Previous Article | Next Article 
Molecular and Cellular Biology, December 1999, p. 8547-8558, Vol. 19, No. 12
0270-7306/99/$04.00+0
Protein Kinase C
Targets Mitochondria, Alters
Mitochondrial Membrane Potential, and Induces Apoptosis in Normal and
Neoplastic Keratinocytes When Overexpressed by an Adenoviral
Vector
Luowei
Li,
Patricia S.
Lorenzo,
Krisztina
Bogi,
Peter M.
Blumberg, and
Stuart H.
Yuspa*
Laboratory of Cellular Carcinogenesis and
Tumor Promotion, Division of Basic Science, National Cancer
Institute, Bethesda, Maryland 20892
Received 2 April 1999/Returned for modification 18 May
1999/Accepted 19 August 1999
 |
ABSTRACT |
Inactivation of protein kinase C
(PKC
) is associated with
resistance to terminal cell death in epidermal tumor cells, suggesting that activation of PKC
in normal epidermis may be a component of a
cell death pathway. To test this hypothesis, we constructed an
adenovirus vector carrying an epitope-tagged PKC
under a
cytomegalovirus promoter to overexpress PKC
in normal and neoplastic
keratinocytes. While PKC
overexpression was detected by
immunoblotting in keratinocytes, the expression level of other PKC
isozymes, including PKC
, PKC
, PKC
, and PKC
, did not change.
Calcium-independent PKC-specific kinase activity increased after
infection of keratinocytes with the PKC
adenovirus. Activation of
PKC
by 12-O-tetradecanoylphorbol-13-acetate (TPA) at a
nanomolar concentration was lethal to normal and neoplastic mouse and
human keratinocytes overexpressing PKC
. Lethality was inhibited by
PKC selective inhibitors, GF109203X and Ro-32-0432. TPA-induced cell
death was apoptotic as evidenced by morphological criteria, TUNEL
(terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end
labeling) assay, DNA fragmentation, and increased caspase activity.
Subcellular fractionation indicated that PKC
translocated to a
mitochondrial enriched fraction after TPA activation, and this finding
was confirmed by confocal microscopy of cells expressing a transfected
PKC
-green fluorescent protein fusion protein. Furthermore,
activation of PKC
in keratinocytes altered mitochondrial membrane
potential, as indicated by rhodamine-123 fluorescence. Mitochondrial
inhibitors, rotenone and antimycin A, reduced TPA-induced cell death in
PKC
-overexpressing keratinocytes. These results indicate that PKC
can initiate a death pathway in keratinocytes that involves direct
interaction with mitochondria and alterations of mitochondrial function.
 |
INTRODUCTION |
Epidermal differentiation, like that
of other stratified squamous epithelia, requires a coordinated program
of sequential gene expression, migratory controls, and temporal
regulation of a death pathway to achieve the proper balance of
functional but nonviable mature squames and viable cells to replenish
them. Studies on cultured keratinocytes from murine and human skin have
revealed components of the regulatory pathways responsible for this
complex maturation process (16, 50). While the control of
gene expression and cell migration has attracted much research
interest, the regulation of the death pathway has not been as fully
explored. In fact, it is still uncertain whether maturation-induced
cell death is an active or a passive process that is simply the result
of production of toxic structural components and the formation of
cornified envelopes. For example, inappropriate expression of keratin
10 in proliferating keratinocytes leads to growth arrest and cell loss
(25, 36). Even the nature of the death pathway is in dispute, having neither complete characteristics of apoptosis nor
necrosis, suggesting that it may be a unique program customized for the
important functions that a nonviable epidermal keratinocyte must
perform without the intervention of phagocytosis (37).
For the most part, correlations have directed interpretations of
keratinocyte-programmed cell death pathways. The pro-apoptotic protein
Bax is increased in differentiating keratinocytes, while bcl-2 and
procaspase 3 are found in proliferating cells (31, 44).
Furthermore, keratinocytes isolated from transgenic mice overexpressing
bcl-2 in the epidermis have a prolonged in vitro lifespan
(40). These studies have been interpreted to support an
apoptotic mechanism for terminal cell death in keratinocytes. The
observation that the phorbol ester tumor promoter
12-O-tetradecanoylphorbol-13-acetate (TPA) enhances terminal
cell death in cultured keratinocytes and epidermis in vivo
(51) has implicated protein kinase C (PKC) as a mediator of
the terminal phase of keratinocyte maturation. In vitro, PKC inhibitors
effectively block keratinocyte terminal differentiation induced by
calcium or TPA (13). However, keratinocytes express five
isoforms of PKC (
,
,
,
, and
), and it has been unclear
if all or only specific isoforms are involved in terminal cell death
based on activation or inhibition studies. Recently, PKC
and -
have been identified as inducers of keratinocyte transglutaminase and
protein cross-linking in studies utilizing adenoviral vectors to
overexpress these isoforms in cultured human keratinocytes (34). These findings were consistent with previous studies
indicating that PKC
translocated and was activated during
calcium-induced keratinocyte differentiation and that PKC
increased
in amount in late stages of epidermal maturation in vitro and in vivo
(8, 27). Furthermore, recent studies have strongly implied
that the activation of PKC
was required for keratinocyte apoptosis induced by UV light (9). PKC
is a ubiquitously expressed
isoform of PKC that regulates pathways in a cell-type-specific manner (21, 26, 29). Under certain conditions, PKC
can stimulate or inhibit proliferation, promote secretion, suppress tumor formation or in vitro transformation, and stimulate differentiation. In several
model systems, PKC
contributes to apoptosis induced by DNA damage
and death receptors. PKC
has several unique characteristics that
distinguish it from other isoforms. It is protected from downregulation
by bryostatin 1 in a specific dose response, and this is regulated by
its catalytic domain (30). It is also subject to
phosphorylation on tyrosine residues by a variety of stimuli, particularly after activation of cells by growth factor receptors (7, 21). Tyrosine phosphorylation may result in activation or inactivation, and the direction of change in catalytic activity may
be substrate dependent (6, 28, 45).
We have focused on PKC
as a keratinocyte death inducer from data
obtained in studies of neoplastic keratinocytes, where escape from
programmed cell death is essential for tumor development. In mouse
keratinocytes transformed by a ras oncogene, PKC
is catalytically inactivated by tyrosine phosphorylation (6), and this is associated with resistance to terminal cell death induced
by calcium or TPA. Furthermore, inhibition of tyrosine phosphorylation
of PKC
by kinase inhibitors reverses the differentiation block in
vitro and causes tumor regression in vivo (6, 46). In
addition, PKC
is specifically downmodulated when human keratinocytes are neoplastically transformed by an oncogenic ras gene
(17). Because of the potential to exploit the endogenous
keratinocyte death pathway in the treatment or prevention of squamous
tumor development, we constructed a replication-deficient adenovirus carrying PKC
to determine whether this isoform can induce
keratinocyte cell death directly in order to define the characteristics
of the death program and to elucidate the cellular targets involved.
 |
MATERIALS AND METHODS |
Chemicals and antibodies.
Polyclonal antibodies to PKC
,
PKC
, PKC
, PKC
, and monoclonal antibody to FLAG peptide (M2)
were from Sigma BioScience (St. Louis, Mo.). TPA was purchased from
Alexis Co. (San Diego, Calif.). MitoTracker red was purchased from
Molecular Probes, Inc. (Portland, Oreg.). Protein kinase inhibitors
GF109203X, Ro-32-0432, PD98059 and H89 were purchased from CalBiochem
(La Jolla, Calif.). Antimycin A, rotenone, and other chemicals or
reagents were from Sigma Chemical Co. (St. Louis, Mo.).
Cell culture.
Primary mouse keratinocytes from newborn
BALB/c mouse epidermis were prepared by a trypsin flotation procedure
(11). The isolated primary keratinocytes were plated at a
density of 2 × 106 to 5 × 106 cells
per 60-mm dish in Eagle minimum essential medium (Ca2+ and
Mg2+ free; BioWhittaker, Walkersville, Md.) supplemented
with 8% Chelex (Bio-Rad Laboratories, Richmond, Calif.)-treated fetal
bovine serum (FBS) (Gemini Bio-Products, Inc., Calabasas, Calif.) and 0.05 mM Ca2+. The cells were maintained at 36°C in a
humidified incubator with 7% CO2 for 6 to 9 days. Fresh
medium was added daily. Mouse neoplastic keratinocyte cell lines SP-1
and 308 were maintained in the same medium as the primary mouse
keratinocytes (47). 293 and HeLa cells were cultured in
Dulbecco modified Eagle medium (DMEM) supplemented with 10% FBS.
SQCC-Y1, a human squamous carcinoma-derived cell line, was kindly
provided by J. Rheinwald of Harvard University (Boston, Mass.),
and HPV-18 infected immortalized human keratinocytes were a gift from
R. Schlegel (Georgetown University, Washington, D.C.). Both cell lines
were grown in DMEM supplemented with 10% FBS.
Generation of adenovirus carrying PKC
.
Two complementary
single stranded DNAs,
GGTACCCTCGAGTATACGCGTGACTACAAGGACGACGATGACAAGTAGAATTCGGGCC
and CGAATTCTACTTGTCATCGTCGTCCTTGTAGTCACGCGTATACTCGAGGGTACCGC were synthesized and annealed at 50°C. This double-stranded
DNA, containing the FLAG sequence followed by a stop codon, several restriction sites, and protruding ends, was cloned into the
SacII and ApaI sites of pGEM vector (Promega,
Madison, Wis.). A mouse PKC
cDNA fragment
(XhoI-MluI) lacking the stop codon was digested from the MTH vector (32) and cloned 5' to the FLAG sequence in the modified pGEM vector (pGEM-FPKC
). The sequence was verified by automated DNA sequencing by using a DNA sequencing kit
(Perkin-Elmer, Branchburg, N.J.). The FLAG-epitope-tagged PKC
cDNA
was then excised from the pGEM-FPKC
with
XhoI-EcoRI and ligated into the plasmid vector,
pCA4 (Microbix Biosystems, Inc., Toronto, Ontario, Canada), which
contains partial adenovirus type 5 sequence deleted in the E1 region
with insertion of the cytomegalovirus (CMV) promoter and the simian
virus 40 polyadenylation signal into the E1 region. The plasmid pCA4
carrying PKC
-FLAG was cotransfected with pJM17 (Microbix Biosystems,
Inc.) into 293 cells. pJM17 is noninfectious in single transfection of
293 cells. Adenoviral plaques were isolated after 10 to 14 days and
reamplified in 293 cells. The expression of PKC
-FLAG fusion protein
was examined by Western blot with both anti-PKC
and anti-FLAG
antibodies. The resulting positive virus was referred to as AdFPKC
.
An adenovirus carrying
-galactosidase (Ad
gal) under the control
of CMV promoter was used as a viral control vector (22).
Construction of plasmid encoding PKC
-GFP fusion protein.
A plasmid containing the green fluorescent protein (GFP) cDNA
(pEGFP-N1) was purchased from Clontech (Palo Alto, Calif.). pEGFP-N1
and pCA4 carrying PKC
-FLAG were digested with XmaI and MluI, respectively. The resulting DNA protruding ends were
filled in with Klenow fragment (Promega). Both linearized plasmids were then digested with XhoI. The PKC
insert from pCA4 and the
vector of pEGFP-N1 were purified by 1% agarose gel and ligated. To
construct plasmid expressing the kinase inactive mutant of PKC
-GFP
fusion protein, pPKC
K376R-GFP, a mouse
PKC
K376R cDNA fragment (XhoI-MluI)
lacking the stop codon was digested from the MTH vector (5,
32) and ligated with the modified pEGFP containing an added
MluI site. The sequences of pPKC
-GFP and
pPKC
K376R-GFP were verified with automated sequencing as
described above.
Infection of adenovirus.
The infection of adenovirus was
carried out in serum-free medium containing 2.5 µg of Polybrene
(Sigma) per ml at 50 PFU/cell for primary mouse keratinocytes and 100 PFU/cell for cell lines, respectively, for 30 min at room temperature.
Fresh serum-containing medium was added thereafter. The transducing
efficiency of the adenovirus under these condition is over 90%.
Transfection.
pGFP, pPKC
-GFP, and
pPKC
K376R-GFP were transfected into SP-1 cells by using
Lipofectamine Plus reagent (Life Technologies, Inc., Gaithersburg, Md.)
according to the procedure recommended by the manufacturer. In brief, 4 µg of DNA, 12 µl of lipid, and 12 µl of Plus reagent were used to
transfect SP-1 cells growing in 60-mm tissue culture dishes at 50%
confluence in 2 ml of medium without serum. Fresh medium with 8% FBS
was added 3 h later. The transfection efficiency is ca. 50%.
Subcellular fractionation.
To isolate the particulate and
cytosol fractions, cells were collected in buffers containing 25 mM
Tris (pH 7.4), 150 mM NaCl, 2 mM MgCl2, 1 mM EGTA, and 1 mM
EDTA. Protease inhibitors (10 µg of leupeptin per ml, 10 µg of
aprotinin per ml, and 1 mM phenylmethylsulfonyl fluoride) and
phosphatase inhibitors (10 µM NaVO4 and 1 mM NaF) were
added prior to lysis. The cell lysates were then sonicated and
centrifuged at 100,000 × g for 1 h at 4°C.
Aliquots of the cytosolic fraction (supernatant) and the particulate
fraction (pellet) were subjected to electrophoresis and immunoblotting. To isolate the mitochondrial enriched membrane fractions, cells were
collected in phosphate-buffered saline (PBS) and then pelleted by
centrifugation. The cell pellets were resuspended in a buffer containing 25 mM Tris (pH 7.4), 250 mM sucrose, 10 mM KCl, 1.5 mM
MgCl2, 1 mM EDTA, 1 mM EGTA, and 1 mM dithiothreitol with
protease inhibitors as described above and homogenized 10 times with a Dounce homogenizer. Unlysed cells and nuclei were removed by
centrifugation at 750 × g for 10 min. The supernatant
was centrifuged at 10,000 × g for 30 min, and the
resulting pellet was washed once with the same buffer and represents
the mitochondrial enriched fraction. The supernatant was further spun
at 100,000 × g for 1 h, and the supernatant from
this final centrifugation represents the cytosol fraction. The
centrifugation was carried out at 4°C (49). The protein
concentration in each sample was determined by the Bradford method
(Bio-Rad, Richmond, Calif.).
Cell viability assay.
Cell viability was measured with a
cell proliferation assay kit (The CellTiter 96; Promega) according to
the manufacturer's protocol. In brief, the cells grown on 24-well
tissue culture plates were infected with adenovirus for 2 days and
treated with TPA in 0.5 ml of medium. After various times, 75 µl of
dye solution was added to the cells without medium change, and 0.5 ml
of solubilization-stop solution was added 4 h later. Then, 200 µl of the final mixture was transferred to 96-well plates, and the
absorbency at 590 nm was examined by a plate reader. Results are
presented relative to 100% of cell death as determined by killing
cells with three cycles of freeze-thawing. The assay is based on the
cellular conversion of a tetrazolium salt (MTT) into a blue formazan
product that is detected by a plate reader at 590 nm.
PKC activity.
The PKC activity was assayed by using the
Protein Kinase C Assay System (Gibco-BRL) according to the
manufacturer's procedure. In brief, both control and viral-infected
cells were lysed in the extraction buffer (20 mM Tris, pH 7.5; 0.5 mM
EDTA; 0.5 mM EGTA; 0.5% Triton X-100; 25 µg each of aprotinin and
leupeptin per ml). Kinase activities from cell lysate (40 µg) and
immunoprecipitation complex were examined by using acetylated myelin
basic protein (Ac-MBP) as the substrate, and the nonspecific activity
was determined by including peptides containing the pseudosubstrate
region of PKC. The assay mixture contains 20 mM Tris (pH 7.5), 20 mM
MgCl2, 1 mM CaCl2, 20 µM ATP, and 50 µM
Ac-MBP, with 0.1 µCi of [
-32P]ATP per assay. For the
Ca2+-independent kinase activity, 5 mM EGTA was included in
the assay mixture. Data represent triplicate determinations.
TUNEL assay.
Apoptotic cells were detected by TUNEL
(terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end
labeling) assay by using the ApopTag Direct In Situ Apoptosis
Detection Kit with Fluorescein (Oncor, Gaithersburg, Md.). Attached
keratinocytes were harvested by trypsinization, combined with
unattached cells, fixed in 5% paraformaldehyde, and resuspended in
PBS. Next, 105 cells were spread on glass slides by use of
a Cytospin (Cytospin 2; Shandon, Pittsburgh, Pa.). Detection of
apoptotic cells and counterstaining with propidium iodide (PI) were
performed according to the instructions provided by the manufacturer.
The slides were viewed and photographed by using a fluorescent Leica microscope.
DNA degradation and caspase 3 activity measurements.
Total
DNA was isolated from primary keratinocytes by lysing cells in a buffer
containing 5 mM Tris (pH 8.0), 10 mM EDTA, and 0.5% Triton X-100. The
lysates were treated with 100 µg of RNase A per ml for 60 min at
37°C and then 200 µg of proteinase K per ml for 50 min at 50°C.
DNA was extracted with equal volumes of phenol-chloroform-isoamyl
alcohol twice and precipitated with 1/4 volume of NH4
acetate (3 N) and 2 volumes of 100% EtOH. The pellets were washed with
70% ethanol once and resuspended in 50 µl of TE. Then, 10 µl of
DNA was used for electrophoresis on a 1.8% agarose gel. The gel was
stained with ethidium bromide and photographed under UV light. Caspase
3 activity was determined by using the Caspase-3 Assay Kit from Biomol
(Plymouth Meeting, Pa.) according to the instructions provided by the
manufacturer. Adenovirus-infected cells were treated with TPA, and cell
lysates were collected after 12 h for assay.
Confocal microscopy.
SP-1 cells were transfected with pGFP,
pPKC
-GFP, and pPKC
K376R-GFP by using Lipofectamine as
described earlier. After 24 h, cells were treated with TPA (250 nM) for 30 min and then loaded with MitoTracker red (20 nM) for an
additional 30 min in culture medium. A time course of
pPKC
K376R-GFP translocation was recorded by use of
confocal microscopy. Confocal fluorescent images were collected by
using a Bio-Rad MRC 1024 confocal scan head mounted on a Nikon Optiphot
microscope with a 488-nm excitation light from an argon-krypton laser.
Emission filters of 598/40 and 522/32 were used for collecting red and green fluorescence, respectively, in channels one and two. After sequential excitation of 1.0- or 1.5-µm optical sections (z series), red and green fluorescent images of the same cell were collected, saved, and merged for colocalization of GFP with MitoTracker red by
using LaserSharp software (Bio-Rad). A time course of PKC
-GFP translocation in SP-1 cells was also viewed and photographed by using
an inverted fluorescent microscope (Zeiss ICM 405).
Detection of mitochondrial membrane potential.
The
mitochondrial membrane potential was determined by using rhodomine-123
(Rh123) as described previously (49). Cells were harvested
by trypsinization and resuspended in medium at 106
cells/ml. Cells were incubated with Rh123 (5 µM) for 20 min at room
temperature, washed once, resuspended in tissue culture medium, and
analyzed by flow cytometry. The uncoupling agent, carbonyl cyanide
m-chlorophenylhydropazone (CCCP; Sigma), was added at 50 µM with Rh123 as a positive control.
 |
RESULTS |
Characterization of adenovirus-mediated expression of PKC
.
Primary mouse keratinocytes were infected with epitope-tagged PKC
or
-galactosidase control adenoviruses at 50 PFU/cell, and cell lysates
were analyzed by Western blotting after 48 h (Fig.
1A). A 10-fold increase in PKC
protein
was detected in the AdFPKC
-infected cells by using anti-PKC
antibodies, and exogenous PKC
was also abundant on Western
blots or by immunoprecipitation when detected by anti-FLAG antibody.
The level of the other PKC isoforms was unaffected by infection with
either adenovirus (Fig. 1B). More than 90% of keratinocytes were
infected under this condition when examined by immunostaining with
anti-FLAG antibodies or a
-galactosidase staining assay (not shown).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of exogenous and endogenous PKC isozymes in
primary mouse keratinocytes. After 3 days in primary culture, mouse
keratinocytes were infected with 50 PFU/cell of either AdFPKC or
Ad gal (vector) for 48 h. (A) Cell lysates from both vector- and
AdFPKC -infected cells were collected and subjected to either
immunoblotting with anti-PKC or anti-FLAG antibodies or
immunoprecipitation (Ip) with anti-FLAG antibody and immunoblotted with
anti-PKC antibodies. (B) The expression of endogenous PKC isozymes
, , , and was examined by immunoblotting of cell lysates
48 h after infection with either AdFPKC or Ad gal.
|
|
The functional activity of the epitope-tagged PKC

