Previous Article | Next Article 
Molecular and Cellular Biology, February 1999, p. 1144-1158, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Seven Novel Methylation Guide Small Nucleolar RNAs
Are Processed from a Common Polycistronic Transcript by Rat1p and
RNase III in Yeast
Liang-Hu
Qu,1
Anthony
Henras,2
Yong-Jun
Lu,1
Hui
Zhou,1
Wei-xin
Zhou,1
Yuan-Qi
Zhu,1
Jin
Zhao,1
Yves
Henry,2
Michèle
Caizergues-Ferrer,2 and
Jean-Pierre
Bachellerie2,*
Biotechnology Research Center, Zhongshan
University, Guangzhou 510 275, People's Republic of
China,1 and
Laboratoire de Biologie
Moléculaire Eucaryote du CNRS, Université Paul Sabatier,
Toulouse, France2
Received 21 September 1998/Returned for modification 28 October
1998/Accepted 9 November 1998
 |
ABSTRACT |
Through a computer search of the genome of the yeast
Saccharomyces cerevisiae, the coding sequences of seven
different box C/D antisense small nucleolar RNAs (snoRNAs) with the
structural hallmarks of guides for rRNA ribose methylation have been
detected clustered over a 1.4-kb tract in an inter-open reading frame
region of chromosome XIII. The corresponding snoRNAs have been
positively identified in yeast cells. Disruption of the nonessential
snoRNA gene cluster specifically suppressed the seven cognate rRNA
ribose methylations but did not result in any growth delay under the conditions of yeast culture tested. The seven snoRNAs are processed from a common polycistronic transcript synthesized from an independent promoter, similar to some plant snoRNAs but in marked contrast with
their vertebrate functional homologues processed from pre-mRNA introns
containing a single snoRNA. Processing of the polycistronic precursor
requires nucleases also involved in rRNA processing, i.e., Rnt1p and
Rat1p. After disruption of the RNT1 gene, the yeast
ortholog of bacterial RNase III, production of the seven mature snoRNAs
was abolished, while the polycistronic snoRNA precursor accumulated. In
cells lacking functional Rat1p, an exonuclease involved in the
processing of both pre-rRNA and intron-encoded snoRNAs, several
processing intermediates of the polycistronic precursor accumulated.
This allowed for the mapping in the precursor of the presumptive Rnt1p
endonucleolytic cuts which provide entry sites for subsequent
exonucleolytic trimming of the pre-snoRNAs. In line with known
properties of double-stranded RNA-specific RNase III, pairs of Rnt1p
cuts map next to each other on opposite strands of long double-helical
stems in the secondary structure predicted for the polycistronic snoRNA precursor.
 |
INTRODUCTION |
Throughout its synthesis and
processing in the nucleoli of eukaryotic cells, pre-rRNA transiently
associates with scores of small nucleolar RNAs (snoRNAs), only a few of
which are required for the cleavages involved in formation of mature
rRNA (36, 53). Cytoplasmic rRNAs of eukaryotic cells contain
two prevalent types of nucleotide modification whose function is still
unknown, ribose methylations and pseudouridylations, both produced
posttranscriptionally on nascent pre-rRNA (34). The vast
majority of snoRNAs have been recently shown to serve as guides
specifying the sites of these rRNA nucleotide modifications, with each
type of modification involving a distinct family of guide snoRNAs
(5, 52). Ribose methylations of rRNA are guided by box C/D
antisense snoRNAs which contain two short sequence motifs, box C
(5'PuUGAUGA3') and box D (5'CUGA3'), and one or occasionally two long
complementarities to rRNA (11, 27, 39, 55). With each
ribose-methylated nucleotide in rRNA is associated a specific box C/D
antisense snoRNA, which targets the position to be methylated in
pre-rRNA through transient formation of a 10- to 21-nucleotide (nt) RNA duplex at the rRNA modification site (5, 11, 27, 39, 55).
Likewise, members of the other major snoRNA family, the H/ACA snoRNAs
(defined by the presence of a common 3'-terminal ACA sequence) (7,
19), guide pseudouridylations through formation of a specific
bipartite base-pairing with pre-rRNA around each uridine to be
isomerized (for reviews, see references 20, 38, and
40).
