Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8412-8421, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Nuclear Retention Elements of U3 Small
Nucleolar RNA
Wayne
Speckmann,1
Aarthi
Narayanan,2
Rebecca
Terns,1 and
Michael P.
Terns1,2,*
Department of Biochemistry and Molecular
Biology1 and Department of
Genetics,2 University of Georgia, Athens,
Georgia 30602
Received 26 July 1999/Returned for modification 27 August
1999/Accepted 3 September 1999
 |
ABSTRACT |
The processing and methylation of precursor rRNA is mediated by the
box C/D small nucleolar RNAs (snoRNAs). These snoRNAs differ from most
cellular RNAs in that they are not exported to the cytoplasm. Instead,
these RNAs are actively retained in the nucleus where they assemble
with proteins into mature small nucleolar ribonucleoprotein particles
and are targeted to their intranuclear site of action, the nucleolus.
In this study, we have identified the cis-acting sequences
responsible for the nuclear retention of U3 box C/D snoRNA by analyzing
the nucleocytoplasmic distributions of an extensive panel of U3 RNA
variants after injection of the RNAs into Xenopus oocyte
nuclei. Our data indicate the importance of two conserved sequence
motifs in retaining U3 RNA in the nucleus. The first motif is comprised
of the conserved box C' and box D sequences that characterize the box
C/D family. The second motif contains conserved box sequences B and C. Either motif is sufficient for nuclear retention, but disruption of
both motifs leads to mislocalization of the RNAs to the cytoplasm.
Variant RNAs that are not retained also lack 5' cap hypermethylation
and fail to associate with fibrillarin. Furthermore, our results
indicate that nuclear retention of U3 RNA does not simply reflect its
nucleolar localization. A fragment of U3 containing the box B/C motif
is not localized to nucleoli but retained in coiled bodies. Thus, nuclear retention and nucleolar localization are distinct processes with differing sequence requirements.
| |
INTRODUCTION |
In all eukaryotic cells, there exist
a multitude of RNAs which perform diverse functions at distinct
subcellular locations. Since RNAs function at sites in the cell which
are remote from where they are synthesized, RNA transport and
localization are obligatory steps in gene expression for all eukaryotic
cells. Despite the fundamental importance of RNA transport and
localization, we have a limited understanding of the cellular
mechanisms that ensure that individual RNAs are sorted to the
intracellular destinations where they function.
We are investigating the mechanisms controlling the intracellular
trafficking of small nucleolar RNAs (snoRNAs). snoRNAs consist of a
family of more than 150 molecules that are known to function in the
processing and modification of rRNA within the nucleolus (2, 18,
47, 68, 74). The snoRNAs are categorized almost exclusively into
two classes based on sequence homology, secondary structure, function,
and binding of common proteins. The two major classes of snoRNAs are
known as the box C/D snoRNAs and the box H/ACA snoRNAs (3,
16). In contrast to most other cellular RNAs, newly synthesized
snoRNAs are not exported from the nucleus to the cytoplasm (52,
71, 73). Rather, these RNAs remain in the nucleus and are
selectively targeted from their sites of synthesis within the
nucleoplasm (17, 69) to their intranuclear site of function,
the nucleolus. At least some snoRNAs associate with nucleoplasmic
structures known as coiled bodies (5, 32, 53, 61, 65). Since
the association of snoRNAs with coiled bodies is transient and precedes
localization of these RNAs to nucleoli (53), coiled bodies
likely play a key role in the biogenesis and/or intranuclear transport
of snoRNAs.
U3 snoRNA, the focus of this investigation, is the best characterized
snoRNA and is a member of the box C/D family of snoRNAs. U3 is required
in the nucleolus for several pre-rRNA endonucleolytic cleavage events
that selectively lead to the generation of 18S rRNA, a component of the
small subunit of ribosomes (13, 25, 33, 50, 62).
Phylogenetic analysis of sequences from a wide range of eukaryotic
organisms has revealed that all U3 RNAs contain six short sequence
elements known as boxes A, A', B, C, C', and D (see Fig. 1). Detailed
structural studies and functional mapping of U3 RNAs in diverse
organisms reveal that many features of U3 RNA structure are conserved
(21, 23, 26, 31, 35, 42, 48, 49, 54, 55, 58, 60). A common
two-domain secondary structure exists in which a short 5' domain is
linked to a larger 3' domain via a single-stranded sequence called the
hinge region (see Fig. 1). The 5' domain and hinge region contain
sequences with complementarity to pre-rRNA (within box A, box A', and
the hinge) and act as a pre-rRNA binding domain (6, 7, 24, 49,
64). The 3' domain contains box B, C, C', and D elements, which
serve as conserved protein binding sites (4, 23, 31, 44, 49,
55). Significantly, these four box elements of the 3' domain of
U3 RNA, which are separated in the primary sequence of the RNA, are
consistently assembled together in the folded RNA to form the box B/C
motif and the box C'/D motif (60). In these motifs, box B
and box C, or box C' and box D, are situated on opposite strands of a
loop formed as the result of base-pairing of flanking sequences. The
motif comprised of box C' and box D of U3 is functionally equivalent to
the box C/D motif present in all other members of the box C/D family
(49, 53, 60). In contrast, the box B/C motif appears to be a
unique structural feature of U3 RNA.
The biogenesis and intracellular transport of U3 RNA have been
investigated. The 7-methylguanosine (m7G) 5' cap structure
of newly synthesized U3 RNA is hypermethylated to a
2,2,7-trimethylguanosine (m2,2,7G) cap structure by a
nuclear methyl transferase (71, 73). Cellular U3 RNA is
complexed with several proteins and is found in 12S to 15S and ~80S
ribonucleoprotein particles (RNPs) which likely correspond to free U3
snoRNPs and U3 snoRNPs associated with pre-rRNA and other nucleolar
components, respectively (14, 34, 76). Like all box C/D
snoRNAs, U3 associates with three nucleolar proteins known as
fibrillarin, Nop56, and Nop58 (4, 37, 41, 63, 78).
Additional proteins including p55, p50, p15, Sof1, mpp10, nucleolin,
Imp3p, Imp4p, and LCP5 appear to selectively associate with U3 RNA
(12, 19, 29, 43, 44, 57, 77). cis-acting
sequences required for the nucleolar localization of U3, and other box
C/D snoRNAs, have been studied in Xenopus oocytes, mammalian
cells, and yeast (38-40, 53, 61). We have found that the
box C'/D motif of U3 RNA, including box C', box D, and a nearby
3'-terminal stem structure, is both necessary and sufficient for the
nucleolar localization of U3 RNA (53). Studies with other
box C/D snoRNAs support the idea that nucleolar localization of all box
C/D snoRNAs is dependent upon the box C/D motif (53, 61).
The mechanism which selectively retains U3 and other snoRNAs within the
nucleus has not been extensively characterized. In vivo competition
studies performed with Xenopus oocytes have shown that U3
and other box C/D snoRNAs are actively retained in the nucleus by a
mechanism which is saturable (73). These studies indicate
that snoRNAs are normally prevented from leaving the nucleus because
they bind titratable specific RNA binding factors. In the study
presented here, we have carried out a detailed mutational analysis of
U3 RNA to determine the cis-acting sequences required for
nuclear retention of U3 RNA. We have defined the sequences that are
necessary and sufficient for the retention of U3 within the nucleus by
assaying the nucleocytoplasmic distribution of a large panel of U3 RNA
variants following injection into the nucleus. Our results show that
the box B/C motif and the box C'/D motif each retain U3 in the nucleus.