was examined by
PKC activity assay as described in Materials and Methods.
Total PKC
activity, including the Ca
2+-dependent and
Ca
2+-independent activity, increased three- to fourfold
(Fig.
2A)
in AdFPKC

-infected
keratinocytes. Since protein levels increased
nearly 10-fold according
to Western blot, this suggests that some
PKC

is in an inactive
state. Most of the PKC activity increase
can be accounted for in the
Ca
2+-independent fraction (i.e., plus EGTA), as would be
expected
for PKC

. Exogenous PKC

was recoverable as a
Ca
2+-independent PKC activity in anti-FLAG
immunoprecipitates from
AdFPKC

but not Ad

gal-infected
keratinocytes (Fig.
2B). The activation
of exogenous and
endogenous PKC

was also tested by measuring
translocation from
cytosol to the particulate fraction after TPA
treatment (Fig.
3A). After infection and expression,
exogenous
PKC

was already present in the particulate fraction of
untreated
cells and frequently appeared as a doublet, suggesting
constitutive
phosphorylation. TPA caused translocation of both
endogenous and
exogenous PKC

from the cytosol to the particulate
fraction. In
PKC

-overexpressing cells, there was a preferential
increase in
the slow mobility band in the particulate fraction,
suggesting
that phosphorylation occurs preferentially at membranes. A
slow
mobility band is also formed in the particulate fraction of
endogenous
PKC

in TPA-treated Ad

gal-infected cells, suggesting
that this
is a phenomenon associated with activation of this isoform.
Endogenous
PKC

also translocates in response to TPA (Fig.
3B) in
both cell
types, indicating it remains active in the presence of excess
PKC