Both families of guide snoRNAs have an unusual gene organization and a
peculiar biosynthetic pathway. In vertebrates, most if not all of them
are encoded in introns of protein genes and not transcribed from their
own promoter in the intron but formed by processing of the host gene
pre-mRNA intron (32, 36), which could provide a regulatory
link between the production of the snoRNA and its host gene mRNA, all
the more because most snoRNA host genes encode proteins involved in
ribosome synthesis or function (36). A few intronic snoRNAs
have also been detected in the yeast Saccharomyces
cerevisiae (4, 45). Exonucleolytic degradation plays an
essential role in the maturation of intronic box C/D and H/ACA snoRNAs,
both in vertebrates (13, 14, 26, 54) and in yeast
(43), with mature snoRNAs generally released by mere
trimming of the debranched lariat, in line with the presence of a
single snoRNA per intron. However, a minor alternative biosynthetic pathway involving prior endonucleolytic cleavages within the pre-mRNA intron can coexist in some cases, and it could become dominant when
splicing efficiency is reduced (9, 10, 58). Processing of
both families of intronic snoRNAs depends on cis-acting
signals located within the mature snoRNA sequence, i.e., boxes C and D and the vicinal 5'- to 3' terminal stem for the box C/D family (10, 13, 59, 62) and the conserved H/ACA motif for the second major snoRNA family (19, 20). In yeast, unlike in
vertebrates, intron-encoded snoRNAs are not prevalent, probably in line
with the paucity of yeast introns, and several independently
transcribed S. cerevisiae modification guide snoRNAs have
been reported (36). Thus, yeast U14, unlike its vertebrate
ortholog, is not intron encoded (63). However, it is also
produced by posttranscriptional processing, and its accumulation is
dependent upon the same cis-acting signals as for processing
of intronic U14 in vertebrates (23). Intriguingly, in the
yeast genome the U14-coding sequence is close to that for another box
C/D snoRNA, snR190, which suggests that both snoRNAs might be produced
by processing of a common dicistronic transcript (63).
Recent experimental findings have unambiguously confirmed this
long-held hypothesis, demonstrating the involvement of both the Rat1p
exonuclease and Rnt1p endonuclease in this process (16, 43).
Another distinctive mode of snoRNA gene organization and expression has
been identified in higher plants, with the presence of independently
transcribed polycistronic snoRNA clusters, the processing of which
requires endonucleolytic cleavages (30, 31).
For identifying new methylation guide snoRNAs, computer searches of
genomic sequences exhibiting the structural hallmarks of box C/D
antisense snoRNAs represent a powerful means which has been largely
used for vertebrates (4, 39, 44, 45). In an effort to
enlarge the known repertoire of S. cerevisiae snoRNAs
guiding the 55 rRNA ribose methylations, we have extended this approach
to the complete yeast genome and detected 15 new members of this large
snoRNA family (46-48). In the present study, we have
focused our attention on seven of these novel box C/D snoRNAs, snR72 to
snR78 (initially termed Z2 to Z8), because of their striking clustering
in a single, relatively short segment of the S. cerevisiae
genome, within an inter-open reading frame (ORF) region of chromosome
XIII, and have experimentally established their requirement for the
cognate nonessential rRNA ribose methylations. We show that these
snoRNAs result from processing of a common polycistronic snoRNA
precursor, revealing in yeast the occurrence of a mode of snoRNA
biosynthesis identified in plants but still undetected in metazoans.
The polycistronic snoRNA transcription unit and ribosomal protein genes
exhibit common cis-acting control elements, while processing
of the polycistronic snoRNA precursor into individual mature snoRNAs
requires endo- and exonucleases also involved in rRNA processing.
 |
MATERIALS AND METHODS |
Unless otherwise stated, all techniques for cloning and
manipulating nucleic acids were performed according to standard
protocols (50).
Computer search of the yeast genome.
The complete S. cerevisiae genome was searched for novel box C/D snoRNAs
exhibiting structural features expected for guides of yeast rRNA ribose
methylations. To also possibly identify guides for some of the 11 to 13 yet-unmapped yeast rRNA ribose methylations (34, 57), the
search for rRNA complementarities was not restricted to known yeast
rRNA ribose-methylated motifs but included all yeast rRNA sequences
homologous to vertebrate ribose methylation sites, given that yeast and
vertebrate rRNA ribose methylation patterns are largely conserved
(34). Searches for a perfect 12-nt complementarity to an
rRNA ribose-methylated sequence, immediately followed by the sequence
NCUGA, were performed with BLAST (3) and FASTA
(41) programs. Positive sequences were then screened for the
presence of a box C motif within the 100 proximal upstream nucleotides
and of another CUGA box D' motif (5, 6, 56) within the 60 proximal upstream or downstream nucleotides.
Strains, media, and plasmids.
