Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 1999, p. 1068-1080, Vol. 19, No. 2
Department of Adult
Oncology1 and
Howard Hughes Medical
Institute,2 Dana-Farber Cancer Institute and
Harvard Medical School, Boston, Massachusetts 02115;
Verna and
Marrs McLean Department of Biochemistry, Baylor College of
Medicine, Houston, Texas 770303; and
Biology Division, National Cancer Center Research
Institute, Chuo-ku, Tokyo 104, Japan4
Received 30 June 1998/Returned for modification 22 July
1998/Accepted 4 November 1998
Stable association of certain proteins, such as E2F1 and p21, with
cyclin-cdk2 complexes is dependent upon a conserved cyclin-cdk2 binding
motif that contains the core sequence ZRXL, where Z and X are usually
basic. In vitro phosphorylation of the retinoblastoma tumor suppressor
protein, pRB, by cyclin A-cdk2 and cyclin E-cdk2 was inhibited by a
short peptide spanning the cyclin-cdk2 binding motif present in E2F1.
Examination of the pRB C terminus revealed that it contained sequence
elements related to ZRXL. Site-directed mutagenesis of one of these
sequences, beginning at residue 870, impaired the phosphorylation of
pRB in vitro. A synthetic peptide spanning this sequence also inhibited
the phosphorylation of pRB in vitro. pRB C-terminal truncation mutants
lacking this sequence were hypophosphorylated in vitro and in vivo
despite the presence of intact cyclin-cdk phosphoacceptor sites.
Phosphorylation of such mutants was restored by fusion to the ZRXL-like
motif derived from pRB or to the ZRXL motifs from E2F1 or p21.
Phospho-site-specific antibodies revealed that certain phosphoacceptor
sites strictly required a C-terminal ZRXL motif whereas at least one
site did not. Furthermore, this residual phosphorylation was sufficient to inactivate pRB in vivo, implying that there are additional mechanisms for directing cyclin-cdk complexes to pRB. Thus, the C
terminus of pRB contains a cyclin-cdk interaction motif of the type
found in E2F1 and p21 that enables it to be recognized and phosphorylated by cyclin-cdk complexes.
Orderly progression through the
mammalian cell cycle requires that different cyclin-cdk complexes
phosphorylate specific substrates in a temporally controlled fashion
(38, 39, 71). For example, the retinoblastoma protein, pRB,
is phosphorylated by cyclin D-cdk4 and cyclin E-cdk2 complexes as cells
exit G1 and enter S phase (66). Cyclin A-cdk2
complexes probably contribute to the maintenance of pRB phosphorylation
during S phase (82, 90). Phosphorylation of pRB results in
the release of E2F family members and hence in transcription of the
E2F-responsive genes that are required for entry into S phase (1,
69). In contrast, entry into M phase is driven by the
phosphorylation of various substrates by cyclin B-cdc2 and cyclin
A-cdc2 complexes (65, 67).
Several lines of evidence suggest that pRB is a critical downstream
target of cyclin D-cdk4. For example, inhibition of cyclin D-cdk4
activity induces a G1/S block in a pRB-dependent manner (3, 25, 50, 61, 62, 68). In contrast, neutralization of cdk2
induces a G1/S block in cells lacking pRB (30, 73, 77,
88, 89, 94). Furthermore, there is mounting evidence that cyclin
E-cdk2 acts both upstream and downstream of pRB. In particular, the
cyclin E promoter is under the control of pRB (4, 23, 32, 40, 72,
84) and the induction of S-phase entry by overproduced cyclin E
does not appear to require phosphorylation of pRB (55, 60).
Thus, there must be physiologically important cdk2 substrates in
addition to pRB.
How cyclin-cdk complexes recognize substrates in general, and pRB in
particular, is largely unknown apart from their requirement for a
(serine/threonine)-proline (S/T-P) phosphoacceptor site and a
preference for a basic residue at position +3 (where the S/T position
is position 0) (36, 70, 83, 85, 98). It is clear, however,
that the cyclin moiety contributes to substrate specificity. For
example, cyclin A-cdc2 but not cyclin B-cdc2 phosphorylates the
pRB-related protein, p107, in vitro (76). Furthermore,
certain substrates can bind stably to cyclin-cdk complexes, suggesting
that physical association may play a role in establishing substrate
specificity in at least some cases.
Cyclin-cdk2 complexes bind stably to cell cycle-regulatory proteins
including the transcription factor E2F1 (15, 51, 95), the
pRB family members p107 and p130 (8, 17, 21, 53, 57), and
all of the p21-like cyclin-dependent kinase inhibitors (CDKIs)
(24, 30, 77, 88, 93, 94). E2F1 and p107 are putative
cyclin-cdk2 substrates (17, 20, 21, 51, 53, 75, 76). We and
others recently identified an octamer cyclin-cdk2 binding motif in
E2F1, p107, and p21 that was required for the efficient phosphorylation
of E2F1 and p107 by cyclin-cdk2 and for the action of p21 as a
cyclin-cdk2 inhibitor (2, 7, 100). This motif has, at its
core, the sequence ZRXL, where Z and X are typically basic (2,
80). Thus, these studies identified a potential cyclin-cdk2
substrate recognition motif and provided evidence that p21-like CDKIs
act, at least in part, by competing with substrates for binding to
cyclin-cdk2 complexes. This model is supported by analysis of the
cyclin A-cdk2-p27 crystal structure (79).
We previously showed that a peptide replica of the above-mentioned
motif, derived from E2F1, blocked the phosphorylation of pRB by cyclin
A-associated kinase activity (2). pRB, unlike E2F1 and p107,
does not bind stably to cyclin-cdk2 complexes. Nonetheless, the
observation that phosphorylation of pRB by cyclin A-cdk2 was inhibited
by such a peptide suggested that pRB contained an analogous sequence.
According to this model, this pRB sequence would mediate a transient
interaction with cyclin-cdk2 complexes that was necessary for a
productive enzyme-substrate interaction.
Examination of the primary sequence of the pRB C terminus showed that
this region contained several candidate cyclin-cdk2 binding motifs
between residues 829 and 928. Site-directed mutagenesis identified one
such motif, beginning at residue 870, that was necessary for efficient
phosphorylation of pRB. A synthetic peptide spanning this motif
inhibited the phosphorylation of pRB by cyclin-cdk2 complexes. A pRB
mutant with C-terminal truncation, pRB(1-829), was not phosphorylated
by cyclin-cdk2 complexes despite retention of all of the potential
cyclin-cdk phosphoacceptor sites of pRB. Fusion to 10 amino acids
spanning the ZRXL-like motif of pRB or 12 amino acids spanning the
cyclin-cdk2 binding motifs present in either E2F1 or p21 restored its
ability to be phosphorylated by these complexes. Thus, pRB contains a
dedicated cyclin-cdk2 substrate recognition motif. Furthermore, these
findings suggest that the paradigm for substrate recognition, based
upon the stable interaction of cyclin-cdk2 complexes with proteins such
as E2F1 and p107, can be extended to include substrates that do not
form such stable complexes.
Cell culture and transfections.
U2OS and SAOS2 osteosarcoma
cells were grown in Dulbecco's modified Eagle's medium supplemented
with 10% fetal clone I (HyClone), penicillin, and streptomycin and
maintained at 37°C in a humidified 10% CO2-containing
atmosphere. The cells were transfected by the calcium phosphate method
(6).
