Previous Article | Next Article 
Molecular and Cellular Biology, February 1999, p. 1016-1024, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Structural Requirements and Dynamics of Mitosin-Kinetochore
Interaction in M Phase
Xueliang
Zhu*
Shanghai Research Center of Life Sciences,
Chinese Academy of Sciences, Shanghai 200031, China
Received 12 May 1998/Returned for modification 3 July 1998/Accepted 26 October 1998
 |
ABSTRACT |
Mitosin is a 350-kDa human nuclear protein which transiently
associates with centromeres and spindle poles in M phase.
Ultrastructure studies reveal that it is located at the outer
kinetochore plate. In this work, we explored the detailed structural
basis and dynamics of the mitosin-kinetochore interaction. Two major
regions important for targeting to centromeres were identified by
analyzing different deletion mutants expressed in CHO cells: (i) the
"core region" between amino acids 2792 and 2887, which was
essential for the centromere localization of mitosin; and (ii) the
internal repeats between residues 2094 and 2487, which cooperated with
the core region to achieve strong mitosin-kinetochore interaction. The core region is characteristic of two leucine zipper motifs. Deletion of
either motif abolished the centromere localization activity. In
addition, Cys2864, adjacent to the second motif, was also
essential for the activity of the core region. In contrast, the
internal repeats alone were insufficient for centromere localization.
We propose that this region may serve as a regulatory domain to
facilitate interaction of the core region with the kinetochore. We
showed that mitosin molecules entering nuclei after nuclear envelope
breakdown (NEBD) were not assembled onto kinetochores efficiently,
suggesting that the mitosin-kinetochore interaction is stabilized prior
to NEBD. This result supports the idea of an ordered process for
kinetochore assembly. Our data also suggest that mitosin might interact
with chromatin in interphase. Evidence for coordinated regulation
between the centromere-targeting and the putative chromatin-binding
activities is also provided.
 |
INTRODUCTION |
The kinetochore is a
three-layer structure located at the centromere of chromosomes.
It is required for separation of sister chromatids in eucaryotes during
M phase. Recently, accumulated evidence has also shown that, in
addition to the ability to `mechanically' move the chromosomes, the
kinetochore may also function as a sensor for the mitotic checkpoints
to guarantee precise segregation of genetic materials to daughter cells
(reviewed in references 1, 10, 21, and
25).
Dissecting its protein components is one of the approaches to
understanding the molecular basis of the mammalian kinetochore functions. Since the identification of CENP-A (for centromere protein A), CENP-B, and CENP-C (9), novel
centromere-associated proteins, including CENP-D, CENP-E, dynein,
and mitosin (also named CENP-F), have also been characterized at the
molecular level (reviewed in reference 22). Most of
them have been shown by electron microscopy to reside in distinct
regions of the kinetochore. For instance, CENP-B, a centromeric
DNA-binding protein, associates with human centromeric DNA beneath the
inner plate of the kinetochore (4, 18); CENP-A and CENP-C
are components of the inner kinetochore plate (26, 33);
mitosin/CENP-F is localized to the coronal surface of the outer
kinetochore plate (24, 39); and the two motor proteins,
dynein and CENP-E, are concentrated in the fibrous corona (5,
35). Recently, the family of centromere proteins has been further
expanded by discoveries of the human homologues of yeast Mad2
(15) and Skp1 (3) and the murine homologue of
yeast Bub1 (31). These evolutionarily conserved proteins transiently associate with centromeres and are involved in control of
the mitotic checkpoints. Clearly, proteins involved in the structure
and function of kinetochores must interact in a certain way in mature
kinetochores. This issue, however, is presently not clear.
The structural characteristics of centromere proteins have been
extensively studied. CENP-A, a histone H3 homologue of 17 kDa, targets
the centromere via a histone H3-related domain (30). CENP-B
(80 kDa) has been shown to utilize its N-terminal 125 amino acid
residues to interact with the centromere (23, 38). The target of this centromere-binding domain is a 17-bp alphoid DNA (18). In addition to this, CENP-B also forms homodimers
through a dimerization domain of 59 amino acid residues at its C
terminus (13, 38). The centromere localization domain of
CENP-C (140 kDa) lies in the homologous region with Mif2, a protein of
budding yeast required for correct segregation of chromosomes (14,
36); this region overlaps with a potential DNA-binding domain
(29, 36). CENP-E (312 kDa), a kinesin-like protein which is
required for metaphase chromosome alignment (27, 34, 37),
possesses two microtubule-binding domains (16); its
centromere localization domain, however, has not been documented in detail.
Five functional regions have been identified in mitosin, a 350-kDa
kinetochore protein. The region between amino acid residues 2961 and 3001 binds to the retinoblastoma protein (Rb) in vitro (39). Residues 2930 through 2958 contain a strong bipartite nuclear localization signal (NLS) (7, 40). Potentially,
mitosin can also form homodimers through a C-terminal domain within the region from residue 2488 to 2925 (40). A polypeptide
containing residues 2488 through 3113 is able to target the centromere
when expressed in monkey kidney CV1 cells (40). Finally, the
C-terminal portion from residue 2094 to 3113 has been shown to be
capable of spindle pole localization during M phase (41).
In this study, we tried to address the detailed structural requirements
for mitosin-kinetochore interaction and to analyze the biochemistry of
such an interaction qualitatively. We defined the structural elements
important for centromere localization of mitosin in detail. We analyzed
the dynamics of mitosin-kinetochore interaction by an in vivo
competition experiment. In addition, we showed that mitosin might
contribute to nuclear organization, possibly through association with
chromatin. The minimal polypeptide of mitosin sufficient for centromere
localization can be used as a probe to isolate a gene(s) coding for its
downstream target(s) on kinetochores. Connections between mitosin and
other kinetochore components can therefore be further explored.
 |
MATERIALS AND METHODS |
Plasmid constructs.
Construction of most deletion mutants
was based on pTN, which is able to express a FLAG-tagged mitosin mutant
containing amino acids 2094 to 3113 under control of the
tetracycline-responsive system (11, 41). All mutants
expressed were thus tagged with a FLAG epitope at their N termini.
Schematic diagrams of all constructs are shown in Fig. 1, 4A, and 5A.
Sequencing was always performed to confirm faithful ligation at
junctions during plasmid construction whenever analysis by restriction
cleavage was not possible.