The yeast diploid strain
JG1017 (MATa/MAT
ade2-1/ade2-1
his4-260/his4-260 leu2-2/leu2-2 lys2-1/lys2-1 met8-1/met8-1 trp1-1/trp1-1 TYR7/tyr7-1 ura3-52/ura3-52 can1-100/can1-100
ILV1/ilv1-1) was used for preparing RNA for Northern and reverse
transcription (RT) analyses and DNA for PCR amplification of the snoRNA
gene cluster. The haploid strain SYNN281 (MATa
ade2-101 his3-
200 lys2-801 trp1-
1
ura3-52 CAN+) and JG337.1B (MATa
ade2-1 his4-260 leu2-2 lys2-1 met8-1 trp1-1 ura3-52
can1-100) were used for transformations and subsequent DNA and RNA
analyses. The following strains were used to study the processing of
the polycistronic transcript: an xrn1
strain (strain
R934, kindly provided by S. Kearsey; MATa ade2-1 his3-11,15 trp1-1 ura3-52 xrn1::URA3
[43]), a rat1-1 strain (DAH18, kindly
provided by C. Cole; MATa his3-
200
leu2-
1 ura3-52 rat1-1 [43]), a
rat1-1 xrn1
strain (strain 966-1C, kindly provided by S. Kearsey; MATa xrn1::URA3 rat1-1), an
rnt1
strain (strain SAE-52/1 [1], kindly
provided by S. Abou-Elela and M. Ares; MATa his3 lys2
leu2-3,112 trp1 ura3-52 pep4 prb1 prc1 rnt1::HIS3), and
an RNT1 strain (strain SAE-6, kindly provided by S. Abou-Elela and M. Ares; same as strain SAE-52/1 but transformed with
plasmid pRS316-RNT1). S. cerevisiae strains were grown in
rich (YPD) medium (1% yeast extract, 1% peptone, 2% glucose) or in
YSD medium (0.67% yeast nitrogen base without amino acids and
containing 2% glucose, supplemented with appropriate amino acids) at
the temperatures specified below. Yeast was transformed by the lithium
acetate method. Transformants were screened on selective plates, and
the deletion of chromosomal alleles was checked by PCR.
Escherichia coli TG1 [F'/supE hsd
5 thi
(lac-proAB)] or DH5
[F' endA1
hsdr17 (rK+mK+)
supE44 thi-1 recA1 gyrA (Nalr) relA1
(lacIZYA-argF)U169 deoR
(f80dlac
(lacZ)M15) grown on 2YT (1.6% Bacto tryptone, 1% Bacto yeast extract, 0.5% NaCl) or on
Luria-Bertani (1% Bacto tryptone, 0.5% Bacto yeast extract, 1% NaCl)
liquid or solid medium were used for all cloning procedures.
Deletion analysis of the polycistronic transcript promoter.
The following plasmids were generated. A DNA fragment consisting of the
entire snoRNA gene cluster flanked by 538 bp 5' and 216 bp 3' was PCR
amplified with oligodeoxynucleotides PC1 and PC2 (see below), which
provide EcoRI and SalI restriction sites, respectively, and cloned into the pFL39 yeast centromeric shuttle vector after EcoRI/SalI digestion. The resulting
plasmid was termed p
0. Progressive 5' deletions of the promoter
region were generated by PCR with p
0 as a template, the
oligodeoxynucleotide 25SCm2195, and one of the following
oligodeoxynucleotides: PolyRAP1.8 (generating the
1 deletion),
PolyRAP1.7 (
2 deletion), Poly4 (
3 deletion), Poly5 (
4
deletion), and PC3 (
5 deletion). The resulting DNA fragments were
digested by EcoRI and BamHI and used to replace the EcoRI/BamHI promoter fragment of p
0,
producing plasmids p
1 to p
5. These were directly transformed into
the haploid yeast strain carrying a chromosomal disruption of the
snoRNA gene cluster.
RNA analyses.
Yeast cells washed with diethyl
pyrocarbonate-treated H2O were ground with liquid
N2. A nucleolar fraction was isolated from purified yeast
nuclei through a detergent-salt extraction procedure (24).
RNA was isolated by the guanidinium thiocyanate method (17)
and analyzed by electrophoresis on 6 or 8% acrylamide-7 M urea gels.