Plasmids.
pRcCMV cyclin A and pRcCMV cyclin E were gifts
from Jonathan Pines. pGEX2TRB(792-928) has been described previously
(78). pGEX2TRB(794-910), pGEX2TRB(794-896),
pGEX2TRB(794-884), pGEX2TRB(794-876), pGEX2TRB(794-864), pGEX2TRB(794-857),
pGEX2TRB(794-844), and pGEX2TRB(794-829) were generated by
PCR amplification of a human RB cDNA with Pfu polymerase and
the 3' primers GCGCGAATTCCTCGAGTCATCGTGTTCGAGTAGAAGTCAT, GCGCGAATTCCTCGAGTCATTTGGACTCTCCTGGGAGATG,
GCGCGAATTCCTCGAGTCATTCATCTGATCCTTCAATATC, GCGCGAATTCCTCGAGTCAGCGTAGTTTTTTCAGTGGTTT,
GCGCGAATTCCTCGAGTCATTCAGCACTTCTTTTGAGCAC, GCGCGAATTCCTCGAGTCAACGGTCGCTGTTACATACCAT,
GCGCGAATTCCTCGAGTCACTTCTCAGAAGTCCCGAATGA, and
GCGCGAATTCTCACTCGAGGTCTGCTGCTGCTGCTACGGTACCTCATCATGATCTTGGAGTCATTTTTG respectively. The 5' primer was
GCGCGGATCCTCACCCTTACGGATTCCTG in each case. The PCR products
were digested with BamHI and EcoRI and ligated
into pGEX2T (Pharmacia PL). Plasmids were verified by restriction
analysis and visualization of the corresponding glutathione
S-transferase (GST) fusion proteins, expressed in Escherichia coli, by Coomassie blue staining following
sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis.
pGEX2TRB(794-829)E2F1CyWT and pGEX2TRB(794-829)E2F1CyMut were
generated by PCR amplification of a human RB cDNA with Pfu
polymerase and the 3' primers
GCGCGAATTCTCACTCGAGGTCGAGACGACGTTTTACTGGTGGTCGACCTGATCTTGGAGTCATTTTTG and
GCGCGAATTCTCACTCGAGGTCTGCTGCCGCGGCTACTGGTGGTCGTCCTGATCTTGGAGTCATTTTTG, respectively. The 5' primer was
GCGCGGATCCTCACCCTTACGGATTCCTG in each case. The PCR products
were digested with BamHI and EcoRI and ligated
into pGEX2T. Plasmids were verified by restriction analysis and
visualization of the corresponding GST fusion proteins by Coomassie
blue staining.
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Retinoblastoma Protein Contains a C-terminal Motif
That Targets It for Phosphorylation by Cyclin-cdk Complexes
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
870 and pGEX2TRB(794-928)
889 were generated by
site-directed mutagenesis of pSG5LHARB(1-928) (81) with the
Bio-Rad Muta-Gene kit as specified by the manufacturer and the
oligonucleotides
GGA AGCAACCCTCCTAATGCCGCCATTCGATCGCGCTTTGATATTGAA and GAAGCAGATGGAAGTGCCGCGGCACCAGGAGAGTCCAAA to
produce pSG5LHARB(1-928)
870 and pSG5LHARB(1-928)
889
respectively. The former results in the replacement of the amino acid
sequence KPLKKL by a flexible linker (NAAIRS) (2, 64, 92),
and the latter results in the replacement of the sequence KHL by AAA.
pSG5LHARB(1-928)
870 and pSG5LHARB(1-928)
889 were used as
templates in PCRs with Pfu polymerase, the 5' primer GCGCGGATCCTCACCCTTACGGATTCCTG, and the 3' primer
GCGCGAATTCAGATCTTCATTTCTCTTCCTTGTTTGAG. The PCR products
were digested with BamHI and EcoRI and ligated into pGEX2T. pGEX2TRB(794-928)
870,889 was generated in the same way
except that both oligonucleotides were included in the initial mutagenesis reaction. The constructs were verified by restriction analysis, DNA sequencing, and visualization of the corresponding GST
fusion proteins by Coomassie blue staining.
Peptides. Peptides were purchased from Biosynthesis, Inc. (Lewisville, Tex.) and were dissolved in phosphate-buffered saline prior to use.
Antibodies. The anti-cyclin A antibody, C160, and the anti-simian virus 40 (SV40) T antibody, pAB419, were gifts of Ed Harlow. The anti-cdk2 antibody, M2, and the anti-cyclin E antibody, HE111, were purchased from Santa Cruz, Inc. The anti-HA antibody, 12CA5, was purchased from Boehringer Mannheim. The Anti-E2F4 antibody, LLF4, was a gift of Jackie Lees. The monoclonal antibody against phospho-Ser780 and the polyclonal antibodies against phospho-Thr821, phospho-Ser795, and phospho-Ser612 were made essentially as described by Kitagawa et al. (46). The generation and validation of these reagents will be described elsewhere (86).
Purification of recombinant cyclin A-cdk2 and cyclin D1-cdk4. The production and purification of cyclin A-cdk2 and cyclin D1-cdk4 by baculoviral infection of insect cells was performed as described previously (9).
In vitro kinase assays and purification of GST fusion proteins. In vitro kinase assays were performed as described previously (2). Purification of GST fusion proteins for use as substrates in kinase assays was performed by the method of Frangioni and Neel (22).
Immunoprecipitation and Western blot analysis. Immunoprecipitations for Western blot analysis were performed essentially as described previously for immunoprecipitation kinase assays, except that after being washed five times in NETN (20 mM Tris [pH 8.0], 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40) the protein A-Sepharose was boiled in Laemmli sample buffer (62 mM Tris [pH 6.8], 2% SDS, 10% glycerol, 100 mM dithiothreitol, 0.01% bromophenol blue), fractionated by SDS-polyacrylamide gel electrophoresis, and transferred to a polyvinylidene difluoride membrane (2). Western blot analysis of total soluble protein was performed as follows. At 36 h after transfection, U2OS or SAOS2 cells were washed once in cold PBS and scraped into 0.2 ml of EBC lysis buffer (50 mM Tris [pH 8.0], 120 mM NaCl, 0.5% Nonidet P-40). The 150 µg of soluble protein (as determined by the Bradford assay) was fractionated by SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. The membranes were probed with either the 12CA5 or 419 antibody, as indicated, followed by a goat anti-mouse antibody conjugated to alkaline phosphatase.
| |
RESULTS |
|---|
|
|
|---|
The pRB C-terminus contains a cluster of seven candidate in vivo cdk phosphorylation sites (see Fig. 2A) (9, 46, 54, 58, 96). GST-RB(792-928) contains five of these sites (residues 795, 807, 811, 821, and 826) and is phosphorylated in vitro by cyclin A, cyclin E, and cyclin D-associated kinases (Fig. 1 and data not shown). We and others previously showed that phosphorylation of GST-RB(792-928) by cyclin A-associated kinase activity was inhibited by synthetic peptides spanning the cyclin-cdk2 binding sequences present in either E2F1 or the cdk inhibitor p21 (2, 7). The same E2F1-derived peptide also inhibited the phosphorylation of GST-RB(792-928) by cdk2- and cyclin E-associated kinase activities immunoprecipitated from asynchronously growing cells (Fig. 1). The observation that phosphorylation of pRB by cyclin-cdk2 complexes was inhibited by the above-mentioned peptides suggested that pRB might contain a sequence, or sequences, capable of forming a structure that interacted, at least transiently, with cyclin-cdk2 in an analagous fashion.
|
Examination of the primary amino acid sequence of the pRB C terminus revealed five potential cyclin-cdk2 binding motifs, related to the ZRXL motif defined previously (2), between residue 829 and the C terminus (Fig. 2A). To test whether these motifs were required for the phosphorylation of pRB, we generated a series of GST-RB C-terminal truncation mutants for use as substrates in in vitro kinase assays. The GST moiety was fused to fragments of pRB starting at residue 794 and ending at residue 910, 896, 884, 876, 864, 857, 844, or 829 as indicated (Fig. 2B). GST-RB(794-884), like GST-RB(792-928), was efficiently phosphorylated by cyclin A-associated kinase activity, whereas GST-RB(794-864) was not. Thus, residues C-terminal to residue 884, including the KXL beginning at residue 889 (Fig. 2A), were not necessary, and the RXL sequences beginning at residues 830 and 857 (Fig. 2A) were not sufficient, for cyclin A-associated kinase(s) to efficiently phosphorylate pRB under these assay conditions. Notably, sequences between residues 864 and 884, which includes the sequence KXLKXL (KPLKKL) beginning at residue 870, were necessary for the efficient phosphorylation of the S/T-P motifs located between residues 794 and 829.
|
We next tested whether these sequences were necessary for
phosphorylation of pRB in vivo. It has been previously shown that pRB
is not phosphorylated in RB
/
SAOS2 osteosarcoma cells
in the absence of ectopic production of an appropriate cyclin (12,
18, 34, 43). Plasmids directing the expression of HA-tagged
versions of wild-type pRB [pRB(1-928)] or C-terminally truncated
versions thereof were transfected into SAOS2 cells. All of the pRB
species were produced at comparable levels as determined by anti-HA
immunoblot analysis and migrated as single bands in the absence of an
ectopically produced cyclin (Fig. 2C and D). pRB(1-928) and
pRB(1-896), but not pRB(1-864) and pRB(1-829), displayed a
characteristic electrophoretic mobility shift, previously shown to be
due to phosphorylation (34), when coproduced with either
cyclin A or cyclin E. All of the pRB species bound to SV40 T antigen
when produced in COS cells, suggesting that they were not grossly
denatured (Fig. 2E). Thus, consistent with the in vitro results,
sequences between residues 864 and 896 were required for the efficient
phosphorylation of pRB by cyclin A- and E-associated kinases in vivo.
