Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8272-8280, Vol. 19, No. 12
Hormone Research
Institute1 and Department of
Medicine,2 University of California, San
Francisco, San Francisco, California 94143-0534
Received 25 March 1999/Returned for modification 20 May
1999/Accepted 16 August 1999
The paired-homeodomain transcription factor PAX4 is expressed in
the developing pancreas and along with PAX6 is required for normal
development of the endocrine cells. In the absence of PAX4, the numbers
of insulin-producing During development, the mammalian
pancreas arises from the epithelial cells of the embryonic gut at the
foregut-midgut junction and differentiates into two distinct
compartments: the exocrine tissue, which produces digestive enzymes,
and the endocrine islets of Langerhans, which produce specific
hormones. The islets are arranged into a core of insulin-producing The coordinated regulation of gene expression required for normal
pancreatic development is not completely understood but clearly
requires the orderly activation of nuclear transcription factors by
both intracellular and extracellular signals. Several transcription
factors (PDX1, ISL1, PAX6, PAX4, BETA2/NeuroD, and NKX2.2) are required
for normal pancreatic endocrine development, and many of these factors
also regulate gene expression in mature islet cells (1, 2, 19, 24,
26, 32, 35-37). However, one of these factors, PAX4, has been
identified only as a regulator of endocrine development, and its target
genes are unknown (35).
PAX4 belongs to the PAX family of transcription factors and contains
both a paired domain and a homeodomain (18, 42) which are
potential DNA binding domains (DBDs). In the normal murine embryo, its
mRNA is detected at embryonic day 9.5 (e9.5) in ventral spinal cord and
pancreas (35). Indirect evidence from mice containing the
To gain insight into the mechanisms of PAX4 function in the endocrine
pancreas, we determined where it binds and how it regulates transcription. We identified a consensus DNA binding site for PAX4 and
showed that PAX4 can bind to various sequences in the rat insulin I,
somatostatin, and glucagon promoters, all of which have previously been
shown to bind PAX6 (32). We found that PAX4 can act as a
transcriptional repressor and showed that the homeodomain and carboxyl
portion of the molecule confers the greatest repressive activity.
Finally, by reverse transcriptase PCR (RT-PCR), we demonstrate that
PAX4 expression peaks early in pancreatic development and that PAX4 is
not expressed in mature islets.
Cloning of murine Pax4.
The Pax4 cDNA was
cloned from a In vitro protein expression.
To produce a PAX4 expression
vector, the two overlapping clones were digested and then religated at
an FseI site located between 43 to 50 bp into the paired
box. The full-length coding sequence was inserted into the pSP72 vector
(Promega, Madison, Wis.), enabling protein expression with the
bacterial SP6 promoter. A truncated coding sequence, terminating at
codon 274, was also created in the same vector because the full-length
PAX4 (349 amino acids [aa]) was not expressed with adequate
efficiency. The PAX6 expression vector (pmPAX6) was a gift from M. Busslinger, Research Institute of Molecular Pathology, Vienna, Austria
(4). PAX4 and PAX6 proteins were produced by in vitro
transcribed/translated (IVTT) reaction, using the TNT coupled
reticulocyte lysate system (Promega) according to the manufacturer's instructions.
PAX4 binding site selection.
To select for PAX4 binding
sequences by using a published technique (3), a 76-mer
sequence with 30 central random bases was used as a probe in an
electrophoretic mobility shift assay (EMSA). The sequence of the top
strand of the 76-mer was
5'-GTGACCAGATCTAATCGTGGTCCTN30ACGGTCGACGAGTACGCGTTAC-3'. Radiolabeling of the second strand with
[ EMSA.
Single-stranded oligonucleotide probes were 5' end
labeled with [
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Paired-Homeodomain Transcription Factor PAX4
Acts as a Transcriptional Repressor in Early Pancreatic
Development
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
cells and somatostatin-producing 
cells are
drastically reduced, while the numbers of glucagon-producing 
cells
are increased. To gain insight into PAX4 function, we cloned a
full-length Pax4 cDNA from a -cell cDNA library and identified a
bipartite consensus DNA binding sequence consisting of a homeodomain
binding site separated from a paired domain binding site by 15 nucleotides. The paired half of this consensus sequence has
similarities to the PAX6 paired domain consensus binding site, and the
two proteins bind to common sequences in several islet genes, although
with different relative affinities. When expressed in an -cell line,
PAX4 represses transcription through the glucagon or insulin promoters
or through an isolated PAX4 binding site. This repression is not simply
due to competition with the PAX6 transcriptional activator for the same
binding site, since PAX4 fused to the unrelated yeast GAL4 DNA binding
domain also represses transcription through the GAL4 binding site in
the -cell line and to a lesser degree in -cell lines and NIH 3T3
cells. Repressor activity maps to more than one domain within the
molecule, although the homeodomain and carboxyl terminus give the
strongest repression. PAX4 transcriptional regulation apparently plays
a role only early in islet development, since Pax4 mRNA as
determined by reverse transcriptase PCR peaks at embryonic day 13.5 in
the fetal mouse pancreas and is undetectable in adult islets. In
summary, PAX4 can function as a transcriptional repressor and is
expressed early in pancreatic development, which may allow it to
suppress -cell differentiation and permit -cell differentiation.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
cells surrounded by a mantle of glucagon-producing cells, and
smaller numbers of somatostatin- and pancreatic polypeptide-producing
cells ( and PP cells, respectively) (34).
-galactosidase coding sequence inserted into the Pax4
gene suggests that at birth PAX4 expression is restricted to the cells within the pancreas (35). Its critical role in
pancreatic endocrine development is demonstrated by the fact that mice
homozygous for a null mutation in the Pax4 gene have a
marked decrease in and cells and an increase in cells,
although the mechanism for these changes is undefined (35).
