Previous Article | Next Article 
Molecular and Cellular Biology, February 1999, p. 1126-1135, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutator Phenotype Induced by Aberrant
Replication
Vivian F.
Liu,
Dipa
Bhaumik, and
Teresa S.-F.
Wang*
Department of Pathology, Stanford University
School of Medicine, Stanford, California 94305-5324
Received 29 July 1998/Returned for modification 14 September
1998/Accepted 5 November 1998
 |
ABSTRACT |
We have identified thermosensitive mutants of five
Schizosaccharomyces pombe replication proteins that have
a mutator phenotype at their semipermissive temperatures.
Allele-specific mutants of DNA polymerase
(pol
) and
mutants of Pol
, two Pol
subunits, and ligase exhibited increased
rates of deletion of sequences flanked by short direct repeats.
Deletion of rad2+, which encodes a nuclease
involved in processing Okazaki fragments, caused an increased rate of
duplication of sequences flanked by short direct repeats. The deletion
mutation rates of all the thermosensitive replication mutators
decreased in a rad2
background, suggesting that deletion
formation requires Rad2 function. The duplication mutation rate of
rad2
was also reduced in a thermosensitive polymerase background, but not in a ligase mutator background, which suggests that
formation of duplication mutations requires normal DNA
polymerization. Thus, although the deletion and duplication mutator
phenotypes are distinct, their mutational mechanisms are
interdependent. The deletion and duplication replication mutators all
exhibited decreased viability in combination with deletion of a
checkpoint Rad protein, Rad26. Interestingly, deletion of Cds1, a
protein kinase functioning in a checkpoint Rad-mediated reversible
S-phase arrest pathway, decreased the viability and exacerbated the
mutation rate only in the thermosensitive deletion replication mutators but had no effect on rad2
. These findings suggest that
aberrant replication caused by allele-specific mutations of these
replication proteins can accumulate potentially mutagenic DNA
structures. The checkpoint Rad-mediated pathways monitor and signal the
aberrant replication in both the deletion and duplication mutators,
while Cds1 mediates recovery from aberrant replication and prevents formation of deletion mutations specifically in the thermosensitive deletion replication mutators.
 |
INTRODUCTION |
Acquired genetic instability has
been proposed to be an early event in tumor evolution (24,
25). The hypothesis that cancer cells exhibit a mutator phenotype
or an increased rate of mutation has been validated by the finding that
mutations in mismatch repair (MMR) genes lead to microsatellite
instability and are the underlying cause of both hereditary
nonpolyposis colon cancer (HNPCC) and sporadic tumors (reviewed
in references 18, 23, and 26). In
addition to MMR genes, mutations in other genes responsible for
ensuring genomic stability may also generate a mutator phenotype (25). Thus, proteins that maintain genomic stability in
normal cells, including those involved in DNA replication,
repair, recombination, chromosomal segregation, transcription,
and cell cycle control are prime proto-mutator candidates. Mutations in
any of these genes may be an early event in tumorigenesis,
allowing the generation of the multiple mutations observed in cancers.
In addition to microsatellite instability, another common source of
mutation in human genetic diseases is deletion of sequences flanked by
short direct repeats (19). For example, this type of
deletion mutation has been documented in the genes responsible for
retinoblastoma (5),
-,
-, and


-thalassemias, ataxia telangiectasia, hemophilia B,
Wilm's tumor, breast cancer (BRCA-1 and BRCA-2), HNPCC (MLH-1 and
MSH2), and xeroderma pigmentosa (10; also references
20 and 27 and references
therein). In addition to human genetic diseases, similar spontaneous
and ionizing radiation-induced deletion mutations have been
characterized at the aprt locus of hamster cells (7,
14, 31).
Maintaining the integrity of genetic material during genome duplication
requires normal and accurate DNA replication. In Saccharomyces cerevisiae, defects in three replication proteins, Pol3 (DNA
polymerase
[Pol
], Rad27 (homolog of mammalian FEN-1), and RPA
(replication protein A) result in a mutator phenotype characterized by
alterations of sequences flanked by short direct repeats in vivo
(6, 37, 38). Strains containing thermosensitive (ts) alleles
of Pol
(pol3-t) or RPA (rfa1-t29,
rfa1-t6, and rfa1-t33) have a mutator phenotype
exhibiting an elevated rate of deletion of sequences flanked by short
direct repeats (6, 38). The pol3-t allele is
thought to reduce the rate of lagging strand DNA synthesis, resulting
in long stretches of single-stranded DNA (ssDNA) on the lagging strand
template (12). Deletions are proposed to arise from DNA
polymerase slippage over a ssDNA loop formed by slip mispairing between
direct repeats (12, 38).
Cells containing a null mutation of RAD27 exhibit an
increased rate of duplication of sequences flanked by short direct
repeats (37). Rad27 functions as either a structure-specific
5' flap endonuclease or exonuclease to process Okazaki fragments (16; see also references 2 and 21 and references therein). The observed
duplications are thought to be initiated when strand displacement
synthesis of Okazaki fragments occurs without the Rad27-dependent
removal of the resulting 5' flap (37). A subsequent ssDNA
loop formed by slip mispairing of direct repeats on the 5' flap
or formation of a double-strand break (dsb) followed by mutagenic
single-stranded annealing are two possible intermediates of
duplication mutations (37).
These findings suggest that either the impairment or absence of a DNA
replication protein could lead to a mutator phenotype that compromises
genomic stability. To test this hypothesis and to further elucidate the
molecular mechanisms underlying deletion and duplication mutations of
sequences flanked by short direct repeats, we screened a panel of
mutants of Schizosaccharomyces pombe replication proteins
shown in Table 1 for a mutator phenotype. We identified specific ts
alleles of pol
, pol
, two pol
subunit genes, and a DNA ligase gene as mutators that generate
deletions and a null mutant of rad2 (homolog of
RAD27 and FEN-1) as a mutator that generates
duplications of sequences flanked by short direct repeats. We
characterized these mutators and found that the deletion and
duplication mutation mechanisms are distinct but interdependent. Furthermore, the deletion and duplication mutators have differential requirements for the checkpoint Rad-mediated mechanisms to recover from
aberrant replication.
 |
MATERIALS AND METHODS |
Genetic and cell biology techniques.
S. pombe 972 h
was used as the wild-type strain. All the fission
yeast strains used in this study contain the wild-type
ura4+ gene either at their endogenous locus or
in the place of a deleted gene in the null mutants. Double mutants were
constructed by standard genetic techniques (15) and were
ensured to contain only one wild-type copy of the
ura4+ gene in the strain. The rich medium (YE)
and the minimal medium (PM) were prepared as described previously
(15, 28). Unless otherwise stated, cells were grown in YES
medium which is YE medium supplemented with 0.2 mg of adenine per ml
and 0.5 mg (each) of uracil, leucine, and histidine per ml. Strains
were generally propagated at 25°C unless otherwise stated.
Conjugation and sporulation were also performed at 25°C.
Determination of permissive, semipermissive, and nonpermissive
temperatures.
The permissive, semipermissive, and nonpermissive
temperatures of each of the strains tested were determined by a variety of methods in rich medium (YES). The permissive temperature was defined
as the condition under which cells grew at the same rate as the
wild-type cells did and displayed very few, if any, elongated cells.
The semipermissive condition was defined as the temperature at which a
strain exhibited a lower growth rate and slightly elongated cells but
still maintained a plating efficiency comparable to that observed at
the permissive temperature. The plating efficiency was determined by
counting the number of colonies resulting from plating 103
cells/plate on rich medium (YES). The nonpermissive temperature was
determined to be the lowest temperature at which the plating efficiency
of a strain was compromised (to <40%) relative to the colony-forming
ability at the permissive temperature, thereby preventing the
measurement of a mutation rate.