. However, there are slight differences in the dose-response
for
cytosol depletion among the two infected cell types of unknown
significance. Nevertheless, the introduction of PKC

by adenovirus
vector results in a functioning enzyme that remains responsive
to
phorbol ester activation and translocation signals.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
PKC activity detected in mouse primary keratinocytes
infected with either AdFPKC or Ad gal. Primary mouse keratinocytes
infected with either AdFPKC or Ad gal for 48 h were lysed as
described in Materials and Methods. (A) PKC kinase activity from total
lysates was assayed in the presence or absence of 5 mM EGTA. (B) PKC
activity from immunoprecipitates of anti-FLAG antibody was examined in
the presence or absence of 5 mM EGTA. Data presented are the mean ± the standard error of the mean (n = 3). Similar
results were obtained in two experiments.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
TPA-induced translocation of PKC and - from
soluble to particulate fractions. SP-1 cells infected with Ad gal or
AdFPKC for 24 h were treated with various doses of TPA as
indicated in the figure for 30 min. Aliquots of cytosol and particulate
fractions were analyzed by Western blot with rabbit anti-PKC (A) or
anti-PKC (B) antibodies.
|
|
Activation of PKC
by TPA induces cell death.
Initially,
infection of primary mouse keratinocytes with AdFPKC
, but not
Ad
gal, at 100 PFU/cell or higher resulted in cell killing for 3 to 5 days so that it was difficult to explore the pathways involved.
Therefore, we reduced adenovirus to 50 PFU/cell and used TPA activation
to control biological events. Under these conditions keratinocytes
infected with the PKC
or control adenoviruses were morphologically
similar in the absence of activation by TPA (Fig.
4). Within the first few hours after
administration of a low dose of TPA (50 nM), cells in both groups
became elongated and formed dendritic structures which were reversed in
the Ad
gal group but became more prominent with time in the AdFPKC
group. Within 24 h of TPA treatment, a spindle phenotype or cell
rounding and detachment was obvious in a majority of AdFPKC
cells,
and by 48 h most of the cells were floating in the medium.
Rounded, detached cells were also seen in control cultures, but to a
much lower extent. Studies with quantitative endpoints for cell
viability (Fig. 5A) indicate that TPA was
lethal to AdFPKC
-infected primary mouse keratinocytes with a
50% effective dose between 3 and 30 nM. Even at 100 nM, TPA did not
cause substantial lethality in cultured control keratinocytes (Fig.
5A). At low concentrations of TPA, cell death in PKC
-overexpressing
cells was inhibited by a 10 µM concentration of the PKC
selective inhibitor, GF109203X (Fig. 5B). GF109203X itself had no
effect on cell growth. To further confirm that the TPA-induced cell
death in PKC
-overexpressing keratinocytes is mediated by PKC
, we
compared the effect of inhibitors for PKA and mitogen-activated protein
kinase kinase (MAPKK) to PKC inhibitors (Fig. 5C). As seen before,
GF109203X and also Ro-32-0432, both PKC-selective inhibitors, blocked
lethality from TPA. In contrast, H89, a PKA inhibitor, had no effect on
TPA-induced cell death. Of interest, however, PD98059, a MAPKK
inhibitor, partially blocked TPA-induced cell death, suggesting that
MAPK may be a downstream target of a PKC
-activated cell death
pathway. Pretreating cells with cycloheximide (5 µg/ml) did not
prevent TPA-induced cell death in PKC
-overexpressing cells (Fig.
5C), suggesting, together with the rapid time course (see below), that
PKC
may directly activate a cell death pathway without a requirement
for gene activation or new protein synthesis. To determine whether a
differentiation program was induced in PKC
-overexpressing
keratinocytes, Western blots were performed on total cell lysates
collected from AdFPKC
-infected primary keratinocytes treated with
TPA after 24 or 48 h. There was no detectable expression of
keratins 1 and 10, loricrin, or filaggrin at these time points (not
shown).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 4.
TPA treatment of primary mouse keratinocytes
overexpressing PKC alters cell morphology. Primary mouse
keratinocytes were infected with either AdFPKC or Ad gal as
described in Materials and Methods. After 24 h (time zero), 50 nM
TPA was added to cells, and photographs were taken after 0, 3, 7, and
24 h.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
TPA induces cell death in PKC -overexpressing normal
and neoplastic keratinocytes. Primary mouse keratinocytes, infected
with either AdFPKC or Ad gal for 24 h, were treated with
various concentrations of TPA (A) or with a PKC inhibitor, GF109203X
(10 µM), with or without 50 nM TPA for 24 h (B). Cell viability
was examined with the MTT assay. (C) PKC selective inhibitors
Ro-32-0432 (10 µM) and GF109203X (10 µM), PKA inhibitor H89 (10 µM), MAPKK inhibitor PD98059 (10 µM), and the protein synthesis
inhibitor cycloheximide (10 µg/ml) were added to primary mouse
keratinocytes overexpressing PKC together with 50 nM TPA. After
24 h, cell viability was examined with the MTT assay. (D)
Neoplastic human and mouse keratinocytes (SQCC-Y1, HPV-18, HeLa, and
SP-1) were infected with AdFPKC or Ad gal as described in the
Materials and Methods for 24 h. TPA (250 nM) was added, and cell
viability was determined after 24 h. Values are expressed relative
to 100% of cell death as determined by three cycles of freeze-thawing
within each experiment. Results (mean ± the SEM) are from one of
at least three experiments, each performed in triplicate. Error bars
for the 30 nM dose in panel A for control and Ad gal groups are too
small to be seen.
|
|
Previous studies have shown that squamous tumor cells are resistant to
phorbol ester-induced terminal cell death (
24). When
AdFPKC

is introduced into a variety of human or mouse squamous
tumor
cell lines (Fig.
5D), these cells become responsive to TPA-induced
lethality and rapidly detach from the culture dish. Both benign
and
malignant cells are susceptible, and these changes are blocked
by PKC
inhibitors (not shown). Time course studies with cell viability
assays
indicated that PKC

-mediated lethality occurred rapidly,
within 3 to
7 h after the addition of TPA (Fig.
6A). Because TPA-induced
cell death was
correlated to cell detachment (Fig.
4), we sought
to determine whether
detachment of keratinocytes preceded or resulted
from lethality induced
by TPA. Primary mouse keratinocytes, infected
with AdFPKC

or
Ad

gal, were treated with TPA (100 nM) for 3 h,
the attached
cells were collected by trypsinization, and 25,000
cells were tested
for viability. By 3 h after TPA treatment, there
was already a
reduction in viability of 50% in PKC

-overexpressing
attached
primary keratinocytes, whereas the loss of viability
was minimal in
vector control cells after TPA at this time (Fig.
6B). Similar results
were obtained when cells were treated with
phorbol dibutyrate (not
shown). This result indicates that lethality
precedes detachment in
PKC

-overexpressing keratinocytes.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 6.
(A) TPA-induced lethality is rapid in
PKC -overexpressing keratinocytes. Primary mouse keratinocytes,
infected with either AdFPKC or Ad gal for 24 h, were exposed
to TPA (50 nM). Cell viability was assessed at multiple times after TPA
treatment by MTT assay. (B) TPA-induced lethality precedes loss of
attachment. Primary mouse keratinocytes, infected with either AdFPKC
or Ad gal for 24 h, were treated with TPA (100 nM) for 3 h.
Attached cells were collected by trypsinization, counted, and
aliquoted. Then, 25,000 cells were seeded per well in 96-well plates
and assayed for cell viability by MTT assay. Data presented are the
means ± the standard error of the mean (n = 6).
Similar results were obtained from two experiments, and a third
experiment was done with phorbol dibutyrate.
|
|
PKC
-mediated cell killing has characteristics of an apoptotic
process.
Before exploring the cellular targets for PKC
-mediated
cell killing, we wanted to characterize the nature of the dying cells in order to provide direction to our mechanistic studies. Primary mouse
keratinocytes, infected with AdFPKC
or Ad
gal, were treated with
TPA and collected after 24 h for TUNEL staining and DNA
fragmentation analysis. TUNEL-positive nuclei (Fig.
7A) were detected in TPA-treated cells of
both groups, but there were three times more in the
PKC
-overexpressing cells compared to the Ad
gal-infected controls
(Table 1). Even in the absence of TPA,
overexpressing PKC
increased the number of TUNEL-positive cells
substantially. DNA fragmentation was also detected in gel mobility
assays of DNA extracted from AdFPKC
keratinocytes treated for
24 h with TPA, whereas DNA from control keratinocytes treated
similarly remained at the origin of the gels (Fig. 7B). However, a
well-defined DNA ladder could not be resolved. The activation of
caspase plays a central role in the regulation of apoptosis induced by
various stimuli (43). Figure 7C indicates that caspase 3 activity is increased in keratinocytes infected with AdFPKC
relative
to keratinocytes infected with Ad
gal and, within 12 h of TPA
treatment, there is a further 8.6-fold increase above that of the
untreated cells. Caspase 3 activity also increases in TPA-treated
Ad
gal-infected cells, but the activity is only 30% of that in
AdFPKC
-infected cells. Taken together, these findings suggest that
TPA induces an apoptosis-like cell death in keratinocytes that is
substantially enhanced by overexpression of PKC
.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 7.
Apoptotic markers detected in keratinocytes
overexpressing PKC . (A) Primary mouse keratinocytes infected with
AdFPKC were treated with TPA (50 nM) for 24 h. Both attached
and floating cells were collected and fixed for TUNEL assay. The red
fluorescence indicates nuclear counterstaining with PI, and the green
fluorescence indicates positive staining for the TUNEL assay. Yellow
nuclei (arrows) express both markers. (B) DNA was isolated from
AdFPKC - or Ad gal-infected primary keratinocytes 24 h after
TPA treatment, processed through a 1.8% agarose gel, and stained with
ethidium bromide. DNA degradation is detected in PKC -overexpressing
cells. Parallel cultures were treated with 1 µM STSP as a positive
control. (C) Cell lysates from SP-1 cells infected with AdFPKC or
Ad gal and treated with 250 nM TPA for 12 h were subjected to
caspase 3 assay as described in Materials and Methods. The relative
activity of caspase 3 was determined as the optical density at
402nm of the reaction mixture. Data presented are mean ± the standard deviation (n = 2). Similar results were
obtained from three experiments.
|
|
Overexpressed PKC
targets mitochondria to induce lethality in
keratinocytes.
To provide guidance for studies of intracellular
targeting of PKC
in response to TPA activation, we constructed a
plasmid expressing a PKC
-GFP fusion protein, transfected that into
SP-1 cells, and treated the cells with TPA. Before TPA treatment,
PKC
-GFP displayed a relatively diffuse cytosolic distribution with
perinuclear concentration in some cells (Fig.
8). After TPA treatment, PKC
-GFP translocated from cytosol to plasma membrane within 10 to 20 min and
then concentrated in perinuclear structures consistent with intracellular organelles (Fig. 8). In contrast, the fluorescence pattern did not change in SP-1 cells transfected with pGFP. To determine whether the punctate perinuclear distribution of PKC
-GFP represents localization to a specific organelle, a fluorescent probe
for mitochondria, MitoTracker red, was loaded into SP-1 cells
expressing either PKC
-GFP or GFP. Red and green fluorescence were
viewed by a confocal microscope with 598/40 and 522/32 emission filters, respectively. Images of red and green fluorescence of optical
sections (1.5 µm) of the same field indicated that PKC
-GFP colocalized with MitoTracker red after TPA treatment (Fig.
9A). In addition to inducing PKC
-GFP
to colocalize with mitochondria, TPA also caused aggregation of
mitochondria and shape changes in SP-1 cells expressing PKC
-GFP. In
contrast, after transfection with the parental GFP vector, the
distribution of GFP was diffuse, and GFP localization or cell
morphology did change after TPA treatment. Likewise transfection with a
kinase-inactive mutant of pPKC
K376R fused to GFP showed
the formation of the cytoplasmic granules after TPA treatment that did
not colocalize with MitoTracker red (Fig. 9B). However, this mutant did
translocate to the plasma membrane after TPA treatment. To confirm the
mitochondrial localization of PKC
, 308 and HeLa cells were infected
with AdFPKC
and treated with TPA, and aliquots of cytosol and
mitochondrial enriched fractions were examined by Western blot after
3 h. Translocation of PKC
to a mitochondrial enriched fraction
was detected in both cell lines (Fig.
10A). Of interest, staurosporine
(STSP), an agent previously shown to induce terminal cell death in
normal and neoplastic keratinocytes through a PKC-dependent mechanism
(12), also caused translocation of PKC
to the
mitochondrial fraction. As shown in Fig. 10B, endogenous PKC
was
also detected in the mitochondrial enriched fraction of SP-1 cells, and
this was substantially increased after TPA stimulation.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 8.
Rapid translocation of PKC -GFP after TPA treatment.
The distribution of green fluorescence of transfected PKC -GFP in
TPA-treated SP-1 cells was monitored in living cells by use of an
inverted fluorescent microscope. SP-1 cells were infected with
pPKC -GFP and, after 24 h, TPA (500 nM) was added directly to
the medium to trigger translocation. Experiments were performed at room
temperature. Photographs were taken at the various times indicated.
Arrows mark cells where organellular translocation is prominent, and
arrowheads mark cells where plasma membrane translocation is
prominent.
|
|