The experiments described above suggested that a sequence between
residues 864 and 884 played a key role in targetting pRB for
phosphorylation by cyclin-cdk2 complexes. To test whether the KXLKXL
beginning at reside 870 could play such a role, site-directed mutagenesis was used to replace this sequence with the sequence NAAIRS
(the NAAIRS sequence has been found in both
-helical and
-sheet
regions of protein secondary structure and therefore is thought to be a
highly flexible linker that should only minimally disrupt the
confirmation of proteins) (Fig. 3A)
(64, 92). Phosphorylation of the NAAIRS substitution mutant
by cyclin A-, cyclin E-, and cdk2-associated kinase activity was
grossly impaired relative to that of GST-RB(792-928) (Fig. 3B). The
mutant was, however, more efficiently phosphorylated than was
GST-RB(794-829) (see Discussion). Consistent with the analysis of the
C-terminal truncation mutants, replacement of the KXL sequence
beginning at residue 889 with three alanine residues had no effect
(Fig. 3).
|
We next asked whether a synthetic peptide spanning the KXLKXL sequence could, like the E2F1-, and p21-derived peptides, inhibit cyclin-cdk2 kinase activity. A 15-mer peptide corresponding to pRB residues 864 to 880, but not a sequence-scrambled version thereof, inhibited the phosphorylation of GST-RB(792-928) by cyclin A-associated kinase (Fig. 4). The pRB-derived peptide appeared to be less potent than the corresponding E2F1-derived peptide, perhaps reflecting the fact that E2F1 forms stable complexes with cyclin-cdk2 complexes whereas pRB does not. Thus, the relative stabilities of the complexes and the relative potencies of the peptides might both reflect, for example, differences in the off-rates for cyclin A bound to E2F1 versus pRB.
|
If the inability to phosphorylate pRB species truncated at residue 829 was due to the loss of a specific cyclin-cdk2 interaction motif rather than to nonspecific conformational changes, then providing a homologous or heterologous cyclin-cdk2 recognition motif in cis should restore their ability to be phosphorylated by cyclin-cdk2 complexes. To test this, a chimera, GST-RB(794-829)RBCy, in which residues 869 to 878 of pRB (PKPLKKLRFD) were fused to the C terminus of GST-RB(794-829), was made (Fig. 5A). GST-RB(794-829)RBCy was phosphorylated as efficiently as GST-RB(792-928) by both cyclin A- and cyclin E-associated kinases (Fig. 5B). In the next set of experiments, 12 amino acids spanning the cyclin-cdk2 binding site of E2F1 (GRPPVKRRLDLE) or p21 (CGSKACRRLFGP) were fused to the C terminus of GST-RB(794-829) to generate GST-RB(794-829)E2F1CyWT and GST-RB(794-829)p21Cy, respectively (Fig. 5A). As a control, GST-RB(794-829)E2F1CyMut, in which the KRRL present in the E2F1 sequence was replaced with four alanine residues (GRPPVAAAADLE), was also generated. The analogous mutation in the cyclin-cdk2 binding sequence of p107 has previously been shown to inactivate cyclin-cdk2 binding (2). Fusion to either the wild-type E2F1 or p21 cyclin-cdk2 binding sequences restored the ability of GST-RB(794-829) to serve as a substrate for both cyclin A- and E-associated kinases whereas fusion to the mutated E2F1 sequence did not (Fig. 5C and D). These results strongly suggest that GST-RB(794-829) is not phosphorylated by cyclin-cdk2 because it lacks a substrate recognition motif, rather than as a result of improper folding and inaccessible phosphoacceptor sites. Furthermore, these results underscore the finding that the cyclin-cdk2 binding motifs derived from pRB, E2F1, and p21 are functionally analogous.
|
We next tested whether the E2F1 cyclin-cdk2 binding motif could restore the ability of cyclin A-associated kinases to phosphorylate a C-terminally truncated pRB species in vivo. To this end, plasmids encoding HA-tagged wild-type pRB [pRB(1-928)], pRB(1-829), or pRB(1-829) fused at its C terminus to either the wild-type or mutant E2F1 cyclin-cdk2 binding sequence [pRB(1-829)E2F1CyWT and pRB(1-829)E2F1CyMut, respectively] were transfected into SAOS2 cells in the presence or absence of a plasmid encoding cyclin A. All of the proteins were produced at comparable steady-state levels as determined by anti-HA immunoblot analysis (Fig. 6A). Phosphorylation was detected by the appearance of pRB species with retarded mobility, as described above. Consistent with the in vitro experiments, fusion of the wild-type but not mutant E2F1-derived cyclin-cdk2 binding sequence to the C terminus of pRB(1-829) enabled it to be phosphorylated by cyclin A-associated kinases (Fig. 6A). Similarly, the wild-type but not mutant cyclin binding site from E2F1 restored phosphorylation by cyclin E-associated kinase in this assay (data not shown).
|
In contrast to SAOS2 cells, U2OS osteosarcoma cells are capable of phosphorylating ectopically produced wild-type pRB in the absence of an ectopically produced cyclin (78). As additional confirmation of the ability of the E2F1 cyclin-cdk2 binding sequence to direct the phosphorylation of pRB (1-829), the same pRB expression plasmids were transfected into U2OS cells. The cells were metabolically labeled with [32P]orthophosphate, lysed, and immunoprecipitated with an anti-HA antibody. Bound proteins were resolved by SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and detected by anti-HA immunoblot analysis (Fig. 6B, bottom) or autoradiography (Fig. 6B, top). In this experiment, electrophoretic conditions were chosen so that the pRB species would migrate as single bands. Anti-HA immunoblot analysis showed that all of the pRB species were produced at comparable steady-state levels. The phosphorylation of pRB(1-829) was reproducibly diminished by approximately 50% relative to wild-type pRB as determined by quantitative phosphorimager analysis (Fig. 6C). Consistent with the results obtained with SAOS2 cells, pRB(1-829)E2F1CyWT but not pRB(1-829)E2F1CyMut, incorporated 32P to the same extent as did wild-type pRB. Thus, in keeping with the results obtained in vitro, pRB residues 829 to 928 contain one or more cyclin-cdk2 recognition motifs, and this function can be provided by a heterologous cyclin-cdk2 recognition motif.
Results similar to those depicted in Fig. 6 were also obtained when heterologous cyclin-cdk2 binding sites were fused to pRB(1-864) rather than to pRB(1-829) (Fig. 7A). The residual phosphorylation of pRB(1-829) and pRB(1-864) following reintroduction into U2OS cells left open several possibilities. For example, phosphorylation of all of the cdk phosphoacceptor sites in pRB might be reduced by similar amounts in these mutants relative to wild-type pRB. Alternatively, different cdk phosphoacceptor sites might exhibit differential requirements for the C-terminal cyclin-cdk2 binding site studied here. Finally, the residual phosphorylation of these mutants might reflect phosphorylation by kinases other than cdks (see also below).
|
To this end, U2OS cells were transfected to produce HA-tagged pRB, pRB(1-896), pRB(1-864), or pRB(1-864) fused to either wild-type or mutant E2F1 cyclin-cdk2 binding sequences. Cell extracts were prepared and immunoblotted with anti-HA antibody or antibodies against specific pRB-derived phosphopeptides corresponding to known cdk phosphorylation sites (Fig. 7B). Interestingly, phosphorylation of T821, S780, and S795 was undetectable in pRB(1-864) and was fully restored in the chimera containing an intact E2F1-derived cyclin-cdk2 binding site. In contrast, residual phosphorylation of S612 was detectable in pRB(1-864) as well as in pRB(1-864) species fused to mutated or scrambled E2F1-derived cyclin-cdk2 binding sites (Fig. 7B, lanes 4, 6, and 7, respectively). These data suggest that some cdk phosphorylation sites, such as T821, are strictly dependent upon an intact RXL-like motif C-terminal to pRB residue 864 whereas at least one (S612) is not. Furthermore, they leave open the possibility that kinases other than cdk2 contribute to the phosphorylation of pRB(1-829) and pRB(1-864) in vivo. pRB(1-864) did not induce a cell cycle arrest when introduced into these cells (data not shown), perhaps reflecting the residual phosphorylation of this mutant. It was previously shown that phosphorylation of S612 inhibits the binding of pRB to E2F (49).
