of the E2A gene leads to T-cell lymphomagenesis (5, 63). The molecular mechanisms leading to tumor formation, however, remain to be determined. Lack of p21 gene expression is unlikely to be solely responsible for lymphomagenesis in the Id1 transgenic mice, because p21 is normally not expressed at a high level in T cells and the p21-deficient mice do not develop lymphomas (14).