Comparison of viability between strains was assessed by spotting 5 µl
of serially diluted cells onto YES plates incubated at various
temperatures (21, 25, 30, 33, and 36°C). This method of assessing
viability (the spot assay) is not as sensitive as measuring the plating
efficiency but can detect differences of >5- to 10-fold between strains.
Mutator analysis.
Yeast strains shown in Table 1 were first
grown on PM plates without uracil to select for cells harboring
wild-type ura4+. After 4 days, whole colonies of
ura+ cells were suspended in nonselective YES
medium and grown overnight for approximately 6.5 generations. Log-phase
cells were plated onto YES plates containing 1 mg of 5-fluoroorotic
acid (5-FOA) per ml at a concentration of 106 cells/plate.
After ~5 days of growth, the number of FOAr colonies was
assessed. Mutation rates per generation were calculated by using the
formula adapted from the formula in reference 35: rate of mutation = 1
e(1/n)lnRn/R0, where
R0 and Rn are the
proportions of ura+ cells 0 and n
generations after removal from selection, respectively. R0 was taken as 1, since the progenitor cells
for each experiment were ura+. The overall
mutation rate was taken as the median value from ~10 to 30 independent experiments per strain. The relative mutation rate was
expressed as the fold induction compared to the wild-type value, which
was 2.89 × 10
8 per generation. Unless otherwise
mentioned, all strains were designated as having a mutator phenotype
within 95% confidence intervals by a two-tailed t test (
= 0.05,
= 0.20).
To analyze the mutation spectra, genomic DNA was isolated from one
FOA
r colony per independent culture. The mutated
ura4 gene was amplified
by PCR using
Vent DNA
polymerase, analyzed by 1.5% agarose gel
electrophoresis, and
classified as having deletions, insertions,
or no distinguishable size
change (NDSC). The
ura4 PCR products
from mutants that
displayed a different-sized PCR product were
gel purified and sequenced
to determine the nature of mutations
generated. PCR primers (Anagen
Technologies) used to amplify the
ura4 gene in
FOA
r cells were P
0 (aagcttagctacaaatcccac)
and P
8 (aacgcctaggaaaacaaacgc)
at
nucleotide positions 1 and 1406, respectively, of the
ura4+ gene. The open reading frame of
ura4+ resides between nucleotide positions 534 and 1320. In addition
to primer P
0, the PCR products were
sequenced by using the primers
P
1
(tttcttaccgtattgtcctac), P
2
(ggaccctatgtctgtgttatc), P
3
(ggcgagggtattatacaaggc),
and P
4
(ggagacgggctgggacagcaa) at nucleotide positions 462, 696,
915, and 1152,
respectively.
 |
RESULTS |
Identification of replication mutators.
It has been shown in
S. cerevisiae that mutations of POL3,
RPA, and RAD27 result in genomic instability.
pol3-t, rfa1-t29, rfa1-t6, and
rfa1-t33 generate deletions and a rad27 null
strain generates duplications of sequences flanked by short direct
repeats (6, 37, 38). To determine whether aberrant
replication caused by mutations in other replication proteins could
also lead to a mutator phenotype, we screened a bank of S. pombe mutants involved in DNA replication (Table
1) for an increased mutation rate. We
used a forward mutation rate assay that detects mutations inactivating
the ura4+ gene (FOAr mutations).
Strains that had a mutation rate fivefold higher than that of the
wild-type cells, which have a mutation rate of 2.89 × 10
8 per generation, were considered to have a mutator
phenotype and will hereafter be referred to as mutators.
By this approach, we identified three ts alleles each of
pol
and
pol
and one ts allele each of two
subunits of
pol
and
a DNA ligase gene that exhibited an
elevated mutation rate relative
to that of wild-type cells at the
semipermissive temperature (boldfaced
values in Table
2). These mutants will hereafter be
designated
the ts replication mutators. As reported in a previous
budding
yeast
rad27 study (
37), deletion of
rad2+ (
S. pombe homolog of
RAD27) also resulted in a mutator phenotype
(Table
2).
Together, the ts replication mutators and
rad2
will
be
referred to as the replication mutators. Strains containing
specific
mutant alleles of
pol
, two
pol
subunit genes, a ligase
gene and
rad2
all exhibited a 9- to 22-fold-higher mutation rate
than that of wild-type cells, while the
mutation rates in cells
containing mutant alleles of
pol
were almost 1 order of magnitude
higher (90- to 186-fold) (Table
2).
As shown in Table
2, not all ts replication mutants had a mutator
phenotype, as two alleles of
pol
,
pol
ts2, and
cdc6-23 did not exhibit
an elevated mutation rate relative to that of
wild-type cells. These
results suggest that the observed mutator
phenotype is not replication
protein specific but allele specific.
Mutant alleles of other
replication proteins that did not exhibit
an increased mutation rate
include Pol

(
cdc20-M10) and proteins
in the
prereplication complex such as Orp1 (
cdc30), MCM2
(
cdc19-P1),
and MCM10 (
cdc23-M36). Together,
these results suggest that mutations
in specific alleles of replication
complex components can affect
genomic
stability.
Mutation spectra of the replication mutators.
We analyzed the
nature of the mutations generated in the ura4 gene of the
FOAr mutant cells. The size of the ura4 gene
from the FOAr cells was determined by PCR amplification and
agarose gel analysis as described in Materials and Methods. The
wild-type ura4+ PCR product is 1,406 bp long.
The mutators had either smaller, larger, or similar-sized PCR fragments
compared to the wild-type ura4+ PCR product
(designated Del, Ins, or NDSC in Table 2, respectively; see also Fig.
1). ura4 PCR products that
were smaller than wild-type products were found in FOAr
colonies derived from ts replication mutants pol1-1,
pol
ts11, pol
ts13,
pol
ts1, cdc1-7,
cdc27-K3, and cdc17-K42, indicating that
mutations at these specific alleles of these replication proteins
caused deletions in the ura4+ gene.
ura4 PCR products that were larger than wild-type products, indicative of insertion mutation events, were rarely found in those ts
replication mutators that generated deletions. These mutants will
hereafter be referred to as the ts deletion mutators (Table 2). The
percentages of deletions versus total types of mutations generated by a
ts replication mutator ranged from 24 in cdc27-K3 to 94 in pol
ts1. The observation that insertions, but very few deletions, were detected in FOAr
rad2
mutant cells (Table 2) is similar to the mutation
spectrum described for S. cerevisiae rad27 mutants
(37).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of ura4 PCR products from
FOAr cells. Genomic DNA isolated from FOAr
cells was amplified by PCR and analyzed by 1.5% agarose gel
electrophoresis as described in Materials and Methods. The wild-type
(WT) ura4 PCR product is 1,406 bp long and marked as having
0-bp alteration. The difference in size between the wild-type and other
ura4 PCR products (+/ bp) is indicated to the right of the
gel, with + indicating larger and indicating smaller than
the wild-type product.
|
|
In addition to deletions and insertions, some of the
ura4
PCR products derived from FOA
r mutators appeared to have
NDSC as estimated by 1.5% agarose gel
analysis. Sequence
analysis of nine of these NDSC PCR products
derived from each of two
deletion mutators,
pol
ts13 and
cdc17-K42,
showed that most of the mutations were base
substitutions, and
none had size changes between 3 and 17 bp (data not
shown). Not
all mutants displaying a mutator phenotype yielded
ura4 PCR products
representative of deletion or insertion
mutation events. For example,
pol
ts3 and
cdc6-121 generated only NDSC
ura4 PCR
products (Table
2). It should be noted that in wild-type cells, only
NDSC
ura4 PCR products were detected. This is in agreement
with the finding
that base substitutions and small frameshifts (

1 and
+1) are
the predominant Can
r mutations found in
S. cerevisiae wild-type cells (
37).