In pilot experiments, we confirmed that pRB(1-864) is sufficient to bind to E2F, in keeping with earlier reports (33, 78). To ask whether phosphorylation of pRB under the control of a heterologous KRXL motif was functionally significant, asynchronously growing SAOS2 cells were transfected with plasmids encoding HA-tagged pRB(1-864) fused to 12 amino acids (GRPPVKRRLDLE) spanning the wild-type cyclin-cdk2 binding sequence of E2F1 [pRB(1-864)E2F1CyWT] or HA-tagged pRB(1-928) in the presence or absence of plasmids encoding cyclin A and cdk2. As negative controls, similar plasmids in which the cyclin-cdk2 sequence was alanine substituted (GRPPVAAAADLE) [pRB(1-864)E2F1CyMut] or scrambled (EPLKGRPVDLRR) [pRB(1-864)E2F1CySCR] were tested in parallel. Subsequently, the cells were lysed and immunoprecipitated with an anti-E2F4 antibody, and bound pRB was detected by anti-HA immunoblot analysis. In the presence of ectopically produced cyclin A and cdk2, pRB(1-928) and pRB(1-864)E2F1CyWT, but not pRB(1-864)E2F1CyMut and pRB(1-864)E2F1CySCR, were detectably phosphorylated, as judged by their relative mobilities following SDS-polyacrylamide gel electrophoresis (Fig. 8, bottom) and in keeping with the data presented in Fig. 6. In the absence of ectopic cyclin A and cdk2, E2F4 associated with wild-type pRB and all three of the pRB mutants (Fig. 8, top). In the presence of ectopically expressed cyclin A and cdk2, however, E2F4 no longer bound to wild-type pRB and pRB(1-864)E2F1CyWT but remained bound to pRB(1-864)E2F1CyMut and pRB(1-864)E2F1CySCR. Thus, the phosphorylation of pRB(1-864) by cyclin A-cdk2 under the direction of the wild-type cyclin-cdk2 recognition motif was associated with the same outcome as phosphorylation of wild-type pRB by cyclin-cdk2, namely, disruption of E2F binding. Furthermore, the failure of cyclin A-cdk2 to disrupt the binding of E2F4 to pRB(1-864)E2F1CyMut and pRB(1-864)E2F1CySCR strongly suggests that the displacement of E2F4 from wild-type pRB and pRB(1-864)E2F1WT is a direct consequence of phosphorylation of pRB by cyclin A-cdk2.
|
pRB is a critical target of cyclin D-cdk4 complexes. Previous studies suggested that short RXL-containing peptides were unlikely to stably interact with cyclin D-cdk4 complexes (2, 7). Nonetheless, these studies left open the possibility that such sequences, in the appropriate molecular context, also contribute to substrate recognition by cyclin D-cdk4. To begin to address this, GST-pRB(792-928) and C-terminally truncated version thereof were tested as substrates in cyclin D1-cdk4 in vitro kinase assays (Fig. 9). Due to the difficulty in recovering high levels of cdk4 kinase activity from mammalian cell extracts, recombinant cyclin D1-cdk4 was used. The amount of recombinant cyclin A-cdk2 and cyclin D1-cdk4 necessary to achieve comparable phosphorylation of GST-pRB(792-928) was determined in pilot experiments and was used subsequently. In contrast to cyclin A-cdk2, deletion of the C-terminal 32 amino acids from pRB led to a dramatic decrease in its ability to undergo phosphorylation by cyclin D1-cdk4 (Fig. 9A), in keeping with a recent report (74). Similar results were obtained with respect to phosphorylation of GST-pRB(773-928) and derivatives thereof by cyclin D1-cdk4 (data not shown). Thus, sequences outside of the KXLKXL motif beginning at residue 870 contribute to the recognition of pRB by cyclin D1-cdk4. Nonetheless, as observed for cyclin-cdk2 (Fig. 3), site-directed mutagenesis of the KXLKXL motif led to a demonstrable decrease in pRB phosphorylation by cyclin D1-cdk4 (Fig. 9B, compare lanes 2 and 4 to lane 1). Finally, fusion of the E2F1-derived cyclin-cdk2 binding site to pRB(792-829) restored its ability to be phosphorylated by cyclin D1-cdk4 (Fig. 9B, compare lane 6 to lanes 5 and 7). Thus, in certain contexts, the KRXL cyclin-cdk2 binding motif can also serve as a recognition site for cyclin D1-cdk4 complexes.
|
| |
DISCUSSION |
|---|
|
|
|---|
Using cyclin-cdk2 as a model, we have attempted to understand how cyclin-cdk complexes recognize their substrates. Our results suggest that cyclin-cdk2 complexes must physically interact with a substrate recognition motif prior to phosphorylation of the S/T-P phosphoacceptor sites and suggest that this model holds true not only for substrates that stably interact with cyclin-cdk2 complexes, such as E2F1 and p107, but also for substrates that interact only transiently, such as pRB. According to this model, the cyclin-cdk2 targeting function may be provided in cis, as part of the same molecule as the S/T-P phosphoacceptor site, or in trans by an adapter molecule that contacts both the substrate and the cyclin-cdk2 complex simultaneously. For example, E2F1 functions as an adapter for phosphorylation of its heterodimeric partner, DP1, by cyclin A-cdk2 (15, 51, 95) and p107 has been suggested to likewise act as an adapter for the phosphorylation of c-myc by cyclin A-cdk2 (35). This model is consistent with two recent observations. First, the N terminus of E2F1, containing its cyclin-cdk2 binding motif, can direct the phosphorylation of E2F4 (which lacks such a motif) by cyclin-cdk2 as an E2F1-E2F4 chimera (16). Second, cyclin A mutants that cannot bind to the RXL motif but retain the ability to bind to cdk2 are unable to phosphorylate substrates such as pRB and are unable to promote S-phase entry (80).
With this general model in mind, a novel function can now be ascribed to the pRB C terminus. That is, the C-terminal 100 amino acid residues of pRB serve to target pRB to cyclin A- and E-cdk2 complexes. In this regard, the pRB C terminus might be viewed as performing a function analogous to that performed by the spacer elements of the pRB family members p107 and p130 (17, 21). Furthermore, the physical separation of the cdk phosphorylation sites (upstream of residue 829) and the cyclin-cdk2 binding region (downstream of residue 829) allows the pRB C terminus to be viewed as two separate subdomains. The N-terminal half contains a number of candidate in vivo phosphorylation sites, residues 780, 788, 795, 807, 811, 821, and 826, whereas the C-terminal half contains a number of candidate cyclin-cdk2 targeting motifs (9, 46, 48, 49, 54, 58, 96). At least one of these, the KPLKKL sequence beginning at residue 870, appears to be functional in directing pRB phosphorylation.
Most of the proteins that stably interact with cyclin-cdk2 contain the sequence RXL (2, 7, 100). Lisztwan et al. recently showed that p45/Skp2 uses the sequence KXL, rather than RXL, to bind to cyclin A-cdk2 (59). It is possible that the use of KXL instead of RXL, in addition to contextual effects, allows pRB to bind to cyclin-cdk2 complexes with a high off-rate typical of most substrate-enzyme interactions. Nonetheless, our findings are consistent with earlier studies that showed that cyclin A can physically interact with pRB (18, 91).