View larger version (111K):
[in this window]
[in a new window]
|
FIG. 9.
Colocalization of PKC -GFP protein with mitochondria.
(A) pGFP and pPKC -GFP were transfected into SP-1 cells by use of
Lipofectamine, and the expression of GFP or GFP-PKC protein was
viewed in living cells by confocal microscopy. Mitochondria were
visualized by staining with MitoTracker red for 30 min. Transfected
cells were treated with 250 nM TPA and examined after incubation at
37°C for 1 h. (B) A kinase inactive mutant,
pPKC K376R-GFP fusion protein, was transfected into SP-1
cells, and after a loading with MitoTracker red for 30 min, cells were
treated with 250 nM TPA and examined for 40 min by confocal microscopy.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 10.
TPA induces translocation of PKC from cytosolic to
mitochondrial enriched fractions. (A) HeLa and 308 cells infected with
AdFPKC were treated with TPA (250 nM) or STSP (1 µM) for 3 h.
Cell lysates were collected, and cytosolic and mitochondrial enriched
fractions were isolated as described in Materials and Methods. Western
blots with PKC antibodies were performed on 20 µg of cytosol
protein and 1 µg of mitochondrial enriched protein. (B) Endogenous
PKC translocates to the mitochondrial enriched fraction in SP-1
cells after TPA treatment. To detect endogenous PKC , SP-1 cells were
treated with 250 nM TPA for 1 h and subjected to subcellular
fractionation. Western blots were performed with PKC antibodies on
10 µg of cytosol protein and 10 µg of mitochondrial enriched
protein.
|
|
Having identified mitochondria as a potential target for PKC

-induced
lethality, we tested several mitochondrial electron
transport
inhibitors for activity against TPA-induced cell death
in SP-1 cells
infected with either AdFPKC

or Ad

gal (Fig.
11).
Both antimycin A, an inhibitor of
complex III in the respiratory
chain, and rotenone, an inhibitor of
complex I, substantially
decreased TPA-induced cell death at low
concentrations. Higher
concentrations of these inhibitors could not be
tested because
they are directly toxic to SP-1 cells. Evidence for a
direct effect
of PKC

on mitochondrial membrane potential was
obtained by using
Rh123 (Fig.
12A).
After TPA treatment Rh123 fluorescence was reduced
in AdFPKC

- but
not Ad

gal-infected SP-1 cells. This change was
inhibited by
GF109203X (Fig.
12B), indicating it is PKC mediated.
In the absence of
TPA, Rh123 fluorescence was similar in control
and PKC

overexpressing SP-1 cells and was significantly reduced
in SP-1 cells
from both groups exposed to an uncoupling agent,
CCCP (Fig.
12).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 11.
Mitochondrial inhibitors, rotenone and antimycin A,
inhibit PKC mediated cell death. SP-1 cells, infected with either
AdFPKC or Ad gal for 24 h, were treated with rotenone (0.25 µM) and antimycin A (0.5 µM) with or without 250 nM TPA. After
24 h, surviving cells were measured by assaying the protein
content in each sample as described in Materials and Methods. Data
presented are the means ± the standard error of the mean
(n = 6). Similar results were obtained from three
separate experiments.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 12.
TPA alters mitochondrial membrane potential in
PKC -overexpressing keratinocytes. (A) SP-1 cells, infected with
either AdFPKC or Ad gal, were treated with TPA (250 nM) for 3 h and collected by trypsinization. Rh123 (5 µM) was loaded, and the
fluorescence intensity was determined by flow cytometry and compared to
similarly infected cells not treated with TPA. For a positive control,
CCCP, an uncoupling agent, was incubated with cells for 15 min. (B) In
a parallel experiment, AdFPKC -infected SP-1 cells were treated with
PKC inhibitor, GF109203X (1 µM), 15 min prior to the addition of TPA
(250 nM). Cells were collected 3 h later, loaded with Rh123, and
analyzed for fluorescence intensity. Similar results were obtained from
two experiments.
|
|
 |
DISCUSSION |
Overexpression and activation of PKC
are lethal to normal and
neoplastic keratinocytes.
Earlier observations indicated that
inactivation of PKC
in neoplastic keratinocytes was associated with
resistance to cell death that accompanies the terminal phase of
keratinocyte differentiation (6). In concert with the
specific downregulation of PKC
detected in human keratinocytes
transformed with a ras oncogene (17), these
findings implied that PKC
might have antitumor effects in squamous
cell carcinogenesis. This study shows that PKC
is lethal to normal
and neoplastic keratinocytes when overexpressed by an adenoviral vector
and activated by TPA. Lethality is rapid, does not require new protein
synthesis, and is prevented by selective inhibitors of PKC catalytic
activity, suggesting that this kinase targets substrates that are
involved in a death pathway. Kuroki and coworkers used PKC
and -
adenoviral vectors producing high levels of gene expression in human
keratinocytes and found that both isoforms caused growth inhibition and
transglutaminase I induction (34). However, only the
isoform caused a spindle cell morphological change similar to what we
described for mouse keratinocytes (Fig. 4), suggesting that there is
specificity in action among these two isoforms. In that study the
longer-term consequences of overexpression on cell viability were not
reported, nor was the consequence of activation by phorbol ester
examined. Since our study examined both mouse and human keratinocytes
and both species were susceptible to cell killing, we must conclude that a lethal response is a general effect of activation of the PKC
isoform when overexpressed in squamous cell types.
A number of other markers of keratinocyte differentiation previously
attributed to PKC activation (
8) are not upregulated
when
PKC

is overexpressed in mouse or human keratinocytes (this
study and
Ohba et al. [
34]). Thus, PKC signals that regulate
particular components of the keratinocyte differentiation and
death
programs are compartmentalized. Since the PKC pathway is
clearly
involved in the regulation of differentiation-dependent
gene expression
in keratinocytes, other isoforms must be responsible
for those
functions. Although the cellular content of the other
PKC isoforms was
not altered by overexpressing PKC

, we cannot
exclude alterations in
subcellular localization that might affect
function of other isoforms,
since this was observed in U937 cells
overexpressing PKC

(
10). In contrast to our observations, overexpression
and
activation of PKC

in mouse myeloid progenitor 32D cells resulted
in
macrophage differentiation (
33), indicating the importance
of cell context in evaluating a particular function of a PKC isoform
signaling pathway. We were particularly gratified to see that
when
overexpressed, activated PKC

could induce lethality in tumor
cells
of both human and mouse origin and of a benign and malignant
phenotype.
Even though we were able to detect tyrosine phosphorylation
of the
exogenous

in tumor cell extracts (not shown), sufficient
active
enzyme persists (as shown by in vitro activity assays)
to respond to
TPA and cause cell death. Currently, we are testing
whether in vivo
delivery of AdFPKC

to cutaneous tumors in mouse
skin grafts will
influence tumor growth and
survival.
PKC
-mediated keratinocyte cell death is an apoptotic
process.
The resistance of preneoplastic or neoplastic
keratinocytes to cell killing by phorbol esters and UV light, while
normal keratinocytes are sensitive, has been proposed to be fundamental
to cell selection required for tumor formation in murine and human skin
(2, 50). Experimental data now suggest that PKC
is
involved in a pathway leading to cell death of keratinocytes from both
phorbol ester and UV light. In human keratinocytes UV light-induced
cell death is a PKC-dependent apoptotic process that generates a
constitutively active proteolytic product of PKC
(9).
Likewise, TPA activation in PKC
-overexpressing keratinocytes
causes apoptosis-associated changes in keratinocyte morphology, DNA
fragmentation and TUNEL-positive staining. As for UV light and other
apoptosis inducers, PKC
activation also increased caspase 3 activity
in keratinocytes. In keratinocytes, procaspase 3 is localized to
mitochondria and is released and activated by apoptosis inducers such
as UV light and STSP (31). PKC
is proteolytically
activated by caspases in several other cell types during apoptosis
induction by DNA-damaging agents (14, 15, 18). In those
models activation of PKC
by proteolysis appears to be essential for
the apoptotic process. Recent evidence suggests that activated PKC
phosphorylates DNA-dependent protein kinase, preventing repair of DNA
double-strand breaks (1). Such an activity would be
consistent with the DNA fragmentation observed in our study, assuming a
DNA damage pathway was also stimulated by PKC
. The efficient killing
of HeLa and HPV-18-transformed keratinocytes by overexpressing PKC
suggests that functional p53 is not required for PKC
to induce cell
death. In contrast, MAPK appears to be involved in PKC
-mediated cell
killing since an inhibitor of this pathway, PD98059, can protect
keratinocytes from lethality. In other cell types PKC
can activate
both MEK1 and ERK1, and these pathways have been implicated in
apoptosis (48). In collaborative studies, we have also
demonstrated that an MAPK cascade is downstream from PKC
activation
in the apoptotic response of LNCaP prostate cancer cells
(16a). Thus, this pathway provides a fruitful lead to
determine the distal consequences of PKC
activation.
PKC
targets mitochondria to induce keratinocyte cell death.
Mitochondria have now been identified as a subcellular target for
PKC
in keratinocytes. Both confocal microscopy of keratinocytes transfected with GFP-PKC
and subcellular fractionation of
keratinocytes infected with AdFPKC
indicate colocalization with
mitochondria. Furthermore, TPA caused rapid translocation of PKC
from cytosol to the plasma membrane and mitochondria, and affected
mitochondria appear to aggregate. Since the kinase-inactive mutant
PKC
K376R translocated to the plasma membrane but not to
the mitochondria, it appears that kinase activity is required for
mitochondrial localization. Studies with SP-1 cells suggest that
endogenous PKC
also translocates to the mitochondria after TPA
exposure, but this cannot be confirmed morphologically because antibody staining is not sufficiently powerful to detect endogenous enzyme unambiguously. If translocation of endogenous PKC
does occur in
neoplastic SP-1 cells, further studies will be required to determine
whether the resistance of these cells to TPA-induced lethality, in the
absence of PKC
overexpression, is due to the phosphorylation state
of the endogenous PKC
or to some other mechanism of interference.
This is the first indication that PKC

localizes to the mitochondria.
Previous studies in overexpressing NIH 3T3 cells indicated
that

resided in the cytosol and Golgi and translocated to plasma
membranes
after TPA stimulation (
19). In contrast, GFP-tagged
PKC

translocated from cytosol to nuclear and plasma membranes
after TPA
exposure in transfected CHO cells (
35). An earlier
study
with fluorescence-labeled PKC inhibitors implied that there
was
mitochondrial localization of an unidentified isoform other
than
PKC