To construct pTZ, the region coding for amino acids 2489 through 2901 was deleted as in E
Z (40) from pTN. In pTNR, the EcoRI restriction fragment from nucleotides 6604 to 7150 was
removed from pTN; amino acids 2178 to 2359 were therefore deleted,
similar to the deletions in E
R (40). pTND and pTNE were
constructed from pTN to express mitosin mutants with truncated C
termini as in E
C2 and E
C1 (40), respectively. To
render nuclear localization of the mitosin mutant produced by pTND, a
sequence coding for the NLS of simian virus 40 (SV40) large T antigen
(7) (5' CTAGGCCTAAGAAAAAGCGTAAAGTCA 3'/3'
CGGATTCTTTTTCGCATTTCAGTGATC 5') was introduced in frame into the
NheI site located between the FLAG-coding sequence and mitosin cDNA to form pTND-N. pTNH-N and pTNF-N contained both the NLS
and 5' coding sequence of mitosin as in pTND-N, but their 3' coding
sequences were truncated at EcoNI (at position 8775) and
ScaI (at position 8660), respectively. pTG was constructed to express the same mutant as E
G, i.e., the mutant containing amino
acids 2488 to 3113 (40), but under control of the
tetracycline-responsive system. Construction of pTC has been described
previously (41). To construct pTCP, pTC was cleaved with
BglII (at position 9561) and partially digested with
PstI; a 3.6-kb fragment was then self-ligated; pTCP
therefore contained the coding sequence from positions 8337 to 8974. To
create pTS, pTCP was cleaved at the NheI site, treated with
mung bean nuclease, and then digested with KpnI; the
resultant 3.7-kb fragment, from which only the FLAG-coding sequence was deleted, was ligated to the 1.2-kb KpnI-StuI
restriction fragment (positions 6349 to 7533) from pTN. To construct
pTSE, pTND was cleaved with EcoNI, treated with mung bean
nuclease, and then digested with BamHI; the resultant 4.2-kb
fragment was ligated to the 0.3-kb ScaI-BamHI
fragment (positions 8660 to 8974) from pTCP. pTCB was created by
further deleting the 3' coding sequence of pTS to the EcoNI
site (at position 8775). In pTCB-N, the sequence encoding the NLS of
large T antigen was introduced into pTCB in the same way as described
above. pTNC was constructed by deleting the
PvuII-EcoNI fragment (8482 to 8775) from pTN;
their incompatible termini were removed with mung bean nuclease before ligation.
To further narrow down the core region, the coding region between 8448 and 8733 was amplified by PCR with primers 10p-18 (5'
GAAAATGAAGTTGTTGATC 3') and 10p-rKB (5'
CGGATCCTCACAGATGGGCCACTTG
3'). The PCR fragment was cleaved with
BamHI and then ligated
to replace the
StuI-
BamHI fragment of pTN (7533 to 9664). The
resulting plasmid was named pTKB. The PCR fragment in pTKB was
sequenced. The sequence coding for the NLS of large T antigen
was
inserted as previously described to create pTKB-N.
Point mutations were introduced by PCR. To mutate
cysteine
2801 to serine, the cDNA fragment between
nucleotides 7080 and 8481,
in which a deletion from 7533 to 8337 resided, was amplified from
pTCB by PCR with primers 10p-7 (5'
AGTGGAGAACCTTGAAAG 3') and
10p-rC1 (5'
CTGTTT
AGAGGATTTGATCAAC 3') (antisense primer; the
mutated codon is underlined). The PCR product was cleaved with
BglII (at 7255), and the fragment containing nucleotides
7255
to 8481 was cloned into pTCB-N to replace the corresponding
BglII-
PvuII
fragment to form pTCBC1-N. To mutate
cysteine
2864 to serine, primers 10p-C2 (5'
AC
TCTTCCTTGCTTATAAGC 3') (sense
primer, the mutated
codon is underlined) and tet-rp (5' ACTGCATTCTAGTTGTGGT
3')
(its target sequence is located in the vector) were used to
amplify the 150-bp fragment from pTCB by PCR. After cleavage with
BamHI, the PCR fragment containing the sequence from 8660 to
8775
was cloned into pTCB-N to replace the corresponding
ScaI-
BamHI
fragment to create pTCBC2-N. The point
mutations in pTCBC1-N and
pTCBC2-N were both confirmed by sequencing.
The PCR fragments
in both plasmids were also sequenced. pTCBC1-N and
pTCBC2-N were
thus identical to pTCB-N, except for their point
mutations.
Transfection.
Chinese hamster ovary (CHO) cells were
maintained in Dulbecco's modified Eagle medium (DMEM; Gibco)
supplemented with 10% calf serum (Sijiqin Company, Hangzhou, China) in
an atmosphere containing 5% CO2. For stable expression,
CHO cells were transfected and selected with G418 as described
previously (41). G418-resistant colonies were then cultured
as a whole in DMEM containing 0.2 mg of G418/ml. For transient
expression, cells were assayed 48 h after transfection. To prevent
unscheduled expression, all the transfected cells were maintained
in DMEM containing tetracycline (1 µg/ml). For centromere
localization, both transient and ectopic experiments generated similar results.
IIF studies.
For indirect immunofluorescence (IIF) staining,
transfected cells were grown on coverslips overnight in the absence of
tetracycline to induce expression before fixation in methanol for 15 min at
20°C. For preparation of metaphase chromosome spread,
transfected cells were split onto glass coverslips to about 40%
confluency, synchronized first in the presence of both thymidine
(2 mM) and tetracycline (1 µg/ml) for 8 h, then
cultured overnight in fresh DMEM containing nocodazole (0.4 µg/ml) but no tetracycline. The chromosome spread was then prepared
as previously described (8). Samples on the coverslips were
fixed in cold methanol. Immunostaining was performed with anti-FLAG M2
antibody (IBI) and fluorescein isothiocyanate-conjugated anti-mouse
immunoglobulin G (Sino-American Biotechnology Company, Shanghai, China)
as described previously (39). Nuclear DNA was stained by
DAPI (4',6-diamidino-2-phenylindole). Due to the difficulty of
controlling the expression levels of different mutants in different
individual cells, it was not possible to precisely measure the
intensities of centromere-specific signals. Our results were therefore
based on both extensive observation of 10 to 20 mitotic cells
expressing each mutant and careful comparisons with records for other
related mutants. Multiple representative images were recorded on Kodak
Gold III (ASA400) or Lucky Pan SHD400 films with an Olympus BX50
fluorescence microscope. Prints were digitized using a Umax Vista-S6
scanner. Images for publication were organized by using Photoshop
software and directly exported from a Tektronix Phaser 450 image printer.
 |
RESULTS |
Identification of the structural elements important for
mitosin-kinetochore interaction.
To further understand the
structural basis of control of the centromere association of mitosin,
we performed detailed deletion analysis to define its centromere
localization domain. In a previous study, my colleagues and I
showed that a mutant containing amino acid residues 2488 to 3113 localizes to the centromere region (40). Attempts to
further define the domain, however, were precluded due to strong
cytoplasmic IF in mitotic cells expressing shorter mutants; the
centromere-specific signals appeared to be overwhelmed by the
background generated by free mitosin. Furthermore, mitotic cells
expressing mutants were rare in many cases. We thus considered that if
we could reduce the expression levels, subcellular targets of the
mutants might be highlighted. Moreover, a lower expression level might
also reduce the extent of cell cycle block caused by overexpression of
mitosin (39). We therefore utilized the tetracycline-responsive system (11) to express FLAG-tagged
mitosin mutants. The CHO cell line was used as the host cell line due to its relatively low chromosome number (2N = 20).