We cannot presently exclude the possibility that pRB contains an
additional (R/K)XL-like sequence that contributes to its phosphorylation by cyclin-cdk2 complexes. In this regard, we have not
yet evaluated pRB mutants in which the RXL motifs beginning at either
residue 830 or residue 857 were specifically altered. The presence of a
second cyclin-cdk2 recognition motif in the pRB C terminus might
account for the residual phosphorylation of GST-RB(794-928)
870 and
GST-pRB(794-844) relative to GST-RB(794-829) and would raise the
interesting possibility that different cyclin-cdk2 substrate
recognition motifs within pRB lead to phosphorylation of different
S/T-P sites. Our data thus far suggest that phosphorylation of at least
some pRB phosphoacceptor sites, such as T821 and S795, is under the
control of the KXLKXL motif beginning at pRB residue 870.
Conceivably, this general model holds true for other cyclin-cdk complexes as well. In this regard, pRB can form complexes with cyclin D (12, 18, 43). Notably, the region of cyclin A that binds to the RXL motif is fairly well conserved among different cyclins (79, 80). Furthermore, mutation of the KXLKXL beginning at residue 870 impaired the phosphorylation of pRB by cyclin D1-cdk4 in vitro. In addition, the E2F1-derived cyclin-cdk2 binding motif restored the phosphorylation of GST-pRB(792-829) by cyclin D1-cdk4. Thus, the (R/K)XL might be viewed as a general cyclin-cdk docking site. Several lines of evidence suggest that flanking residues influence whether this sequence will form a productive complex with a given cyclin-cdk complex. First, short RXL-containing peptides inhibit the activity of cyclin-cdk2 complexes at much lower concentrations than are required to inhibit cyclin D-cdk4 complexes (2, 7). Second, pRB mutants that lack residues 910 to 928 but retain the phosphoacceptor and (R/K)XL sites are inefficiently phosphorylated by cyclin D-cdk4 (reference 74 and results described above). Finally, E2F1 binds to cyclin A-cdk2 but not to cyclin E-cdk2 whereas the E2F1-derived cyclin-cdk2 binding peptide interacts with both (references 2 and 51 and results described above).
The pRB pocket, corresponding to pRB(379-792), binds to proteins containing the consensus sequence LXCXE. Intriguingly, the D-type cyclins and cyclin E contain LXCXE sequences, which might serve to target them to pRB (12, 45). In addition, pRB pocket mutants are hypophosphorylated in vivo (28, 29, 44, 87). Nonetheless, pRB(792-928) is efficiently phosphorylated by cyclin-cdk2 and cyclin-cdk4 complexes in vitro whereas phosphorylation of pRB(1-829), which contains an intact pocket, is clearly impaired. Furthermore, cyclin D1 LXCXE mutants can phosphorylate pRB (9, 37). Our data provide a potential reconciliation of these findings. Specifically, it is possible that cyclin-cdk complexes can interact with pRB via the pocket or via the (R/K)XL motif(s). Mutation of the pocket might affect the phosphorylation of pRB in vivo in at least two ways. First, it is possible that certain phosphoacceptor sites strictly depend upon docking of cyclin-cdk complexes to the pRB pocket in an LXCXE-dependent manner. Second, mutations in the pRB pocket might lead to conformational changes that affect the accessibility of the (R/KXL) motifs.
Short phosphoacceptor peptides that can serve as substrates for cyclin A-cdk2 or cyclin D-cdk4 complexes have been selected or identified (9, 46, 74, 83). Pan et al. found that a pRB-derived peptide containing a putative cyclin D-cdk4 phosphoacceptor site (Ser 795) was phosphorylated 1,000-fold less efficiently than was RB(792-928) by cyclin D1-cdk4 (74). This result is entirely consistent with our data implicating the need for a cyclin-cdk-docking site in conjunction with a phosphoacceptor site for efficient phosphorylation by cyclin-cdk complexes.
There are precedents for cellular kinases being targeted to their
substrates in this fashion. For example, JNK kinase interacts with a
docking site on its substrate, c-jun, that is separate from the phosphoacceptor sites (26, 42). Indeed, there is evidence to suggest that the relative specificity of the JNK family kinases for the Jun family members, c-jun, junD,
and junB, is in part determined by their relative affinities for the
docking site. Other examples include mitogen-activated protein kinase and its substrate p90rsk (99) and
receptor tyrosine kinases and substrates such as phospholipase C
(5).
The finding that a p21-derived cyclin-cdk2 could direct the phosphorylation of a heterologous substrate [pRB(1-829)] suggests that the binding of cyclin-cdk2 to this sequence, per se, does not prevent it from acting as a kinase. This is in keeping with earlier observations that suggested that p21, at least when present in low concentrations, could be found in complexes that contained catalytically active cyclin-cdk2 (97). This has led to the speculation that p21, under certain situations, might act as a substrate or adapter (2, 52, 100). The RXL motif, based on the crystal structure of cyclin A-cdk2 bound to the p21 family member p27, is likely to interact with a potential substrate-docking site or cleft formed by cyclin A (79). Inhibition of cyclin-cdk2 by full-length p27 and, by extension, by p21, probably also involves the induction of conformational changes in the cyclin-cdk2 complex and steric effects on the ATP binding site (79).
It has been suggested that Ser780 (46, 96) and Ser795 (9, 74) are preferentially phosphorylated by cyclin D-cdk4 complexes rather than cyclin-cdk2 complexes. Nonetheless, these sites were phosphorylated in pRB(1-896) but not in pRB(1-864) in vivo. This is in apparent disagreement with our in vitro studies, as well as those of Pan et al. (74), suggesting a requirement for the C-terminal 18 residues of pRB for recognition by cyclin D-cdk4 complexes. One possibility is that these sites can also be phosphorylated by cyclin-cdk2 complexes in vivo under certain conditions. A second possibility stems from the fact that U2OS cells lack the cdk4 inhibitor p16INK4A. It is possible that the residual interaction of cyclin D-cdk4 with the KXLKXL motif beginning at residue 870 can lead to the phosphorylation of these sites in this setting.
pRB phosphorylation occurs in an orchestrated fashion as cells exit G0, traverse G1, and enter S (10, 66). The initial phosphorylation of pRB coincides with activation of the D-type cyclins, whereas hyperphosphorylation of pRB in late G1 coincides with activation of cyclin E (66). Recent studies suggest that D-type cyclins and cyclin E cooperate to neutralize the ability of pRB to suppress cell growth (19, 31, 63). Furthermore, recent studies suggest a requirement for continued phosphorylation of pRB by cyclin A during S phase (47). On the other hand, it is clear that cyclin E-cdk2 can also act downstream of, or perhaps in parallel with, pRB (4, 11, 13, 14, 23, 32, 40, 55, 56, 60, 72). Our studies have not addressed the relative contributions of cdk4 and cdk2 to the control of pRB function. In particular, the ability of cyclin A to promote the dissolution of pRB-E2F complexes in SAOS2 cells when overproduced cannot be taken as evidence that it performs this function under physiological conditions. The creation of pRB mutants that are not recognized by specific cyclin-cdk complexes should facilitate studies aimed at addressing these issues.
Emerging data suggest that different pRB phosphoacceptor sites regulate distinct biochemical functions such as binding to LXCXE proteins or E2F (48, 49, 96). It is possible that combinatorial regulation of pRB phosphorylation, and hence its biochemical activities, is achieved through the use of different cyclin-cdk complexes, different cyclin-cdk docking sites, and different phosphoacceptor sites.
The majority of human cancers harbor RB gene mutations or mutations which lead to the untimely phosphorylation and hence functional inactivation of pRB by cyclin-cdk complexes (27, 41). Understanding the structural requirements for pRB phosphorylation by cyclin-cdk complexes and the identification of peptides which specifically block pRB phosphorylation may facilitate the development of small molecules which modulate pRB phosphorylation in cancer cells.
| |
ACKNOWLEDGMENTS |
|---|
We thank Ed Harlow for the C160 (anti-cyclin A) and pAB419 (anti-SV40 T-antigen) antibodies, Jackie Lees for the LLF4-1 (anti-E2F4) antibody, Jonathan Pines for pRcCMV cyclin A and pRcCMV cyclin E, José Ayté for invaluable assistance in the production of figures, and David Livingston and Mark Ewen and all members of the Division of Neoplastic Disease Mechanisms for many helpful comments.