Furthermore, these two motifs appear to mediate the nuclear retention
of U3 RNA through distinct mechanisms.
| |
MATERIALS AND METHODS |
Generation of U3 mutant constructs.
Most mutant constructs
contained block substitution mutations in which all nucleotides in a
conserved box element were replaced as described previously (see Fig.
1) (53). Single box variants of U3 as well as the U3 3'
domain fragment were generated by PCR approaches which are described
elsewhere (53). The production of U3 double box variants was
accomplished by similar PCR strategies utilizing single box mutant
templates to produce the desired double mutation. The construction of
the B/C subfragment (nucleotides 93 to 208) was also accomplished by
PCR with a wild-type U3 template and primers 2 plus 3 (see below). The
U3 subfragment C'/D (nucleotides 1 to 6, 75 to 104, a GCUU tetraloop,
and 198 to 220) was constructed with primer 4 as a template and primers
5 plus 6. The U3 5' deletion mutant was produced with a wild-type U3
template and primers 1 plus 7. All U3 mutant DNA fragments produced
were subcloned into the SmaI site of pUC19 and sequenced.
All PCRs were performed with Pfu DNA polymerase (Stratagene)
as the enzyme and an annealing temperature of 52°C. The
deoxyoligonucleotide primers used to prepare the mutated
Xenopus U3 templates are as follows, with SP6 or T7 promoter
sequences underlined: 1, ACCACTCAGCCTGTGTTCTCTCCCTCC; 2, GATTTAGGTGACACTATAGAGTGTTCTCTCCTGAGCG; 3, GTGTTCTCTCCCTCCATCTCC; 4, TAATACGACTCACTATAGGGAAGACTACCACGAGGAAGAGCGTCAGTGTTCTCTCCTTCGGGAGAGAACACAGGCTGAGTGGT; 5, CACGGATCCTAATACGACTCACTATAGGG; 6, ACCACTCAGCCTGTGTTC; 7, GATTTAGGTGACACTATAGATACTTTCAGGGATCA.
In vitro transcription.
Linearized plasmids or PCR products
were utilized as transcription templates. The reaction conditions used
to generate m7G-capped, 32P-labeled RNAs by SP6
or T7 RNA polymerase were carried out essentially as previously
described (72). Fluorescein-labeled U3 variants were
generated by in vitro transcription with an equal mixture (250 µM
each) of UTP and fluorescein-12-UTP (Boehringer Mannheim) as described
elsewhere (53). Control RNAs, as follows, were prepared by
in vitro transcription as previously described: Xenopus U8
(56), Xenopus U1, U1sm
, and U6 (72).
Injection of RNAs into Xenopus oocytes.
A
detailed description of the procedure by which we microinjected and
micromanipulated oocytes has been reported previously (53,
70). In brief, the nuclei of stage V and VI Xenopus
laevis oocytes were injected with 10 nl of a 20-mg/ml blue dextran
solution which contained 1 fmol of each 32P-labeled RNA
(fluorescein-labeled RNA experiments were done with 5 fmol of RNA/10
nl). After injection, oocytes were maintained in MBSH buffer at 18°C
until being manually dissected in J buffer (8) into nuclear
and cytoplasmic fractions. The RNAs were isolated from two to four
dissected nuclear and cytoplasmic fractions by proteinase K digestion,
phenol extraction, and ethanol precipitation. One nuclear or one
cytoplasmic equivalent was then resolved on an 8% denaturing
polyacrylamide gel and detected by autoradiography.
Cytoplasmic injections were accomplished with 10 nl of solution
containing 1 fmol of each 32P-labeled RNA. The
injections were done at the equator between the animal and vegetal
poles of the oocyte. Isolation of the RNAs after injection was
performed as described above.
Immunoprecipitations.
Polyclonal antibodies directed against
either the m7G (51) or m2,2,7G
(10) cap and a monoclonal antibody (72B9) directed against fibrillarin (59) were utilized as previously described
(53), except that Net-2 buffer (150 mM NaCl, 50 mM Tris HCl
[pH 7.5], and 0.05% NP-40) was used for fibrillarin immunoprecipitations.
Nuclear spreads, immunofluorescence, and microscopy.
Preparation of nuclear spreads and image collection were performed as
previously described (53). Indirect immunofluorescence with
an antibody against p80 coilin was performed as previously described
(53).
| |
RESULTS |
Nuclear retention of U3 snoRNA is mediated by both the box B/C and
box C'/D motifs.
U3 RNA injected into Xenopus oocyte
nuclei was previously shown to be stable and retained within the
nucleus (71, 73). To identify the cis-acting
sequences within U3 RNA necessary for its nuclear retention, we
injected an extensive panel of U3 RNA sequence variants into
Xenopus oocyte nuclei. In these experiments, we hoped to
identify nuclear retention elements as sequences within U3 RNA that
when disrupted by mutation would lead to mislocalization of U3 RNA from
the nucleus to the cytoplasm.
To test the idea that one of the phylogenetically conserved box
elements of U3 was required for nuclear retention, we introduced
block
substitution mutations into the A, A', B, C, C', and D box
elements. In
each case, every nucleotide in the box element was
replaced by its
Watson-Crick complement (Fig.
1) (see
Materials
and Methods). Similar base substitutions were introduced into
the hinge region of U3 RNA (Fig.
1). Although the hinge region
is not
conserved in primary sequence, it plays an important functional
role in
rRNA processing (
6,
49). In addition, the first six
nucleotides of U3 were deleted to determine if this single-stranded
5'
leader sequence was essential for nuclear retention.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Predicted secondary structure of the U3 snoRNA. The
220-nucleotide sequence of X. laevis U3 snoRNA is shown. The
boxed nucleotides are phylogenetically conserved sequences. The hinge
region connects the 5' and 3' domains of U3 and is marked by a square
bracket. The general regions of the C'/D and B/C motifs are shown with
dashed lines. The table lists the block substitution changes (indicated
as  ) made in the U3 mutants used in this study.
|
|
32P-labeled, m
7G-capped U3 RNA variants were
synthesized by in vitro transcription and coinjected into oocyte nuclei
with U1sm
,
U8, and U6 control RNAs. The control RNAs were utilized to
show
that cellular transport was functioning (U1sm
is exported to
the
cytoplasm) and that the nuclear injections and dissections
were precise
(U6 and U8 RNAs are normally retained in the nucleus).
The use of U8,
which is also a member of the box C/D family of
snoRNAs, allowed us to
determine if changes observed with U3 variants
were specific to those
molecules and not due to a global affect
on box C/D snoRNA family
members. After injection, the oocytes
were manually dissected into
nuclear and cytoplasmic fractions
at specific times after injection (1, 4, and 8 h). The RNAs in
each fraction were purified and analyzed
by electrophoresis on
denaturing polyacrylamide gels, followed by
autoradiography.
We found that all of the single box substitution mutants, the 5'
deletion mutant, and the hinge mutant were retained in the
oocyte
nucleus at all time points analyzed, like wild-type U3
RNA (Fig.
2 and Table
1). The control RNAs were exported
(U1sm
)
or retained (U6 and U8) as expected in every experiment, and
all
U3 RNA variants were sufficiently stable to allow analysis (Fig.
2
and data not shown). Thus, none of the tested sequence elements
is
individually essential for retention of U3 in the nucleus.
These
results suggest that the nuclear retention of U3 is not
dependent upon
any single, dominantly acting nuclear retention
element.
View larger version (60K):
[in this window]
[in a new window]
|
FIG. 2.