Sequence analysis of the smaller-than-wild-type
ura4 PCR
products showed a common pattern in all the observed deletions (Table
3). The pattern of deletions generated in
the mutated
ura4 gene
in these ts replication mutators was
similar to that previously
described in
S. cerevisiae
mutators. Up to 75 bp of an artificially
inserted sequence flanked by a
3- to 9-bp short direct repeat
engineered in the
LYS2 gene
was deleted in
pol3-t (
38), and
8 bp to 17.7 kb
of sequences flanked by short direct repeats were
deleted in
Can
r mutants in
rfa-t29 (
6). In this
study, we used the entire
ura4+ gene as the
mutagenic target reporter. The length of deleted
sequence found ranged
from 18 to 1,070 bp, with the median length
of deleted sequence being
132 bp. The deleted sequence was flanked
by short direct repeats of 4 to 12 bp (Table
3). One of the short
direct repeats was always deleted,
and the median size of the
direct repeat involved was 7 bp. We found
that 31% of deletions
occurred in sequences including the initiation
codon of the
ura4 gene. Eleven of these deletions within the
start site involved
variations of the short direct repeat
(aaaagcaaag) at nucleotide
position 534. A 100-bp fragment
including the entire direct repeat
(aaaagcaaag) and a 262-bp
fragment including a smaller portion
of the same direct repeat
(aaaagca) were deleted in five and four
independent
occurrences, respectively. In the remaining mutations,
a
319-bp fragment including a 4-bp direct repeat (aagc) and a
100-bp
fragment including a 7-bp direct repeat (aaagcaa) were
deleted. It is noteworthy that deletions of sequences that inactivate
the
ura4 gene in FOA
r cells were not limited to
any specific part of the ~790-bp open
reading frame. The deletions
were in a wide variety of locations,
including an 18-bp deletion that
is only 45 bp upstream of the
ura4 termination codon. In
nine instances, the direct repeats
involved in the deletions were not
perfectly identical, sharing
all but one variant nucleotide (see short
direct repeats marked
by * and ** in Table
3). We found an
approximately equal incidence
of deletion of the first or second
imperfect short direct repeat.
Analysis of the insertion events in
rad2
and in the one
case observed in
pol
ts13 revealed that the
pattern of insertion
was similar to that described in a
S. cerevisiae rad27 null mutant
(
37). The insertion
mutation resulted in a duplication of one
of the 4- to 7-bp short
direct repeats and sequences flanked by
the short direct repeats (Table
3). The size of the duplicated
sequence ranged from 20 to 41 bp, and
the median size of duplicated
sequence was 22 bp. These results
indicate that
S. pombe rad2
generates the same
mutator phenotype characterized by duplication
of sequences flanked by
short direct repeats as deletion of its
S. cerevisiae
homolog
RAD27.
Deletion mutator phenotype is dependent upon semipermissive growth
conditions.
We further characterized the replication mutators to
elucidate the deletion and duplication mechanisms. Studies of an
S. cerevisiae pol3-t mutant have shown an eightfold
increase of the mutation rate at 30°C over that at 21°C, suggesting
that Pol
has an increased mutation rate at the semipermissive
temperature (38). We thus tested the effects of temperature
on the mutation rates of the ts deletion replication mutators
(pol
ts11, pol
ts13,
pol
ts1, cdc1-7,
cdc27-K3, and cdc17-K42), a ts replication
nondeletion mutator (pol
ts3), and a ts
replication nonmutator (pol
ts2) at 21, 25, or 30°C. Mutation rates of wild-type cells were similar at
25, 30, and 37°C (data not shown). The ts replication mutators pol
ts11, pol
ts13,
pol
ts1, and cdc1-7 that displayed
an elevated mutation rate relative to that of wild-type cells at 25°C
had a lower mutation rate at 21°C. At 21°C, the mutation rates in pol
ts1 and cdc1-7 were reduced ca.
five- to ninefold to near-wild-type levels, and the mutation rates in
pol
ts11 and pol
ts13
were reduced from ~180- to ~50-fold higher than that of wild-type
cells (compare Tables 2 and 6). At 25°C, cells harboring the
pol
ts11, pol
ts13, pol
ts1, or cdc1-7 allele were
slightly elongated, which is indicative of a mild replication
perturbation and 25°C being the semipermissive condition for these
mutants (3; also data not shown). At 21°C, cells
harboring the pol
ts11 or
pol
ts13 allele displayed a higher mutation
rate than the wild-type cells did, indicating that 21°C is still a
semipermissive temperature for these two mutants. Analogously, regardless of their ability to generate deletions, mutants such as
cdc17-K42, cdc27-K3,
pol
ts3, and cdc6-121 mutants that
exhibited a mutator phenotype at 30°C had decreased mutation rates to
near-wild-type levels at 25°C (compare Tables 2 and 6). Viability
analysis indicated that 30°C is the semipermissive temperature of
these replication mutators (Table 1). The mutation rate of a ts
nonmutator (pol
ts2) remained at the wild-type
rates at 21, 25, and 28°C (Table 2 and data not shown). Cells
harboring rad2
are not temperature-sensitive (30), and thus, the associated mutation rate did not change in a temperature-dependent manner (data not shown). These results indicate that the observed increased mutation rate in all the ts
replication mutators is dependent upon semipermissive growth conditions
and confirms that the mutated replication protein is the source of the
mutator phenotype.
Formation of deletion mutations requires Rad2.
The
differential mutation spectra associated with the ts replication
mutators and rad2
suggest that the processes of
generating deletions and duplications are distinct. However, the
two mechanisms may be related, since proteins mutated in both
pathways are directly involved in DNA replication and the sequence that
is altered is always flanked by short direct repeats. To test whether
the underlying mechanisms responsible for generating deletions and
duplications by these replication mutators are interdependent, we
constructed double mutants of each of the deletion-generating ts
replication mutators in a rad2
background. Deletion of
rad2 had no effect on the viability or restrictive
temperature of all the double mutants tested (data not shown). We then
compared the mutation rate of the ts replication mutators in a
rad2+ or rad2
background at the
semipermissive temperature of each respective ts replication mutator
(Table 4). Surprisingly, the mutation
rates of pol
ts11 and
pol
ts13 decreased 4.6- to 7.1-fold, respectively, in a rad2
background. It was difficult to
evaluate the effect of rad2
on the mutation rate of the
other ts replication mutators within 95% confidence levels, since
these ts replication mutators and rad2
had similar
mutation rates which were 9- to 22-fold higher than that of wild-type
cells (Table 4). However, agarose gel analysis of the FOAr
PCR products revealed that all the ts deletion mutators in a rad2
background had reduced percentages of deletion
mutations (Table 4). For example, in a rad2+
background, mutations generated by pol
ts1 were
94% deletions and 6% NDSCs (Tables 2 and 4), whereas in a
rad2
background, deletions in
pol
ts1 were no longer detectable (Table 4).
Finding decreases in both the mutation rates in
pol
ts11 and pol
ts13 and in the percentages of deletion mutations formed in all the ts
deletion mutators in a rad2
background indicates that
Rad2 is required to generate the observed deletion mutations in the ts
replication mutators.
Formation of duplication mutations in rad2
requires
normal DNA polymerization, but not DNA ligation.
We also measured
the duplication mutation rate of rad2
in all the ts
replication mutator backgrounds. With the exception of the ligase
mutator (cdc17-K42), the duplication mutation rate of
rad2
was reduced in a ts replication mutator background.