P.D.A. was supported by the Novartis Pharmaceutical Corporation and the Cancer Research Foundation of America, W.R.S. was supported by an NIH Physician Scientist Award, and W.G.K. was supported by Novartis Pharmaceutical Corporation and is a Howard Hughes Medical Institute assistant investigator.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Adult Oncology and Howard Hughes Medical Institute, Dana-Farber Cancer Institute and Harvard Medical School, 44 Binney St., Mayer Building Room 457, Boston, MA 02115. Phone: (617) 632-3975. Fax: (617) 632-4760. E-mail: william_kaelin{at}dfci.harvard.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Adams, P. D., and W. G. Kaelin. 1995. Transcriptional control by E2F. Semin. Cancer Biol. 6:99-108[Medline]. |
| 2. | Adams, P. D., W. R. Sellers, S. K. Sharma, A. D. Wu, C. M. Nalin, and W. G. Kaelin. 1996. Identification of a cyclin-cdk2 recognition motif present in substrates and p21-like cdk inhibitors. Mol. Cell. Biol. 16:6623-6633[Abstract]. |
| 3. | Bartkova, J., J. Lukas, H. Muller, D. Lutzhoft, M. Strauss, and J. Bartek. 1994. Cyclin D1 protein expression and function in human breast cancer. Int. J. Cancer 57:353-361[Medline]. |
| 4. | Botz, J., K. Zerfass-Thome, D. Spitzovsky, H. Delius, B. Vogt, M. Eilers, A. Hatzigeorgiou, and P. Jansen-Durr. 1996. Cell cycle regulation of the murine cyclin E gene depends on an E2F binding site in the promoter. Mol. Cell. Biol. 16:3401-3409[Abstract]. |
| 5. | Cantley, L. C., K. R. Auger, C. Carpenter, B. Duckworth, A. Graziani, R. Kapeller, and S. Soltoff. 1991. Oncogenes and signal transduction. Cell 64:281-302[Medline]. |
| 6. |
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752 |
| 7. | Chen, J., P. Saha, S. Kornbluth, B. D. Dynlacht, and A. Dutta. 1996. Cyclin binding motifs are essential for the function of p21cip1. Mol. Cell. Biol. 16:4673-4682[Abstract]. |
| 8. |
Cobrinik, D.,
P. Whyte,
D. S. Peeper,
T. Jacks, and R. A. Weinberg.
1993.
Cell cycle-specific association of E2F with the p130 E1A-binding protein.
Genes Dev.
7:2392-2404 |
| 9. | Connell-Crowley, L., J. W. Harper, and D. W. Goodrich. 1997. Cyclin D1/Cdk4 regulates retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation. Mol. Biol. Cell 8:287-301[Abstract]. |
| 10. |
DeCaprio, J. A.,
Y. Furukawa,
F. Ajchenbaum,
J. Griffen, and D. M. Livingston.
1992.
The retinoblastoma-susceptibility gene product becomes phosphorylated in multiple stages during cell cycle entry and progression.
Proc. Natl. Acad. Sci. USA
89:1795-1798 |
| 11. |
DeGregori, J.,
G. Leone,
K. Ohtani,
A. Miron, and J. R. Nevins.
1995.
E2F1 accumulation bypasses a G1 arrest resulting from the inhibition of G1 cyclin-dependent kinase activity.
Genes Dev.
9:2873-2887 |
| 12. | Dowdy, S. F., P. W. Hinds, K. Louie, S. I. Reed, A. Arnold, and R. A. Weinberg. 1993. Physical interaction of the retinoblastoma protein with human D cyclins. Cell 73:499-511[Medline]. |
| 13. |
Duronio, R. J.,
A. Brook,
N. Dyson, and P. H. O'Farrell.
1996.
E2F induced S phase requires cyclin E.
Genes Dev.
10:2505-2513 |
| 14. |
Duronio, R. J., and P. H. O'Farrell.
1995.
Developmental control of the G1 to S transition in Drosophila: cyclin E is a limiting downstream target of E2F.
Genes Dev.
9:1456-1468 |
| 15. |
Dynlacht, B.,
D. Flores,
O. Lees, and J. A. Harlow, E.
1994.
Differential regulation of E2F transactivation by cyclin/cdk complexes.
Genes Dev.
8:1772-1786 |
| 16. | Dynlacht, B. D., K. Moberg, J. A. Lees, E. Harlow, and L. Zhu. 1997. Specific Regulation of E2F family members by cyclin-dependent kinases. Mol. Cell. Biol. 17:3867-3875[Abstract]. |
| 17. |
Ewen, M. E.,
B. Faha,
E. Harlow, and D. M. Livingston.
1992.
Interaction of p107 with cyclin A independent of complex formation with viral oncoproteins.
Science
255:85-87 |
| 18. | Ewen, M. E., H. K. Sluss, C. J. Sherr, H. Matsushime, J.-Y. Kato, and D. M. Livingston. 1993. Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell 73:487-497[Medline]. |
| 19. |
Ezhevsky, S.,
H. Nagahara,
A. Vocero-Akbani,
D. Gius,
M. Wei, and S. Dowdy.
1997.
Hypo-phosphorylation protein (pRb) by cyclin D:Cdk/6 complexes results in active pRb.
Proc. Natl. Acad. Sci. USA
94:10699-10704 |
| 20. | Fagan, R., K. J. Flint, and N. Jones. 1994. Phosphorylation of E2F1 modulates its interaction with the retinoblastoma gene product and the adenoviral E4 19kD protein. Cell 78:799-811[Medline]. |
| 21. |
Faha, B.,
M. Ewen,
L. Tsai,
D. M. Livingston, and E. Harlow.
1992.
Interaction between human cyclin A and adenovirus E1A-associated p107 protein.
Science
255:87-90 |
| 22. | Frangioni, J., and B. G. Neel. 1993. Solubilisation and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal. Biochem. 210:179-187[Medline]. |
| 23. | Geng, Y., E. N. Eaton, M. Picon, J. M. Roberts, A. S. Lundberg, A. Gifford, C. Sardet, and R. A. Weinberg. 1996. Regulation of cyclin E transcription by E2Fs and retinoblastoma protein. Oncogene 12:1173-1180[Medline]. |
| 24. | Gu, Y., C. W. Turek, and D. O. Morgan. 1993. Inhibition of cdk2 activity in vivo by an associated 20K regulatory subunit. Nature 366:707-710[Medline]. |
| 25. |
Guan, K.-L.,
C. W. Jenkins,
Y. Li,
M. A. Nichols,
X. Wu,
C. L. O'Keefe,
A. G. Matera, and Y. Xiong.
1994.
Growth suppression by p18, a p16 INK4/MTS1 and p14 INK4B/MTS1-related CDK6 inhibitor, correlates with wild-type pRb function.
Genes Dev.
8:2939-2952 |
| 26. | Gupta, S., T. Barrett, A. J. Whitmarsh, J. Cavanagh, H. K. Sluss, B. Derijard, and R. J. Davis. 1996. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J. 15:2760-2770[Medline]. |
| 27. | Hall, M., and G. Peters. 1996. Genetic alterations of cyclins, cyclin dependent kinases, and Ddk inhibitors in human cancer. Adv. Cancer Res. 68:67-108[Medline]. |
| 28. |
Hamel, P. A.,
B. L. Cohen,
L. M. Sorce,
B. L. Gallie, and R. A. Phillips.
1990.
Hyperphosphorylation of the retinoblastoma gene product is determined by domains outside the simian virus 40 large-T-antigen-binding regions.
Mol. Cell. Biol.
10:6586-6595 |
| 29. | Hamel, P. A., R. M. Gill, R. A. Phillips, and B. L. Gallie. 1992. Regions controlling hyperphosphorylation and conformation of the retinoblastoma gene product are independent of domains required for transcriptional repression. Oncogene 7:693-701[Medline]. |
| 30. | Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge. 1993. The p21 cdk-interacting protein CIP1 is a potent inhibitor of G1 Cyclin-dependent kinases. Cell 75:805-816[Medline]. |
| 31. |
Hatakeyama, M.,
J. Brill,
G. Fink, and R. Weinberg.
1994.
Collaboration of G1 cyclins in the functional inactivation of the retinoblastoma protein.
Genes Dev.
8:1759-1771 |
| 32. | Herrera, R. E., V. P. Sah, B. O. Williams, T. P. Makela, R. A. Weinberg, and T. Jacks. 1996. Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts. Mol. Cell. Biol. 16:2402-2407[Abstract]. |
| 33. |
Hiebert, S. W.