Importantly, insulin-expressing cells are detected in the null mutants
at e10.5, suggesting that insulin transcription can occur in the
absence of PAX4. Ultimately however, the null mutants die within a few
days of birth, apparently as a consequence of insulin deficiency.
Heterozygotes containing a single mutated Pax4 allele are
normal. It is interesting that PAX6, which is highly related to PAX4,
is also required for normal endocrine pancreatic development
(36), although its absence reduces all four endocrine
lineages (32). Furthermore, double null mutants for both
Pax4 and Pax6 fail to produce any mature pancreatic endocrine cells (36), suggesting that these two
factors together are required for endocrine cell differentiation.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TC3 cell line plasmid library (a generous gift from D. Hanahan, University of California, San Francisco) by PCR, using a
high-fidelity system (Expand PCR; Boehringer Mannheim, Indianapolis,
Ind.), producing two overlapping clones. The 5' clone was produced by
PCR using the SP6 forward primer (located in the vector) and a reverse
primer beginning at the 3' end of the paired box
(5'-CGGAATTCCTGAAGTGCCCGAAGTACTCG-3'). This clone extends 18 bp 5' of the initiator ATG codon. The 3' clone was produced by using a
forward primer from the 5' end of the paired box
(5'-CGCGGATCCCTCAGCAGTGTGAATCAGCT-3') and the T7 reverse
primer (located in the vector). The two clones span 1.1 kb of the
Pax4 cDNA and include the entire predicted coding sequence.
-32P]dCTP was performed with Klenow polymerase,
deoxynucleoside triphosphates, and the primer
5'-GTAACGCGTACTCGTCGACCGT-3' (REV). The labeled, double-stranded random sequences were incubated with in vitro-produced truncated PAX4 and electrophoresed under nondenaturing conditions. The
specific retarded complex was cut out of the gel, and the selected
76-mers were eluted. The eluted 76-mers were then amplified and
relabeled by using 16 cycles of PCR with [-32P]dCTP,
the REV primer, and the forward primer
5'-GTGACCAGATCTAATCGTGGTCCT-3' (FWD). This PCR product was
used as probe for the next round of EMSA selection. A total of 13 selection cycles were performed, and the selected 76-mers were
subcloned into pCR2.1 (Invitrogen) and sequenced after the 10th and
13th cycles.
-32P]ATP by using T4 polynucleotide
kinase. Labeled oligonucleotides were column purified and annealed to
an excess of the complementary strand. EMSA buffers and electrophoresis
conditions were as previously described (13). Where in
vitro-synthesized PAX4 or PAX6 was used, 0.05 to 1 µl of the 50-µl
reaction volume was added.
328 to 304,
5'-CTGGGAAATGAGGTGGAAAATGCTC-3'; rat somatostatin upstream
enhancer (SMS.UE), bp 102 to 76,
5'-GCGAGGCTAATGGTGCGTAAAAGCACT-3'; rat glucagon G3 (GluG3),
bp 265 to 231, 5'-TTTTTCACGCCTGACTGAGATTGAAGGGTGTATTT-3'; and rat glucagon G1 (GluG1), bp 100 to 52,
5'-CAAAACCCCATTATTTACAGATGAGAAATTTATATTGTCAGCGTAATAT-3'.
Cell culture and transient transfections.
A PAX4 eukaryotic
expression vector was produced by subcloning the full-length
Pax4 cDNA into a vector (pBAT12) containing the human
cytomegalovirus (CMV) immediate-early gene promoter. pBAT12 is
identical to pBAT7 (14) except for a modification in the
polylinker and replacement of the early simian virus 40 polyadenylation
signal with the late simian virus 40 polyadenylation signal. The
reporter constructs were created by using either the 410 bp rat
insulin I promoter, the 482 bp rat glucagon promoter, the Rous
sarcoma virus (RSV) long terminal repeat (LTR), the CMV promoter, or
the isolated rInsIC2 fragment linked to the herpes simplex virus
thymidine kinase (HSV-TK) promoter to drive the chloramphenicol
acetyltransferase (CAT) gene in the pFOXCAT2 vector (25).
TC1.6, TC3, and HIT-T15 M2.2.2 cells were cultured,
transfected with calcium phosphate, and harvested as previously described (13). CAT assays and luciferase assays were
performed as previously described, using 10 µg of cell protein
extract (13, 14).
Mouse pancreatic buds were isolated from fetal mice at e12.5, and the
mesenchyme and epithelium were separated as previously described
(15). The epithelium from each bud was individually transfected with 3 µg of the plasmid DNAs indicated and 9 µg of the
cationic lipid transfection reagent Transfast (Promega). After transfection, the epithelium was washed and recombined with the mesenchyme on a surface of Matrigel (Collaborative Research). After
culturing for 24 h, the buds were harvested and RT-PCR was performed.
RT-PCR.
Total RNA was purified from the indicated tissue
source by using an RNAqueous kit (Ambion, Austin, Tex.) and quantified
by spectrophotometry. Using a modification of the method described by
Gittes and Rutter (16), 250 ng of total RNA was then used as
template to synthesize first-strand cDNA by the action of avian myeloblastosis virus reverse transcriptase primed by a poly(dT) primer.
The cDNA produced was used as a template for the indicated number of
cycles of PCR using primers that amplify fragments of the indicated
cDNA (PAX4 primers 1 [GTGTTGGCTCCAGTTCTTCC] and 2 [AACCAAACCCTCACCGTGTC]; -actin primers 1 [TGAGAGGGAAATCGTGCGTG] and 2 [TGCTTGCTGATCCACATCTGC]; mouse insulin II primers 1 [GCCCTAAGTGATCCGCTACAATC] and 2 [GCAGCACTGATCTACAATGCCAC]; luciferase and EGFP primer 1 [TGGGCAGGCTGCTGGTCTGAG]; luciferase primer 2 [TGCTCTCCAGCGGTTCCATC]; EGFP primer 2 [TCAGGGTCAGCTTGCCGTAGG]) Each set of primers was designed
to include at least one intron in order to allow the discrimination of
contaminating genomic or plasmid DNA from cDNA. The cycling program
used for all samples was 95°C for 2 min and then 25 to 40 cycles of
95°C for 20 s, 55°C for 30 s, and 72°C for 30 s.