The percentages of duplication mutations decreased from 37 in the rad2
single mutant to 0 to 6 in a
pol
ts11, pol
ts13,
cdc1-7, or cdc27-K3 background and to 14 in a
pol
ts1 background (Table 4). These results
suggest that duplication mutations caused by rad2
are
dependent upon normal DNA polymerization, but not upon DNA ligation.
Together, these results indicate that the deletion and duplication
mutation mechanisms are distinct but interdependent.
Cds1 is required for growth and viability of the ts replication
mutators, but not the duplication mutator rad2
.
All
the replication mutators described in this study involve proteins that
directly function at the replication fork, suggesting that these
replication mutators generate aberrant replication structures at the
semipermissive temperature. We thus investigated how the cell responds
to prevent cell death and mutation formation from aberrant
replication(s). To this end, we analyzed these replication mutators in
a cds1
background (Table
5). In response to hydroxyurea (HU) or
DNA damage, the protein kinase Cds1 enables cells to arrest S phase
reversibly through a checkpoint-Rad mediated S-phase recovery pathway
(22). Cds1 is phosphorylated and activated by S-phase arrest
(22). Our previous studies have shown that Cds1 protein kinase is activated in pol
ts11 and
pol
ts13 mutants at the semipermissive temperature (25°C), suggesting that these mutants have aberrant replication structures that activate Cds1 (3). Furthermore, Cds1 function is required for viability of mutant cells containing pol
ts alleles, since cells with
pol
ts11 or pol
ts13 in
a cds1
background at 25°C are either inviable or grow
poorly (3). We therefore tested the effect of deleting
cds1+ in the replication mutators.
The viability of each replication mutator in a
cds1
background was assessed in rich medium at various temperatures, since
cds1
single mutant were not temperature-sensitive. In a
cds1
background, the viability of the ts replication
mutators was reduced
at the semipermissive temperature of the
respective parental strains
(Table
5). With the exception of the
pol
ts mutants, the other
ts replication
mutators had normal viability in a
cds1
background
at the
permissive temperature but were unable to grow at the semipermissive
temperature of the parental strains. Thus, deletion of Cds1 reduced
the
restrictive (and semipermissive) temperatures of the ts replication
mutators. In contrast, deletion of
cds1+ had no
effect on the viability or restrictive temperature of
those ts
replication mutants that did not exhibit a mutator phenotype,
which
included
pol
ts2,
cdc6-23,
cdc20-M10,
cdc19-P1,
cdc23-M36,
and
cdc30 (Table
5). Thus, all the ts replication mutators, but
not the nonmutators, required Cds1 for viability or normal growth
(Table
5). These results indicate that Cds1 responds to the specific
aberrant replication generated in the ts replication mutators
but not
the ts replication
nonmutators.
Interestingly, deletion of
cds1+ had no effect
on the viability of
rad2
cells (Table
5), suggesting that
Cds1 does not respond
to the aberrant DNA structures generated in
rad2
cells. The specific
requirement of Cds1 for the ts
replication mutators but not
rad2
suggests that the
deletion and duplication mutations are processed
distinctly.
Absence of Cds1 exacerbates the deletion, but not duplication,
mutator phenotype.
We next analyzed the mutation rate of the ts
replication mutators in a cds1
background. Since
cds1
did not have a mutator phenotype (Table
6) and deletion of
cds1+ reduced the semipermissive temperature of
all the ts replication mutators (Table 5), analyses were performed at
the permissive temperature of the respective ts replication mutators.
The pol
ts11 cds1
double mutant was
inviable, and the pol
ts13 cds1
double mutant grew too poorly to be assessed at 21°C. In a
cds1
background, the mutation rates of ts deletion
replication mutators, pol
ts1, cdc1-7, cdc27-K3, and cdc17-K42,
increased 3.6- to 18.5-fold over that in a cds1+
background (Table 6). Thus, at the permissive temperature, Cds1 plays a
role in preventing formation of mutations in these ts replication
mutators. Similar to the effect of Cds1 on viability, deletion of
cds1+ also did not have any effect on the
mutation rate in the duplication mutator rad2
or ts
nonmutator pol
ts2 (Table 6).
Cds1 function was also required for viability and to prevent further
exacerbation of the mutator phenotype in the non-deletion-causing
ts
replication mutators (
pol
ts3 and
cdc6-121) (Tables
5 and
6). Neither
pol
ts3 nor
cds1
single mutant
exhibited deletion
mutations (Table
2). Interestingly, in a
cds1
background,
pol
ts3 was able
to form deletion mutations, exhibiting 50% deletion and
50% NDSC
mutations (data not shown). Thus, at the semipermissive
temperature
(30°C),
pol
ts3 requires Cds1 to recover from
the
aberrant replication that can result in a NDSC mutator phenotype.
At 25°C, the permissive temperature of
pol
ts3, the few aberrant
replication
structures generated become further destabilized,
resulting in deletion
mutations in the absence of
Cds1.
All replication mutators require checkpoint Rad proteins for
viability.
Incomplete replication is monitored by the checkpoint
Rad proteins either to activate Cds1 to ensure a reversible S-phase arrest (intra-S checkpoint) or to activate Chk1 and Cds1 to establish a
G2 arrest (S-to-M checkpoint) (4, 22, 40).
Finding that deletion of cds1+ decreased the
restrictive temperature (Table 5) and enhanced the mutation rate of the
ts replication mutators (Table 6) led us to test whether deletion
of a Rad protein, Rad26, would similarly affect these replication
mutators. Six checkpoint Rad proteins, Rad1, Rad3, Rad9, Rad17,
Rad26, and Hus1, form a "guardian" complex that establishes the DNA
damage and replication checkpoints, and loss of any single component
results in a nonfunctional complex (1). As expected, all the
ts replication mutators were either inviable or grew poorly in a
rad26
background at the semipermissive temperature (Table
5). Similar to cds1+, deletion of
rad26+ also exacerbated the mutator phenotype of
two ts replication deletion mutators tested. The mutation rates of
cdc27-K3 and cdc17-K42 increased ca. fourfold in
a rad26
background at the permissive temperature (25°C)
over those of the single mutants (data not shown). This suggests that
aberrant replication in these two ts replication mutants is monitored
through the checkpoint Rad proteins to activate Cds1 to prevent cell
death and mutation formation at the semipermissive and permissive
temperatures, respectively. However, the requirement for Rad26 is not
restricted to the ts replication mutators. Two nonmutator Pol
mutants, pol
ts2 and cdc6-23, were
also inviable in a rad26
background at their
semipermissive temperatures (Table 5). This indicates that many types
of replication defects are monitored through the checkpoint Rad proteins.
Deletion of
rad26+, but not
cds1+, reduced the growth rate (data not shown)
and viability of
rad2
cells (Table
5). This indicates
that although aberrant DNA structures generated in
rad2
cells
are monitored by the checkpoint Rad proteins, they do not
activate
the Cds1-dependent pathway to maintain normal growth. This led
us to test whether the viability of
rad2
may be
maintained by
the Rqh1-dependent recovery pathway.
rqh1+ encodes a putative DNA helicase with
homology to the gene products
of the human
BLM and
WRN genes and
S. cerevisiae SGS1 genes
(
35).
Genetic studies indicate that
rqh1+, like
BLM, functions to prevent
inappropriate recombination.