Nuclear retention of wild-type U3 and single box mutants
of U3. 32P-labeled U3, U3 variant, U1sm, U8, and U6 RNAs
were synthesized by in vitro transcription. A mixture of U3 or a U3
mutant and control RNAs (U1sm, U8, and U6) was injected into the
nuclei of X. laevis oocytes. After 1, 4, and 8 h, the
radiolabeled RNAs present in the nuclear (N) and cytoplasmic (C)
fractions of the oocytes were isolated and analyzed by electrophoresis
in a denaturing polyacrylamide gel. Autoradiography shows the
nucleocytoplasmic distribution of the RNAs after incubation. Marker
lanes (M) show the RNAs prior to injection.
|
|
The finding that mutation of no single element affected nuclear
retention of U3 prompted us to analyze double mutants in which
combinations of two conserved elements were altered (Fig.
3).
The majority of the double mutants
were retained in the oocyte
nucleus (Fig.
3A and Table
1). In contrast,
a loss of nuclear
retention was observed with a specific subset of U3
double mutants
(
C'B,
C'C,
BD, and
CD [Fig.
3B and Table
1]). These double
mutants accumulated in the cytoplasm in a
time-dependent manner
following nuclear injection and were exported out
of the nucleus
at a rate comparable to that of U1sm
RNA (Fig.
3B).
Eight hours
following injection, essentially all of the mutant U3 RNAs
were
present in the cytoplasm.
View larger version (107K):
[in this window]
[in a new window]
|
FIG. 3.
Nucleocytoplasmic distribution of U3 double box
variants. RNAs were prepared, injected, and analyzed as described in
the legend to Fig. 2. Nuclear (N) and cytoplasmic (C) distribution of
RNAs at 1, 4, and 8 h after nuclear injection are shown. Marker
lanes (M) show the RNAs prior to injection. (A) Double box variants of
U3 that are retained in the nucleus. (B) The four double box variants
that are not retained in the nucleus.
|
|
Loss of nuclear retention was observed only with those double mutants
involving elements confined to the 3' domain of U3 (boxes
B, C, C', and
D [Fig.
1]). Furthermore, only particular combinations
of the double
mutations in the 3' domain box elements disrupted
nuclear retention.
The results indicate that both the box B/C
and box C'/D motifs are
important for nuclear retention and that
each motif is independently
capable of supporting the nuclear
retention of U3 RNA. Nuclear
retention was not disrupted when
both sequence elements of either the
box B/C or the box C'/D motif
were mutated (
BC and
C'D,
respectively [Fig.
3A]). However,
simultaneous mutation of one box
element from each motif (i.e.,
C'B,
C'C,
BD, and
CD)
results in loss of nuclear retention
of that molecule (Fig.
3B). The
results indicate that box B and
box C, as well as box C' and box D,
function as pairs and that
the structurally conserved (see the
introduction) box B/C and
box C'/D motifs function separately to retain
U3 RNA in the
nucleus.
U3 RNA variants are stable and remain in the cytoplasm following
injection into the cytoplasm.
While wild-type U3 RNA is normally
retained within the nucleus (71, 73), control experiments
were performed to test for nuclear import of the U3 variants upon
direct injection of the RNAs into the cytoplasmic compartment (Fig.
4). RNA mixtures containing U3, or a U3
variant, and control RNAs (U1 and U8) were injected into the cytoplasm
of Xenopus oocytes. The nucleocytoplasmic distributions of
the RNAs were determined at 1, 4, and 8 h after injection. Neither
the wild-type U3 or U8 RNAs nor any of the variant U3 RNAs exhibited
any significant import to the nucleus after 8 and even 24 h (Fig.
4 and data not shown). Importantly, the coinjected U1 control RNA was
imported into the nucleus in a time-dependent manner, as expected (Fig.
4). The same results were observed multiple times with oocytes from
many different frogs. Furthermore, the variant U3 RNAs were stable in
the cytoplasm (Fig. 4 and data not shown). Since the RNAs are stable
and not imported from the cytoplasm, any U3 variant RNA exported from
the nucleus should have been observed in the cytoplasm. These control
experiments indicate that the variant U3 RNAs that appeared to be
retained were retained in the nucleus, not exported and rapidly
reimported. Finally, any decrease in stability of any of the variant U3
RNAs relative to the wild type (e.g., D [Fig. 2] and C'D [Fig.
3]) was due to degradation within the nucleus, not degradation in the
cytoplasm following export.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
Absence of detectable nuclear import of U3, U3 mutants,
or U8 following injection into oocyte cytoplasms. Mixtures of U3 or a
U3 variant and control RNAs (U1 and U8) were injected into the
cytoplasm of Xenopus oocytes. After 1, 4, and 8 h, the
nuclear and cytoplasmic distributions of RNAs were determined as
described for the previous figures. The nucleocytoplasmic distributions
of U3 and each of several U3 mutants are shown. One example each of the
typical nucleocytoplasmic distributions of U1 and U8 from these
experiments are also shown.
|
|
Export of U3 RNA variants is affected by temperature and the 5' cap
structure.
For those U3 RNA variants that failed to be retained in
the nucleus, we sought to better understand the mechanism by which they
were transported out of the nucleus (Fig.
5). Low temperatures generally inhibit
active, energy-dependent transport processes in cells. To determine if
the nuclear export of the U3 variants is a temperature-dependent
process, we examined the nucleocytoplasmic distribution of the injected
RNAs at reduced temperatures (Fig. 5A). We injected a variant U3 RNA
that failed to be retained (BD) and control RNAs into oocytes that
were preincubated and maintained at 4°C or at the normal temperature
of 18°C. Incubation at 4°C resulted in a dramatic reduction in the
nuclear export of BD and U1sm RNAs relative to incubation at
18°C. Thus, nuclear export of the U3 mutants is a
temperature-dependent process.
View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Temperature and cap dependence of nuclear export of U3
mutants. (A) 32P-labeled U3BD and control RNAs (U1sm
and U8) were injected into the nuclei of Xenopus oocytes.
The oocytes were incubated for 8 h at 4 or 18°C. After
incubation, the radiolabeled RNAs present in the nuclear (N) and
cytoplasmic (C) fractions of the oocytes were isolated and analyzed.
(B) 32P-labeled U3BD with either an m7G or
ApppG cap structure and control RNAs (U1sm and U8) were injected into
the nucleus. After 8 h of incubation, the radiolabeled RNAs
present in the nuclear and cytoplasmic fractions of the oocytes were
isolated and analyzed. Marker lanes (M) show the RNAs prior to
injection.
|
|
Another indication that the U3 RNA variants do not simply passively
diffuse out of the nucleus was the finding that the export
rate of the
RNA is influenced by the 5' cap structure. It is known
that an
m
7G cap structure is an important determinant for RNA
export (
22,
27,
28,
72). We tested the effect of the
m
7G cap structure of U3 on the rate of export of mutant U3
snoRNAs
that failed to be retained by examining the transport of
ApppG-capped
U3
BD. The U3
BD variant RNA with the ApppG cap
structure was
exported from the nucleus but at a reduced rate relative
to the
m
7G-capped RNA (Fig.
5B and data not shown). Thus,
as has been observed
for other RNAs (
22,
72), the
m
7G cap enhances the rate of export of the U3 RNA variant
but it
is not essential for the
transport.
Variant U3 RNAs that fail to be retained in the nucleus also fail
to associate with fibrillarin and to undergo 5' cap
hypermethylation.
Like all members of the box C/D family of
snoRNAs, U3 RNA associates with the nucleolar protein fibrillarin
(4). In addition, U3 snoRNA is synthesized with an
m7G cap which is hypermethylated within the nucleus to an
m2,2,7G cap structure (71, 73). We tested
whether the variant U3 RNAs that failed to be retained in the nucleus
were able to associate with fibrillarin and to undergo 5' cap
hypermethylation prior to exiting the nucleus (Fig.