Samples were analyzed on a 6% polyacrylamide gel and stained with
ethidium bromide. Identity of the amplified products was confirmed by
subcloning and DNA sequencing. PCR performed for luciferase and EGFP in
the transfected pancreatic buds included 100,000 cpm of
[-32P] dCTP. PCR products were quantified with a
phosphorimager and expressed as the ratio of luciferase cDNA to EGFP cDNA.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Cloning of Pax4.
To study the function of PAX4, we
cloned the Pax4 cDNA from a -cell tumor line (TC3)
plasmid cDNA library. The predicted amino acid sequence of PAX4 is
identical to a recently published sequence derived from the MIN6
insulinoma cell line (18), except for a proline at position
277 in our sequence, which has been replaced with a serine. PAX4 is
therefore a 349-aa protein with its 128-aa paired domain beginning at
the fifth residue after the initiator methionine. A 36-aa intervening
sequence separates the paired domain from the 60-aa homeodomain, and a
further 121 aa extend from the homeodomain to the carboxyl terminus.
PAX4 binding site selection. To gain insight into PAX4 function, we attempted to determine PAX4 recognition sequences by using a previously described strategy (3) and ultimately to identify its downstream target genes. To select oligonucleotides with high PAX4 binding affinity, we incubated a pool of radiolabeled oligonucleotide probes containing a central core of 30 random bases with in vitro-produced PAX4 and performed an EMSA. We used a C-terminally truncated in vitro-produced PAX4 because the synthesis of full-length PAX4 was less efficient (data not shown). The truncated protein is 274 aa instead of 349 aa but contains both the paired and homeodomains.
After the first EMSA, the specific PAX4-DNA retarded complex was cut from the gel and the bound oligonucleotides were eluted. PCR was performed to amplify and to radiolabel the selected oligonucleotides, which were then used for the next round of EMSA selection. Oligonucleotide products were subcloned for sequencing after the 10th and 13th rounds of selection. All of the sequences obtained from the 13th round of selection were subjected to an ungapped alignment using the multiple sequence alignment function in the MacVector 6.5 software package (Oxford Molecular Ltd.). This alignment reveals a bipartite consensus (Fig. 1A). The 3' sequence generally conforms to the consensus DNA binding sequences for other paired domains (20) and shares a six-nucleotide overlap with the PAX6 consensus binding sequence (Fig. 1E) obtained by using the paired domain alone (7). The 5' sequence contains the overlapping TAAT sequence found in many binding sites for homeodomain transcription factors (39).
|
PAX4 binds to hormone gene promoters. Comparison of the consensus PAX4 binding sequence with the insulin promoter sequence shows that a sequence matching five of the seven bases in the consensus is found in rInsIC2 (Fig. 1E). As this element has been shown to bind strongly to PAX6 (32), and as PAX4 and PAX6 recognition sequences share some overlap, we compared the PAX4 consensus sequence to sequences of other known PAX6 binding sites on islet hormone gene promoters, namely, rat SMS.UE and rat GluG3 (32). In both SMS.UE and GluG3, there are sites matching the PAX4 consensus (Fig. 1E). We also tested for PAX4 and PAX6 binding to rat GluG1, as it shares sequence similarity to GluG3 (21, 29) and binds similar protein complexes (29). The GluG1 sequence contains two potential PAX4 paired binding sites, although with only four matching bases at each site, and two TAAT sequences (Fig. 1E).
Oligonucleotides including these potential binding sites were end labeled and used as probes in EMSA, initially to compare the DNA binding characteristics of the truncated and full-length PAX4. PAX4 binds with highest affinity to rInsIC2, followed by SMS.UE and GluG3 (Fig. 2A). Binding to GluG1 is substantially weaker than binding to the other oligonucleotides (Fig. 2A). Importantly, we show that the truncated and full-length proteins have the same relative affinities for the different oligonucleotide probes.
|
-cell promoter elements, including the human insulin (hIns) C2
element, the rIns and hIns C1 elements, rInsI A3/4 element, the hIns Z
element, and the rat -cell-specific glucokinase promoter Pal1 and
Pal2 sites (11, 12, 31, 33) (data not shown).
PAX4 represses transcription.
We used the high affinity PAX4
C2 binding site to assess the transcriptional effect of PAX4 in
cultured cells. A single copy of the isolated C2 element linked to the
HSV-TK promoter was used to drive CAT gene expression. PAX4 expression
was driven by the CMV immediate-early promoter in the eukaryotic
expression vector pBAT12-PAX4. Expression and reporter constructs were
cotransfected into (TC1.6), (TC3 and HIT-T15 M2.2.2), and
nonislet (NIH 3T3) cell lines, and CAT activity was assessed.
-cell lines and NIH 3T3 cells, PAX4 has little effect on the
transcriptional activity of the isolated C2 element (Fig. 3B). In contrast, in TC1.6 cells, PAX4
represses transcription from the isolated C2 element approximately
threefold but has no effect on the TK promoter in the absence of the C2
element.
|
TC1.6 cells
but does not occur with the unrelated RSV and CMV promoters (Fig. 3C).
These results demonstrate that PAX4 represses transcription through its
binding site and that this effect may depend on the cellular context.