Expression levels were indeed reduced when interphase CHO cells
expressing identical mutants under control of either the
cytomegalovirus promoter or the tetracycline-responsive promoter were
compared by IIF microscopy (data not shown). Similar examination showed that the average levels of most mutants expressed in CHO cells were
compatible; only mitosin-pTCP showed a relatively low expression level
(data not shown). For IIF study, we prepared chromosome spreads by
using nocodazole-arrested cells to achieve clearer results. To
avoid a possible effect of different subcellular localization on
centromere targeting, we introduced an NLS into mutants in which
the intrinsic NLS had been deleted.
We first confirmed that results achieved in CHO cells were
consistent with previous ones in CV1. Similar to results
obtained
in CV1 cells by using plasmids E

N and E

Z
(
40), a mitosin mutant
expressed in CHO from pTN, named
mitosin-pTN, exhibited strong
centromere IF (Fig.
1A and Fig.
2, panels 1 to 3), while
mitosin-pTZ
lacked the ability for centromere localization (Fig.
1A and
Fig.
2, panels 4 to 6). Further analysis showed that regions from amino
acid residues 2488 to 2755 and from residues 2967 to 3113 were
both
dispensable because mitosin-pTS localized to centromeres
effectively
(Fig.
1A and Fig.
2, panels 7 to 9). Further deletion
of residues 2756 to 2862 from pTS (which generated mitosin-pTSE),
however, completely
abolished centromere localization (Fig.
1A
and Fig.
2, panels 10 to
12). On the other hand, while mitosin-pTNH-N
(containing amino acids
2094 to 2901) was positive for centromere
localization (Fig.
1 and data
not shown), mitosin-pTNF-N (containing
residues 2094 to 2862) was
completely negative (Fig.
1A and Fig.
2, panels 13 to 15).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Determination of structural elements important for
centromere localization of mitosin. (A) Diagrams of representative
mutants used in this study. A diagram showing both structural
characteristics of the full-length mitosin and restriction sites on its
cDNA used for plasmid construction is displayed on top. Names of the
constructs are printed on the left for each mutant. Numbers
represent positions of amino acid residues. PKKKRKV indicates an
insertion of the NLS of SV40 large T antigen. All the listed mutants
were nuclear proteins in interphase as expected (data not shown). Their
abilities for centromere localization (+, positive; , negative) are
summarized on the right. Dashed lines indicate common boundaries shared
by multiple mutants. The essential core region is located between
residues 2792 and 2887. (B) Sequence of the core region. Leucines in
each putative leucine zipper are underlined. Arrowheads indicate the
two cysteine residues on which we performed mutagenesis studies (Fig.
4).
|
|

View larger version (106K):
[in this window]
[in a new window]
|
FIG. 2.
IIF images of representative mitosin mutants. CHO cells
transfected with mitosin mutants were plated on coverslips,
synchronized to prometaphase, and subjected to preparation of in situ
chromosome spreads. Samples were then immunostained with anti-FLAG M2
monoclonal antibody and fluorescein isothiocyanate-conjugated goat
anti-mouse immunoglobulin G. Chromosomes were visualized by DAPI
staining. All the left panels are IIF images of different mutants. All
the right panels are images of chromosomes. The middle panels consist
of superimposed images. The names of plasmids used for transfection are
listed on the left. Arrowheads indicate typical centromere IF of
positive mutants. One typical mitotic cell is shown for each mutant.
The insets in panels 16 and 17 are amplified images included to
highlight the weak centromere-specific IF. Scale bar, 10 µm.
|
|
Further analysis showed that a critical region (which we refer to as
the core region) was located within residues 2756 to
2901. Although
mitosin-pTG (containing amino acids 2488 to 3113;
Fig.
1A) was
identical to the polypeptides expressed by E

G (
40),
it
did exhibit clearer centromere IF over the background due to
lowered
expression levels (data not shown). Centromere localization
was also
observed in mitotic cells expressing mitosin-pTC, a shorter
mutant
containing residues 2756 to 3113 (Fig.
1A and Fig.
2, panels
16 to 18).
In contrast to positive mutants containing the internal
repeats (such
as mitosin-pTN and mitosin-pTS), both mitosin-pTG
and mitosin-pTC bound
weakly to kinetochores; the centromere-specific
IF was only a little
stronger than the cytoplasmic staining (Fig.
2, panels 16 to 18, and
data not shown). Mitosin-pTC appeared
even more unstable at centromeres
since it was hardly detectable
in cells that were well swelled in
hypotonic buffer (data not
shown).
The negative results from mitosin-pTCP (containing amino acids 2756 to
2966; Fig.
1A) in multiple experiments (data not shown),
however,
obscured the possibility that the core region might serve
as a discrete
centromere localization domain, implying a complex
situation in terms
of the centromere localization of mitosin.
In contrast to mitosin-pTS,
which localized to centromeres strongly
(Fig.
2, panels 7 to 9),
mitosin-pTCP lacks only the internal
repeat region (Fig.
1A). We also
noted that strong centromere
IF but low cytoplasmic background actually
correlated with all
the tested positive mutants containing the internal
repeats, for
instance, mitosin-pTN (Fig.
1A and Fig.
2, panels 1 to 3)
and
mitosin-pTS (Fig.
1A and Fig.
2, panels 7 to 9), suggesting high
binding affinities of these mutants for kinetochores. On the other
hand, although mitosin-pTG and -pTC, which lacked the internal
repeats,
were both able to localize to centromeres, their affinities
for
kinetochores were low; the majority of the mutants appeared
to be free
forms or the cytoplasmic background. These observations
suggested that
the internal repeats were also important for mitosin-kinetochore
interaction. Contribution of the internal repeats to centromere
localization was further corroborated by mitosin-pTNR. This mutant
contained only one chimeric repeat, in contrast to mitosin-pTN
(Fig.
1A). However, it targeted centromeres more weakly than the
latter did
(Fig.
2, panels 1 to 3 and 19 to 21). Similar to the
weakly positive
mutant mitosin-pTC, the majority of mitosin-pTNR
also appeared as free
forms (background) (Fig.
2, panels 19 to
21). Both the repeat units
were therefore required for maximal
localization potential of mitosin
to centromeres. In contrast
to mitosin-pTC, however, the repeat region
alone did not target
the centromeres, as indicated by results from
mitosin-pTZ, -pTSE,
and -pTNF-N (Fig.