6).
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 6.
Exported U3 mutants fail to bind fibrillarin and fail to
undergo 5' cap hypermethylation. (A) Immunoprecipitations with
antifibrillarin antibodies (72B9) were performed on nuclear extracts
prepared 3 h after injection of RNAs into oocyte nuclei. RNAs
present in the precipitate (P) and 20% of the supernatant (S) were
analyzed by gel electrophoresis followed by autoradiography. (B) The
RNAs present in the nucleus 3 h after injection were precipitated
with anti-m7G or anti-m2,2,7G cap
(m3G) antibodies, as indicated. RNAs present in the
precipitates are shown in the top panel, and those in the supernatants
are shown in the bottom panel.
|
|
To determine if the U3 RNA variants associated with fibrillarin, we
assayed whether these RNAs could be coimmunoprecipitated
by using a
monoclonal antibody (72B9) against fibrillarin (
59)
(Fig.
6A). Radiolabeled RNAs were injected into oocyte nuclei,
and nuclear
extracts were prepared 3 h after injection (when approximately
50% of exported variant U3 RNA was still present in the nucleus).
As
expected, the box C/D snoRNAs, U3 and U8, were coimmunoprecipitated
by
the antifibrillarin antibodies while U1 and U6 were not (Fig.
6A). Each
of the U3 variants that exhibited a loss of nuclear
retention (
C'B,
C'C,
BD, and
CD) failed to be coimmunoprecipitated
(Fig.
6A),
indicating that these RNAs had lost the ability to
associate with the
common box C/D snoRNA binding protein
fibrillarin.
To test for 5' cap hypermethylation of the variant U3 RNAs, nuclear
RNAs were isolated 3 h after injection and subsequently
immunoprecipitated with antibodies that specifically recognize
either
the m
7G cap (
51) or the m
2,2,7G cap
(
10) (Fig.
6B). Each experiment included the use of
coinjected
control RNAs U1sm
, U8, and U6. As expected, the
hypermethylation-defective
U1sm
RNA was recognized only by the
m
7G antibody (
46,
72), and U6 snRNA was not
recognized by either
antibody since it has a methyl-pppG cap structure
(
67). The
m
7G cap of wild-type U3 snoRNA showed
extensive hypermethylation
following a 3-h nuclear incubation. However,
the U3 RNA variants
that are not retained were not appreciably
hypermethylated. Importantly,
coinjected m
7G-capped
U8 RNA was hypermethylated in every experiment. In summary,
our
results show that the U3 RNA variants that have lost the ability
to be
retained in the nucleus are not hypermethylated and do not
associate
with the snoRNA binding protein
fibrillarin.
Both the box B/C motif and the box C'/D motif are sufficient for
nuclear retention of U3 RNA fragments, but the RNAs localize to
different intranuclear structures.
To further characterize the
sequence elements responsible for nuclear retention, we tested
fragments of U3 RNA for the ability to remain in the nucleus following
nuclear injection (Fig. 7). Deletion of
the entire 5' domain and hinge region (nucleotides 1 to 75) did not
affect the ability of the RNA to be retained in the nucleus (Fig. 7A),
indicating that the 3' domain of U3 RNA is sufficient for retention in
the nucleus. Our mutational analysis indicated that both the box B/C
and box C'/D motifs in the 3' domain functioned in nuclear retention
(Fig. 3 and Table 1). Subfragments of the 3' domain were then tested to
determine if the box B/C motif and/or the box C'/D motif were
sufficient for nuclear retention. A fragment consisting of box B, box
C, and the flanking stem regions was retained within the nucleus (Fig.
7B). This RNA underwent 3' trimming in the oocyte to produce a smaller,
stable RNA species that can be observed as a faster-migrating RNA (Fig.
7B) with an intact 5' end, as assayed by immunoprecipitation with
m7G cap antibodies (data not shown). A fragment containing
box C', box D, and flanking stems demonstrated reduced stability over time but was retained within the nucleus (Fig. 7C). As described for
other variant U3 RNAs (Fig. 4), these subfragments were stable and
remained in the cytoplasm when injected into the cytoplasm (data not
shown). Thus, the box B/C motif and the box C'/D motif are each
sufficient for nuclear retention.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 7.
Fragments of U3 that are sufficient for nuclear
retention are not all localized to nucleoli. The diagrams on the left
represent the RNA fragments injected (see Materials and Methods for
sequences). The nucleocytoplasmic distributions of the 3' domain
fragment (A), the B/C subfragment (B), and the C'/D subfragment (C) are
shown next to the corresponding diagrams. The adjacent panels on the
right show nuclear spreads prepared 4 h after injection of
fluorescein-labeled 3' domain fragment (D), B/C subfragment (E), and
C'/D subfragment (F) RNAs. Each set of three images includes
differential interference contrast (DIC), the fluorescein-labeled RNAs
(RNA), and indirect immunofluorescence with antibody H1 directed
against the coiled-body marker protein p80 coilin (75a) from
the same field. The arrow in each DIC image points to a representative
nucleolus.
|
|
We also examined the localization of the U3 fragments within the
nucleus. We assayed the localization of injected, fluorescently
labeled
RNAs in
Xenopus oocyte nuclear spreads (Fig.
7). Briefly,
this technique involves centrifuging the contents of manually
isolated
oocyte nuclei onto microscope slides and determining
the localizations
of the fluorescent RNAs relative to nuclear
structures such as
nucleoli, chromosomes, and coiled bodies by
fluorescence and light
microscopy. We have shown previously that
labeling of U3 RNA with
fluorescein does not affect properties
of the RNA, including cap
hypermethylation, fibrillarin binding,
nuclear retention, or nucleolar
localization (
52,
53). We
also found that U3 RNA (and other
box C/D snoRNAs) transiently
localizes to coiled bodies prior to
nucleoli (
53). Coiled bodies
are conserved nuclear
structures of uncertain function (
15,
45) that can be
readily identified with antibodies against the
coiled-body marker
protein, p80 coilin (
1) (Fig.
7D to
F).
The 3' domain fragment of U3 and the subfragment containing the box
C'/D motif were both targeted specifically to nucleoli
(Fig.
7D and F,
respectively). Their transport to nucleoli is
preceded by localization
to coiled bodies at early time points
(15 min [data not shown]), as
we observed previously for full
length U3 (
53). In contrast,
the subfragment containing the
box B/C motif fails to localize to
nucleoli but is clearly retained
in coiled bodies (Fig.
7E).
Full-length U3 RNAs in which the box
C'/D motif is disrupted but the
box B/C motif remains intact (
C'
or
D) are also retained in the
nucleus (Fig.
3A) and not targeted
to nucleoli but retained in coiled
bodies (
53). These results
demonstrate that nucleolar
localization is not necessary for nuclear
retention of U3
RNA.
| |
DISCUSSION |
We have found that U3 snoRNA contains two independent structural
motifs that each contribute to nuclear retention of the molecule (see
Fig. 8). Both the box B/C motif and the box C'/D motif are capable of
retaining U3 RNA within the nucleus; disruption of one motif does not
prevent nuclear retention by the other (Fig. 3A). Furthermore, U3 RNA
fragments consisting of either motif are sufficient for nuclear
retention (Fig. 7). However, disruption of both motifs results in loss
of the RNA from the nucleus (Fig. 3B). The entire 5' domain and hinge
region of U3, although required for U3 interaction with pre-rRNA
(6, 24, 49), is dispensable for nuclear retention of the
molecule (Fig. 2 and 7 and Table 1).