1993.
Regions of the retinoblastoma gene product required for its interaction with the E2F transcription factor are necessary for E2 promoter repression and pRb-mediated growth suppression.
Mol. Cell. Biol.
13:3384-3391 |
| 34. | Hinds, P. W., S. Mittnacht, V. Dulic, A. Arnold, S. I. Reed, and R. A. Weinberg. 1992. Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 70:993-1006[Medline]. |
| 35. | Hoang, A., B. Lutterbach, B. C. Lewis, T. Yano, T. Y. Chou, J. F. Barrett, M. Raffeld, S. R. Hann, and C. V. Dang. 1995. A link between increased transforming activity of lymphoma derived MYC mutant alleles, their defective regulation by p107, and altered phosphorylation of the c-myc transactivation domain. Mol. Cell. Biol. 15:4031-4042[Abstract]. |
| 36. | Holmes, J. K., and M. J. Solomon. 1996. A predictive scale for evaluating cyclin-dependent kinase substrates. J. Biol. Chem. 41:25240-25246. |
| 37. | Horton, L. E., Y. Qian, and D. J. Templeton. 1995. G1 cyclins control the retinoblastoma gene product growth regulation activity via upstream mechanisms. Cell Growth Differ. 6:395-407[Abstract]. |
| 38. | Hunter, T., and J. Pines. 1991. Cyclins and cancer. Cell 66:1071-1074[Medline]. |
| 39. | Hunter, T., and J. Pines. 1994. Cyclins and cancer II: cyclin D and CDK inhibitors come of age. Cell 79:573-582[Medline]. |
| 40. |
Hurford, R. K.,
D. Cobrinik,
M.-H. Lee, and N. Dyson.
1997.
pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes.
Genes Dev.
11:1447-1463 |
| 41. | Kaelin, W. G. 1997. Recent insights into the functions of the retinoblastoma gene product. Cancer Investig. 15:243-254[Medline]. |
| 42. | Kallunki, T., T. Deng, M. Hibi, and M. Karin. 1996. c-jun can recruit JNK to phosphorylate dimerisation partners via specific docking interactions. Cell 87:929-39[Medline]. |
| 43. |
Kato, J.-Y.,
H. Matsushime,
S. W. Hiebert,
M. E. Ewen, and C. J. Sherr.
1993.
Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase cdk4.
Genes Dev.
7:331-342 |
| 44. |
Kaye, F. J.,
R. A. Kratzke,
J. L. Gerster, and J. M. Horowitz.
1990.
A single amino acid substitution results in a retinoblastoma protein defective in phosphorylation and oncoprotein binding.
Proc. Natl. Acad. Sci. USA
87:6922-6926 |
| 45. |
Kelly, B.,
K. Wolfe, and J. Roberts.
1998.
Identification of a substrate-targeting domain in cyclin E necessary for phosphorylation of the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
95:2535-2540 |
| 46. | Kitagawa, M., H. Higashi, H.-K. Jung, I. Suzuki-Takahashi, M. Ikeda, K. Tamai, J. Kato, K. Seqawa, E. Yoshida, S. Nishimura, and Y. Taya. 1996. The consensus motif for phosphorylation by cyclin D1-cdk4 is different from that for phosphorylation by cyclin A/E-cdk2. EMBO J. 15:7060-7069[Medline]. |
| 47. |
Knudsen, E. S.,
C. Buckmaster,
T.-T. Chen,
J. R. Feramisco, and J. Y. J. Wang.
1998.
Inhibition of DNA synthesis by RB: effects on G1/S transition and S-phase progression.
Genes Dev.
12:2278-2821 |
| 48. |
Knudsen, E. S., and J. Y. Wang.
1996.
Differential regulation of retinoblastoma function by specific cdk phosphorylation sites.
J. Biol. Chem.
271:8313-20 |
| 49. | Knudsen, E. S., and J. Y. J. Wang. 1997. Dual mechanisms for the inhibition of E2F binding to RB by cyclin-dependent kinase-mediated RB phosphorylation. Mol. Cell. Biol. 17:5771-5783[Abstract]. |
| 50. | Koh, J., G. Enders, B. Dynlacht, and E. Harlow. 1995. Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature 375:506-510[Medline]. |
| 51. | Krek, W., M. Ewen, S. Shirodkar, Z. Arany, W. G. Kaelin, and D. M. Livingston. 1994. Negative regulation of the growth-promoting transcription factor E2F-1 by a stably bound cyclin A-dependent protein kinase. Cell 78:1-20[Medline]. |
| 52. |
LaBaer, J.,
M. D. Garrett,
L. F. Stevenson,
J. M. Slingerland,
C. Sandhu,
H. S. Chou,
A. Fattaey, and E. Harlow.
1997.
New functional activities for the p21 family of CDK inhibitors.
Genes Dev.
11:847-862 |
| 53. |
Lees, E.,
B. Faha,
V. Dulic,
S. I. Reed, and E. Harlow.
1992.
Cyclin E/cdk2 and cyclin A/cdk2 kinases associate with p107 and E2F in a temporally distinct manner.
Genes Dev.
6:1874-1885 |
| 54. | Lees, J. A., K. J. Buchkovich, D. R. Marshak, C. W. Anderson, and E. Harlow. 1991. The retinoblastoma protein is phosphorylated on multiple sites by human cdc2. EMBO J. 10:4279-4290[Medline]. |
| 55. | Leng, X., L. Connell-Crowley, D. Goodrich, and J. W. Harper. 1997. S-phase entry upon ectopic production of G1 cyclin-dependent kinases in the absence of retinoblastoma phosphorylation. Curr. Biol. 7:709-712[Medline]. |
| 56. | Leone, G., J. DeGregori, R. Sears, L. Jakoi, and J. R. Nevins. 1997. Myc and Ras collaborate in inducing accumulation of active cyclin E/cdk2 and E2F. Nature 387:422-426[Medline]. |
| 57. |
Li, Y.,
C. Graham,
S. Lacy,
A. M. V. Duncan, and P. Whyte.
1993.
The adenovirus E1A-associated 130-kd protein is encoded by a member of the retinoblastoma gene family and physically interacts with cyclins A and E.
Genes Dev.
7:2366-2377 |
| 58. | Lin, B. T.-Y., S. Gruenwald, A. O. Moria, W.-H. Lee, and J. Y. J. Wang. 1991. Retinoblastoma cancer suppressor gene product is a substrate of the cell cycle regulator cdc2 kinase. EMBO J. 10:857-864[Medline]. |
| 59. | Lisztwan, J., A. Marti, H. Sutterluty, M. Gstaiger, C. Wirbelauer, and W. Krek. 1998. Association of human CUL-1 and ubiquitin-conjugating enzyme CDC34 with the F-box protein p45(SKP2): evidence for evolutionary conservation in the subunit composition of the CDC34-SCF pathway. EMBO 17:368-383[Medline]. |
| 60. |
Lukas, J.,
T. Herzinger,
K. Hansen,
M. C. Moroni,
D. Resnitzky,
I. Helin,
S. I. Reed, and J. Bartek.
1997.
Cyclin E induced S phase without activation of the Rb/E2F pathway.
Genes Dev.
11:1479-1492 |
| 61. | Lukas, J., D. Parry, L. Aargaard, D. J. Mann, J. Bartkova, M. Strauss, G. Peters, and J. Bartek. 1995. Retinoblastoma-protein-dependent cell-cycle inhibition by the tumor suppressor p16. Nature 375:503-506[Medline]. |
| 62. | Lukas, J. B., J. Rohde, M. Strauss, and J. Bartek. 1995. Cyclin D1 is dispensable for G1 control in retinoblastoma gene deficient cells independently of cdk4 activity. Mol. Cell. Biol. 15:2600-2611[Abstract]. |
| 63. | Lundberg, A., and R. Weinberg. 1998. Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes. Mol. Cell. Biol. 18:743-761. |
| 64. |
Marsilio, E.,
S. H. Cheng,
B. Schaffhausen,
E. Paucha, and D. M. Livingston.
1991.
The T/t common region of simian virus 40 large T antigen contains a distinct transformation-governing sequence.