In response to S-phase arrest by HU or DNA
damage, the checkpoint
Rad proteins are thought to also activate a
Rqh1-dependent process
to prevent inappropriate recombination
(
35). The
rad2
rqh1
double
mutant was inviable (data not shown), suggesting that cells
require
Rqh1, but not Cds1, for recovery from aberrant replication
structures
generated in the absence of Rad2. All the ts replication
mutators and
some nonmutators, such as
cdc6-23,
cdc20-M10, and
cdc23-M36, were also inviable in the
rqh1
background at their
respective semipermissive temperatures (data not
shown). Thus,
the requirement for Rqh1 is common, but not specific, to
all the
replication mutators. Unlike deletion of Cds1 or Rad26,
deletion
of Rqh1 did not elevate the mutation rate of the ts
replication
mutators at the permissive temperature (data not shown).
Together,
these results suggest that Rqh1 responds to the aberrant
replication
structures in all replication mutators, whereas Cds1
responds
specifically to the aberrant replications generated in the ts
replication
mutators.
 |
DISCUSSION |
In this study, we have identified mutant alleles of S. pombe replication proteins that confer a mutator phenotype.
Characterization of these mutators reveal the following interesting and
novel findings. (i) ts alleles of pol
, pol
,
two pol
subunit genes, cdc1 and cdc27, and a DNA ligase gene cause aberrant
replication that induces a mutator phenotype characterized by deletions
of sequences flanked by short direct repeats. (ii) Generation of
deletion mutations in these ts replication mutators requires a
functional Rad2. (iii) Deletion of rad2+ results
in an increased rate of duplication of sequences flanked by short
direct repeats that requires normal DNA polymerization, but not DNA
ligation. (iv) The checkpoint Rad proteins are required to prevent cell
death from aberrant replication generated in the deletion and
duplication mutators. (v) Cds1 is required to maintain cell viability
and prevent deletion mutation formation specifically in the ts
replication mutators, but not in the rad2
duplication mutator.
ssDNA gap initiates formation of deletion mutations in a
Rad2-dependent manner.
Studies of S. cerevisiae
pol3-t have suggested that the observed deletion of sequences
flanked by short direct repeats depends on their orientation relative
to the origin of replication and are specific to either the leading or
lagging strand, but not both (38). Simian virus 40 reconstituted replication studies have shown that Pol
, ligase, and
FEN-1 (mammalian homolog of Rad2) specifically function in lagging
strand DNA synthesis, while Pol
functions in both leading and
lagging strand synthesis (39). Our finding that mutant
alleles of pol
, pol
, two pol
subunit genes, a ligase gene and deletion of rad2
destabilize sequences flanked by short direct repeats indicates that
the observed sequence alterations in these replication mutators occur
predominantly during lagging strand synthesis. These mutant alleles
could cause a decreased rate of lagging strand synthesis or a stalled
replication fork, yielding a ssDNA gap on the template similar to the
proposed mutational mechanism in S. cerevisiae pol3-t
(12, 38) (Fig. 2A). The
absence of ligase function results in a nick that may be resected into
a ssDNA gap (Fig. 2A). Deletions are proposed to arise from DNA
polymerase slippage over a ssDNA loop formed by slip mispairing of
short direct repeats on the template strand (12, 38).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Proposed mechanisms for formation of deletion and
duplication mutations and their interdependency in replication
mutators. Two adjoining Okazaki fragments are shown, with thick arrows
representing short direct repeats. (A) A ssDNA gap generated by a slow
or stalled replication fork in ts DNA polymerases or by a resected nick
in ts ligase mutant yields a potentially mutagenic structure that can
form deletions. The ssDNA gap may initiate deletion mutation formation
via a dsb or upon replication slippage over a ssDNA loop formed by slip
mispairing of short direct repeats on the template strand. Following
are two proposed roles (21) for Rad2 in processing a
deletion mutation intermediate: (i) Rad2 may play a role in
homology-dependent DNA end joining in dsb repair. After DNA ends are
aligned by terminal microhomology, DNA on each strand beyond the short
stretches of homology would be 3' and 5' flaps that would have to be
cleaved off. Rad2 is the only known 5' flap endonuclease and the only
known 5' 3'-specific double-stranded DNA exonuclease activity in
higher eukaryotes and thus, may be involved in resolving these
structures (reviewed in reference 21). (ii) Deletion
formation may involve a ssDNA loop as an intermediate and is shown in
panel A. Initial nicking of the ssDNA loop by an unknown enzyme would
result in 3' and 5' flaps that would have to be cleaved off. Rad2 may
be required to remove the 5' flaps to generate deletion mutations. (B)
Duplication mutations are initiated when strand displacement synthesis
of Okazaki fragments occur without Rad2-dependent removal of the
resulting 5' flap. The 5' flap yields duplication mutations via a dsb
or upon replication slippage over a ssDNA loop formed by slip
mispairing of short direct repeats on the nascent strand as previously
proposed (37) and described in the Discussion. (C) In a ts
ligase mutant, displacement of the downstream Okazaki fragment occurs
to generate a potentially mutagenic 5' flap. The absence of Rad2 to
process the displaced 5' flap structure initiates duplication mutations
as described above for panel B. (D) In a double mutant of ts polymerase
and rad2 , a semidisabled polymerase has a reduced
potential to displace a 5' flap in the downstream Okazaki fragment.
Decreased levels of displaced 5' flap structures result in a reduced
duplication mutation rate as described in the Discussion.
|
|
The deletion mutation rate of the ts replication mutators decreased in
a
rad2
background, suggesting that formation of deletion
mutations is dependent upon a functional Rad2. Rad2 is a
structure-specific
exo- and/or endonuclease that is involved in
processing Okazaki
fragments (reviewed in references
2 and
21), and in
S. pombe,
it also functions in a recombination UV
dimer endonuclease-dependent
repair pathway (
30). We suggest
that Rad2 may be involved in
the resolution of intermediates of a
deletion mutation. Rad2 may
be required to process the 5' flaps
generated (i) after a ssDNA
loop formed by slip mispairing of direct
repeats is nicked or
(ii) during homology-dependent end joining
(reviewed in reference
21) (Fig.
2A). Alternatively,
the presence of a 5' flap due
to the absence of Rad2 may reduce either
the frequency or size
of the ssDNA gap on the template strand of the ts
replication
mutators. Thus, the absence of Rad2 would result in a
reduced
deletion mutation rate in the ts replication mutators (Fig.
2A).
Duplication mutations in rad2
are dependent upon
normal DNA polymerization, but not DNA ligation.
The duplication
mutations observed in S. cerevisiae rad27 mutants are
proposed to be initiated by strand displacement of a 5' flap on a
downstream Okazaki fragment by synthesis of the upstream Okazaki
fragment. The similarity of the duplication mutator
phenotypes of S. pombe rad2
and S. cerevisiae rad27 mutants suggests that the source of the
duplication mutations observed in rad2
is likely to also
be initiated by a 5' flap (Fig. 2B).
With the exception of the ligase mutator (
cdc17-K42), the
duplication mutation rate in
rad2
was reduced in a ts
replication
mutator background (Table
4). This suggests that formation
of
duplications in
rad2
cells requires wild-type
replication polymerases
but not DNA ligase. These results are
reminiscent of a recent
report showing that stimulation of
microsatellite instability
by a
rad27 mutant was reduced in
a
pol3-t mutant background in
S. cerevisiae
(
17). We suggest that the decreased duplication
mutation
rate of
rad2
cells harboring a polymerase mutation is
due
to a reduced rate of synthesis of an upstream Okazaki fragment
by the
polymerase mutants. Slowed or stalled synthesis of an upstream
Okazaki
fragment reduces the likelihood of strand displacement
of a downstream
Okazaki fragment to generate a 5' flap DNA structure
that initiates
duplication mutations (Fig.
2D). This would result
in the observed
decreased duplication mutator phenotype of
rad2
cells in
a polymerase mutant background (Fig.