While either the box B/C motif or the box C'/D motif can function to
retain U3 RNA in the nucleus, each retention motif may mediate nuclear
retention via a distinct mechanism. The box C'/D motif of U3 RNA has
been shown to be both necessary and sufficient for nucleolar
localization of the RNA (53); the box B/C motif is neither
necessary (53) nor sufficient (Fig. 7) for nucleolar targeting. Nuclear retention may be accomplished by sequestering RNA in
the nucleolus in the case of the box C'/D motif, but the box B/C motif
retains RNA within the nucleus without targeting it to the nucleolus
(Fig. 8). Interestingly, the box B/C (and the box C'/D) subfragment associates with coiled bodies (Fig. 7E),
suggesting that coiled bodies may be important for retention. On the
other hand, the U3 variants that are not retained (e.g., C'B,
C'C, BD, and CD) also transiently associate with coiled bodies
prior to export (our unpublished data), indicating that association
with coiled bodies is not sufficient for nuclear retention.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Model of U3 snoRNA depicting the positions and roles of
the box B/C and box C'/D motifs in nuclear retention and nucleolar
localization.
|
|
Our finding that U3 RNA contains two nuclear retention motifs, one
specific to U3 (B/C) and the other shared among box C/D snoRNA family
members (C'/D), sheds new light on results obtained in previous studies
aimed at understanding the nuclear retention of U3 RNA. Previous
studies with Xenopus oocytes revealed that box D was
essential for nuclear retention of U8 snoRNA but not for U3
(73). It is clear from the present study that box D also functions in the retention of U3 RNA in the nucleus but that mutation of box D is insufficient to disrupt nuclear retention because the box
B/C nuclear retention motif remains functional. Furthermore, previous
in vivo competition experiments showed that high levels of U3 RNA
effectively compete for nuclear retention of both the U3 and U8
snoRNAs. In contrast, U8 RNA was an effective competitor for its
own retention but was not able to compete for the nuclear retention of
U3 RNA (73). Taken together with the results of this study,
these observations indicate that nuclear retention of U3 RNA depends
upon binding of both trans-acting factors that are common to
U3 and U8 snoRNAs (at the box C/D motif) and factors specific to U3 RNA
(at the box B/C motif). Thus, the box C/D motif is very likely of
general importance for the nuclear retention (and nucleolar
localization) of all box C/D snoRNA family members. It will be
interesting to determine whether the related box C'/D' motif, found in
addition to the box C/D motif in the majority of box C/D snoRNAs other
than U3 and U8 (36), also functions as a nuclear retention
signal. There is evidence that redundant nuclear retention signals may
also exist in the spliceosomal snRNA U6 (9).
We observed a correlation between the loss of nuclear retention of four
variants of U3 RNA and an inability to undergo normal 5' cap
hypermethylation and to bind fibrillarin (Fig. 6). However, several
observations indicate that neither cap hypermethylation nor fibrillarin
binding alone mediate nuclear retention of U3 RNA. For example, it was
previously demonstrated that U3 RNA remains in the nucleus irrespective
of the nature of its 5' cap structure (73). Furthermore,
mutation of the box D element of U3 prevents hypermethylation but does
not affect nuclear retention (73) (Fig. 2). Also, mutant U3
RNAs that fail to interact with fibrillarin (4) are
nevertheless retained within the nucleus (C [Fig. 2]). Finally,
genetic depletion of fibrillarin in yeast cells does not prevent
nucleolar localization of snoRNAs, including U3 (75). It is
possible that hypermethylation and fibrillarin binding together mediate
the retention of U3 or that the failure of these U3 RNA variants to be
hypermethylated and to bind fibrillarin is a secondary defect.
The box B/C and the box C'/D motif are likely highly conserved among U3
RNAs from diverse organisms despite functional redundancy in nuclear
retention because the motifs provide other, nonredundant functions. The
box C'/D motif but not the box B/C motif is required for the stability,
hypermethylation, and nucleolar localization of U3 (49, 53, 60,
73). Furthermore, both motifs are important for the function of
U3 in rRNA processing (49, 60). The box C'/D motif likely
binds common box C/D family snoRNA binding proteins (see above) such as
Nop56 and Nop58 (37, 78). Several proteins that appear to
selectively associate with U3 snoRNA have been identified, and among
these may be box B/C motif binding factors. We have found that the
U3-specific protein p55 (44, 57) specifically interacts with
sequence elements in the box B/C motif of U3 in vivo (44a),
suggesting that p55 may play a role in nuclear retention of U3 snoRNA.
While U3 RNA is normally not exported to the cytoplasm in oocytes or
somatic cells (11, 71, 73), it has been reported that a
fraction of U3 RNA may leave the nucleus during serum starvation in
certain cell types (20, 66). It was of interest to
characterize the manner in which the exported mutant U3 RNAs left the
nucleus. Several lines of evidence lead us to suggest that upon
disruption of nuclear retention, the U3 variants access a cellular
export pathway that normally exists to transport spliceosomal snRNAs. First, the export of both the mutant U3 RNAs and snRNAs is temperature dependent, indicating an active rather than passive transport process
(Fig. 5A). Second, different classes of RNAs are transported from the
oocyte nucleus with distinct kinetics (30, 72), and the rate
at which the variant U3 RNAs were exported was nearly identical to that
of the control U1 snRNA (Fig. 3B and 5A and data not shown). Finally,
as has been observed with U1 snRNA (72), replacement of the
5' m7G cap with the nonphysiological cap structure ApppG
greatly reduces the rate of variant U3 RNA export (Fig. 5B). The
presence of U3 in the cytoplasm under special circumstances raises the
interesting possibility that nuclear retention of U3 RNA may be a
regulated process. Altering the functional pool of U3 RNAs within the
nucleus may provide a way to regulate ribosome production in response to extracellular signals.
| |
ACKNOWLEDGMENTS |
We kindly thank Reinhard Lührmann (m2,2,7G
cap), Elsebet Lund (m7G cap), Joseph Gall (p80 coilin
monoclonal antibody H1), and Michael Pollard and Eng Tan (fibrillarin
monoclonal antibody 72B9) for providing antibodies used in this study.
We are grateful to Claiborne V. C. Glover III and members of our
laboratory for critical reading of the manuscript and to James
Griffith, Thomas Eades, and Ellie Kalwerisky for assistance in
generating many of the mutant templates used in this work.
This work was supported in part by a Basil O'Conner Starter Scholar
Research Award from the March of Dimes Birth Defects Foundation and by
a grant from the National Institutes of Health (GM54682) to M.P.T.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, University of Georgia, Life
Sciences Building, Athens, GA 30602. Phone: (706) 542-1896. Fax: (706) 542-1752. E-mail: mterns{at}bchiris.bmb.uga.edu.
| |
REFERENCES |
| 1.
|
Andrade, L.,
E. Chan,
I. Raska,
C. Peebles,
G. Roos, and E. Tan.
1991.
Human autoantibody to a novel protein of the nuclear coiled body: immunological characterization and cDNA cloning of p80-coilin.
J. Exp. Med.
173:1407-1419[Abstract/Free Full Text].
|
| 2.
|
Bachellerie, J.,
B. Michot,
M. Nicoloso,
A. Balakin,
J. Ni, and M. Fournier.
1995.
Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA.
Trends Biochem. Sci.
20:261-264[Medline].
|
| 3.
|
Balakin, A.,
L. Smith, and M. Fournier.
1996.
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Cell
86:823-834[Medline].
|
| 4.
|
Baserga, S. J.,
X. D. Yang, and J. A. Steitz.
1991.