Capillary transfer or electrotransfer onto nylon membranes (Amersham)
was carried out, followed by UV light irradiation of the membranes
(Hybond-N for snoRNA expression assays and Hybond-N+ for
ribose methylation assays). Northern blot hybridizations were carried
out with oligodeoxynucleotide probes labeled at the 5' ends with
32P through a 3-h incubation in 5× SSPE (1× SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA [pH
7.7]-1% sodium dodecyl sulfate (SDS)-5× Denhardt's solution-150
µg of tRNA per ml at a temperature 15 to 18°C below the theoretical
midpoint temperature of the hybrid. Membranes were washed twice with
0.1× SSPE-0.1% SDS or twice with 2× SSC-0.1% SDS and twice with
1× SSC-0.1% SDS before autoradiography. A
TaqI/HaeIII digest of pBR322 DNA labeled with
32P served as a size marker. For identifying 5' ends of
mature snoRNAs, primer extensions were carried out in 20-µl reaction
mixtures containing 15 µg of total cellular heat-denatured RNA
(65°C, 5 min, in H2O) and 20 ng of 5'-end-labeled primer
in the presence of 250 µM deoxynucleotide triphosphates (dNTPs) and
100 U of avian myeloblastosis virus (AMV) reverse transcriptase
(Promega) for 30 min at 42°C. Sequence analysis of cDNAs was
performed after purification of full-size primer extension products on
denaturing polyacrylamide gels. After addition of a 3' poly(G) tail
with terminal transferase (Promega), cDNAs were amplified by PCR with a
forward poly(C) primer carrying EcoRI and BamHI
restriction sites and a reverse Pz2-Pz8 primer. PCR products were
purified on 8% denaturing acrylamide gels and cloned into the pGEM T
vector (Promega) for sequence determination (Sequenase sequencing kit; Life Sciences Co.). Primer extension experiments with RNAs extracted from the rat1-1, xrn1
, rat1-1/xrn1
, SAE-52/1, or SAE-6
strain were performed as described above except that 5 µg of each of the relevant RNAs was denatured for 4 min at 80°C and that 5 U of AMV
reverse transcriptase (Promega) and 1 mM dNTPs were used.
RT-PCR experiment.
Total cellular RNA was submitted to an
extensive DNase I treatment before RT with reverse primer Pz4 or Pz2
(Fig. 1). About 50 µg of RNA in 100 µl in DNase I buffer was incubated (30 min, 37°C) with 10 U of RQ1
RNase-free DNase I (Promega) and subsequently submitted to
phenol-chloroform-isoamyl alcohol (50:49:1) extractions. A PCR was then
carried out with one of these reverse primers and the corresponding
forward primer (as depicted in Fig. 5), using the following program: 35 cycles of denaturation (30 s, 94°C), annealing (30 s, 55°C), and
extension (1 min, 72°C), followed by a final extension (10 min,
72°C).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence of the inter-ORF region of S. cerevisiae chromosome XIII, which spans the clustered snoRNA
genes. The sequence of the 2,129-bp region separating YMR013c and
YMR014w within the 3.9-kb YMR012-YMR014 inter-ORF region on the w
strand is shown. The proximal sequences of flanking ORFs on opposite
DNA strands, YMR013c and YMR014w, are also shown (in capital letters,
with the initiation codon in boldface). The cluster of snoRNA-coding
regions is boxed. Nucleotides outside snoRNA-coding regions are in
lowercase letters. Within each snoRNA-coding region the C and D motifs
(boxes), the 10- to 16-nt antisense elements matching sites of rRNA
ribose methylation (thick overlines), and the gene-specific primers
(horizontal arrows) used to delineate boundaries of mature snoRNA
sequences (Fig. 2) are indicated. The locations of PCR primers P1 and
P2 and restriction sites used for deleting the snoRNA gene cluster
(Fig. 3) are also indicated.
|
|
Detection of ribose-methylated nucleotides.
Ribose
methylation was tested by RT at low dNTP concentrations (35)
as follows. Five micrograms of total yeast RNA was mixed with 0.1 pmol
of a gel-purified oligodeoxynucleotide labeled at the 5' end with
32P, dried (SpeedVac), and resuspended in 20 µl of 1× RT
buffer (Promega). After a heat denaturation step (90°C, 5 min),
hybridization was performed at 55°C for 20 min. Primer extension with
10 U of AMV reverse transcriptase (Promega) was carried out in parallel on two aliquots (final volume, 40 µl) in the presence of either 4 µM or 1 mM dNTPs.
Immunoprecipitations.