1A and
2) as well as a mutant
containing the
repeats only (data not shown). These results suggested
that strong
centromere localization of mitosin might require
combination of
both the internal repeat region and the core region.
Apparently,
as indicated by results from mitosin-pTG and -pTC, certain
sequences
adjacent to the core region were also involved in the
centromere
localization of
mitosin.
The behaviors of mitosin-pTCB-N (Fig.
1A) confirmed our speculation.
Indeed, this mutant targeted centromeres efficiently
(Fig.
2, panels 22 to 24). Clear centromere IF with low background
resembled the patterns
produced by mitosin-pTN and -pTS. Between
amino acid residues 2756 and
2901, there are two leucine zipper
motifs, spanning residues 2797 to
2818 and 2866 to 2887 (Fig.
1B). Deleting either motif (as in the case
of mitosin-pTSE and
mitosin-pTNF-N) abolished centromere localization
(Fig.
1A and
2). Indeed, as proved with mitosin-pTKB-N, a shorter
region just
spanning both the leucine zipper motifs was sufficient for
the
core region function (Fig.
1A and data not shown). The core region
was therefore defined as residues 2792 to 2887 (Fig.
1B).
We noticed that many mutants tended to form huge amorphous aggregates
in cells, probably due to destruction of molecular integrity
by
mutagenesis. Among these mutants were mitosin-pTS, -pTSE, -pTNF-N,
-pTCB-N, and -pTKB-N (Fig.
2 and
3 and
data not shown). All these
mutants were correlated with C-terminal
truncation. Such aggregates
were frequently observed in cells at either
interphase or M phase;
for nuclear proteins, aggregates were also found
in the cytoplasm
(Fig.
2 and
3 and data not shown). In contrast,
mutants such as
mitosin-pTN, -pTNR, -pTNE, -pTNC, -pTG, and -pTC
(
41) behaved
relatively normally in cells in interphase:
their distribution
in the nucleus was relatively uniform, and no
aggregates were
noticed in the cytoplasm (see Fig.
5) (data not shown).
Aggregate
formation added further complexity to our study. Fortunately,
aggregation did not alter the centromere localization properties
because centromere-specific IF was readily detected in positive
mutants
with an aggregation tendency, e.g., mitosin-pTS and -pTCB-N
(Fig.
2,
panels 7 to 9 and 22 to 24). Neither did the aggregation
significantly alter the affinities of mutants for
kinetochores,
because these mutants exhibited strong centromere IF
comparable
with that of mitosin-pTN (Fig.
2, panels 1 to 3, 7 to 9, and
22
to 24). These observations allowed us to directly compare the
centromere localization properties among different mutants.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 3.
Subcellular localization of mitosin-pTCB-N and
mitosin-pTCB in the cell cycle. CHO cells transfected with pTCB-N and
pTCB were grown, respectively, on coverslips overnight in the absence
of tetracycline and fixed in cold methanol. Mitosin mutants were
stained with anti-FLAG M2 monoclonal antibody and fluorescein
isothiocyanate-conjugated goat anti-mouse immunoglobulin G (panels 1, 3, 5, and 7). Chromosomes were visualized by DAPI (panels 2, 4, 6, and
8). Both mutants tended to form aggregates in the majority of cells
throughout the cell cycle. To highlight the centromere-specific
localization of mitosin-pTCB-N, only mitotic cells with few aggregates
are shown. (A) Diagrams of constructs used in this assay. Numbers
indicate positions of amino acid residues. (B) Mitosin-pTCB-N forms
strong centromere dots during M phase. Arrowheads indicate positions of
centromere-specific IF. (C) Localization of mitosin-pTCB to centromeres
is hardly detectable throughout M phase. A typical cell is shown at
interphase (panels 1 and 2), at prophase (panels 3 and 4), at metaphase
(panels 5 and 6), and at telophase (panels 7 and 8). Scale bar, 20 µm.
|
|
Binding of mitosin to kinetochores is hindered after NEBD.
To
explore the dynamics of the mitosin-kinetochore interaction, we studied
the ability of a competitor, mitosin-pTCB, to target to centromeres in
unsynchronized cells. As a cytoplasmic protein, mitosin-pTCB would be
sequestered outside the nucleus until nuclear envelope breakdown
(NEBD). Then it would compete with endogenous mitosin for sites on
kinetochores. Mitosin-pTCB-N and mitosin-pTCB differed by only the
presence of an artificial NLS in the former (Fig. 3A). Mitosin-pTCB-N
was therefore a nuclear protein in interphase (Fig. 3B, panels 1 to 2),
while mitosin-pTCB was cytoplasmic (Fig. 3C, panels 1 to 2). Although
both mutants formed huge aggregates in cells at different stages of the
cell cycle, their centromere localization properties were not
significantly affected, similar to other mutants discussed previously.
Similar to the wild-type mitosin, mitosin-pTCB-N redistributed to the
centromeres in prophase (Fig. 3B, panels 3 to 4). In contrast to this,
mitosin-pTCB stayed in the cytoplasm in prophase; no detectable IF was
observed in the nucleus in prophase (Fig. 3C, panels 3 to 4). In
addition to that at prophase, strong centromere localization of
mitosin-pTCB-N persisted in cells at metaphase (Fig. 3B, panels 5 to 6)
and anaphase (panels 7 to 8). Mitosin-pTCB, however, was still hardly
observed at centromeres, even after NEBD, e.g., in cells at metaphase
(Fig. 3C, panels 5 to 6) and anaphase (panels 7 to 8). Nevertheless, mitosin-pTCB was capable of centromere localization: when it was exposed to kinetochores for a prolonged period, e.g., in mitotic cells
arrested by nocodazole, positive signals at centromeres were observed
(data not shown). These data indicated that mitosin molecules available
after NEBD could no longer be incorporated into kinetochores efficiently.
Cysteine2864 is essential for the activity of the core
region.
In addition to the two leucine zipper motifs in the core
region, another notable feature is the two cysteine residues located at
positions 2801 and 2864 (Fig. 1B). The first cysteine lies in the first
leucine zipper motif, and the second one is close to the second motif.
To examine if these cysteines were essential for the activity of the
core region, we mutated the codon of each cysteine into serine based on
construct pTCB-N. The resulting plasmids, pTCBC1-N and pTCBC2-N, were
capable of expressing polypeptides identical to mitosin-pTCB-N except
for the point mutations Cys2801
Ser and
Cys2864
Ser, respectively (Fig.
4A). Proper expression of these mutants was confirmed by immunoblotting (data not shown). We found that both
mutants formed amorphous aggregates throughout the cell cycle (Fig. 4B
and data not shown) like their parental mutant, mitosin-pTCB-N (Fig.
3B). Nevertheless, the point mutation at Cys2801 did not
affect the centromere localization of the mutant (Fig. 4B, panels 1 to
3). The mutation at Cys2864, however, completely abolished
localization of the mutant to centromeres (Fig. 4B, panels 4 to 6).