An intact Box C sequence in the U3 snRNA is required for binding of fibrillarin, the protein common to the major family of nucleolar snRNPs.
EMBO J.
10:2645-2651[Medline].
|
| 5.
|
Bauer, D.,
C. Murphy,
Z. Wu,
C. Wu, and J. Gall.
1994.
In vitro assembly of coiled bodies in Xenopus egg extract.
Mol. Biol. Cell
5:633-644[Abstract].
|
| 6.
|
Beltrame, M., and D. Tollervey.
1995.
Base pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis.
EMBO J.
14:4350-4356[Medline].
|
| 7.
|
Beltrame, M., and D. Tollervey.
1994.
Mutational analysis of an essential binding site for the U3 snoRNA in the 5' external transcribed spacer of yeast pre-rRNA.
Nucleic Acids Res.
22:5139-5147[Abstract/Free Full Text].
|
| 8.
|
Birkenmeier, E. H.,
D. D. Brown, and E. Jordan.
1978.
A nuclear extract of Xenopus laevis oocytes that accurately transcribes 5S RNA genes.
Cell
15:1077-1086[Medline].
|
| 9.
|
Boelens, W. C.,
I. Palacios, and I. W. Mattaj.
1995.
Nuclear retention of RNA as a mechanism for localization.
RNA
1:273-283[Abstract].
|
| 10.
|
Bringmann, P.,
J. Rinke,
B. Appel,
R. Reuter, and R. Luhrmann.
1983.
Purification of snRNPs U1, U2, U4, U5, and U6 with 2,2,7-trimethylguanosine-specific antibody and definition of their constituent proteins reacting with anti-Sm and anti-(U1) RNP antisera.
EMBO J.
2:1129-1135[Medline].
|
| 11.
|
Cheng, Y.,
J. E. Dahlberg, and E. Lund.
1995.
Diverse effects of the guanine nucleotide exchange factor RCC1 on RNA transport.
Science
267:1807-1810[Abstract/Free Full Text].
|
| 12.
|
Dunbar, D.,
S. Wormsley,
T. Agentis, and S. Baserga.
1997.
Mpp10p, a U3 small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast.
Mol. Cell. Biol.
17:5803-5812[Abstract].
|
| 13.
|
Enright, C.,
E. Maxwell, and B. Sollner-Webb.
1996.
5'ETS rRNA processing facilitated by four small RNAs: U14, E3, U17, and U3.
RNA
2:1094-1099[Abstract].
|
| 14.
|
Epstein, P.,
R. Reddy, and H. Busch.
1984.
Multiple states of U3 RNA in Novikoff hepatoma nucleoli.
Biochemistry
23:5421-5425[Medline].
|
| 15.
|
Gall, J.,
A. Tsvetkov,
Z. Wu, and C. Murphy.
1995.
Is the sphere organelle/coiled body a universal nuclear component?
Dev. Genet.
16:25-35[Medline].
|
| 16.
|
Ganot, P.,
F. M. Caizergues, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 17.
|
Gao, L.,
M. Frey, and A. Matera.
1997.
Human genes encoding U3 snRNA associate with coiled bodies in interphase cells and are clustered on chromosome 17p11.2 in a complex inverted repeat structure.
Nucleic Acids Res.
25:4740-4747[Abstract/Free Full Text].
|
| 18.
|
Gerbi, S.
1995.
Small nucleolar RNA.
Biochem. Cell Biol.
73:845-858[Medline].
|
| 19.
|
Ginisty, H.,
F. Amalric, and P. Bouvet.
1998.
Nucleolin functions in the first step of ribosomal RNA processing.
EMBO J.
17:1476-1486[Medline].
|
| 20.
|
Glibetic, M.,
D. E. Larson,
N. Sienna,
J. P. Bachellerie, and B. H. Sells.
1992.
Regulation of U3 snRNA expression during myoblast differentiation.
Exp. Cell Res.
202:183-189[Medline].
|
| 21.
|
Greenwood, S. J.,
M. N. Schnare, and M. W. Gray.
1996.
Molecular characterization of U3 small nucleolar RNA from the early diverging protist, Euglena gracilis.
Curr. Genet.
30:338-346[Medline].
|
| 22.
|
Hamm, J., and I. W. Mattaj.
1990.
Monomethylated cap structures facilitate RNA export from the nucleus.
Cell
63:109-118[Medline].
|
| 23.
|
Hartshorne, T., and N. Agabian.
1994.
A common core structure for U3 small nucleolar RNAs.
Nucleic Acids Res.
22:3354-3364[Abstract/Free Full Text].
|
| 24.
|
Hughes, J.
1996.
Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.
J. Mol. Biol.
259:645-654[Medline].
|
| 25.
|
Hughes, J., and M. J. Ares.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 26.
|
Hughes, J. M.,
D. A. Konings, and G. Cesareni.
1987.
The yeast homologue of U3 snRNA.
EMBO J.
6:2145-2155[Medline].
|
| 27.
|
Izaurralde, E.,
C. McGuigan, and I. W. Mattaj.
1995.
Nuclear localization of a cap-binding protein complex.
Cold Spring Harbor Symp. Quant. Biol.
60:669-675[Abstract/Free Full Text].
|
| 28.
|
Izaurralde, E.,
J. Stepinski,
E. Darzynkiewicz, and I. Mattaj.
1992.
A cap binding protein that may mediate nuclear export of RNA polymerase II-transcribed RNAs.
J. Cell. Biol.
118:1287-1295[Abstract/Free Full Text].
|
| 29.
|
Jansen, R.,
D. Tollervey, and E. C. Hurt.
1993.
A U3 snoRNP protein with homology to splicing factor PRP4 and G beta domains is required for ribosomal RNA processing.
EMBO J.
12:2549-2558[Medline].
|
| 30.
|
Jarmolowski, A.,
W. Boelens,
E. Izaurralde, and I. Mattaj.
1994.
Nuclear export of different classes of RNA is mediated by specific factors.
J. Cell. Biol.
124:627-635[Abstract/Free Full Text].
|
| 31.
|
Jeppesen, C.,
B. B. Stebbins, and S. Gerbi.
1988.
Nucleotide sequence determination and secondary structure of Xenopus U3 snRNA.
Nucleic Acids Res.
16:2127-2148[Abstract/Free Full Text].
|
| 32.
|
Jimenez-Garcia, L.,
M. Segura-Valdez,
R. Ochs,
L. Rothblum,
R. Hannan, and D. Spector.
1994.
Nucleologenesis: U3 snRNA-containing prenucleolar bodies move to sites of active pre-rRNA transcription after mitosis.
Mol. Biol. Cell
5:955-966[Abstract].
|
| 33.
|
Kass, S.,
K. Tyc,
J. A. Steitz, and B. Sollner-Webb.
1990.
The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing.
Cell
60:897-908[Medline].
|
| 34.
|
Kiss, T.,
C. Marshallsay, and W. Filipowicz.
1991.
Alteration of the RNA polymerase specificity of U3 snRNA genes during evolution and in vitro.
Cell
65:517-526[Medline].
|
| 35.
|
Kiss, T., and F. Solymosy.
1990.
Molecular analysis of a U3 RNA gene locus in tomato: transcription signals, the coding region, expression in transgenic tobacco plants and tandemly repeated pseudogenes.
Nucleic Acids Res.
18:1941-1949[Abstract/Free Full Text].
|
| 36.
|
Kiss-Laszlo, Z.,
Y. Henry, and T. Kiss.
1998.
Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of pre-rRNA.
EMBO J.