Ten microliters of rabbit
antitrimethylguanosine (anti-TMG) antibody R1131, kindly provided by R. Lührmann (33a), or 10 µl of nonimmune anti-mouse
immunoglobulin Gs (IgGs) (Sigma) was incubated with gentle agitation
for 1 h at 4°C with 3 mg of protein A-Sepharose (PAS) previously
swollen in 150 µl of a solution containing 50 mM Tris-HCl (pH 7.4),
150 mM NaCl, and 0.05% Nonidet P-40. PAS-IgG pellets were washed twice
with 1 ml of the same buffer and then resuspended in 100 µl of the
same buffer supplemented with 80 U of RNasin RNase inhibitor (Promega).
Twenty micrograms of total RNA purified from either rnt1
cells or isogenic wild-type cells was then added to PAS-IgG samples.
The RNA-IgG interaction was allowed to take place for 1 h at 4°C
with gentle agitation. PAS pellets were then collected by very brief
centrifugation. The supernatants were removed, and the pellets were
washed five times with 1 ml of 50 mM Tris-HCl (pH 7.4)-150 mM
NaCl-0.05% Nonidet P-40. RNAs were then extracted from the pellet and
supernatant fractions by standard procedures.
Oligodeoxynucleotides.
Oligonucleotides were synthesized on
a PerSeptive Biosystems Expedite apparatus (Y. de Préval, LBME,
Toulouse, France) or obtained from the Shanghai Biochemistry Institute
(Academy of Sciences, People's Republic of China). After labeling of
the 5' ends with [32P]kinase, oligonucleotides were
either directly used as probes for Northern hybridization or submitted
to purification by electrophoresis on a 15% acrylamide-7 M urea gel
before utilization as RT primers. Sequences of primers (termed Pz2 to
Pz8) used for Northern and RT analyses of snR72 to snR78 are delineated
in Fig. 1. The forward poly(C) primer used for PCR amplification of
oligo(G)-tailed cDNAs for snR72 to snR78 was
5'GGAATTCGGATC163'. RT-PCR experiments (see Fig.
5) were performed with the following oligonucleotides: 5'TCCCTTGATGACCAAAATAAA3' (Scn2),
5'CATCAGACACTAATTGCTCT3' (Pz4), 5'CCATTCATGCCTTTCTGAAGC3' (P102f), and
5'ATCAGACTGACGTGCTTTTC3' (Pz2). Primers used for disrupting
the snoRNA gene cluster (see Fig. 3) were as follows
5'CGTCGGTACCATATAGGCAATGAACAG3' (P1, carrying a
KpnI site) and 5'GACGGAGCTCTCGTAATAGTGAATCTTAT3'
(P2, carrying a SacI site). Ribose-methylated
nucleotides in specific regions of S. cerevisiae rRNAs were
assayed with the following primers: 5'TGGTTCGATTAGTCTTTCGCCC3'
(o26S-snR72), 5'CCATTGTAAGTAGTCATCC3' (o26S-snR73),
5'TATACTTAGACATGCATGGCTTA3' (o18S-snR74),
5'CGTTAATCCATTCATGCGCGTC3' (o26S-snR75),
5'GCGCTTGGTTGAATTTCTTCAC3' (o26S-snR76),
5'AACTGCAACAACTTTAATATACG3' (o18S-snR77), and
5'GTGGGAGATACAGAGAAGTG3' (o26S-snR78). Primers used to
produce progressive 5' deletions of the promoter of the polycistronic
transcript were as follows: PC1,
5'CCCGAATTCATAGGCAATGAACAGAATAACG3' (provides an
EcoRI site); PC2, 5'CCCGTCGACGTTTCCTTTGGGTTATCCGTAC3' (provides a SalI site); PolyRAP1.8,
5'CCCGAATTCCTCTTTTGAAAATTACGTGCC3' (provides an
EcoRI site); PolyRAP1.7,
5'CCCGAATTCTAGAACTTTTTTCATTTCTG3' (provides an
EcoRI site); Poly4, 5'CCCGAATTCCTTCTAGGATTACTTCGGG3' (provides an EcoRI site); Poly5,
5'CCCGAATTCGAAAGGCTGAGAGAGAAATTG3' (provides an
EcoRI site); and PC3,
5'CCCGAATTCATCACAGGCTAATTATTCCCTTG3' (provides an
EcoRI site).