PAX4 contains transcriptional repression domains. Repression by PAX4 could result from competition for binding at the rInsIC2 site with a strong activator (such as PAX6) or could reflect an intrinsic repressor function of the PAX4 molecule. To distinguish between these two possibilities, we made chimeric proteins by fusing portions of PAX4 to the yeast GAL4 DBD. We also used the C-terminal region of PAX6 (codon 271 to COOH) as a known positive activating domain (17, 32). To allow direct comparison to the experiments using the C2 site, an analogous reporter construct was constructed by simply replacing the C2 element in the C2-TK-CAT plasmid with a single GAL4 DNA-binding site (the GAL4 UAS). The fusion protein constructs and reporter constructs were cotransfected into cultured cells. This approach allows for DNA binding through the GAL4 DBD, independent of the PAX4 paired and homeodomains.
InTC1.6 cells, the region of PAX4 C terminal to the paired domain
(codon 127 to COOH) represses CAT activity to approximately 40% of
baseline (Fig. 4B), a degree of
repression similar to that produced by intact PAX4 acting through an
isolated C2 site. The PAX4 carboxyl terminus beyond the homeodomain
(codon 211 to COOH) can also repress CAT activity. While there is some
weak repression in the other cell lines, the -cell line gives the
strongest repression, consistent with the -cell repression
demonstrated by the intact PAX4 protein on the C2 element (Fig. 3B).
When a reporter construct that contains multiple GAL4 UAS binding sites
is used, the repression by GAL4-PAX4 fusion proteins is more pronounced
and can be detected in NIH 3T3 and TC3 cells as well (Fig. 4C).
|
TC1.6 cells (Fig. 4D). Thus, the repressive effects seen
in this system can occur only when the expressed chimeric PAX4-GAL4 DBD
proteins bind specifically to a promoter containing the GAL4 UAS.
To ensure that the transcriptional activation potential of PAX4 was not
hidden by the high basal activity of the HSV-TK promoter, we also
tested the same fusion constructs with a construct containing five GAL4
UASs linked to the adenovirus E1b promoter driving CAT expression
(pG5CAT; Clontech). Even with this minimal promoter, the PAX4
constructs do not activate in TC3 cells, whereas stimulatory activity of the PAX6 carboxyl terminus is obvious (Fig. 4E).
PAX4 is not expressed in mature cells.
Transgenic
experiments have previously suggested that PAX4 is expressed
specifically in pancreatic cells, making its role as a
transcriptional repressor, especially of the insulin promoter, difficult to understand. Because of this inconsistency and our inability to detect PAX4 protein in mature cells by EMSA or Western
blot analysis (data not shown), we tested for the expression of
Pax4 mRNA by RT-PCR.
TC3 cells, but not in the NIH 3T3 fibroblast cells
(Fig. 5B). Pax4 mRNA is expressed at much lower level in
TC1.6 cells, and a faint band can be detected in Fig. 5B, although
this is more obvious with additional cycles of PCR (data not shown).
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In these studies, we selected DNA oligonucleotides that bind to a PAX4 protein that contains both the paired domain and the homeodomain. Sequences of the selected oligonucleotides reveal the presence of two linked sites: a consensus homeodomain binding site and a consensus paired domain binding site. The relative position of these two sites appears to be important, since in the more highly selected set of oligonucleotides the spacing becomes fixed. Both PAX3 (28) and Drosophila Prd (20) have also been found to bind with high affinity to sequences that include both paired and homeodomain binding sites. Interestingly, both on a natural site in the even-skipped gene (9) and in sites selected by a method similar to the one used here (20), the two binding sites for Prd are much closer than we found for PAX4, a difference of approximately one helical turn. For both PAX4 and Prd, the paired and homeodomain binding sites lie on opposite sides of the DNA.
The paired-like half of the bipartite DNA binding sequence for Pax4 is similar but not identical to the consensus binding site for the PAX6 paired domain (7). The differences from the PAX6 binding sequence could be due to the fact that we used a PAX4 protein containing both the paired and homeodomains for binding site selection, while only the paired domain was used for determining the PAX6 consensus sequences. The presence of both domains may alter the specificity of each, as is the case for PAX3 (40). However, differences in DNA binding specificity were confirmed by using a set of paired domain binding sites from islet genes that demonstrate different relative affinities for the full-length PAX4 and PAX6 proteins. The presence and exact position of a linked homeodomain binding site could potentially increase these differences. Furthermore, in the intranuclear environment, within the context of chromatin structure and other interacting proteins, the differences in binding affinities may be further accentuated. Nonetheless, these studies suggest that PAX4 and PAX6 could potentially compete for some binding sites.
Our transient transfection experiments show that PAX4 can repress
transcription through a single isolated binding site linked to a
promoter or through a binding site in the context of an intact promoter. Furthermore, the experiments with GAL4 DBD fusion constructs mapped this repressor function predominantly to the region of PAX4 C
terminal to the paired domain. DNA binding is necessary for repression
but may be mediated by a heterologous DBD, such as the yeast GAL4 DBD,
in place of the paired and homeodomains. Transcriptional repression is
not unique within the PAX family, having been shown with PAX5 (5,
41) and the Drosophila paired domain family member,
Goosecoid (23). More recently, PAX6 has also been shown to
act as a transcriptional repressor, requiring both its paired domain
and homeodomain for this effect on -crystallin genes in the lens
(6). This finding suggests that PAX6 repression may be due
to competition with transcriptional activators for DNA binding sites.
However, chimeric proteins consisting of the GAL4 DBD fused to various
regions of PAX6 show that some regions of PAX6 may also have modest
intrinsic repressor activity (38).