1 in TPA-treated rat embryo fibroblasts, and this was
associated
with mitochondrial shape changes (
4). However, PKC
was
not identified as the isoform responsible. In contrast, in
HL60 and
apoptosis-sensitive human leukemia cells, PKC

was shown
to
participate in resistance to the apoptotic response to DNA-damaging
agents by colocalizing with Bcl-2 in mitochondria and enhancing
its
antiapoptotic activity by phosphorylation (
41). Thus, cell
type and isoform type are important variables in localization
analysis
and the functional response to PKC
activation.
Two inhibitors of mitochondrial electron transport, rotenone and
antimycin, substantially reduced PKC

-mediated cell killing
at
concentrations that are not toxic to keratinocytes. This provides
evidence that the mitochondrial target is functionally important
and is
dependent on changes in the electron transport system.
Furthermore,
studies with Rh123 indicate that mitochondrial membrane
potential
decreases within 3 h of PKC activation of AdFPKC

cells
by TPA.
These studies suggest that mitochondria are a direct target
of PKC

activity. Since mitochondria are downstream of a number
of apoptosis
inducers (
3,
20), the involvement of PKC

in
several
pathways of cell death seems worthy of further
study.
While we can only speculate on the identity of the relevant pathways
downstream from PKC

-induced alterations in mitochondrial
electron
transport, the ceramide-induced apoptotic pathway has
certain
similarities worth noting. In specific cell types, ceramide
induces
translocation of PKC

, stimulates H
2O
2
production from
mitochondria, reduces mitochondrial membrane potential,
causes
DNA fragmentation, and induces apoptosis that is inhibited by
rotenone and antimycin (
39). Furthermore,
H
2O
2 is an activator
of both PKC

and MAPKK,
and some of its biological effects are
inhibited by PKC inhibitors or
PD 98059 (
42). PKC activation
by TPA is known to produce
reactive oxygen species and DNA strand
breakage in keratinocytes
(
23,
38). These similarities provide
a starting point to
design approaches for understanding the mechanism
of PKC