2D).
Interestingly, the rate of duplication mutations generated in
rad2
cells was not reduced in a mutant ligase background
(
cdc17-K42).
In the absence of DNA ligase, normal synthesis
of the upstream
Okazaki fragment by DNA polymerases and subsequent
displacement
of the downstream Okazaki fragment to form a 5' flap
structure
in
rad2
cells occur. Thus, there is no effect
on the duplication
mutation rate of the
cdc17-K42 alele in
rad2
cells (Fig.
2C).
The reductional effects of the ts
polymerases, but not ts ligase,
on the rates of duplication mutations
in
rad2
substantiates the
hypothesis that the 5' flap
initiates the observed duplication
mutations (Fig.
2B).
Cds1 responds specifically to aberrant replication induced in the
ts replication mutators.
Our finding that in addition to DNA
polymerases, mutations in DNA ligase could result in a mutator
phenotype suggests that the observed deletion mutations are induced by
aberrant replication rather than solely by polymerase slippage. The
aberrant replication in rad2
cells that induces
duplication mutations is distinct from that of the ts replication
mutators. However, cells with either type of aberrant replication in a
rad26
background are inviable (Table 5). This suggests
that the checkpoint Rad proteins respond to both types of aberrant
replication in the deletion and duplication mutators. The loss of
viability in a rqh1
background indicates that the
checkpoint Rad-mediated Rqh1-dependent pathway is required to prevent
inappropriate recombination (35) and maintain viability from
aberrant replication in the deletion and duplication mutators. However,
Rqh1 does not seem to be involved in deletion mutation production
because the absence of Rqh1 does not affect the mutation rate of the ts
replication mutators (data not shown) and the requirement for Rqh1 is
not specific to the replication mutators (data not shown).
The specific requirement of Cds1 kinase for the ts replication mutators
demonstrates, for the first time, the involvement
of a cell cycle
checkpoint kinase in preventing the occurrence
of deletion mutations
and maintaining the viability of the ts
replication mutators. In
response to S-phase perturbation, Cds1
is activated to ensure a
reversible S-phase arrest (intra-S checkpoint),
thereby preventing the
accumulation of unrepairable DNA lesions
(
22). Cds1 is
thought to respond specifically to aberrant replication
structures in S
phase (
22). Rad53 (
S. cerevisiae homolog of
Cds1) has been proposed to stabilize replication structures under
conditions of replication inhibition and function in a DNA
replication-block
stress-response pathway (
8). This may be
accomplished by Rad53
preventing inappropriate firing of late origins
by blocking recruitment
of RPA to origins upon exposure to HU
(
36). Rad53 has also been
shown to prevent early firing of
late origins during undisturbed
S phase (
34).
At the semipermissive temperature, deletion of
cds1+ reduced the viability of the ts
replication mutators (Table
5). The ts
replication mutator cells
displayed an elongated cell morphology
at the semipermissive
temperature (data not shown), which is indicative
of aberrant
replication. This suggests that Cds1 is required to
allow cells to
recover from aberrant replication induced under
semipermissive
conditions, perhaps by preventing firing of late
origins. Thus, in the
absence of Cds1, cell death results from
the inability to recover from
a multitude of aberrant replication.
This may be analogous to the
primary lethal defect in a
rad53 null strain being an
inability to complete chromosomal replication
upon exposure to HU
(
8). In the presence of Cds1 at the semipermissive
temperature, some aberrant replication structures escape the
Cds1-dependent
recovery mechanism and thus result in deletion
mutations. At the
permissive temperature, the ts replication mutators
displayed
a normal cell morphology, suggesting the presence of none or
very
few aberrant replication structures. Under permissive conditions,
deletion of
cds1+ did not noticeably affect
viability but did exacerbate the mutation
rate of all the ts
replication mutators (Table
6). Furthermore,
in the absence of Cds1,
deletions were generated in
pol
ts3, which
is a
non-deletion-generating mutator, at the permissive temperature
(Table
2
and data not shown). This suggests that at the permissive
temperature,
Cds1 is required to prevent formation of deletion
mutations. The
seemingly dual effects of Cds1 in preventing cell
death and formation
of deletion mutations at the semipermissive
and permissive
temperatures, respectively, may be explained by
the cells' response to
different degrees of aberrant replication
occurring at the various
conditions.
In
S. pombe, the protein kinases Chk1 and Cds1 appear
to jointly enforce the S-to-M checkpoint (distinct from the intra-S
checkpoint described above) in response to HU in a checkpoint
Rad-dependent manner (
4,
40). In addition, it has been
reported
that following exposure to HU, Cds1 phosphorylates Wee1 to
establish
a cell cycle checkpoint (
4). Unlike Cds1, we found
that effects
on viability upon deletion of Chk1 or mutation of Wee1 did
not
correlate with the presence or absence of a mutator phenotype
in
the ts replication mutants (data not shown). Together, our
results
suggest that the roles of Cds1 in maintaining viability
and preventing
mutation formation are related to its function
in allowing cells to
recover from an aberrant replication, not
by enforcing the S-to-M cell
cycle checkpoint. Similarly, the
lethality in
rad53 null
strains exposed to HU is not the result
of inappropriate entry into
mitosis but the inability to complete
replication (
8). The
correlation of the deletion mutator phenotype
with specific biochemical
defects in replication fork progression
indicates that any mutations in
proteins that disrupt, destabilize,
or stall replication fork
progression have the potential to be
mutators. Our study also predicts
that mutants that require Cds1
for viability are likely to have a
mutator
phenotype.
Interestingly, deletion of Cds1 had no effect on either the growth or
mutation rate of the duplication mutator
rad2
(Tables
5
and
6). Thus, the Cds1-dependent pathway does not respond
to a
potentially mutagenic 5' flap structure generated in the
rad2
duplication mutator. Together, these results
strongly suggest
that different checkpoint Rad-mediated subpathways
respond to
different aberrant replication structures in order to
maintain
viability and prevent mutation
formation.
A proposed model of how deletion and duplication mutations in the
replication mutators are processed by the checkpoint Rad-dependent
S-phase recovery pathway is illustrated in Fig.
3.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
How checkpoint Rad proteins and Cds1 respond to aberrant
replication in the deletion and duplication mutators. ts replication
proteins at the semipermissive temperature and deletion of Rad2
generate different types of aberrant replication structures that are
monitored by checkpoint Rad proteins. Checkpoint Rad proteins activate
Rqh1 to prevent inappropriate recombination and cell death from both
types of aberrant replication structures. In response to prevalent
levels of aberrant replication specifically in ts replication mutators
at the semipermissive temperature, checkpoint Rad proteins activate the
Cds1-dependent recovery subpathway to prevent cell death and formation
of deletion mutations. Some aberrant replication structures escape the
Cds1-dependent recovery mechanism and thus result in deletion
mutations. In the presence of lower levels of aberrant replication at
the permissive temperature, Cds1 prevents formation of deletion
mutations in the ts replication mutators. Details of these checkpoint
responses are described in the Discussion.
|
|
 |
ACKNOWLEDGMENTS |
We thank A. M. Carr for providing us with the
cds1
and rad26
strains, S. Forsburg
for providing most of the parental cdc strains, and T. Enoch
for providing the rqh1
strain. We also thank Rose Borbely
for excellent technical help and Alison Miyamoto and members of the
Wang lab for helpful discussions and critical reading of the manuscript.
This work was supported in part by a grant from NIH (CA14835).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, Stanford University School of Medicine, Stanford, California 94305-5324. Phone: (650) 725-4907. Fax: (650) 725-6902. E-mail: twang{at}cmgm.stanford.edu.
 |
REFERENCES |
| 1.
|
Al-Khodairy, F.,
E. Fotou,
K. S. Sheldrick,
D. J. F. Griffiths,
A. R. Lehmann, and A. M. Carr.
1994.