Cys2864 was therefore a critical residue for the activity
of the core region. According to these results, Cys2801 and
Cys2864 are unlikely to form a disulfide bridge with each
other.

View larger version (97K):
[in this window]
[in a new window]
|
FIG. 4.
Cysteine2864 is an essential amino acid for
the centromere localization of mitosin. (A) Diagrams showing the point
mutants used in this study. Both the plasmids were constructed based on
pTCB-N (Fig. 1A). Restriction sites used for construction are shown.
The positions of point mutations are also indicated. Numbers indicate
positions of amino acid residues. (B) IIF images of the point mutants.
CHO cells were transfected with pTCBC1-N or pTCBC2-N. Chromosome
spreads and IIF staining were performed as described in the legend to
Fig. 2. Similar to their parental mutant, mitosin-pTCB-N, both point
mutants tended to aggregate in cells. Left panels, IIF images; right
panels, chromosomes visualized by DAPI staining; middle panels,
superimposed images. Panels 1 to 3 show a typical mitotic cell
expressing mitosin-pTCBC1-N; strong centromere localization was
observed despite the existence of aggregates. Panels 4 to 6 show a
mitotic cell expressing mitosin-pTCBC2-N; no centromere localization
was observed. Differences in the sizes of chromosomes are due to
different extents of expansion in hypotonic buffer during sample
preparation. Scale bar, 10 µm.
|
|
Mitosin colocalizes with nuclear DNA in interphase.
The
nuclear matrix has been shown to serve as sites of chromatin
organization in the nucleus (2, 6). Mitosin/CENP-F is a
nuclear matrix protein in interphase (17, 24). We frequently noticed that, in interphase, mitosin tended to closely colocalize with
DAPI-stained nuclear DNA. Such a colocalization was not highlighted in
wild-type mitosin and some deletion mutants (e.g., mitosin-pTN) due to
the relatively homogeneous distributions of both mitosin and DNA (Fig.
5A and 5B, panels 1 to 2)
(39-41). Nevertheless, in nuclei swollen by hypotonic
buffer, colocalization of wild-type mitosin with nuclear DNA in CV1
cells was observed by IIF microscopy (data not shown). In addition,
colocalization was obvious with certain mutants, such as mitosin-pTC
(41), mitosin-pTNE (Fig. 5A and 5B, panels 3 to 4), and
mitosin-pTZ (Fig. 5A and 5B, panels 7 to 8). In cells expressing these
mutants, brightly stained DNA foci were frequently superimposed with
strong IF of mitosin mutants. It appeared that these mutants somehow
altered the chromatin organization in the nucleus because the
distinct DNA foci were usually not observed in mock-transfected
cells (Fig. 5B and data not shown). On the other hand, all the tested
mutants with truncations to residue 2949 and further removed from the C
terminus (i.e., mitosin-pTND-N and -pTCB-N) completely lost such a
colocalization (Fig. 5A, 5B, panels 5 to 6, and 3B). These results
implied that mitosin might interact with chromatin proteins or DNA. As
summarized in Fig. 5A, a putative chromatin-binding domain of mitosin
was speculated to lie between residues 2902 and 3037.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 5.
Mitosin colocalizes with nuclear DNA in interphase. (A)
Diagrams of representative mitosin mutants used in this study.
Restriction sites used for constructing the listed plasmids are shown
at the top. The ability of each mutant to colocalize with DNA is
summarized on the right. A putative chromatin-binding domain is
speculated to exist between residues 2902 and 3037 and is indicated
between dashed lines. (B) IF images of the mutants. CHO cells
transfected with pTN, pTNE, pTND-N, and pTZ were fixed on coverslips
and subjected to IIF microscopy as described in the legend to Fig. 3.
All the listed mutants were nuclear proteins in interphase as expected.
Panels 1, 3, 5, and 7, IF images of different mutants; panels 2, 4, 6, and 8, nuclear DNA stained by DAPI. Arrowheads indicate typical areas
where mitosin mutants colocalize with condensed DNA. Typical cells at
interphase expressing mitosin-pTN (panels 1 and 2), mitosin-pTNE
(panels 3 and 4), mitosin-pTND-N (panels 5 and 6), and mitosin-pTZ
(panels 7 and 8) are displayed. Scale bar, 20 µm.
|
|
Deletion of the core region results in distribution of mitosin
along chromosomes.
In prophase, mitosin/CENP-F dissociates from
the nuclear matrix and redistributes to kinetochores (17, 24,
39). Therefore, activation of the centromere colocalization
property should be accompanied by loss of its nuclear
matrix-associating as well as the putative chromatin-binding
activities. To test if there might be any direct connections among
these events, we deleted the core region from mitosin-pTN to form
mitosin-pTNC, which lacked residues 2804 to 2901 of mitosin-pTN (Fig.
6A). Mitosin-pTNC did not aggregate in interphase cells; it was
distributed in the nucleus in a pattern similar to that of mitosin-pTZ
(data not shown). To our surprise, mitosin-pTNC appeared to fail to
completely dissociate from chromatin in M phase since bright foci of
various sizes were observed along virtually all chromosomes (Fig.
6B). The number of foci on chromosomes
varied from cell to cell, as shown in Fig. 6B, panels 1 to 3 and 4 to
6. We also noticed that some of the foci only partially associated with
chromosomes (panel 2). In some cases, especially when the foci on
chromosomes were dense, immunofluorescence could be observed at
centromere regions of some, but not all, chromosomes (data not shown).
Detailed study showed that such centromere colocalization was
nonspecific, since, in many cases, IF at centromeres was not observed
(panels 1 to 3). These results suggest that the core region might
down-regulate the putative chromatin-binding activity of mitosin in
prophase.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 6.
Mitosin-pTNC is distributed along chromosomes in M
phase. Chromosome spreads prepared from CHO cells expressing
mitosin-pTNC were subjected to IIF staining as described in the legend
to Fig. 2. (A) Diagrams for mitosin-pTNC. Numbers indicate positions of
amino acids. (B) IF images. Left panels, IIF images of transfected
cells; right panels, chromosome images stained by DAPI; middle panels,
superimposed images. Panels 1 to 3 show a mitotic cell bearing large
foci along chromosomes; arrows indicate centromeres without IF label.
Panels 4 to 6 show a mitotic cell bearing dense IF dots along
chromosomes. Scale bar, 10 µm.
|
|
 |
DISCUSSION |
The structural basis for mitosin-kinetochore
interaction.