-mediated
lethality in normal and neoplastic keratinocytes.
Most importantly,
they may provide new targets to induce lethality
in tumors that arise
in squamous
epithelia.
 |
ACKNOWLEDGMENTS |
We thank Mariana Gerschenson for very helpful discussion and
critically reading the manuscript; Toren Finkel for generously providing Ad
gal; Susan Garfield and Mark Miller of the core facility in the Division of Basic Sciences, National Cancer Institute, for
providing technical support for confocal microscopy and DNA sequencing,
respectively; Yajun Zhang for assistance with vector construction and
adenovirus production and student interns; and Michael Cheng,
Maximillian Soong, and Andrea Ceresa for their helpful technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Cellular Carcinogenesis and Tumor Promotion, Bldg. 37, Rm. 3B25,
National Cancer Institute, 37 Convent Dr., MSC 4255, Bethesda, MD
20892-4255. Phone: (301) 496-2612. Fax: (301) 496-8709. E-mail:
yuspas{at}mail.nih.gov.
 |
REFERENCES |
| 1.
|
Bharti, A.,
S. K. Kraeft,
M. Gounder,
P. Pandey,
S. Jin,
Z. M. Yuan,
S. P. Lees-Miller,
R. Weichselbaum,
D. Weaver,
L. B. Chen,
D. Kufe, and S. Kharbanda.
1998.
Inactivation of DNA-dependent protein kinase by protein kinase C : implications for apoptosis.
Mol. Cell. Biol.
18:6719-6728[Abstract/Free Full Text].
|
| 2.
|
Brash, D. E.,
A. Ziegler,
A. S. Jonason,
J. A. Simon,
S. Kunala, and D. J. Leffell.
1996.
Sunlight and sunburn in human skin cancer: p53, apoptosis, and tumor promotion.
J. Investig. Dermatol. Symp. Proc.
1:136-142[Medline].
|
| 3.
|
Brenner, C.,
I. Marzo, and G. Kroemer.
1998.
A revolution in apoptosis: from a nucleocentric to a mitochondriocentric perspective.
Exp. Gerontol.
33:543-553[Medline].
|
| 4.
|
Chen, C. S., and M. Poenie.
1993.
New fluorescent probes for protein kinase C. Synthesis, characterization, and application.
J. Biol. Chem.
268:15812-15822[Abstract/Free Full Text].
|
| 5.
|
Chen, N.,
Ma Wy,
C. Huang, and Z. Dong.
1999.
Translocation of protein kinase C and protein kinase C to membrane is required for ultraviolet B-induced activation of mitogen-activated protein kinases and apoptosis.
J. Biol. Chem.
274:15389-15394[Abstract/Free Full Text].
|
| 6.
|
Denning, M. F.,
A. A. Dlugosz,
M. K. Howett, and S. H. Yuspa.
1993.
Expression of an oncogenic rasHa gene in murine keratinocytes induces tyrosine phosphorylation and reduced activity of protein kinase C .
J. Biol. Chem.
268:26079-26081[Abstract/Free Full Text].
|
| 7.
|
Denning, M. F.,
A. A. Dlugosz,
D. W. Threadgill,
T. Magnuson, and S. H. Yuspa.
1996.
Activation of the epidermal growth factor receptor signal transduction pathway stimulates tyrosine phosphorylation of protein kinase C .
J. Biol. Chem.
271:5325-5331[Abstract/Free Full Text].
|
| 8.
|
Denning, M. F.,
A. A. Dlugosz,
E. K. Williams,
Z. Szallasi,
P. M. Blumberg, and S. H. Yuspa.
1995.
Specific protein kinase C isozymes mediate the induction of keratinocyte differentiation markers by calcium.
Cell Growth Differ.
6:149-157[Abstract].
|
| 9.
|
Denning, M. F.,
Y. Wang,
B. J. Nickoloff, and T. Wrone-Smith.
1998.
Protein kinase C is activated by caspase-dependent proteolysis during ultraviolet radiation-induced apoptosis of human keratinocytes.
J. Biol. Chem.
273:29995-30002[Abstract/Free Full Text].
|
| 10.
|
de Vente, J.,
S. Kiley,
T. Garris,
W. Bryant,
J. Hooker,
K. Posekany,
P. Parker,
P. Cook,
D. Fletcher, and D. K. Ways.
1995.
Phorbol ester treatment of U937 cells with altered protein kinase C content and distribution induces cell death rather than differentiation.
Cell Growth Differ.
6:371-382[Abstract].
|
| 11.
|
Dlugosz, A. A.,
A. B. Glick,
T. Tennenbaum,
W. C. Weinberg, and S. H. Yuspa.
1995.
Isolation and utilization of epidermal keratinocytes for oncogene research, p. 3-20.
In
P. K. Vogt, and I. M. Verma (ed.), Methods in enzymology. Academic Press, New York, N.Y
|
| 12.
|
Dlugosz, A. A., and S. H. Yuspa.
1991.
Staurosporine induces protein kinase C agonist effects and maturation of normal and neoplastic mouse keratinocytes in vitro.
Cancer Res.
51:4677-4684[Abstract/Free Full Text].
|
| 13.
|
Dlugosz, A. A., and S. H. Yuspa.
1993.
Coordinate changes in gene expression which mark the spinous to granular cell transition in epidermis are regulated by protein kinase C.
J. Cell Biol.
120:217-225[Abstract/Free Full Text].
|
| 14.
|
Emoto, Y.,
H. Kisaki,
Y. Manome,
S. Kharbanda, and D. Kufe.
1996.
Activation of protein kinase C in human myeloid leukemia cells treated with 1- -D-arabinofuranosylcytosine.
Blood
87:1990-1996[Abstract/Free Full Text].
|
| 15.
|
Emoto, Y.,
Y. Manome,
G. Meinhardt,
H. Kisaki,
S. Kharbanda,
M. Robertson,
T. Ghayur,
W. W. Wong,
R. Kamen, and R. Weichselbaum.
1995.
Proteolytic activation of protein kinase C by an ICE-like protease in apoptotic cells.
EMBO J.
14:6148-6156[Medline].
|
| 16.
|
Fuchs, E.
1994.
Epidermal differentiation and keratin gene expression.
Princess Takamatsu Symp.
24:290-302[Medline].
|
| 16a.
| Fujii, T., M. L. García-Bermejo, J. L. Bernabó, J. Caamaño, M. Ohba, T. Kuroki, S. H. Yuspa,
and M. G. Kazanietz. Unpublished data.
|
| 17.
|
Geiges, D.,
F. Marks, and M. Gschwendt.
1995.
Loss of protein kinase C from human HaCaT keratinocytes upon ras transfection is mediated by TGF .
Exp. Cell Res.
219:299-303[Medline].
|
| 18.
|
Ghayur, T.,
M. Hugunin,
R. V. Talanian,
S. Ratnofsky,
C. Quinlan,
Y. Emoto,
P. Pandey,
R. Datta,
Y. Huang,
S. Kharbanda,
H. Allen,
R. Kamen,
W. Wong, and D. Kufe.
1996.
Proteolytic activation of protein kinase C by an ICE/CED 3-like protease induces characteristics of apoptosis.
J. Exp. Med.
184:2399-2404[Abstract/Free Full Text].
|
| 19.
|
Goodnight, J. A.,
H. Mischak,
W. Kolch, and J. F. Mushinski.
1995.
Immunocytochemical localization of eight protein kinase C isozymes overexpressed in NIH 3T3 fibroblasts. Isoform-specific association with microfilaments, Golgi, endoplasmic reticulum, and nuclear and cell membranes.
J. Biol. Chem.
270:9991-10001[Abstract/Free Full Text].
|
| 20.
|
Green, D. R., and J. C. Reed.
1998.
Mitochondria and apoptosis.
Science
281:1309-1312[Abstract/Free Full Text].
|
| 21.
|
Gschwendt, M.
1999.
Protein kinase C .
Eur. J. Biochem.
259:555-564[Medline].
|
| 22.
|
Guzman, R. J.,
E. A. Hirschowitz,
S. L. Brody,
R. G. Crystal,
S. E. Epstein, and T. Finkel.
1994.
In vivo suppression of injury-induced vascular smooth muscle cell accumulation using adenovirus-mediated transfer of the herpes simplex virus thymidine kinase gene.
Proc. Natl. Acad. Sci. USA
91:10732-10736[Abstract/Free Full Text].
|
| 23.
|
Hartley, J. A.,
N. W. Gibson,
L. A. Zwelling, and S. H. Yuspa.
1985.
Association of DNA strand breaks with accelerated terminal differentiation in mouse epidermal cells exposed to tumor promoters.
Cancer Res.
45:4864-4870[Abstract/Free Full Text].
|
| 24.
|
Hennings, H.,
D. Michael,
U. Lichti, and S. H. Yuspa.
1987.
Response of carcinogen-altered mouse epidermal cells to phorbol ester tumor promoters and calcium.
J. Investig. Dermatol.
88:60-65[Medline].
|
| 25.
|
Kartasova, T.,
D. R. Roop, and S. H. Yuspa.
1992.
Relationship between the expression of differentiation-specific keratins 1 and 10 and cell proliferation in epidermal tumors.
Mol. Carcinog.
6:18-25[Medline].
|
| 26.
|
Kazanietz, M. G., and P. M. Blumberg.
1996.
Protein kinase C and signal transduction in normal and neoplastic cells, p. 389-402.
In
A. E. Sirica (ed.), Cellular and molecular pathogenesis. Raven Press, New York, N.Y
|
| 27.
|
Koizumi, H.,
Y. Kohno,
S. Osada,
S. Ohno,
A. Ohkawara, and T. Kuroki.
1993.
Differentiation-associated localization of nPKC , a Ca++-independent protein kinase C, in normal human skin and skin diseases.
J. Investig. Dermatol.
101:858-863[Medline].
|
| 28.
|
Li, W.,
H. Mischak,
J. C. Yu,
L. M. Wang,
J. F. Mushinski,
M. A. Heidaran, and J. H. Pierce.
1994.
Tyrosine phosphorylation of protein kinase C- in response to its activation.
J. Biol. Chem.
269:2349-2352[Abstract/Free Full Text].
|
| 29.
|
Liu, W. S., and C. A. Heckman.
1998.
The sevenfold way of PKC regulation.
Cell. Signalling
10:529-542[Medline].
|
| 30.
|
Lorenzo, P. S.,
K. Bogi,
P. Acs,
G. R. Pettit, and P. M. Blumberg.
1997.
The catalytic domain of protein kinase C conveys protection from down-regulation induced by bryostatin 1.
J. Biol. Chem.
272:33338-33343[Abstract/Free Full Text].
|
| 31.
|
Mancini, M.,
D. W. Nicholson,
S. Roy,
N. A. Thornberry,
E. P. Peterson,
L. A. Casciola-Rosen, and A. Rosen.
1998.
The caspase-3 precursor has a cytosolic and mitochondrial distribution: implications for apoptotic signaling.
J. Cell Biol.
140:1485-1495[Abstract/Free Full Text].
|
| 32.
|
Mischak, H.,
J. Goodnight,
W. Kolch,
G. Martiny-Baron,
C. Schaechtle,
M. G. Kazanietz,
P. M. Blumberg,
J. H. Pierce, and J. F. Mushinski.
1993.
Overexpression of protein kinase C- and - in NIH 3T3 cells induces opposite effects of growth, morphology, anchorage dependence, and tumorigenicity.
J. Biol. Chem.
268:6090-6096[Abstract/Free Full Text].
|
| 33.
|
Mischak, H.,
J. H. Pierce,
J. Goodnight,
M. G. Kazanietz,
P. M. Blumberg, and J. F. Mushinski.
1993.
Phorbol ester-induced myeloid differentiation is mediated by protein kinase C- and - and not by protein kinase C- II, - , -zeta and eta.
J. Biol. Chem.
268:20110-20115[Abstract/Free Full Text].
|
| 34.
|
Ohba, M.,
K. Ishino,
M. Kashiwagi,
S. Kawabe,
K. Chida,
N. H. Huh, and T. Kuroki.
1998.
Induction of differentiation in normal human keratinocytes by adenovirus-mediated introduction of the eta and delta isoforms of protein kinase C.
Mol. Cell. Biol.
18:5199-5207[Abstract/Free Full Text].
|
| 35.
|
Ohmori, S.,
Y. Shirai,
N. Sakai,
M. Fujii,
H. Konishi,
U. Kikkawa, and N. Saito.
1998.
Three distinct mechanisms for translocation and activation of the subspecies of protein kinase C.
Mol. Cell. Biol.
18:5263-5271[Abstract/Free Full Text].
|
| 36.
|
Paramio, J. M.,
M. L. Casanova,
C. Segrelles,
S. Mittnacht,
E. B. Lane, and J. L. Jorcano.
1999.
Modulation of cell proliferation by cytokeratins K10 and K16.
Mol. Cell. Biol.
19:3086-3094[Abstract/Free Full Text].
|
| 37.
|
Polakowska, R. R.,
M. Piacentini,
R. Bartlett,
L. A. Goldsmith, and A. R. Haake.
1994.
Apoptosis in human skin development: morphogenesis, periderm, and stem cells.
Dev. Dyn.
199:176-188[Medline].
|
| 38.
|
Przybyszewski, J.,
H. C. Box, and M. Kulesz-Martin.
1998.
Induction of reactive oxygen species without 8-hydroxydeoxyguanosine formation in DNA of initiated mouse keratinocytes treated with 12-O-tetradecanoylphorbol-13-acetate.
Carcinogenesis
19:1467-1474[Abstract/Free Full Text].
|
| 39.
|
Quillet-Mary, A.,
J. P. Jaffrezou,
V. Mansat,
C. Bordier,
J. Naval, and G. Laurent.
1997.
Implication of mitochondrial hydrogen peroxide generation in ceramide-induced apoptosis.
J. Biol. Chem.
272:21388-21395[Abstract/Free Full Text].
|
| 40.
|
Rodriguez-Villanueva, J.,
D. Greenhalgh,
X. J. Wang,
D. Bundman,
S. Cho,
M. Delehedde,
D. Roop, and T. J. McDonnell.
1998.
Human keratin-1.bcl-2 transgenic mice aberrantly express keratin 6, exhibit reduced sensitivity to keratinocyte cell death induction, and are susceptible to skin tumor formation.