It is becoming increasingly recognized that some transcription factors can act as either repressors or activators, depending on the cell type, promoter context, and concentration of the factor (reviewed in references 22, 27, and 30). Indeed, within the PAX family, both PAX5 (BSAP) and PAX6 have recently been shown to have such a dual function (6, 41). However, it is important to note that in many studies, transcriptional effects are assessed with DNA regulatory elements removed from their native chromosomal locations, and using highly efficient vectors to express the transcription factors, potentially resulting in supraphysiological intranuclear concentrations of the factors. In addition, differential splicing of the Pax4 mRNA within the region coding the carboxy end of the protein has been detected and could affect the balance of repressor/activator function. Thus, our studies do not exclude the possibility that PAX4 can function as a transcriptional activator in some contexts. In fact, Fujitani et al. (10) have now shown that in certain cellular contexts, portions of PAX4 may function as transcriptional activators.
Even if PAX4 can function as a transcriptional activator, it seems
unlikely that it is an important regulator of islet hormone gene
expression in vivo. Despite the high affinity of PAX4 for rInsIC2 and
the evidence that PAX4 may be expressed in early cells
(35), insulin transcription persists in animals lacking PAX4
(35), and we have failed to detect activation of the insulin promoter by PAX4 in any context. PAX4 could potentially suppress insulin transcription in cells, but PAX4 expression has not been
detected in cells in vivo (35). Finally, its absence from adult islets rules out a role for PAX4 in maintaining the differentiated phenotype of the mature endocrine cells.
Could opposing effects on transcription by PAX4 and PAX6 modulate the expression of target genes? While PAX4 and PAX6 could potentially compete for some binding sites, their differences in binding specificity suggest that the two proteins may have different target genes. There also may be little or no overlap in the expression of the two proteins since PAX4 is expressed in developing islet cells, and PAX6 is expressed in the fully differentiated islet cells (32).
On the other hand, the repressor function of PAX4 may play an essential
role during pancreatic development, by suppressing the -cell gene
expression program and committing developing endocrine cells to the
- and -cell lineages. The loss of PAX4 repression would explain
the marked increase in cells and decrease in and cells seen
in animals homozygous for a targeted disruption of the Pax4
gene (35). Identifying the target genes for PAX4 could help
explain how the cell phenotype is established and maintained.
| |
ACKNOWLEDGMENTS |
|---|
The first two authors contributed equally to this work.
We thank J. Wang, J. Leong, Y. Zhang, and J. Lau for technical assistance, members of the Michael German laboratory for helpful comments and criticisms, and Gabriele Bergers for advice on PCR strategies for cloning Pax4. H.C.E. and S.B.S. are recipients of Juvenile Diabetes Foundation International postdoctoral fellowships. This work was supported by National Institutes of Health grant DK41822.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Hormone Research Institute, University of California, San Francisco, San Francisco, CA 94143-0534. Phone: (415) 476-9262. Fax: (415) 731-3612. E-mail: german{at}cgl.ucsf.edu.
Present address: Gastroenterology Department, Sir Charles Gairdner
Hospital, Nedlands, Western Australia 6009, Australia.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Ahlgren, U., J. Jonsson, and H. Edlund. 1996. The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development 122:1409-1416[Abstract]. |
| 2. | Ahlgren, U., S. L. Pfaff, T. M. Jessell, T. Edlund, and H. Edlund. 1997. Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells. Nature 385:257-260[Medline]. |
| 3. |
Blackwell, T. K., and H. Weintraub.
1990.
Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection.
Science
250:1104-1110 |
| 4. |
Czerny, T.,
G. Schaffner, and M. Busslinger.
1993.
DNA sequence recognition by Pax proteins: bipartite structure of the paired domain and its binding site.
Genes Dev.
7:2048-2061 |
| 5. | Dorfler, P., and M. Busslinger. 1996. C-terminal activating and inhibitory domains determine the transactivation potential of BSAP (Pax-5), Pax-2 and Pax-8. EMBO J. 15:1971-1982[Medline]. |
| 6. |
Duncan, M. K.,
J. I. Haynes II,
A. Cvekl, and J. Piatigorsky.
1998.
Dual roles for Pax-6: a transcriptional repressor of lens fiber cell-specific -crystallin genes.
Mol. Cell. Biol.
18:5579-5586 |
| 7. |
Epstein, J.,
J. Cai,
T. Glaser,
L. Jepeal, and R. Maas.
1994.
Identification of a Pax paired domain recognition sequence and evidence for DNA-dependent conformational changes.
J. Biol. Chem.
269:8355-8361 |
| 8. |
Epstein, J. A.,
T. Glaser,
J. Cai,
L. Jepeal,
D. S. Walton, and R. L. Maas.
1994.
Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing.
Genes Dev.
8:2022-2034 |
| 9. | Fujioka, M., P. Miskiewicz, L. Raj, A. A. Gulledge, M. Weir, and T. Goto. 1996. Drosophila Paired regulates late even-skipped expression through a composite binding site for the paired domain and the homeodomain. Development 122:2697-2707[Abstract]. |
| 10. |
Fujitani, Y.,
Y. Kajimoto,
T. Yasada,
T. Matsuoka,
H. Kaneto,
Y. Umayahara,
N. Fujita,
H. Watada,
J. Miyazaki,
Y. Yamasaki, and M. Hori.
1999.
Identification of a portable repression domain and an E1A-responsive activation domain in Pax4: a possible role of Pax4 as a transcriptional repressor in the pancreas.
Mol. Cell. Biol.
19:8281-8291 |
| 11. | German, M., S. Ashcroft, K. Docherty, H. Edlund, T. Edlund, S. Goodison, H. Imura, G. Kennedy, O. Madsen, D. Melloul, L. Moss, K. Olson, M. A. Permutt, J. Philippe, R. P. Robertson, W. J. Rutter, P. Serup, R. Stein, D. Steiner, M.-J. Tsai, and M. D. Walker. 1995. The insulin gene promoter. Diabetes 44:1002-1004[Medline]. |
| 12. | German, M. S. 1994. Insulin gene structure and regulation, p. 91-117. In B. Draznin, and D. LeRoith (ed.), Molecular biology of diabetes, part 1. Humana Press Inc., Totawa, N.J |
| 13. |
German, M. S.,
L. G. Moss,
J. Wang, and W. J. Rutter.
1992.