By performing deletion analysis, we found that two
major structural elements, the internal repeats from residues
2094 through 2487 and the core region located between residues
2792 and 2887, were critical for strong mitosin-kinetochore
interaction. Their contributions to the centromere localization
property, however, were clearly different. Although independent
localization to centromeres was not detected, the core region was
indeed essential for the centromere localization of mitosin: without
this region (e.g., in mitosin-pTNC and -pTZ), or even when the region
was partially deleted (e.g., in mitosin-pTSE and -pTNF-N) or
point mutated (e.g., in mitosin-pTCBC2-N), the corresponding
mutants never exhibited centromere localization. Without the repeat
region, in contrast, some mutants containing the core region (e.g.,
mitosin-pTG and -pTC) were still able to manifest centromere
localization in spite of their weak affinities. Clearly, some sequences
in the vicinity of the core region could partially compensate for the
function of the internal repeats. In spite of this, clearly strong
centromere localization was observed only in mutants containing both
the internal repeats and the core region (e.g., mitosin-pTN, -pTS, -pTCB-N, and -pTKB-N). In addition, we found that both the repeat units
were required for maximal mitosin-kinetochore interaction. How the
internal repeats coordinate with the core region to achieve strong
centromere localization is still an intriguing mystery. Our data
suggest that the internal repeats (and other minor elements adjacent to
the core region), instead of binding to kinetochores directly, might
facilitate and/or stabilize the core region-kinetochore interaction.
Neither the core region nor the internal repeats of mitosin show
significant sequence homology with centromere localization
domains of
other centromere proteins. The core region contains
two leucine
zipper motifs. Deletion of either one abolished localization
to
centromeres. These two motifs could potentially form heterodimers
with
their downstream partners on the kinetochore. The core region
also
contains two cysteine residues. Cys
2864, which lies
adjacent to the second leucine zipper motif, was
found to be an
essential amino
acid.
We have shown previously that there is a potential dimerization domain
within residues 2488 through 2925 (
40). Since this
region
includes the core region (residues 2792 to 2887), the latter
could be
merely a dimerization domain that was passively targeted
to the
centromeres via dimer formation with endogenous hamster
mitosin. We
excluded this possibility by studying the subcellular
localization of
mitosin-pTCB in unsynchronized CHO cells. If the
core region (together
with the internal repeats) did not dimerize
with hamster mitosin,
mitosin-pTCB would stay outside the nucleus
until NEBD at prometaphase;
otherwise, this mutant would be brought
into the nucleus by endogenous
mitosin prior to NEBD. We examined
prophase cells expressing
mitosin-pTCB carefully. Neither nuclear
nor centromere localization was
observed in these cells (Fig.
3C). Lack of centromere localization was
not due to loss of this
ability since, when cells expressing
mitosin-pTCB were blocked
at prometaphase by nocodazole, weak
centromere localization was
detected in chromosome spread (data not
shown). Therefore, neither
the core region nor the internal
repeats were capable of
homodimerization.
The minimal fragment capable of centromere localization with high
affinity (e.g., mitosin-pTKB-N) will be used as a probe
to clone the
gene(s) coding for the downstream target(s) of mitosin.
The
molecular architecture of the kinetochore can thus be approached
progressively.
The dynamics of mitosin-kinetochore interaction.
With the
study of a cytoplasmic mutant, mitosin-pTCB, we explored the kinetics
of mitosin-kinetochore interaction qualitatively. We found that bound
mitosin did not exchange its binding sites easily with free forms after
NEBD. Significant exchange could be observed only when mitosis was
blocked to allow prolonged time of competition. This result implied
that the assembly of mitosin into kinetochores was completed prior to
NEBD. After this point, free mitosin could no longer be recruited into
kinetochores effectively. One of the possible explanations is that,
after NEBD, access to the bound mitosin or mitosin-binding sites is
denied by another component(s) of kinetochores assembled after mitosin.
It has long been suspected that functional kinetochores are assembled
in multiple stages. In cells at interphase, precursors of kinetochores,
or prekinetochores, are found as discrete foci which contain certain centromere proteins (e.g., CENP-A, CENP-B, and CENP-C) colocalized with
alphoid satellite DNA (12, 19, 20). In contrast, mitosin is
one of the components assembled onto kinetochores in prophase (39).
The core region may regulate the putative chromatin-binding
activity of mitosin.
Several lines of evidence suggest that
mitosin might bind to chromatin proteins or DNA in interphase. First,
several mitosin mutants colocalized with brightly stained DNA foci in
cells at interphase. Among cells expressing mitosin-pTZ, for instance, those bright DNA foci were observed only in transfected cells; mitosin-pTZ appeared to have reorganized chromatin distribution in
these cells (Fig. 5B). This phenomenon was also observed in cells
expressing mitosin-pTNE (Fig. 5B), mitosin-pTC (41), and several other mutants (data not shown). Second, our data suggested that
there might be a chromatin-binding domain between residues 2902 and
3037. This region covers the previously identified in vitro Rb-binding
domain and the intrinsic NLS (39, 40). Third, mitosin-pTNC exhibited both the colocalization with nuclear DNA in interphase and localization along chromosomes in mitotic
cells. Last, during interphase, wild-type mitosin also colocalized with nuclear DNA in cells treated with hypotonic buffer (data not shown). The nuclear matrix is a complex structure implicated in multiple functions including chromatin organization (reviewed in references 2 and 6). The present
results further imply that, as a nuclear matrix protein in
interphase (17), mitosin/CENP-F might provide sites of
attachment for proper chromatin organization. Detailed studies at
the electron microscopic level are required to further test these speculations.
The chromosome localization of mitosin-pTNC, a mutant lacking only the
core region of mitosin-pTN, provided possible insights
into the
regulation of different activities in mitosin. Activation
of the core
region (possibly by hyperphosphorylation of mitosin
at or after the
G
2/M transition [
39]) might in turn
deactivate
the interaction of mitosin with chromatin for concerted
behaviors
of the molecule during the cell cycle (
39). In
this case, the
putative chromatin-binding property of mitosin would be
functional
only in interphase. Nevertheless, colocalization of mitosin
with
nuclear DNA could have resulted from interaction with
nuclear
components other than chromatin. The aberrant association
of mitosin-pTNC
with chromosomes could also be due to artifacts
generated by mutant
proteins. Although several centromere
proteins, including CENP-A
(
28,
32,
33), CENP-B (
18,
23,
38), and CENP-C (
29,
36), have been shown to
possess DNA-binding activities, direct
evidence is required to clarify
if mitosin indeed binds directly
to chromatin proteins or DNA in
cells.
 |
ACKNOWLEDGMENTS |
This work was supported by grant KJ951-B1-608 and President's
fund from the Chinese Academy of Sciences, grant 97JC14006 from the
Shanghai Committee of Science and Technology, and grant 39500030 from
the National Natural Science Foundation of China.