Oncogene
16:853-863[Medline].
|
| 41.
|
Ruvolo, P. P.,
X. Deng,
B. K. Carr, and W. S. May.
1998.
A functional role for mitochondrial protein kinase C in Bcl2 phosphorylation and suppression of apoptosis.
J. Biol. Chem.
273:25436-25442[Abstract/Free Full Text].
|
| 42.
|
Sabri, A.,
K. L. Byron,
A. M. Samarel,
J. Bell, and P. A. Lucchesi.
1998.
Hydrogen peroxide activates mitogen-activated protein kinases and Na+-H+ exchange in neonatal rat cardiac myocytes.
Circ. Res.
82:1053-1062[Abstract/Free Full Text].
|
| 43.
|
Salvesen, G. S., and V. M. Dixit.
1997.
Caspases: intracellular signaling by proteolysis.
Cell
91:443-446[Medline].
|
| 44.
|
Sermadiras, S.,
M. Dumas,
R. Joly-Berville,
F. Bonte,
A. Meybeck, and M. H. Ratinaud.
1997.
Expression of Bcl-2 and Bax in cultured normal human keratinocytes and melanocytes: relationship to differentiation and melanogenesis.
Br. J. Dermatol.
137:883-889[Medline].
|
| 45.
|
Smith, H.,
E. Y. Chang,
Z. Szallasi,
P. M. Blumberg, and J. Rivera.
1995.
Tyrosine phosphorylation of protein kinase C- in response to the activation of the high affinity receptor for immunoglobulin E modifies its substrate recognition.
Proc. Natl. Acad. Sci. USA
92:9112-9116[Abstract/Free Full Text].
|
| 46.
|
Strickland, J. E.,
A. A. Dlugosz,
H. Hennings, and S. H. Yuspa.
1993.
Inhibition of tumor formation from grafted murine papilloma cells by treatment of grafts with staurosporine, an inducer of squamous differentiation.
Carcinogenesis
14:205-209[Abstract/Free Full Text].
|
| 47.
|
Strickland, J. E.,
D. A. Greenhalgh,
A. Koceva-Chyla,
H. Hennings,
C. Restrepo,
M. Balaschak, and S. H. Yuspa.
1988.
Development of murine epidermal cell lines which contain an activated rasHa oncogene and form papillomas in skin grafts on athymic nude mouse hosts.
Cancer Res.
48:165-169[Abstract/Free Full Text].
|
| 48.
|
Ueda, Y.,
Hirai Si,
Osada Si,
A. Suzuki,
K. Mizuno, and S. Ohno.
1996.
Protein kinase C activates the MEK-ERK pathway in a manner independent of Ras and dependent on Raf.
J. Biol. Chem.
271:23512-23519[Abstract/Free Full Text].
|
| 49.
|
Vander Heiden, M. G.,
N. S. Chandel,
E. K. Williamson,
P. T. Schumacker, and C. B. Thompson.
1997.
Bcl-xL regulates the membrane potential and volume homeostasis of mitochondria.
Cell
91:627-637[Medline].
|
| 50.
|
Yuspa, S. H.
1994.
The pathogenesis of squamous cell cancer: lessons learned from studies of skin carcinogenesis. Thirty-third G. H. A. Clowes Memorial Award Lecture.
Cancer Res.
54:1178-1189[Abstract/Free Full Text].
|
| 51.
|
Yuspa, S. H.,
T. Ben,
H. Hennings, and U. Lichti.
1982.
Divergent responses in epidermal basal cells exposed to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate.
Cancer Res.
42:2344-2349[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 1999, p. 8547-8558, Vol. 19, No. 12
0270-7306/99/$04.00+0
This article has been cited by other articles:
-
Qi, X., Mochly-Rosen, D.
(2008). The PKC{delta} -Abl complex communicates ER stress to the mitochondria - an essential step in subsequent apoptosis. J. Cell Sci.
121: 804-813
[Abstract]
[Full Text]
-
Park, J.-A., Crews, A. L., Lampe, W. R., Fang, S., Park, J., Adler, K. B.
(2007). Protein Kinase C{delta} Regulates Airway Mucin Secretion via Phosphorylation of MARCKS Protein. Am. J. Pathol.
171: 1822-1830
[Abstract]
[Full Text]
-
Steinberg, R., Harari, O. A., Lidington, E. A., Boyle, J. J., Nohadani, M., Samarel, A. M., Ohba, M., Haskard, D. O., Mason, J. C.
(2007). A Protein Kinase C{epsilon}-Anti-apoptotic Kinase Signaling Complex Protects Human Vascular Endothelial Cells against Apoptosis through Induction of Bcl-2. J. Biol. Chem.
282: 32288-32297
[Abstract]
[Full Text]
-
Gorelik, G., Fang, J. Y., Wu, A., Sawalha, A. H., Richardson, B.
(2007). Impaired T Cell Protein Kinase C{delta} Activation Decreases ERK Pathway Signaling in Idiopathic and Hydralazine-Induced Lupus. J. Immunol.
179: 5553-5563
[Abstract]
[Full Text]
-
DeVries-Seimon, T. A., Ohm, A. M., Humphries, M. J., Reyland, M. E.
(2007). Induction of Apoptosis Is Driven by Nuclear Retention of Protein Kinase C{delta}. J. Biol. Chem.
282: 22307-22314
[Abstract]
[Full Text]
-
Suh, K. S., Mutoh, M., Mutoh, T., Li, L., Ryscavage, A., Crutchley, J. M., Dumont, R. A., Cheng, C., Yuspa, S. H.
(2007). CLIC4 mediates and is required for Ca2+-induced keratinocyte differentiation. J. Cell Sci.
120: 2631-2640
[Abstract]
[Full Text]
-
Crigler, L., Kazhanie, A., Yoon, T.-J., Zakhari, J., Anders, J., Taylor, B., Virador, V. M.
(2007). Isolation of a mesenchymal cell population from murine dermis that contains progenitors of multiple cell lineages. FASEB J.
21: 2050-2063
[Abstract]
[Full Text]
-
House, S. L., Melhorn, S. J., Newman, G., Doetschman, T., Schultz, J. E. J.
(2007). The protein kinase C pathway mediates cardioprotection induced by cardiac-specific overexpression of fibroblast growth factor-2. Am. J. Physiol. Heart Circ. Physiol.
293: H354-H365
[Abstract]
[Full Text]
-
Gomel, R., Xiang, C., Finniss, S., Lee, H. K., Lu, W., Okhrimenko, H., Brodie, C.
(2007). The Localization of Protein Kinase C{delta} in Different Subcellular Sites Affects Its Proapoptotic and Antiapoptotic Functions and the Activation of Distinct Downstream Signaling Pathways. Mol Cancer Res
5: 627-639
[Abstract]
[Full Text]
-
Kaminski, M., Kiessling, M., Suss, D., Krammer, P. H., Gulow, K.
(2007). Novel Role for Mitochondria: Protein Kinase C{theta}-Dependent Oxidative Signaling Organelles in Activation-Induced T-Cell Death. Mol. Cell. Biol.
27: 3625-3639
[Abstract]
[Full Text]
-
Zeidan, Y. H., Hannun, Y. A.
(2007). Activation of Acid Sphingomyelinase by Protein Kinase C{delta}-mediated Phosphorylation. J. Biol. Chem.
282: 11549-11561
[Abstract]
[Full Text]
-
Gavrielides, M. V., Gonzalez-Guerrico, A. M., Riobo, N. A., Kazanietz, M. G.
(2006). Androgens Regulate Protein Kinase C{delta} Transcription and Modulate Its Apoptotic Function in Prostate Cancer Cells. Cancer Res.
66: 11792-11801
[Abstract]
[Full Text]
-
Walker, J. L., Castagnino, P., Chung, B. M., Kazanietz, M. G., Assoian, R. K.
(2006). Post-transcriptional Destabilization of p21cip1 by Protein Kinase C in Fibroblasts. J. Biol. Chem.
281: 38127-38132
[Abstract]
[Full Text]
-
Nomura-Takigawa, Y., Nagano-Fujii, M., Deng, L., Kitazawa, S., Ishido, S., Sada, K., Hotta, H.
(2006). Non-structural protein 4A of Hepatitis C virus accumulates on mitochondria and renders the cells prone to undergoing mitochondria-mediated apoptosis. J. Gen. Virol.
87: 1935-1945
[Abstract]
[Full Text]
-
Humphries, M. J., Limesand, K. H., Schneider, J. C., Nakayama, K. I., Anderson, S. M., Reyland, M. E.
(2006). Suppression of Apoptosis in the Protein Kinase C{delta} Null Mouse in Vivo. J. Biol. Chem.
281: 9728-9737
[Abstract]
[Full Text]
-
Hanrott, K., Gudmunsen, L., O'Neill, M. J., Wonnacott, S.
(2006). 6-Hydroxydopamine-induced Apoptosis Is Mediated via Extracellular Auto-oxidation and Caspase 3-dependent Activation of Protein Kinase C{delta}. J. Biol. Chem.
281: 5373-5382
[Abstract]
[Full Text]
-
Tuthill, M. C., Oki, C. E., Lorenzo, P. S.
(2006). Differential effects of bryostatin 1 and 12-O-tetradecanoylphorbol-13-acetate on the regulation and activation of RasGRP1 in mouse epidermal keratinocytes.. Molecular Cancer Therapeutics
5: 602-610
[Abstract]
[Full Text]
-
Li, L., Sampat, K., Hu, N., Zakari, J., Yuspa, S. H.
(2006). Protein Kinase C Negatively Regulates Akt Activity and Modifies UVC-induced Apoptosis in Mouse Keratinocytes. J. Biol. Chem.
281: 3237-3243
[Abstract]
[Full Text]
-
Gartsbein, M., Alt, A., Hashimoto, K., Nakajima, K., Kuroki, T., Tennenbaum, T.
(2006). The role of protein kinase C {delta} activation and STAT3 Ser727 phosphorylation in insulin-induced keratinocyte proliferation. J. Cell Sci.
119: 470-481
[Abstract]
[Full Text]
-
Ryer, E. J., Sakakibara, K., Wang, C., Sarkar, D., Fisher, P. B., Faries, P. L., Kent, K. C., Liu, B.
(2005). Protein Kinase C Delta Induces Apoptosis of Vascular Smooth Muscle Cells through Induction of the Tumor Suppressor p53 by Both p38-dependent and p38-independent Mechanisms. J. Biol. Chem.
280: 35310-35317
[Abstract]
[Full Text]
-
Santiago-Walker, A. E., Fikaris, A. J., Kao, G. D., Brown, E. J., Kazanietz, M. G., Meinkoth, J. L.
(2005). Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest. J. Biol. Chem.
280: 32107-32114
[Abstract]
[Full Text]
-
Tse, S. M. L., Mason, D., Botelho, R. J., Chiu, B., Reyland, M., Hanada, K., Inman, R. D., Grinstein, S.
(2005). Accumulation of Diacylglycerol in the Chlamydia Inclusion Vacuole: POSSIBLE ROLE IN THE INHIBITION OF HOST CELL APOPTOSIS. J. Biol. Chem.
280: 25210-25215
[Abstract]
[Full Text]
-
Okhrimenko, H., Lu, W., Xiang, C., Ju, D., Blumberg, P. M., Gomel, R., Kazimirsky, G., Brodie, C.
(2005). Roles of Tyrosine Phosphorylation and Cleavage of Protein Kinase C{delta} in Its Protective Effect Against Tumor Necrosis Factor-related Apoptosis Inducing Ligand-induced Apoptosis. J. Biol. Chem.
280: 23643-23652
[Abstract]
[Full Text]
-
Meyer, E., Vollmer, J.-Y., Bovey, R., Stamenkovic, I.
(2005). Matrix Metalloproteinases 9 and 10 Inhibit Protein Kinase C-Potentiated, p53-Mediated Apoptosis. Cancer Res.
65: 4261-4272
[Abstract]
[Full Text]
-
Song, M.-G., Gao, S.-M., Du, K.-M., Xu, M., Yu, Y., Zhou, Y.-H., Wang, Q., Chen, Z., Zhu, Y.-S., Chen, G.-Q.
(2005). Nanomolar concentration of NSC606985, a camptothecin analog, induces leukemic-cell apoptosis through protein kinase C{delta}-dependent mechanisms. Blood
105: 3714-3721
[Abstract]
[Full Text]
-
Gillespie, S., Zhang, X. D., Hersey, P.
(2005). Variable expression of protein kinase C{varepsilon} in human melanoma cells regulates sensitivity to TRAIL-induced apoptosis. Molecular Cancer Therapeutics
4: 668-676
[Abstract]
[Full Text]
-
DeVries, T. A., Kalkofen, R. L., Matassa, A. A., Reyland, M. E.
(2004). Protein Kinase C{delta} Regulates Apoptosis via Activation of STAT1. J. Biol. Chem.
279: 45603-45612
[Abstract]
[Full Text]
-
Efimova, T., Broome, A.-M., Eckert, R. L.
(2004). Protein Kinase C{delta} Regulates Keratinocyte Death and Survival by Regulating Activity and Subcellular Localization of a p38{delta}-Extracellular Signal-Regulated Kinase 1/2 Complex. Mol. Cell. Biol.
24: 8167-8183
[Abstract]
[Full Text]
-
Koivunen, J., Aaltonen, V., Koskela, S., Lehenkari, P., Laato, M., Peltonen, J.
(2004). Protein Kinase C {alpha}/{beta} Inhibitor Go6976 Promotes Formation of Cell Junctions and Inhibits Invasion of Urinary Bladder Carcinoma Cells. Cancer Res.
64: 5693-5701
[Abstract]
[Full Text]
-
Kedei, N., Lundberg, D. J., Toth, A., Welburn, P., Garfield, S. H., Blumberg, P. M.
(2004). Characterization of the Interaction of Ingenol 3-Angelate with Protein Kinase C. Cancer Res.
64: 3243-3255
[Abstract]
[Full Text]
-
Chu, F., Chen, L. H., O'Brian, C. A.
(2004). Cellular protein kinase C isozyme regulation by exogenously delivered physiological disulfides--implications of oxidative protein kinase C regulation to cancer prevention. Carcinogenesis
25: 585-596
[Abstract]