17:797-807[Medline].
|
| 37.
|
Lafontaine, D. L. J., and D. Tollervey.
1999.
Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability.
RNA
5:455-467[Abstract].
|
| 38.
|
Lange, T.,
A. Borovjagin, and S. Gerbi.
1998.
Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.
RNA
4:789-800[Abstract].
|
| 39.
|
Lange, T.,
A. Borovjagin,
E. Maxwell, and S. Gerbi.
1998.
Conserved Boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs.
EMBO J.
17:3176-3187[Medline].
|
| 40.
|
Lange, T.,
M. Ezrokhi,
A. Borovjagin,
R. Rivera-Leon,
M. North, and S. Gerbi.
1998.
Nucleolar localization elements of xenopus laevis U3 small nucleolar RNA.
Mol. Biol. Cell
9:2973-2985[Abstract/Free Full Text].
|
| 41.
|
Lapeyre, B.,
P. Mariottini,
C. Mathieu,
P. Ferrer,
F. Amaldi,
F. Amalric, and M. Caizergues-Ferrer.
1990.
Molecular cloning of Xenopus fibrillarin, a conserved U3 small nuclear ribonucleoprotein recognized by antisera from humans with autoimmune disease.
Mol. Cell. Biol.
10:430-434[Abstract/Free Full Text].
|
| 42.
|
Leader, D. J.,
S. Connelly,
W. Filipowicz, and J. W. Brown.
1994.
Characterisation and expression of a maize U3 snRNA gene.
Biochim. Biophys. Acta
1219:145-147[Medline].
|
| 43.
|
Lee, S. J., and S. J. Baserga.
1999.
Imp3p and Imp4p, two specific components of the U3 small nucleolar ribonucleoprotein that are essential for pre-18S rRNA processing.
Mol. Cell. Biol.
19:5441-5452[Abstract/Free Full Text].
|
| 44.
|
Lubben, B.,
C. Marshallsay,
N. Rottmann, and R. Luhrmann.
1993.
Isolation of U3 snoRNP from CHO cells: a novel 55 kDa protein binds to the central part of U3 snoRNA.
Nucleic Acids Res.
21:5377-5385[Abstract/Free Full Text].
|
| 44a.
| Lukowiak, A., S. Mattox, R. Terns, and M. P. Terns. Unpublished data.
|
| 45.
|
Matera, A.
1998.
Of coiled bodies, gems, and salmon.
J. Cell. Biochem.
69:1-13[Medline].
|
| 46.
|
Mattaj, I. W.
1986.
Cap trimethylation of U snRNA is cytoplasmic and dependent on U snRNP protein binding.
Cell
46:905-911[Medline].
|
| 47.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-933.
|
| 48.
|
Mazan, S.,
M. P. Gulli,
N. Joseph, and J. P. Bachellerie.
1992.
Structure of the differentially expressed mouse U3A gene.
Eur. J. Biochem.
205:1033-1041[Medline].
|
| 49.
|
Mereau, A.,
R. Fournier,
A. Gregoire,
A. Mougin,
P. Fabrizio,
R. Luhrmann, and C. Branlant.
1997.
An in vivo and in vitro structure-function analysis of the Saccharomyces cerevisiae U3A snoRNP: protein-RNA contacts and base-pair interaction with the pre-ribosomal RNA.
J. Mol. Biol.
273:552-571[Medline].
|
| 50.
|
Mougey, E. B.,
L. K. Pape, and B. Sollner-Webb.
1993.
A U3 small nuclear ribonucleoprotein-requiring processing event in the 5' external transcribed spacer of Xenopus precursor rRNA.
Mol. Cell. Biol.
13:5990-5998[Abstract/Free Full Text].
|
| 51.
|
Munns, T. W.,
M. K. Liszewski,
J. T. Tellam,
H. F. Sims, and R. E. Rhoads.
1982.
Antibody-nucleic acid complexes. Immunospecific retention of globin messenger ribonucleic acid with antibodies specific for 7-methylguanosine.
Biochemistry
21:2922-2928[Medline].
|
| 52.
|
Narayanan, A.,
A. Lukowiak,
B. E. Jady,
F. Dragon,
T. Kiss,
R. M. Terns, and M. P. Terns.
1999.
Nucleolar localization signals of box H/ACA small nucleolar RNAs.
EMBO J.
18:5120-5130[Medline].
|
| 53.
|
Narayanan, A.,
W. Speckmann,
R. Terns, and M. Terns.
1999.
Role of the box C/D motif in the localization of small nucleolar RNAs to nucleoli and coiled bodies.
Mol. Biol. Cell
10:2131-2147[Abstract/Free Full Text].
|
| 54.
|
Orum, H.,
H. Nielsen, and J. Engberg.
1993.
Sequence and proposed secondary structure of the Tetrahymena thermophila U3-snRNA.
Nucleic Acids Res.
21:2511[Free Full Text].
|
| 55.
|
Parker, K., and J. Steitz.
1987.
Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.
Mol. Cell. Biol.
7:2899-2913[Abstract/Free Full Text].
|
| 56.
|
Peculis, B. A., and J. A. Steitz.
1994.
Sequence and structural elements critical for U8 snRNP function in Xenopus oocytes are evolutionarily conserved.
Genes Dev.
8:2241-2255[Abstract/Free Full Text].
|
| 57.
|
Pluk, H.,
J. Soffner,
R. Luhrmann, and V. W. Van.
1998.
cDNA cloning and characterization of the human U3 small nucleolar ribonucleoprotein complex-associated 55-kilodalton protein.
Mol. Cell. Biol.
18:488-498[Abstract/Free Full Text].
|
| 58.
|
Porter, G. L.,
P. J. Brennwald,
K. A. Holm, and J. A. Wise.
1988.
The sequence of U3 from Schizosaccharomyces pombe suggests structural divergence of this snRNA between metazoans and unicellular eukaryotes.
Nucleic Acids Res.
16:10131-10152[Abstract/Free Full Text]. (Erratum, 19:3484, 1991.)
|
| 59.
|
Reimer, G.,
K. M. Pollard,
C. A. Penning,
R. L. Ochs,
M. A. Lishwe,
H. Busch, and E. M. Tan.
1987.
Monoclonal autoantibody from a (New Zealand black X New Zealand white) F1 mouse and some human scleroderma sera target an Mr 34,000 nucleolar protein of the U3 RNP particle.
Arthritis Rheum.
30:793-800[Medline].
|
| 60.
|
Samarsky, D., and M. Fournier.
1998.
Functional mapping of the U3 small nucleolar RNA from the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:3431-3444[Abstract/Free Full Text].
|
| 61.
|
Samarsky, D.,
M. Fournier,
R. Singer, and E. Bertrand.
1998.
The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization.
EMBO J.
17:3747-3757[Medline].
|
| 62.
|
Savino, R., and S. A. Gerbi.
1990.
In vivo disruption of Xenopus U3 snRNA affects ribosomal RNA processing.
EMBO J.
9:2299-2308[Medline].
|
| 63.
|
Schimmang, T.,
D. Tollervey,
H. Kern,
R. Frank, and E. Hurt.
1989.
A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability.
EMBO J.
8:4015-4024[Medline].
|
| 64.
|
Sharma, K., and D. Tollervey.
1999.
Base pairing between U3 small nucleolar RNA and the 5' end of 18S rRNA is required for pre-rRNA processing.
Mol. Cell. Biol.
19:6012-6019[Abstract/Free Full Text].
|
| 65.
|
Shaw, P.,
A. Beven,
D. Leader, and J. Brown.
1998.
Localization and processing from a polycistronic precursor of novel snoRNAs in maize.