I thank Xia Sun for her excellent technical assistance. I also thank
Chi Zhang, Xiaohua Gong, Dating Lin, Ning Liu, and Zhe Qu for their
technical assistance during their stay in the lab.
 |
FOOTNOTES |
*
Mailing address: Shanghai Research Center of Life
Sciences, Chinese Academy of Sciences, 320 Yue Yang Rd., Shanghai
200031, China. Phone: 86-21-64748700, ext. 169. Fax: 86-21-64333084. E-mail: xlzhu{at}iris.shlc.ac.cn.
 |
REFERENCES |
| 1.
|
Allshire, R. C.
1997.
Centromeres, checkpoints and chromatid cohesion.
Curr. Opin. Genet. Dev.
7:264-273[Medline].
|
| 2.
|
Berezney, R.,
M. J. Mortillaro,
H. Ma,
X. Wei, and J. Samarabandu.
1995.
The nuclear matrix: a structural milieu for genomic function.
Int. Rev. Cytol.
162A:1-65.
|
| 3.
|
Connelly, C., and P. Hieter.
1996.
Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression.
Cell
86:275-285[Medline].
|
| 4.
|
Cooke, C. A.,
R. L. Bernat, and W. C. Earnshaw.
1990.
CENP-B: a major human centromere protein located beneath the kinetochore.
J. Cell Biol.
110:1475-1488[Abstract/Free Full Text].
|
| 5.
|
Cooke, C. A.,
B. Schaar,
T. J. Yen, and W. C. Earnshaw.
1997.
Localization of CENP-E in the fibrous corona and outer plate of mammalian kinetochores from prometaphase through anaphase.
Chromosoma
106:446-455[Medline].
|
| 6.
|
Davie, J. R.
1995.
The nuclear matrix and the regulation of chromatin organization and function.
Int. Rev. Cytol.
162A:191-250.
|
| 7.
|
Dingwall, C., and R. A. Laskey.
1991.
Nuclear targeting signal sequences a consensus?
Trends Biochem. Sci.
16:478-481[Medline].
|
| 8.
|
Earnshaw, W. C.,
N. Halligan,
C. A. Cooke, and N. Rothfield.
1984.
The kinetochore is part of metaphase chromosome scaffold.
J. Cell Biol.
98:352-357[Abstract/Free Full Text].
|
| 9.
|
Earnshaw, W. C., and N. Rothfield.
1985.
Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma.
Chromosoma
91:313-321[Medline].
|
| 10.
|
Gorbsky, G. J.
1997.
Cell cycle checkpoints: arresting progress in mitosis.
Bioessays
19:193-197[Medline].
|
| 11.
|
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci. USA
89:5547-5551[Abstract/Free Full Text].
|
| 12.
|
He, D., and B. R. Brinkley.
1996.
Structure and dynamic organization of centromeres/prekinetochores in the nucleus of mammalian cells.
J. Cell Sci.
109:2693-2704[Abstract].
|
| 13.
|
Kitagawa, K.,
H. Masumoto,
M. Ikeda, and T. Okazaki.
1995.
Analysis of protein-DNA and protein-protein interactions of centromere protein B (CENP-B) and properties of the DNA-CENP-B complex in the cell cycle.
Mol. Cell. Biol.
15:1602-1612[Abstract].
|
| 14.
|
Lanini, L., and F. McKeon.
1995.
Domains required for CENP-C assembly at the kinetochore.
Mol. Biol. Cell
6:1049-1059[Abstract].
|
| 15.
|
Li, Y., and R. Benezra.
1996.
Identification of a human mitotic checkpoint gene: hsMAD2.
Science
274:246-248[Abstract/Free Full Text].
|
| 16.
|
Liao, H.,
G. Li, and T. J. Yen.
1994.
Mitotic regulation of microtubule cross-linking activity of CENP-E kinetochore protein.
Science
265:394-398[Abstract/Free Full Text].
|
| 17.
|
Liao, H.,
R. J. Winkfein,
G. Mack,
J. B. Rattner, and T. J. Yen.
1995.
CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis.
J. Cell Biol.
130:507-518[Abstract/Free Full Text].
|
| 18.
|
Masumoto, H.,
H. Masukata,
Y. Muro,
N. Nozaki, and T. Okazaki.
1989.
A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite.
J. Cell Biol.
109:1963-1973[Abstract/Free Full Text].
|
| 19.
|
Masumoto, H.,
K. Sugimoto, and T. Okazaki.
1989.
Alphoid satellite DNA is tightly associated with centromere antigens in human chromosomes throughout the cell cycle.
Exp. Cell Res.
181:181-196[Medline].
|
| 20.
|
Moroi, Y.,
A. L. Hartman,
P. K. Nakane, and E. M. Tan.
1981.
Distribution of kinetochore (centromere) antigen in mammalian cell nuclei.
J. Cell Biol.
90:254-259[Abstract/Free Full Text].
|
| 21.
|
Nicklas, R. B.
1997.
How cells get the right chromosomes.
Science
275:632-637[Abstract/Free Full Text].
|
| 22.
|
Pluta, A. F.,
A. M. Mackay,
A. M. Ansztein,
I. G. Goldberg, and W. C. Earnshaw.
1995.
The centromere: hub of chromosomal activities.
Science
270:1591-1594[Abstract/Free Full Text].
|
| 23.
|
Pluta, A. F.,
N. Saitoh,
I. Goldberg, and W. C. Earnshaw.
1992.
Identification of a subdomain of CENP-B that is necessary and sufficient for localization to the human centromere.
J. Cell Biol.
116:1081-1093[Abstract/Free Full Text].
|
| 24.
|
Rattner, J. B.,
A. Rao,
M. J. Fritzler,
D. W. Valencia, and T. J. Yen.
1993.
CENP-F is a ca. 400 kDa kinetochore protein that exhibits a cell-cycle dependent localization.
Cell Motil. Cytoskelet.
26:214-226[Medline].
|
| 25.
|
Rudner, A. D., and A. W. Murray.
1996.
The spindle assembly checkpoint.
Curr. Opin. Cell Biol.
8:773-780[Medline].
|
| 26.
|
Saitoh, H.,
J. Tomkiel,
C. A. Cooke,
H. Ratrie III,
M. Maurer,
N. F. Rothfield, and W. C. Earnshaw.
1992.
CENP-C, an autoantigen in scleroderma, is a component of the human inner kinetochore plate.
Cell
70:115-125[Medline].
|
| 27.
|
Schaar, B. T.,
G. K. Chan,
P. Maddox,
E. D. Salmon, and T. J. Yen.
1997.
CENP-E function at kinetochores is essential for chromosome alignment.
J. Cell Biol.
139:1373-1382[Abstract/Free Full Text].
|
| 28.
|
Shelby, R. D.,
O. Vafa, and K. F. Sullivan.
1997.
Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites.
J. Cell Biol.
136:501-513[Abstract/Free Full Text].
|
| 29.
|
Sugimoto, K.,
H. Yata, and M. Himeno.
1994.