The following oligodeoxynucleotides were used in Northern or primer
extension experiments with RNAs extracted from the rat1-1, xrn1
, rat1-1/xrn1
, SAE-52/1, or SAE-6 strain: snoRNA1
(hybridizing to snR78), 5'ACGTTCTAATCACAAAAG3'; 18SUm578
(hybridizing to snR77), 5'GATAGTGCAAAAACGTAT3'; 25SCm2195
(hybridizing to snR76), 5'GTGGATCCTCATTTCCAT3'; 25SCm2195.2
(hybridizing to snR76), 5'CATTTGAAAGGATATTTGTTTCC3'; 25SGm2286 (hybridizing to snR75), 5'TGGTAATTTTAATAGTTG3';
18SAm28.2 (hybridizing to snR74),
5'CACTAATTGCTCTTTTCAATCATG3'; SnoRNA4.2 (hybridizing to
snR73), 5'CGATAAACATTCGAAAAACGCAG3'; and 25SAm874 (hybridizing to snR72), 5'ATCATTTGATGAGACGTT3'.
 |
RESULTS |
Detection of a cluster of seven putative methylation guide snoRNA
coding sequences on S. cerevisiae chromosome XIII.
In
methylation guide snoRNAs the systematic linkage of a 10- to 21-bp
antisense element with an adjacent downstream CUGA motif (6-8) provides the basis for an efficient sequence search
of the 13-Mb S. cerevisiae genome for novel box C/D snoRNAs,
given that positive sequences can be screened for the presence of an additional hallmark box C motif. Among the 15 novel S. cerevisiae snoRNAs eventually identified by this approach
(46-48), we have focused our attention on 7 species,
because their coding regions are intriguingly clustered. As shown in
Fig. 1, the seven sequences, termed snR72 to snR78, are all organized
in a head-to-tail fashion within a 1.4-kb segment of an inter-ORF
region on the w strand of chromosome XIII. They exhibit different
antisense elements corresponding to distinct 18S or 25S rRNA sequences,
as detailed below, and except for box C and D motifs they are not
related to each other or to any other sequence in the entire yeast
genome. The same holds true for all the relatively short (85- to
141-nt) AT-rich spacers which separate the snoRNA-coding regions.
Positive identification of the snoRNAs.
With oligonucleotide
probes specific for each presumptive coding region, the seven expected
RNAs were readily detected by Northern blot analysis of total yeast
cellular RNA (Fig. 2A). In each case the
intensity of the single band (size range, 87 to 109 nt) pointed to
cellular abundances in the same order of magnitude, roughly similar to
what was previously determined for intron-encoded methylation guide
snoRNA U24 (45). Parallel analysis of purified yeast
nucleolar RNA and total cellular RNA indicated that all these RNAs are
enriched in the nucleolar fraction more than 20 times, as shown for
snR77 (Fig. 2B). Mature 5' termini of the seven RNAs were identified by
primer extension with the same oligonucleotides (Fig. 2C and data not
shown), followed by cloning and sequencing of the cDNA (as detailed in
Materials and Methods). As expected, all cDNA sequences matched
perfectly the sequences of the presumptive coding regions delineated in
Fig. 1. Mature 3' termini were inferred from RNA migration on
denaturing gels (Fig. 2A). Three of the seven snoRNAs, snR72, and
snR74, and snR76, have the potential to form a characteristic 5'-to-3' terminal stem-box structure, as do about half the snoRNAs of this family (4-6).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Characterization of individual snoRNAs. (A and B)
Northern analysis. (A) Total cellular RNA (15 µg) was separated on an
8% acrylamide-8 M urea gel. After electrophoretic transfer, nylon
membranes were hybridized with the labeled oligonucleotide probes
depicted in Fig. 1. Lanes M, size markers. (B) Parallel analysis of
yeast nucleolar RNA and total cellular RNA with the snR77
oligonucleotide probe. Lane T, 15 µg of total cellular RNA. Lane No,
3 µg of RNA purified from yeast isolated nucleoli. (C) Primer
extension analysis. RT was carried out with the 32P-,
5'-end-labeled oligonucleotides depicted in Fig. 1.
|
|
Disruption of the gene cluster suppresses the cognate rRNA
methylations.
To test the essentiality of the clustered snoRNA
genes, we replaced the
2.0-kb DNA fragment containing the seven
snoRNA-coding regions plus vicinal flanking sequences with the
URA3 marker gene (Fig. 3).
After transformation of a haploid ura
strain
by the disrupted allele, Ura+ colonies were
selected. A PCR analysis of genomic DNA demonstrated that the
seven-snoRNA gene locus was completely deleted in
Ura+ cells, with the appearance of the expected
1.5-kb amplification product instead of the
2.4-kb band obtained
with wild-type strain DNA when the same pair of primers was used (Fig.