The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical -cell nuclear complexes.
Mol. Cell. Biol.
12:1777-1788 |
| 14. |
German, M. S.,
J. Wang,
R. B. Chadwick, and W. J. Rutter.
1992.
Synergistic activation of the insulin gene by a LIM-homeo domain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex.
Genes Dev.
6:2165-2176 |
| 15. | Gittes, G. K., P. E. Galante, D. Hanahan, W. J. Rutter, and H. T. Debas. 1996. Lineage-specific morphogenesis in the developing pancreas: role of mesenchymal factors. Development 122:439-447[Abstract]. |
| 16. |
Gittes, G. K., and W. J. Rutter.
1992.
Onset of cell-specific gene expression in the developing mouse pancreas.
Proc. Natl. Acad. Sci. USA
89:1128-1132 |
| 17. | Glaser, T., L. Jepeal, J. G. Edwards, S. R. Young, J. Favor, and R. L. Maas. 1994. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet. 7:463-471[Medline]. |
| 18. | Inoue, H., J. Nomiyama, K. Nakai, A. Matsutani, Y. Tanizawa, and Y. Oka. 1998. Isolation of full-length cDNA of mouse PAX4 gene and identification of its human homologue. Biochem. Biophys. Res. Commun. 243:628-633[Medline]. |
| 19. | Jonsson, J., L. Carlsson, T. Edlund, and H. Edlund. 1994. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371:606-609[Medline]. |
| 20. | Jun, S., and C. Desplan. 1996. Cooperative interactions between paired domain and homeodomain. Development 122:2639-2650[Abstract]. |
| 21. |
Knepel, W.,
M. Vallejo,
J. A. Chafitz, and J. F. Habener.
1991.
The pancreatic islet-specific glucagon G3 transcription factors recognize control elements in the rat somatostatin and insulin-I genes.
Mol. Endocrinol.
5:1457-1466 |
| 22. | Lefstin, J. A., and K. R. Yamamoto. 1998. Allosteric effects of DNA on transcriptional regulators. Nature 392:885-888[Medline]. |
| 23. | Mailhos, C., S. Andre, B. Mollereau, A. Goriely, A. Hemmati-Brivanlou, and C. Desplan. 1998. Drosophila Goosecoid requires a conserved heptapeptide for repression of paired-class homeoprotein activators. Development 125:937-947[Abstract]. |
| 24. |
Naya, F. J.,
H. P. Huang,
Y. Qiu,
H. Mutoh,
F. J. DeMayo,
A. B. Leiter, and M. J. Tsai.
1997.
Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice.
Genes Dev.
11:2323-2334 |
| 25. |
Odagiri, H.,
J. Wang, and M. S. German.
1996.
Function of the human insulin promoter in primary cultured islet cells.
J. Biol. Chem.
271:1909-1915 |
| 26. | Offield, M. F., T. L. Jetton, P. A. Labosky, M. Ray, R. W. Stein, M. A. Magnuson, B. L. M. Hogan, and C. V. E. Wright. 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995[Abstract]. |
| 27. | Ogbourne, S., and T. M. Antalis. 1998. Transcriptional control and the role of silencers in transcriptional regulation in eukaryotes. Biochem. J. 331:1-14. |
| 28. |
Phelan, S. A., and M. R. Loeken.
1998.
Identification of a new binding motif for the paired domain of Pax-3 and unusual characteristics of spacing of bipartite recognition elements on binding and transcription activation.
J. Biol. Chem.
273:19153-19159 |
| 29. |
Philippe, J.,
C. Morel, and M. Cordier-Bussat.
1995.
Islet-specific proteins interact with the insulin-response element of the glucagon gene.
J. Biol. Chem.
270:3039-3045 |
| 30. |
Roy, S.,
S. Garges, and S. Adhya.
1998.
Activation and repression of transcription by differential contact: two sides of a coin.
J. Biol. Chem.
273:14059-14062 |
| 31. |
Sander, M.,
S. C. Griffen,
J. Huang, and M. S. German.
1998.
A novel glucose-responsive element in the human insulin gene functions uniquely in primary cultured islets.
Proc. Natl. Acad. Sci. USA
95:11572-11577 |
| 32. |
Sander, M.,
A. Neubuser,
J. Kalamaras,
H. C. Ee,
G. R. Martin, and M. S. German.
1997.
Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development.
Genes Dev.
11:1662-1673 |
| 33. |
Shelton, K. D.,
A. J. Franklin,
A. Khoor,
J. Beechem, and M. A. Magnuson.
1992.
Multiple elements in the upstream glucokinase promoter contribute to transcription in insulinoma cells.
Mol. Cell. Biol.
12:4578-4589 |
| 34. | Slack, J. M. W. 1995. Developmental biology of the pancreas. Development 121:1569-1580[Abstract]. |
| 35. |
Sosa-Pineda, B.,
K. Chowdhury,
M. Torres,
G. Oliver, and P. Gruss.
1997.
The Pax4 gene is essential for differentiation of insulin-producing cells in the mammalian pancreas.
Nature
386:399-402[Medline].
|
| 36. |
St-Onge, L.,
B. Sosa-Pineda,
K. Chowdhury,
A. Mansouri, and P. Gruss.
1997.
Pax6 is required for differentiation of glucagon-producing -cells in mouse pancreas.
Nature
387:406-409[Medline].
|
| 37. | Sussel, L., J. Kalamaras, O. C. D. J. Hartigan, J. J. Meneses, R. A. Pedersen, J. L. Rubenstein, and M. S. German. 1998. Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development 125:2213-2221[Abstract]. |
| 38. |
Tang, H. K.,
S. Singh, and G. F. Saunders.
1998.