Human centromere protein C (CENP-C) is a DNA-binding protein which possesses a novel DNA-binding motif.
J. Biochem. (Tokyo)
116:877-881[Abstract/Free Full Text].
|
| 30.
|
Sullivan, K. F.,
M. Hechenberger, and K. Masri.
1994.
Human CENP-A contains a histone H3 related histone fold domain that is required for targeting to the centromere.
J. Cell Biol.
127:581-592[Abstract/Free Full Text].
|
| 31.
|
Taylor, S. S., and F. McKeon.
1997.
Kinetochore localization of murine Bub1 is required for normal mitotic timing and checkpoint response to spindle damage.
Cell
89:727-735[Medline].
|
| 32.
|
Vafa, O., and K. F. Sullivan.
1997.
Chromatin containing CENP-A and alpha-satellite DNA is a major component of the inner kinetochore plate.
Curr. Biol.
7:897-900[Medline].
|
| 33.
|
Warburton, P. E.,
C. A. Cooke,
S. Bourassa,
O. Vafa,
B. A. Sullivan,
G. Stetten,
G. Gimelli,
D. Warburton,
C. Tyler-Smith,
K. F. Sullivan,
G. G. Poirier, and W. C. Earnshaw.
1997.
Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres.
Curr. Biol.
7:901-904[Medline].
|
| 34.
|
Wood, K. W.,
R. Sakowicz,
L. S. Goldstein, and D. W. Cleveland.
1997.
CENP-E is a plus end-directed kinetochore motor required for metaphase chromosome alignment.
Cell
91:357-366[Medline].
|
| 35.
|
Wordeman, L.,
E. R. Steuer,
M. P. Sheetz, and T. Mitchison.
1991.
Chemical subdomains within the kinetochore domain of isolated CHO mitotic chromosomes.
J. Cell Biol.
114:285-294[Abstract/Free Full Text].
|
| 36.
|
Yang, C. H.,
J. Tomkiel,
H. Saitoh,
D. H. Johnson, and W. C. Earnshaw.
1996.
Identification of overlapping DNA-binding and centromere-targeting domains in the human kinetochore protein CENP-C.
Mol. Cell. Biol.
16:3576-3586[Abstract].
|
| 37.
|
Yen, T. J.,
G. Li,
B. T. Schaar,
I. Szilak, and D. W. Cleveland.
1992.
CENP-E is a putative kinetochore motor that accumulates just before mitosis.
Nature
359:536-539[Medline].
|
| 38.
|
Yoda, K.,
K. Kitagawa,
H. Masumoto,
Y. Muro, and T. Okazaki.
1992.
A human centromere protein, CENP-B, has a DNA binding domain containing 4 potential alpha-helices at the NH2 terminus, which is separable from dimerizing activity.
J. Cell Biol.
119:1413-1427[Abstract/Free Full Text].
|
| 39.
|
Zhu, X.,
M. A. Mancini,
K.-H. Chang,
C. Y. Liu,
C. F. Chen,
B. Shan,
D. Jones,
T. L. Yang-Feng, and W.-H. Lee.
1995.
Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression.
Mol. Cell. Biol.
15:5017-5029[Abstract].
|
| 40.
|
Zhu, X.,
K.-H. Chang,
D. He,
M. A. Mancini,
W. R. Brinkley, and W.-H. Lee.
1995.
The C-terminus of mitosin is essential for its nuclear localization, centromere/kinetochore targeting, and dimerization.
J. Biol. Chem.
270:19545-19550[Abstract/Free Full Text].
|
| 41.
|
Zhu, X.,
L. Ding, and G. Pei.
1997.
Carboxyl terminus of mitosin is sufficient to confer spindle pole localization.
J. Cell. Biochem.
66:441-449[Medline].
|
Molecular and Cellular Biology, February 1999, p. 1016-1024, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ding, C., Liang, X., Ma, L., Yuan, X., Zhu, X.
(2009). Opposing effects of Ndel1 and {alpha}1 or {alpha}2 on cytoplasmic dynein through competitive binding to Lis1. J. Cell Sci.
122: 2820-2827
[Abstract]
[Full Text]
-
Tarailo, M., Tarailo, S., Rose, A. M.
(2007). Synthetic Lethal Interactions Identify Phenotypic "Interologs" of the Spindle Assembly Checkpoint Components. Genetics
177: 2525-2530
[Abstract]
[Full Text]
-
Liang, Y., Yu, W., Li, Y., Yu, L., Zhang, Q., Wang, F., Yang, Z., Du, J., Huang, Q., Yao, X., Zhu, X.
(2007). Nudel Modulates Kinetochore Association and Function of Cytoplasmic Dynein in M Phase. Mol. Biol. Cell
18: 2656-2666
[Abstract]
[Full Text]
-
Soukoulis, V., Reddy, S., Pooley, R. D., Feng, Y., Walsh, C. A., Bader, D. M.
(2005). Cytoplasmic LEK1 is a regulator of microtubule function through its interaction with the LIS1 pathway. Proc. Natl. Acad. Sci. USA
102: 8549-8554
[Abstract]
[Full Text]
-
Yang, Z., Guo, J., Chen, Q., Ding, C., Du, J., Zhu, X.
(2005). Silencing Mitosin Induces Misaligned Chromosomes, Premature Chromosome Decondensation before Anaphase Onset, and Mitotic Cell Death. Mol. Cell. Biol.
25: 4062-4074
[Abstract]
[Full Text]
-
Zhou, X., Wang, R., Fan, L., Li, Y., Ma, L., Yang, Z., Yu, W., Jing, N., Zhu, X.
(2005). Mitosin/CENP-F as a Negative Regulator of Activating Transcription Factor-4. J. Biol. Chem.
280: 13973-13977
[Abstract]
[Full Text]
-
Liang, Y., Yu, W., Li, Y., Yang, Z., Yan, X., Huang, Q., Zhu, X.
(2004). Nudel functions in membrane traffic mainly through association with Lis1 and cytoplasmic dynein. JCB
164: 557-566
[Abstract]
[Full Text]
-
Yan, X., Li, F., Liang, Y., Shen, Y., Zhao, X., Huang, Q., Zhu, X.
(2003). Human Nudel and NudE as Regulators of Cytoplasmic Dynein in Poleward Protein Transport along the Mitotic Spindle. Mol. Cell. Biol.
23: 1239-1250
[Abstract]
[Full Text]
-
Ashar, H. R., James, L., Gray, K., Carr, D., Black, S., Armstrong, L., Bishop, W. R., Kirschmeier, P.
(2000). Farnesyl Transferase Inhibitors Block the Farnesylation of CENP-E and CENP-F and Alter the Association of CENP-E with the Microtubules. J. Biol. Chem.
275: 30451-30457
[Abstract]
[Full Text]