3B). Disruption of the snoRNA gene cluster was further confirmed by
primer extensions (Fig. 3C) and Northern blot analyses (data not shown)
of Ura+ cell RNA. In both cases no positive
radioactive signal was obtained with the different snoRNA-specific
5'-end-labeled oligonucleotides when probing disrupted-strain RNA, in
contrast to what was observed for parent wild-type strain RNA. To our
surprise, we could not detect any phenotypic difference at various
growth temperatures for the Ura+ cells with a
disrupted gene cluster, suggesting that the seven snoRNA genes were
dispensable in yeast.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Disruption of the snoRNA gene cluster. (A) The top
diagram shows PCR amplification of the 2.4-kb genomic DNA fragment of
an S. cerevisiae diploid strain with primers P1 and P2
(carrying KpnI and SacI sites, respectively) and
cloning of the amplified fragment into the corresponding restriction
sites of E. coli plasmid Bluescript M13 . (MCS, multiple
cloning site.) The bottom diagram shows how the
XbaI-HindIII 1.9-kb genomic fragment
containing the entire gene cluster was then replaced by the selectable
marker, the URA3 gene, giving rise to plasmid pYL3, which
was used to transform a haploid yeast strain after digestion with
KpnI and SacI. (B) PCR analysis of
URA+ transformants. DNAs from two different
URA+ transformants were PCR amplified with
primers P1 and P2 (lanes 1 and 2) and P1 and Pz6 (lanes 4 and 5), and
PCR products were analyzed by electrophoresis on an 0.8% agarose gel
followed by ethidium bromide staining. Lanes 3 and 6 are control lanes
showing amplification of wild-type strain YNN281 DNA with the primer
pairs P1-P2 and P1-Pz6s, respectively. Lane m contains a 2-kb molecular
size marker. (C) RT analysis of RNA from a URA+
transformant. The reaction was carried out with the snR78-specific
primer by using 15 µg of total RNA purified from either a
URA+ transformant (lane 1) or wild-type strain
YNN281 (lane 2). Lane m contains molecular size markers.
|
|
Of the seven antisense elements immediately followed by a CUGA motif
found in the different snoRNA-coding regions of the gene cluster, only
three, in snR74, snR77, and snR76, match previously mapped
ribose-methylated nucleotides in yeast rRNAs, i.e., Am27 and Um578 in
18S rRNA and Cm2196 in 25S rRNA, respectively (34, 57). In
contrast, the 11- to 15-nt antisense elements of snR72, snR73, snR75,
and snR78, which are also followed by a CUGA motif and definitely
exhibit the structural features of a bona fide guide sequence, did not
match a known rRNA ribose-methylated nucleotide. Within all guide
snoRNA-rRNA duplexes the methylated site is always at the same
location, paired to the fifth nucleotide upstream from the CUGA motif
(5, 6, 11, 27, 39). The positive identification of snR72,
snR73, snR75, and snR78 therefore strongly suggested that 25S rRNA
nucleotides A874, U2955, G2287, and U2420, respectively (Fig.
4A), were among the 11 to 13 yeast rRNA
ribose methylations which remained unmapped (34, 55), and
this has been recently verified experimentally (12). Using
primer extension at low dNTP concentrations, which causes pauses at
ribose-methylated nucleotides in the RNA template (35), we
have observed that disruption of the snoRNA gene cluster results in the
disappearance of the seven cognate rRNA ribose methylations (Fig. 4).
Each radioactive band reflecting the presence of the cognate ribose
methylation in wild-type strain RNA completely disappeared at low dNTP
concentrations when disrupted-strain RNA was used (Fig. 4B, lanes 2),
confirming that snR72 to snR78 are the cognate functional guides and
showing that their function cannot be fulfilled in an alternative way. Conversely, the other proximal rRNA ribose methylations assayed in
these experiments (Fig. 4B) were not affected by disruption of the gene
cluster, as expected, indicating that most, if not all, site-specific
rRNA ribose methylations are formed independently of each other and can
still proceed after a substantial reduction of the snoRNA guide
repertoire.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
Site-specific defects in rRNA ribose methylation after
disruption of the snoRNA cluster. (A) Methylation guide duplexes
between snoRNAs snR72 to snR78 and yeast rRNA. Ribose methylation sites
(filled circles) and box D or D' motifs (boxes) are indicated. (B)
Detection of rRNA ribose-methylated nucleotides by RT at low dNTP
concentrations. Primer extensions on total cellular RNA were performed
with seven appropriate oligonucleotides selected downstream from
cognate sites of ribose methylation for each snoRNA of the cluster (as
indicated at the top of each panel). Lanes C, control reaction at 1 mM
dNTPs on wild-type strain RNA; lanes 1 and 2, primer extension at 4 µM dNTPs on wild-type strain and disrupted strain RNA, respectively.