Dissection of the transactivation function of the transcription factor encoded by the eye developmental gene PAX6.
J. Biol. Chem.
273:7210-7221 |
| 39. | Treisman, J., E. Harris, D. Wilson, and C. Desplan. 1992. The homeodomain: a new face for the helix-turn-helix? Bioessays 14:145-150[Medline]. |
| 40. |
Underhill, D. A., and P. Gros.
1997.
The paired-domain regulates DNA binding by the homeodomain within the intact Pax-3 protein.
J. Biol. Chem.
272:14175-14182 |
| 41. |
Wallin, J. J.,
E. R. Gackstetter, and M. E. Koshland.
1998.
Dependence of BSAP repressor and activator functions on BSAP concentration.
Science
279:1961-1964 |
| 42. | Walther, C., J.-L. Guenet, D. Simon, U. Deutsch, B. Jostes, M. D. Goulding, D. Plachov, R. Balling, and P. Gruss. 1991. Pax: a multigene family of paired box-containing genes. Genomics 11:424-434[Medline]. |
| 43. |
Wilson, D.,
G. Sheng,
T. Lecuit,
N. Dostatni, and C. Desplan.
1993.
Cooperative dimerization of paired class homeo domains on DNA.
Genes Dev.
7:2120-2134 |
| 44. | Xu, W., M. A. Rould, S. Jun, C. Desplan, and C. O. Pabo. 1995. Crystal structure of a paired domain-DNA complex at 2.5 Å resolution reveals structural basis for Pax developmental mutations. Cell 80:639-650[Medline]. |
Molecular and Cellular Biology, December 1999, p. 8272-8280, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bailey, M. J., Coon, S. L., Carter, D. A., Humphries, A., Kim, J.-s., Shi, Q., Gaildrat, P., Morin, F., Ganguly, S., Hogenesch, J. B., Weller, J. L., Rath, M. F., Moller, M., Baler, R., Sugden, D., Rangel, Z. G., Munson, P. J., Klein, D. C.
(2009). Night/Day Changes in Pineal Expression of >600 Genes: CENTRAL ROLE OF ADRENERGIC/cAMP SIGNALING. J. Biol. Chem.
284: 7606-7622
[Abstract] [Full Text] -
Rath, M. F., Bailey, M. J., Kim, J.-S., Ho, A. K., Gaildrat, P., Coon, S. L., Moller, M., Klein, D. C.
(2009). Developmental and Diurnal Dynamics of Pax4 Expression in the Mammalian Pineal Gland: Nocturnal Down-Regulation Is Mediated by Adrenergic-Cyclic Adenosine 3',5'-Monophosphate Signaling. Endocrinology
150: 803-811
[Abstract] [Full Text] -
Brun, T., He, K. H. H., Lupi, R., Boehm, B., Wojtusciszyn, A., Sauter, N., Donath, M., Marchetti, P., Maedler, K., Gauthier, B. R.
(2008). The diabetes-linked transcription factor Pax4 is expressed in human pancreatic islets and is activated by mitogens and GLP-1. Hum Mol Genet
17: 478-489
[Abstract] [Full Text] -
Brun, T., Gauthier, B. R
(2008). A focus on the role of Pax4 in mature pancreatic islet {beta}-cell expansion and survival in health and disease. J Mol Endocrinol
40: 37-45
[Abstract] [Full Text] -
Mrowka, R., Steege, A., Kaps, C., Herzel, H., Thiele, B. J., Persson, P. B., Bluthgen, N.
(2007). Dissecting the action of an evolutionary conserved non-coding region on renin promoter activity. Nucleic Acids Res
35: 5120-5129
[Abstract] [Full Text] -
Plengvidhya, N., Kooptiwut, S., Songtawee, N., Doi, A., Furuta, H., Nishi, M., Nanjo, K., Tantibhedhyangkul, W., Boonyasrisawat, W., Yenchitsomanus, P.-t., Doria, A., Banchuin, N.
(2007). PAX4 Mutations in Thais with Maturity Onset Diabetes of the Young. J. Clin. Endocrinol. Metab.
92: 2821-2826
[Abstract] [Full Text] -
Artner, I., Le Lay, J., Hang, Y., Elghazi, L., Schisler, J. C., Henderson, E., Sosa-Pineda, B., Stein, R.
(2006). MafB: An Activator of the Glucagon Gene Expressed in Developing Islet {alpha}- and {beta}-Cells. Diabetes
55: 297-304
[Abstract] [Full Text] -
Collombat, P., Hecksher-Sorensen, J., Broccoli, V., Krull, J., Ponte, I., Mundiger, T., Smith, J., Gruss, P., Serup, P., Mansouri, A.
(2005). The simultaneous loss of Arx and Pax4 genes promotes a somatostatin-producing cell fate specification at the expense of the {alpha}- and {beta}-cell lineages in the mouse endocrine pancreas. Development
132: 2969-2980
[Abstract] [Full Text] -
Mauvais-Jarvis, F., Smith, S. B., May, C. L., Leal, S. M., Gautier, J.-F., Molokhia, M., Riveline, J.-P., Rajan, A. S., Kevorkian, J.-P., Zhang, S., Vexiau, P., German, M. S., Vaisse, C.
(2004). PAX4 gene variations predispose to ketosis-prone diabetes. Hum Mol Genet
13: 3151-3159
[Abstract] [Full Text] -
Collombat, P., Mansouri, A., Hecksher-Sorensen, J., Serup, P., Krull, J., Gradwohl, G., Gruss, P.
(2003). Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev.
17: 2591-2603
[Abstract] [Full Text] -
Smith, S. B., Gasa, R., Watada, H., Wang, J., Griffen, S. C., German, M. S.
(2003). Neurogenin3 and Hepatic Nuclear Factor 1 Cooperate in Activating Pancreatic Expression of Pax4. J. Biol. Chem.