J. Cell Sci.
111:2121-2128[Abstract].
|
| 66.
|
Sienna, N.,
D. E. Larson, and B. H. Sells.
1996.
Altered subcellular distribution of U3 snRNA in response to serum in mouse fibroblasts.
Exp. Cell Res.
227:98-105[Medline].
|
| 67.
|
Singh, R., and R. Reddy.
1989.
Gamma-monomethyl phosphate: a cap structure in spliceosomal U6 small nuclear RNA.
Proc. Natl. Acad. Sci. USA
86:8280-8283[Abstract/Free Full Text].
|
| 68.
|
Smith, C., and J. Steitz.
1997.
Sno storm in the nucleolus: new roles for myriad small RNPs.
Cell
89:669-672[Medline].
|
| 69.
|
Suh, D.,
H. Busch, and R. Reddy.
1987.
Human U3 small nucleolar RNA genes are localized to the nucleoplasm.
Biochem. Biophys. Res. Commun.
143:658-664[Medline].
|
| 70.
|
Terns, M., and D. Goldfarb.
1998.
Nuclear transport of RNAs in microinjected Xenopus oocytes.
Methods Cell Biol.
53:559-589[Medline].
|
| 71.
|
Terns, M. P., and J. E. Dahlberg.
1994.
Retention and 5' cap trimethylation of U3 snRNA in the nucleus.
Science
264:959-961[Abstract/Free Full Text].
|
| 72.
|
Terns, M. P.,
J. E. Dahlberg, and E. Lund.
1993.
Multiple cis-acting signals for export of pre-U1 snRNA from the nucleus.
Genes Dev.
7:1898-1908[Abstract/Free Full Text].
|
| 73.
|
Terns, M. P.,
C. Grimm,
E. Lund, and J. E. Dahlberg.
1995.
A common maturation pathway for small nucleolar RNAs.
EMBO J.
14:4860-4871[Medline].
|
| 74.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342[Medline].
|
| 75.
|
Tollervey, D.,
H. Lehtonen,
M. Carmo-Fonseca, and E. C. Hurt.
1991.
The small nucleolar RNP protein NOP1 (fibrillarin) is required for pre-rRNA processing in yeast.
EMBO J.
10:573-583[Medline].
|
| 75a.
|
Tuma, R. S.,
J. A. Stolk, and M. B. Roth.
1993.
Identification and characterization of a sphere organelle protein.
J. Cell Biol.
122:767-773[Abstract/Free Full Text].
|
| 76.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 77.
|
Wiederkehr, T.,
R. F. Prétôt, and L. Minvielle-Sebastia.
1998.
Synthetic lethal interactions with conditional poly(A) polymerase alleles identify LCP5, a gene involved in 18S rRNA maturation.
RNA
4:1357-1372[Abstract].
|
| 78.
|
Wu, P.,
J. Brockenbrough,
A. Metcalfe,
S. Chen, and J. Aris.
1998.
Nop5p is a small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast.
J. Biol. Chem.
273:16453-16463[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1999, p. 8412-8421, Vol. 19, No. 12
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Xu, Q., Walker, D., Bernardo, A., Brodbeck, J., Balestra, M. E., Huang, Y.
(2008). Intron-3 Retention/Splicing Controls Neuronal Expression of Apolipoprotein E in the CNS. J. Neurosci.
28: 1452-1459
[Abstract]
[Full Text]
-
Watkins, N. J., Lemm, I., Luhrmann, R.
(2007). Involvement of Nuclear Import and Export Factors in U8 Box C/D snoRNP Biogenesis. Mol. Cell. Biol.
27: 7018-7027
[Abstract]
[Full Text]
-
Granneman, S., Vogelzangs, J., Luhrmann, R., van Venrooij, W. J., Pruijn, G. J. M., Watkins, N. J.
(2004). Role of Pre-rRNA Base Pairing and 80S Complex Formation in Subnucleolar Localization of the U3 snoRNP. Mol. Cell. Biol.
24: 8600-8610
[Abstract]
[Full Text]
-
Narayanan, A., Eifert, J., Marfatia, K. A., Macara, I. G., Corbett, A. H., Terns, R. M., Terns, M. P.
(2003). Nuclear RanGTP is not required for targeting small nucleolar RNAs to the nucleolus. J. Cell Sci.
116: 177-186
[Abstract]
[Full Text]
-
Granneman, S., Pruijn, G. J. M., Horstman, W., van Venrooij, W. J., Luhrmann, R., Watkins, N. J.
(2002). The hU3-55K Protein Requires 15.5K Binding to the Box B/C Motif as Well as Flanking RNA Elements for Its Association with the U3 Small Nucleolar RNA in Vitro. J. Biol. Chem.
277: 48490-48500
[Abstract]
[Full Text]
-
Lam, Y. W., Lyon, C. E., Lamond, A. I.
(2002). Large-Scale Isolation of Cajal Bodies from HeLa Cells. Mol. Biol. Cell
13: 2461-2473
[Abstract]
[Full Text]
-
Handwerger, K. E., Wu, Z.'a., Murphy, C., Gall, J. G.
(2002). Heat shock induces mini-Cajal bodies in the Xenopus germinal vesicle. J. Cell Sci.
115: 2011-2020
[Abstract]
[Full Text]
-
Yu, Y.-T., Shu, M.-D., Narayanan, A., Terns, R. M., Terns, M. P., Steitz, J. A.
(2001). Internal Modification of U2 Small Nuclear (Snrna) Occurs in Nucleoli of Xenopus Oocytes. JCB
152: 1279-1288
[Abstract]
[Full Text]
-
Pederson, T.
(2001). Fluorescent RNA cytochemistry: tracking gene transcripts in living cells. Nucleic Acids Res
29: 1013-1016
[Abstract]
[Full Text]
-
GERBI, S.A., BOROVJAGIN, A.V., EZROKHI, M., LANGE, T.S.
(2001). Ribosome Biogenesis: Role of Small Nucleolar RNA in Maturation of Eukaryotic rRNA. Cold Spring Harb Symp Quant Biol
66: 575-590
[Abstract]
-
Petersen, J. M., Her, L.-S., Varvel, V., Lund, E., Dahlberg, J. E.
(2000). The Matrix Protein of Vesicular Stomatitis Virus Inhibits Nucleocytoplasmic Transport When It Is in the Nucleus and Associated with Nuclear Pore Complexes. Mol. Cell. Biol.
20: 8590-8601
[Abstract]
[Full Text]
-
Speckmann, W. A., Terns, R. M., Terns, M. P.
(2000). The Box C/D motif directs snoRNA 5'-cap hypermethylation. Nucleic Acids Res
28: 4467-4473
[Abstract]
[Full Text]
-
Lukowiak, A. A., Granneman, S., Mattox, S. A., Speckmann, W. A., Jones, K., Pluk, H., Venrooij, W. J. v., Terns, R. M., Terns, M. P.
(2000). Interaction of the U3-55k protein with U3 snoRNA is mediated by the Box B/C motif of U3 and the WD repeats of U3-55k. Nucleic Acids Res
28: 3462-3471
[Abstract]
[Full Text]
-
Lange, T. S., Gerbi, S. A.
(2000). Transient Nucleolar Localization Of U6 Small Nuclear RNA In Xenopus Laevis Oocytes. Mol. Biol. Cell
11: 2419-2428
[Abstract]
[Full Text]
-
Waggener, J. M., DiMario, P. J.
(2002). Two Splice Variants of Nopp140 in Drosophila melanogaster. Mol. Biol. Cell
13: 362-381
[Abstract]
[Full Text]
Top
Abstract
Introduction