[Full Text]
-
Kajimoto, T., Shirai, Y., Sakai, N., Yamamoto, T., Matsuzaki, H., Kikkawa, U., Saito, N.
(2004). Ceramide-induced Apoptosis by Translocation, Phosphorylation, and Activation of Protein Kinase C{delta} in the Golgi Complex. J. Biol. Chem.
279: 12668-12676
[Abstract]
[Full Text]
-
Ventura, A., Maccarana, M., Raker, V. A., Pelicci, P. G.
(2004). A Cryptic Targeting Signal Induces Isoform-specific Localization of p46Shc to Mitochondria. J. Biol. Chem.
279: 2299-2306
[Abstract]
[Full Text]
-
Rambaratsingh, R. A., Stone, J. C., Blumberg, P. M., Lorenzo, P. S.
(2003). RasGRP1 Represents a Novel Non-protein Kinase C Phorbol Ester Signaling Pathway in Mouse Epidermal Keratinocytes. J. Biol. Chem.
278: 52792-52801
[Abstract]
[Full Text]
-
Wang, H. Q., Quan, T., He, T., Franke, T. F., Voorhees, J. J., Fisher, G. J.
(2003). Epidermal Growth Factor Receptor-dependent, NF-{kappa}B-independent Activation of the Phosphatidylinositol 3-Kinase/Akt Pathway Inhibits Ultraviolet Irradiation-induced Caspases-3, -8, and -9 in Human Keratinocytes. J. Biol. Chem.
278: 45737-45745
[Abstract]
[Full Text]
-
Inagaki, K., Chen, L., Ikeno, F., Lee, F. H., Imahashi, K.-i., Bouley, D. M., Rezaee, M., Yock, P. G., Murphy, E., Mochly-Rosen, D.
(2003). Inhibition of {delta}-Protein Kinase C Protects Against Reperfusion Injury of the Ischemic Heart In Vivo. Circulation
108: 2304-2307
[Abstract]
[Full Text]
-
Tanaka, Y., Gavrielides, M. V., Mitsuuchi, Y., Fujii, T., Kazanietz, M. G.
(2003). Protein Kinase C Promotes Apoptosis in LNCaP Prostate Cancer Cells through Activation of p38 MAPK and Inhibition of the Akt Survival Pathway. J. Biol. Chem.
278: 33753-33762
[Abstract]
[Full Text]
-
Soh, J.-W., Weinstein, I. B.
(2003). Roles of Specific Isoforms of Protein Kinase C in the Transcriptional Control of Cyclin D1 and Related Genes. J. Biol. Chem.
278: 34709-34716
[Abstract]
[Full Text]
-
Cataisson, C., Joseloff, E., Murillas, R., Wang, A., Atwell, C., Torgerson, S., Gerdes, M., Subleski, J., Gao, J.-L., Murphy, P. M., Wiltrout, R. H., Vinson, C., Yuspa, S. H.
(2003). Activation of Cutaneous Protein Kinase C{alpha} Induces Keratinocyte Apoptosis and Intraepidermal Inflammation by Independent Signaling Pathways. J. Immunol.
171: 2703-2713
[Abstract]
[Full Text]
-
Tillman, D. M., Izeradjene, K., Szucs, K. S., Douglas, L., Houghton, J. A.
(2003). Rottlerin Sensitizes Colon Carcinoma Cells to Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis via Uncoupling of the Mitochondria Independent of Protein Kinase C. Cancer Res.
63: 5118-5125
[Abstract]
[Full Text]
-
Shukla, A., Stern, M., Lounsbury, K. M., Flanders, T., Mossman, B. T.
(2003). Asbestos-Induced Apoptosis Is Protein Kinase C{delta}-Dependent. Am. J. Respir. Cell Mol. Bio.
29: 198-205
[Abstract]
[Full Text]
-
Liu, J., Chen, J., Dai, Q., Lee, R. M.
(2003). Phospholipid Scramblase 3 Is the Mitochondrial Target of Protein Kinase C {delta}-induced Apoptosis. Cancer Res.
63: 1153-1156
[Abstract]
[Full Text]
-
Chu, F., Ward, N. E., O'Brian, C. A.
(2003). PKC isozyme S-cysteinylation by cystine stimulates the pro-apoptotic isozyme PKC{delta} and inactivates the oncogenic isozyme PKC{varepsilon}. Carcinogenesis
24: 317-325
[Abstract]
[Full Text]
-
Cartee, L., Maggio, S. C., Smith, R., Sankala, H. M., Dent, P., Grant, S.
(2003). Protein Kinase C-dependent Activation of the Tumor Necrosis Factor Receptor-mediated Extrinsic Cell Death Pathway Underlies Enhanced Apoptosis in Human Myeloid Leukemia Cells Exposed to Bryostatin 1 and Flavopiridol. Molecular Cancer Therapeutics
2: 83-93
[Abstract]
[Full Text]
-
Nowak, G.
(2002). Protein Kinase C-alpha and ERK1/2 Mediate Mitochondrial Dysfunction, Decreases in Active Na+ Transport, and Cisplatin-induced Apoptosis in Renal Cells. J. Biol. Chem.
277: 43377-43388
[Abstract]
[Full Text]
-
Willis, D. B., Colburn, N. H.
(2002). Molecular Targets for Cancer Prevention: A Meeting Review of the Third American Cancer Society-Schilling Research Conference. Cancer Epidemiol. Biomarkers Prev.
11: 972-978
[Abstract]
[Full Text]
-
Morrish, B. C., Rumsby, M. G.
(2002). The 5' Untranslated Region of Protein Kinase C{delta} Directs Translation by an Internal Ribosome Entry Segment That Is Most Active in Densely Growing Cells and during Apoptosis. Mol. Cell. Biol.
22: 6089-6099
[Abstract]
[Full Text]
-
Goerke, A., Sakai, N., Gutjahr, E., Schlapkohl, W. A., Mushinski, J. F., Haller, H., Kolch, W., Saito, N., Mischak, H.
(2002). Induction of Apoptosis by Protein Kinase Cdelta Is Independent of Its Kinase Activity. J. Biol. Chem.
277: 32054-32062
[Abstract]
[Full Text]
-
Zrachia, A., Dobroslav, M., Blass, M., Kazimirsky, G., Kronfeld, I., Blumberg, P. M., Kobiler, D., Lustig, S., Brodie, C.
(2002). Infection of Glioma Cells with Sindbis Virus Induces Selective Activation and Tyrosine Phosphorylation of Protein Kinase C delta . IMPLICATIONS FOR SINDBIS VIRUS-INDUCED APOPTOSIS. J. Biol. Chem.
277: 23693-23701
[Abstract]
[Full Text]
-
Cartee, L., Smith, R., Dai, Y., Rahmani, M., Rosato, R., Almenara, J., Dent, P., Grant, S.
(2002). Synergistic Induction of Apoptosis in Human Myeloid Leukemia Cells by Phorbol 12-Myristate 13-Acetate and Flavopiridol Proceeds via Activation of Both the Intrinsic and Tumor Necrosis Factor-Mediated Extrinsic Cell Death Pathways. Mol. Pharmacol.
61: 1313-1321
[Abstract]
[Full Text]
-
Ren, J., Li, Y., Kufe, D.
(2002). Protein Kinase C delta Regulates Function of the DF3/MUC1 Carcinoma Antigen in beta -Catenin Signaling. J. Biol. Chem.
277: 17616-17622
[Abstract]
[Full Text]
-
Deucher, A., Efimova, T., Eckert, R. L.
(2002). Calcium-dependent Involucrin Expression Is Inversely Regulated by Protein Kinase C (PKC)alpha and PKCdelta. J. Biol. Chem.
277: 17032-17040
[Abstract]
[Full Text]
-
Barrett, C. M., Lewis, F. L., Roaten, J. B., Sweatman, T. W., Israel, M., Cleveland, J. L., Lothstein, L.
(2002). Novel Extranuclear-targeted Anthracyclines Override the Antiapoptotic Functions of Bcl-2 and Target Protein Kinase C Pathways to Induce Apoptosis. Molecular Cancer Therapeutics
1: 469-481
[Abstract]
[Full Text]
-
Joseloff, E., Cataisson, C., Aamodt, H., Ocheni, H., Blumberg, P., Kraker, A. J., Yuspa, S. H.
(2002). Src Family Kinases Phosphorylate Protein Kinase C delta on Tyrosine Residues and Modify the Neoplastic Phenotype of Skin Keratinocytes. J. Biol. Chem.
277: 12318-12323
[Abstract]
[Full Text]
-
Anantharam, V., Kitazawa, M., Wagner, J., Kaul, S., Kanthasamy, A. G.
(2002). Caspase-3-Dependent Proteolytic Cleavage of Protein Kinase Cdelta Is Essential for Oxidative Stress-Mediated Dopaminergic Cell Death after Exposure to Methylcyclopentadienyl Manganese Tricarbonyl. J. Neurosci.
22: 1738-1751
[Abstract]
[Full Text]
-
Carpenter, L., Cordery, D., Biden, T. J.
(2002). Inhibition of Protein Kinase C {delta} Protects Rat INS-1 Cells Against Interleukin-1{beta} and Streptozotocin-Induced Apoptosis. Diabetes
51: 317-324
[Abstract]
[Full Text]
-
Garcia-Bermejo, M. L., Leskow, F. C., Fujii, T., Wang, Q., Blumberg, P. M., Ohba, M., Kuroki, T., Han, K.-C., Lee, J., Marquez, V. E., Kazanietz, M. G.
(2002). Diacylglycerol (DAG)-lactones, a New Class of Protein Kinase C (PKC) Agonists, Induce Apoptosis in LNCaP Prostate Cancer Cells by Selective Activation of PKCalpha. J. Biol. Chem.
277: 645-655
[Abstract]
[Full Text]
-
Blass, M., Kronfeld, I., Kazimirsky, G., Blumberg, P. M., Brodie, C.
(2002). Tyrosine Phosphorylation of Protein Kinase C{delta} Is Essential for Its Apoptotic Effect in Response to Etoposide. Mol. Cell. Biol.
22: 182-195
[Abstract]
[Full Text]
-
Majumder, P. K., Mishra, N. C., Sun, X., Bharti, A., Kharbanda, S., Saxena, S., Kufe, D.
(2001). Targeting of Protein Kinase C {delta} to Mitochondria in the Oxidative Stress Response. Cell Growth Differ.
12: 465-470
[Abstract]
[Full Text]
-
VRABLIC, A. S., ALBRIGHT, C. D., CRACIUNESCU, C. N., SALGANIK, R. I., ZEISEL, S. H.
(2001). Altered mitochondrial function and overgeneration of reactive oxygen species precede the induction of apoptosis by 1-O-octadecyl-2-methyl-rac-glycero-3-phosphocholine in p53-defective hepatocytes. FASEB J.
15: 1739-1744
[Abstract]
[Full Text]
-
Alt, A., Ohba, M., Li, L., Gartsbein, M., Belanger, A., Denning, Mitchell. F., Kuroki, T., Yuspa, S. H., Tennenbaum, T.
(2001). Protein Kinase C{{delta}}-mediated Phosphorylation of {{alpha}}6{beta}4 Is Associated with Reduced Integrin Localization to the Hemidesmosome and Decreased Keratinocyte Attachment. Cancer Res.
61: 4591-4598
[Abstract]
[Full Text]
-
Mandil, R., Ashkenazi, E., Blass, M., Kronfeld, I., Kazimirsky, G., Rosenthal, G., Umansky, F., Lorenzo, P. S., Blumberg, P. M., Brodie, C.
(2001). Protein Kinase C{{alpha}} and Protein Kinase C{{delta}} Play Opposite Roles in the Proliferation and Apoptosis of Glioma Cells. Cancer Res.
61: 4612-4619
[Abstract]
[Full Text]
-
Maher, P.
(2001). How Protein Kinase C Activation Protects Nerve Cells from Oxidative Stress-Induced Cell Death. J. Neurosci.
21: 2929-2938
[Abstract]
[Full Text]
-
Otieno, M. A., Kensler, T. W.
(2000). A Role for Protein Kinase C-{{delta}} in the Regulation of Ornithine Decarboxylase Expression by Oxidative Stress. Cancer Res.
60: 4391-4396
[Abstract]
[Full Text]
-
Fujii, T., Garcia-Bermejo, M. L., Bernabo, J. L., Caamano, J., Ohba, M., Kuroki, T., Li, L., Yuspa, S. H., Kazanietz, M. G.
(2000). Involvement of Protein Kinase C delta (PKCdelta ) in Phorbol Ester-induced Apoptosis in LNCaP Prostate Cancer Cells. LACK OF PROTEOLYTIC CLEAVAGE OF PKCdelta. J. Biol. Chem.
275: 7574-7582
[Abstract]
[Full Text]
-
Bahr, C., Rohwer, A., Stempka, L., Rincke, G., Marks, F., Gschwendt, M.
(2000). DIK, a Novel Protein Kinase That Interacts with Protein Kinase Cdelta . CLONING, CHARACTERIZATION, AND GENE ANALYSIS. J. Biol. Chem.
275: 36350-36357
[Abstract]
[Full Text]
-
Jost, M., Huggett, T. M., Kari, C., Boise, L. H., Rodeck, U.
(2001). Epidermal Growth Factor Receptor-dependent Control of Keratinocyte Survival and Bcl-xL Expression through a MEK-dependent Pathway. J. Biol. Chem.
276: 6320-6326
[Abstract]
[Full Text]
-
Caloca, M. J., Wang, H., Delemos, A., Wang, S., Kazanietz, M. G.
(2001). Phorbol Esters and Related Analogs Regulate the Subcellular Localization of beta 2-Chimaerin, a Non-protein Kinase C Phorbol Ester Receptor. J. Biol. Chem.
276: 18303-18312
[Abstract]
[Full Text]
-
Matassa, A. A., Carpenter, L., Biden, T. J., Humphries, M. J., Reyland, M. E.
(2001). PKCdelta Is Required for Mitochondrial-dependent Apoptosis in Salivary Epithelial Cells. J. Biol. Chem.
276: 29719-29728
[Abstract]
[Full Text]
-
Soltoff, S. P.
(2001). Rottlerin Is a Mitochondrial Uncoupler That Decreases Cellular ATP Levels and Indirectly Blocks Protein Kinase Cdelta Tyrosine Phosphorylation. J. Biol. Chem.
276: 37986-37992
[Abstract]
[Full Text]
-
Gomez-Angelats, M., Bortner, C. D., Cidlowski, J. A.
(2000). Protein Kinase C (PKC) Inhibits Fas Receptor-induced Apoptosis through Modulation of the Loss of K+ and Cell Shrinkage. A ROLE FOR PKC UPSTREAM OF CASPASES. J. Biol. Chem.
275: 19609-19619
[Abstract]
[Full Text]