278: 38254-38259
[Abstract] [Full Text] -
Schwitzgebel, V. M., Mamin, A., Brun, T., Ritz-Laser, B., Zaiko, M., Maret, A., Jornayvaz, F. R., Theintz, G. E., Michielin, O., Melloul, D., Philippe, J.
(2003). Agenesis of Human Pancreas due to Decreased Half-Life of Insulin Promoter Factor 1. J. Clin. Endocrinol. Metab.
88: 4398-4406
[Abstract] [Full Text] -
Kahan, B. W., Jacobson, L. M., Hullett, D. A., Ochoada, J. M., Oberley, T. D., Lang, K. M., Odorico, J. S.
(2003). Pancreatic Precursors and Differentiated Islet Cell Types From Murine Embryonic Stem Cells: An In Vitro Model to Study Islet Differentiation. Diabetes
52: 2016-2024
[Abstract] [Full Text] -
Ogihara, T., Watada, H., Kanno, R., Ikeda, F., Nomiyama, T., Tanaka, Y., Nakao, A., German, M. S., Kojima, I., Kawamori, R.
(2003). p38 MAPK Is Involved in Activin A- and Hepatocyte Growth Factor-mediated Expression of Pro-endocrine Gene Neurogenin 3 in AR42J-B13 Cells. J. Biol. Chem.
278: 21693-21700
[Abstract] [Full Text] -
Cao, X., Flock, G., Choi, C., Irwin, D. M., Drucker, D. J.
(2003). Aberrant Regulation of Human Intestinal Proglucagon Gene Expression in the NCI-H716 Cell Line. Endocrinology
144: 2025-2033
[Abstract] [Full Text] -
Heremans, Y., Van De Casteele, M., in't Veld, P., Gradwohl, G., Serup, P., Madsen, O., Pipeleers, D., Heimberg, H.
(2002). Recapitulation of embryonic neuroendocrine differentiation in adult human pancreatic duct cells expressing neurogenin 3. JCB
159: 303-312
[Abstract] [Full Text] -
Flock, G., Drucker, D. J.
(2002). Pax-2 Activates the Proglucagon Gene Promoter But Is Not Essential for Proglucagon Gene Expression or Development of Proglucagon-Producing Cell Lineages in the Murine Pancreas or Intestine. Mol. Endocrinol.
16: 2349-2359
[Abstract] [Full Text] -
Samaras, S. E., Cissell, M. A., Gerrish, K., Wright, C. V. E., Gannon, M., Stein, R.
(2002). Conserved Sequences in a Tissue-Specific Regulatory Region of the pdx-1 Gene Mediate Transcription in Pancreatic {beta} Cells: Role for Hepatocyte Nuclear Factor 3{beta} and Pax6. Mol. Cell. Biol.
22: 4702-4713
[Abstract] [Full Text] -
Chakrabarti, S. K., James, J. C., Mirmira, R. G.
(2002). Quantitative Assessment of Gene Targeting in Vitro and in Vivo by the Pancreatic Transcription Factor, Pdx1. IMPORTANCE OF CHROMATIN STRUCTURE IN DIRECTING PROMOTER BINDING. J. Biol. Chem.
277: 13286-13293
[Abstract] [Full Text] -
Shimajiri, Y., Sanke, T., Furuta, H., Hanabusa, T., Nakagawa, T., Fujitani, Y., Kajimoto, Y., Takasu, N., Nanjo, K.
(2001). A Missense Mutation of Pax4 Gene (R121W) Is Associated With Type 2 Diabetes in Japanese. Diabetes
50: 2864-2869
[Abstract] [Full Text] -
Watada, H., Mirmira, R. G., Kalamaras, J., German, M. S.
(2000). Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins. Proc. Natl. Acad. Sci. USA
97: 9443-9448
[Abstract] [Full Text] -
Mirmira, R. G., Watada, H., German, M. S.
(2000). beta -Cell Differentiation Factor Nkx6.1 Contains Distinct DNA Binding Interference and Transcriptional Repression Domains. J. Biol. Chem.
275: 14743-14751
[Abstract] [Full Text] -
Schwitzgebel, V., Scheel, D., Conners, J., Kalamaras, J, Lee, J., Anderson, D., Sussel, L, Johnson, J., German, M.
(2000). Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development
127: 3533-3542
[Abstract] -
Fujitani, Y., Kajimoto, Y., Yasuda, T., Matsuoka, T.-A., Kaneto, H., Umayahara, Y., Fujita, N., Watada, H., Miyazaki, J.-I., Yamasaki, Y., Hori, M.
(1999). Identification of a Portable Repression Domain and an E1A-Responsive Activation Domain in Pax4: a Possible Role of Pax4 as a Transcriptional Repressor in the Pancreas. Mol. Cell. Biol.
19: 8281-8291
[Abstract] [Full Text] -
Smith, S. B., Watada, H., Scheel, D. W., Mrejen, C., German, M. S.
(2000). Autoregulation and Maturity Onset Diabetes of the Young Transcription Factors Control the Human PAX4 Promoter. J. Biol. Chem.
275: 36910-36919
[Abstract] [Full Text] -
Ritz-Laser, B., Estreicher, A., Gauthier, B., Philippe, J.
(2000). The Paired Homeodomain Transcription Factor Pax-2 Is Expressed in the Endocrine Pancreas and Transactivates the Glucagon Gene Promoter. J. Biol. Chem.
275: 32708-32715
[Abstract] [Full Text] -
Wang, H., Maechler, P., Ritz-Laser, B., Hagenfeldt, K. A., Ishihara, H., Philippe, J., Wollheim, C. B.
(2001). Pdx1 Level Defines Pancreatic Gene Expression Pattern and Cell Lineage Differentiation. J. Biol. Chem.
276: 25279-25286
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»