J. Virol.
65:5647-5652 |
| 65. | Mitchison, T. J. 1989. Mitosis: basic concepts. Curr. Opin. Cell Biol. 1:67-74[Medline]. |
| 66. | Mittnacht, S. 1998. Control of pRB phosphorylation. Curr. Opin. Genet. Dev. 8:21-27[Medline]. |
| 67. | Moreno, S., and P. Nurse. 1990. Substrates for p34cdc2: in vivo veritas. Cell 61:549-551[Medline]. |
| 68. |
Muller, H.,
J. Lukas,
A. Schneider,
P. Warthoe,
J. Bartek,
M. Eilers, and M. Strauss.
1994.
Cyclin D1 expression is regulated by the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
91:2945-2949 |
| 69. |
Nevins, J. R.
1992.
E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.
Science
258:424-429 |
| 70. | Nigg, E. 1991. The substrates of the cdc2 kinase. Semin. Cell. Biol. 2:261-270[Medline]. |
| 71. | Norbury, C., and P. Nurse. 1992. Animal cell cycles and their control. Annu. Rev. Biochem. 61:441-470[Medline]. |
| 72. |
Ohtani, K.,
J. DeGregori, and J. R. Nevins.
1995.
Regulation of the cyclin E gene by transcription factor E2F1.
Proc. Natl. Acad. Sci. USA
92:12146-12150 |
| 73. | Ohtsubo, M. T., A. M. Schumacher, J. Roberts, and M. Pagano. 1995. Human cyclin E, a nuclear protein essential for the G1/S phase transition. Mol. Cell. Biol. 15:2612-2624[Abstract]. |
| 74. |
Pan, W.,
T. Sun,
R. Hoess, and R. Grafstrom.
1998.
Defining the minimal portion of the retinoblastoma protein that serves as an efficient substrate for cdk4 kinase/cyclin D1 complex.
Carcinogenesis
19:765-769 |
| 75. | Peeper, D. S., P. Keblusek, K. Helin, M. Toebes, A. J. van der Eb, and A. Zantema. 1995. Phosphorylation of a specific site in E2F1 affects its electrophoretic mobility and promotes pRB binding in vitro. Oncogene 10:39-48[Medline]. |
| 76. | Peeper, D. S., L. L. Parker, M. E. Ewen, M. Toebes, F. L. Frederick, M. Xu, A. Zantema, A. J. van der Eb, and H. Piwnica-Worms. A- and B- type cyclins differentially modulate substrate specificity of cyclin-CDK complexes. EMBO J., in press. |
| 77. | Polyak, K., M. Lee, H. Erdjument-Bromage, A. Koff, J. Roberts, P. Tempst, and J. Massague. 1994. Cloning of p27kip1, a cyclin dependent kinase inhibitor and a potential mediator of extracellular mitogenic signals. Cell 78:59-66[Medline]. |
| 78. |
Qin, X.-Q.,
T. Chittenden,
D. M. Livingston, and W. G. Kaelin.
1992.
Identification of a growth suppression domain within the retinoblastoma gene product.
Genes Dev.
6:953-964 |
| 79. | Russo, A. A., P. D. Jeffrey, A. K. Patten, J. Massague, and N. P. Pavletich. 1996. Crystal structure of the p27kip1 cyclin dependent kinase inhibitor bound to the cyclin A-cdk2 complex. Nature 382:325-331[Medline]. |
| 80. |
Schulman, B.,
D. Lindstrom, and E. Harlow.
1998.
Substrate recruitment to cyclin-dependent kinase 2 by a multipurpose docking site on cyclin A.
Proc. Natl. Acad. Sci. USA
95:10453-10458 |
| 81. |
Sellers, W. R.,
B. G. Novitch,
S. Miyake,
A. Heith,
G. A. Otterson,
F. J. Kaye,
A. Lassar, and W. G. Kaelin.
1998.
Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth.
Genes Dev.
12:95-106 |
| 82. | Sherr, C. 1993. Mammalian G1 cyclins. Cell 73:1059-1065[Medline]. |
| 83. | Songyang, Z., S. Blechner, N. Hoagland, M. F. Hoekstra, H. Piwnica-Worms, and L. C. Cantley. 1994. Use of an orientated peptide library to determine the optimal substrates of protein kinases. Curr. Biol. 4:973-982[Medline]. |
| 84. | Soucek, T., O. Pusch, E. Hengstschlager-Ottnad, P. D. Adams, and M. Hengstschlager. 1997. Deregulated Expression of E2F1 induces cyclin A- and E-associated kinase activities independently from cell cycle position. Oncogene 14:2251-2257[Medline]. |
| 85. | Srinivasan, J., M. Koszelak, M. Mendelow, Y.-G. Kwon, and D. S. Lawrence. 1995. The design of peptide based substrates for the cdc2 protein kinase. Biochem. J. 309:927-931. |
| 86. | Taya, Y. Unpublished data. |
| 87. |
Templeton, D. J.,
S. H. Park,
L. Lanier, and R. Weinberg.
1991.
Nonfunctional mutants of the retinoblastoma protein are characterized by defects in phosphorylation, viral oncoprotein association, and nuclear tethering.
Proc. Natl. Acad. Sci. USA
88:3033-3037 |
| 88. | Toyoshima, H., and T. Hunter. 1994. p27, a novel inhibitor of G1 cyclin/cdk protein kinase activity is related to p21. Cell 78:67-74[Medline]. |
| 89. |
van den Heuvel, S., and E. Harlow.
1993.
Distinct roles for cyclin-dependent kinases in cell cycle control.
Science
262:2050-2053 |
| 90. | Weinberg, R. A. 1995. The retinoblastoma protein and cell cycle control. Cell 81:323-330[Medline]. |
| 91. | Williams, R. T., D. A. Carbonaro-Hall, and F. L. Hall. 1992. Co-purification of p34 cdc2/p58cyclin A proline-directed protein kinase and the retinoblastoma tumor susceptibility gene product: interaction of an oncogenic serine-threonine protein kinase with a tumor-suppressor protein. Oncogene 7:423-432[Medline]. |
| 92. |
Wilson, I. A.,
D. H. Haft,
E. D. Getzoff,
J. A. Tainer,
R. A. Lerner, and S. Brenner.
1985.
Identical short peptide sequences in unrelated proteins can have different confirmations: a testing ground for theories of immune recognition.
Proc. Natl. Acad. Sci. USA
82:5255-5259 |
| 93. |
Xiong, Y.,
H. Zhang, and D. Beach.
1993.
Subunit rearrangement of the cyclin dependent kinases is associated with cellular transformation.
Genes Dev.
7:1572-1583 |
| 94. | Xiong, Y., G. Hannon, H. Zhang, D. Casso, R. Kobayashi, and D. Beach. 1993. p21 is a universal inhibitor of cyclin kinases. Nature 366:701-704[Medline]. |
| 95. |
Xu, M.,
K. A. Sheppard,
C.-Y. Peng,
A. S. Yee, and H. Piwnica-Worms.
1994.
Cyclin A/cdk2 binds directly to E2F1 and inhibits the DNA-binding activity of E2F1/DP1 by phosphorylation.
Mol. Cell. Biol.
14:8420-8431 |
| 96. |
Zarkowska, T., and S. Mittnacht.
1997.
Differential phosphorylation of the retinoblastoma protein by G1/S cyclin-dependent kinases.
J. Biol. Chem.
272:12738-12746 |
| 97. |
Zhang, H.,
G. J. Hannon, and D. Beach.
1994.
p21-containing cyclin kinases exist in both active and inactive states.
Genes Dev.
8:1750-1758 |
| 98. | Zhang, J., R. J. Sanchez, S. Wang, C. Guarnaccia, A. Tossi, S. Zahariev, and S. Pongor. 1994. Substrate specificity of cdc2 kinase from human HeLa cells as determined with synthetic peptides and molecular modelling. Arch. Biochem. Biophys. 315:415-424[Medline]. |
| 99. |
Zhao, Y.,
C. Bjorbaek, and D. E. Moller.
1996.
Regulation and Interaction of pp90(rsk) isoforms with mitogen-activated protein kinases.
J. Biol. Chem.
271:29773-29779 |
| 100. |
Zhu, L.,
E. Harlow, and B. D. Dynlacht.
1995.
p107 uses a p21/CIP1-related domain to bind cyclin/cdk2 and regulate interactions with E2F.
Genes Dev.
9:1740-1752 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»