Identification and characterization of new elements involved in checkpoint and feedback controls in fission yeast.
Mol. Biol. Cell
5:147-160[Abstract].
|
| 2.
|
Bambara, R. A.,
R. S. Murante, and L. A. Henricksen.
1997.
Enzymes and reactions at the eukaryotic DNA replication fork.
J. Biol. Chem.
272:4647-4650[Free Full Text].
|
| 3.
|
Bhaumik, D., and T. S.-F. Wang.
1998.
Mutational effect of fission yeast Pol on cell cycle events.
Mol. Biol. Cell
9:2107-2123[Abstract/Free Full Text].
|
| 4.
|
Boddy, M. N.,
B. Furnari,
O. Mondesert, and P. Russell.
1998.
Replication checkpoint enforced by kinases Cds1 and Chk1.
Science
280:909-912[Abstract/Free Full Text].
|
| 5.
|
Canning, S., and T. P. Dryja.
1989.
Short direct repeats at the breakpoints of deletions of the retinoblastoma gene.
Proc. Natl. Acad. Sci. USA
86:5044-5048[Abstract/Free Full Text].
|
| 6.
|
Chen, C.,
K. Umezu, and R. D. Kolodner.
1998.
Chromosomal rearrangements occur in S. cerevisiae rfa1 mutator mutants due to mutagenic lesions processed by double-strand-break repair.
Mol. Cell
2:9-22[Medline].
|
| 7.
|
de Jong, P. J.,
A. J. Grosovsky, and B. W. Glickman.
1988.
Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level.
Proc. Natl. Acad. Sci. USA
85:3499-3503[Abstract/Free Full Text].
|
| 8.
|
Desany, B. A.,
A. A. Alcasabas,
J. B. Bachant, and S. J. Elledge.
1998.
Recovery from DNA replicational stress is the essential function of the S-phase checkpoint pathway.
Genes Dev.
12:2956-2970[Abstract/Free Full Text].
|
| 9.
|
D'Urso, G.,
B. Grallert, and P. Nurse.
1995.
DNA polymerase alpha, a component of the replication initiation complex, is essential for the checkpoint coupling S phase to mitosis in fission yeast.
J. Cell Sci.
108:3109-3118[Abstract].
|
| 10.
|
Efstratiadis, A.
1980.
The structure and evolution of the human -globin gene family.
Cell
21:653-668[Medline].
|
| 11.
|
Francesconi, S.,
H. Park, and T. S.-F. Wang.
1993.
Fission yeast with DNA polymerase delta temperature-sensitive alleles exhibits cell division cycle phenotype.
Nucleic Acids Res.
21:3821-3828[Abstract/Free Full Text].
|
| 12.
|
Gordenin, D. A.,
A. L. Malkova,
A. Peterzen,
V. N. Kulikov,
Y. I. Pavlov,
E. Perkins, and M. A. Resnick.
1992.
Transposon Tn5 excision in yeast: influence of DNA polymerases , , and and repair genes.
Proc. Natl. Acad. Sci. USA
89:3785-3789[Abstract/Free Full Text].
|
| 13.
|
Grallert, B., and P. Nurse.
1996.
The ORC1 homolog orp1 in fission yeast plays a key role in regulating onset of S phase.
Genes Dev.
10:2644-2654[Abstract/Free Full Text].
|
| 14.
|
Grosovsky, A. J.,
J. G. de Boer,
P. J. de Jong,
E. A. Drobetsky, and B. W. Glickman.
1988.
Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutation in mammalian cells.
Proc. Natl. Acad. Sci. USA
85:185-188[Abstract/Free Full Text].
|
| 15.
|
Gutz, H.,
H. Heslot,
U. Leupold, and N. Loprieno.
1974.
Schizosaccharomyces pombe, p. 395-446.
In
R. C. King (ed.), Handbook of genetics 1, vol. 1. Plenum Press, New York, N.Y.
|
| 16.
|
Harrington, J. J., and M. R. Leiber.
1994.
The characterization of a mammalian DNA structure-specific endonuclease.
EMBO J.
13:1235-1246[Medline].
|
| 17.
|
Kokoska, R. J.,
L. Stefanovic,
H. T. Tran,
M. A. Resnick,
D. A. Gordenin, and T. D. Petes.
1998.
Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase (pol3-t).
Mol. Cell. Biol.
18:2779-2788[Abstract/Free Full Text].
|
| 18.
|
Kolodner, R.
1996.
Biochemistry and genetics of eukaryotic mismatch repair.
Genes Dev.
10:1433-1442[Free Full Text].
|
| 19.
|
Krawczak, M., and D. N. Cooper.
1991.
Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environments.
Hum. Genet.
86:425-441[Medline].
|
| 20.
|
Krawczak, M., and D. N. Cooper.
1997.
The human gene mutation database.
Trends Genet.
13:121-122[Medline].
|
| 21.
|
Lieber, M. R.
1997.
The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair.
Bioessays
19:233-240[Medline].
|
| 22.
|
Lindsay, H. D.,
D. J. F. Griffiths,
R. Edwards,
J. M. Murray,
P. U. Christensen,
N. Walworth, and A. M. Carr.
1998.
S-phase-specific activation of Cds1 kinase defines a subpathway of the checkpoint response in Schizosaccharomyces pombe.
Genes Dev.
12:382-395[Abstract/Free Full Text].
|
| 23.
|
Loeb, L. A.
1998.
Cancer cells exhibit a mutator phenotype.
Adv. Cancer Res.
72:25-56[Medline].
|
| 24.
|
Loeb, L. A.
1994.
Microsatellite instability: marker of a mutator phenotype in cancer.
Cancer Res.
54:5059-5063[Free Full Text].
|
| 25.
|
Loeb, L. A.
1991.
Mutator phenotype may be required for multi-stage carcinogenesis.
Cancer Res.
51:3075-3079[Free Full Text].
|
| 26.
|
Marra, G., and C. R. Boland.
1995.
Hereditary nonpolyposis colorectal cancer: the syndrome, the genes and historical perspectives.
J. Natl. Cancer Inst.
87:1114-1125[Abstract/Free Full Text].
|
| 27.
|
Meuth, M.
1989.
Illegitimate recombination in mammalian cells.
In
D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
|
| 28.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
94:795-823.
|
| 29.
|
Murakami, H., and H. Okayama.
1995.
A kinase from fission yeast responsible for blocking mitosis in S phase.
Nature
374:817-819[Medline].
|
| 30.
|
Murray, J. M.,
M. Tavassoli,
R. Al-Harithy,
K. S. Sheldrick,
A. R. Lehmann,
A. M. Carr, and F. Z. Watts.
1994.
Structural and functional conservation of the human homolog of the Schizosaccharomyces pombe rad2 gene, which is required for chromosome segregation and recovery from DNA damage.
Mol. Cell. Biol.
14:4878-4888[Abstract/Free Full Text].
|
| 31.
|
Nalbantoglu, J.,
D. Hartley,
G. Phear,
G. Tear, and M. Meuth.
1986.
Spontaneous deletion formation at the aprt locus of hamster cells: the presence of short sequence homologies and dyad symmetries at deletion termini.
EMBO J.
5:1199-1204[Medline].
|
| 32.
|
Nasmyth, K., and P. Nurse.
1981.
Cell division cycle mutants altered in DNA replication and mitosis in the fission yeast Schizosaccharomyces pombe.
Mol. Gen. Genet.
182:119-124[Medline].
|
| 33.
|
Nurse, P.,
P. Thuriaux, and K. Nasmyth.
1976.
Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe.
Mol. Gen. Genet.
146:167-178[Medline].
|
| 34.
|
Santocanale, S., and J. F. X. Diffley.
1998.
A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication.
Nature
395:615-618[Medline].
|
| 35.
|
Stewart, E.,
C. R. Chapman,
F. Al-Khodairy,
A. M. Carr, and T. Enoch.
1997.
rqh1+, a fission yeast gene related to the Bloom's and Werner's syndrome genes, is required for reversible S-phase arrest.
EMBO J.
16:2682-2692[Medline].
|
| 36.
|
Tanaki, T., and K. Nasmyth.
1998.
Association of RPA with chromosomal replication origins requires an Mcm protein, and is regulated by Rad53, and cyclin- and Dbf4-dependent kinases.
EMBO J.
17:5182-5191[Medline].
|
| 37.
|
Tishkoff, D. X.,
N. Filosi,
G. M. Gaida, and R. D. Kolodner.
1997.
A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair.
Cell
88:253-263[Medline].
|
| 38.
|
Tran, H. T.,
N. P. Degtyareva,
N. N. Koloteva,
A. Sugino,
H. Masumoto,
D. A. Gordenin, and M. A. Resnick.
1995.
Replication slippage between distant short repeats in Saccharomyces cerevisiae depends on the direction of replication and the RAD50 and RAD52 genes.
Mol. Cell. Biol.
15:5607-5617[Abstract].
|
| 39.
|
Waga, S., and B. Stillman.
1994.
Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro.
Nature
369:207-212[Medline].
|
| 40.
|
Zeng, Y.,
K. C. Forbes,
Z. Wu,
S. Morena,
H. Piwnica-Worms, and T. Enoch.
1998.
Replication checkpoint requires phosphorylation of the phosphatase Cdc25 by Cds1 or Chk1.
Nature
395:507-510[Medline].
|
Molecular and Cellular Biology, February 1999, p. 1126-1135, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yin, L., Locovei, A. M., D'Urso, G.
(2008). Activation of the DNA Damage Checkpoint in Mutants Defective in DNA Replication Initiation. Mol. Biol. Cell
19: 4374-4382
[Abstract]
[Full Text]
-
Kai, M., Boddy, M. N., Russell, P., Wang, T. S.-F.
(2005). Replication checkpoint kinase Cds1 regulates Mus81 to preserve genome integrity during replication stress. Genes Dev.
19: 919-932
[Abstract]
[Full Text]
-
Tanaka, H., Ryu, G.-H., Seo, Y.-S., MacNeill, S. A.
(2004). Genetics of lagging strand DNA synthesis and maturation in fission yeast: suppression analysis links the Dna2-Cdc24 complex to DNA polymerase {delta}. Nucleic Acids Res
32: 6367-6377
[Abstract]
[Full Text]
-
Zhou, Y., Wang, T. S.-F.
(2004). A Coordinated Temporal Interplay of Nucleosome Reorganization Factor, Sister Chromatin Cohesion Factor, and DNA Polymerase {alpha} Facilitates DNA Replication. Mol. Cell. Biol.
24: 9568-9579
[Abstract]
[Full Text]
-
Niimi, A., Limsirichaikul, S., Yoshida, S., Iwai, S., Masutani, C., Hanaoka, F., Kool, E. T., Nishiyama, Y., Suzuki, M.
(2004). Palm Mutants in DNA Polymerases {alpha} and {eta} Alter DNA Replication Fidelity and Translesion Activity. Mol. Cell. Biol.
24: 2734-2746
[Abstract]
[Full Text]
-
Gutierrez, P. J. A., Wang, T. S.-F.
(2003). Genomic Instability Induced by Mutations in Saccharomyces cerevisiae POL1. Genetics
165: 65-81
[Abstract]
[Full Text]
-
Ogawa, M., Limsirichaikul, S., Niimi, A., Iwai, S., Yoshida, S., Suzuki, M.
(2003). Distinct Function of Conserved Amino Acids in the Fingers of Saccharomyces cerevisiae DNA Polymerase {alpha}. J. Biol. Chem.
278: 19071-19078
[Abstract]
[Full Text]
-
Dahlen, M., Sunnerhagen, P., Wang, T. S.-F.
(2003). Replication Proteins Influence the Maintenance of Telomere Length and Telomerase Protein Stability. Mol. Cell. Biol.
23: 3031-3042
[Abstract]
[Full Text]
-
Kai, M., Wang, T. S.-F.
(2003). Checkpoint activation regulates mutagenic translesion synthesis. Genes Dev.
17: 64-76
[Abstract]
[Full Text]
-
Feng, W., D'Urso, G.
(2001). Schizosaccharomyces pombe Cells Lacking the Amino-Terminal Catalytic Domains of DNA Polymerase Epsilon Are Viable but Require the DNA Damage Checkpoint Control. Mol. Cell. Biol.
21: 4495-4504
[Abstract]
[Full Text]
-
Kai, M., Tanaka, H., Wang, T. S.-F.
(2001). Fission Yeast Rad17 Associates with Chromatin in Response to Aberrant Genomic Structures. Mol. Cell. Biol.
21: 3289-3301
[Abstract]
[Full Text]
-
Griffiths, D. J. F., Liu, V. F., Nurse, P., Wang, T. S.-F.
(2001). Role of Fission Yeast Primase Catalytic Subunit in the Replication Checkpoint. Mol. Biol. Cell
12: 115-128
[Abstract]
[Full Text]
-
Campbell, M. R., Thang, T. Y., Jirik, F. R., Andrew, S. E.
(2000). Candidate mutator genes in mismatch repair-deficient thymic lymphomas: no evidence of mutations in the DNA polymerase {{delta}} gene. Carcinogenesis
21: 2281-2285
[Abstract]
[Full Text]
-
Tan, S., Wang, T. S.-F.
(2000). Analysis of Fission Yeast Primase Defines the Checkpoint Responses to Aberrant S Phase Initiation. Mol. Cell. Biol.
20: 7853-7866
[Abstract]
[Full Text]
-
Kokoska, R. J., Stefanovic, L., DeMai, J., Petes, T. D.
(2000). Increased Rates of Genomic Deletions Generated by Mutations in the Yeast Gene Encoding DNA Polymerase delta or by Decreases in the Cellular Levels of DNA Polymerase delta. Mol. Cell. Biol.
20: 7490-7504
[Abstract]
[Full Text]
-
Chen, J. Z., Qiu, J., Shen, B., Holmquist, G. P.
(2000). Mutational spectrum analysis of RNase H(35) deficient Saccharomyces cerevisiae using fluorescence-based directed termination PCR. Nucleic Acids Res
28: 3649-3656
[Abstract]
[Full Text]
-
Nozawa, K., Suzuki, M., Takemura, M., Yoshida, S.
(2000). In vitro expansion of mammalian telomere repeats by DNA polymerase {alpha}-primase. Nucleic Acids Res
28: 3117-3124
[Abstract]
[Full Text]
-
Griffiths, D, Uchiyama, M, Nurse, P, Wang, T.
(2000). A novel mutant allele of the chromatin-bound fission yeast checkpoint protein Rad17 separates the DNA structure checkpoints. J. Cell Sci.
113: 1075-1088
[Abstract]
-
Chen, C., Merrill, B. J., Lau, P. J., Holm, C., Kolodner, R. D.
(1999). Saccharomyces cerevisiae pol30 (Proliferating Cell Nuclear Antigen) Mutations Impair Replication Fidelity and Mismatch Repair. Mol. Cell. Biol.
19: 7801-7815
[Abstract]
[Full Text]