Among the sites of ribose methylation (arrows) revealed by RT pauses at
low dNTP concentrations, those specifically affected in the disrupted
yeast strain are indicated by boxed coordinates. In the panel for
snR74, bands denoted +1 and P correspond to the 5' end of 18S rRNA and
to an RT pause at a pseudo-knot structure, respectively.
|
|
Detection of a polycistronic snoRNA transcript.
The close
linkage of the seven snoRNAs, together with the short sizes of all
intergenic spacers which are devoid of any known promoter sequence
element, such as a TATA box, suggested that these genes might be
polycistronically expressed, similar to clusters of snoRNA genes in
plants (30, 31). To test this possibility we tried to detect
the presence of a long polycistronic transcript spanning the gene
cluster by RT-PCR. RT-PCRs were performed with two pairs of primers
designed to amplify two overlapping regions which together encompass
the entire cluster. In each case, the single band produced corresponded
precisely to the size of the product expected for the presence of a
common polycistronic transcript. Thus, with primers designed to amplify
between the snR75 and snR72 genes a band of 664 bp was expected, and an
amplified DNA fragment of
660 to 680 bp was observed (Fig.
5B). Likewise, a band of 941 bp was
expected for the snR78-snR74 primer combination, and an RT-PCR product
of about 950 bp was amplified (Fig. 5C). No amplification product was
observed in any of the RT-PCR controls performed in the absence of
reverse transcriptase (Fig. 5B and C, lanes C1 and C2). The results of
the different RT-PCR experiments were therefore consistent with the
existence of a common polycistronic transcript spanning the snoRNA gene
cluster.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of a polycistronic transcript spanning the
snoRNA cluster. (A) Locations of the two pairs of primers used for
RT-PCR experiments. (B and C) Products of the RT-PCR obtained with each
pair of primers. Reaction products were analyzed on an 0.8% agarose
gel and revealed by ethidium bromide staining. Lanes M, 2-kb molecular
size marker. Lanes R1 and R2, products of two
different PCRs with different concentrations of RT reaction products.
Lanes C1 and C2, control reactions carried out
without reverse transcriptase. Lanes D and D', control PCR performed on
yeast genomic DNA with the same pair of primers.
|
|
Delineation of the snoRNA gene cluster promoter.
Promoter
elements controlling the synthesis of the putative polycistronic
transcript are most likely located between the start of the upstream
ORF (YMR013c) and the start of the snR78-coding region. Intriguingly,
this region contains two perfect matches to the RAP1 binding site
consensus 5'(A/G)(A/C)ACCCANNCA(T/C)(T/C)3' (reviewed in reference
21) followed by an AT-rich stretch and a TATAAA
box (Fig. 6A), i.e., the elements
required for full transcriptional activity of most promoters of
S. cerevisiae ribosomal protein genes (61),
suggesting that there might be a coordinate transcriptional control of
some snoRNA and ribosomal protein genes. It is known that the latter
are regulated by carbon source; their mRNA levels display a fourfold
increase after cells are shifted from a medium containing a
nonfermentable carbon source to a medium containing a fermentable one,
and it has been suggested that this effect is mediated by Rap1p
(22, 28). We therefore tested first whether the steady-state
levels of snR78 are likewise affected by the carbon source. Northern
analysis revealed that snR78 levels are indeed twofold higher in cells
grown on glucose than in cells grown on glycerol (data not shown). We
next wanted to determine whether the putative Rap1p binding sites and
the T-rich sequence upstream of the snoRNA gene cluster are required
for its transcription. For this purpose, the complete snoRNA gene
cluster with 5' and 3' flanking sequences was cloned into a yeast
centromeric vector, and progressive deletions in the snR78 5' flanking
region were introduced (Fig. 6A). The resulting plasmids were then
transformed into a yeast strain in which the snoRNA gene cluster had
been disrupted. Northern blot analysis of RNAs extracted from cells harboring the various deletion mutants revealed that (i) an 88-bp region containing the two putative Rap1p binding sites is required for
full transcriptional activity, since in its absence snoRNA steady-state
levels were reduced by 40 to 50%; and (ii) in the absence of this
88-bp region, the AT-rich stretch becomes essential for promoter
activity, since when it was also removed, snoRNA steady-state levels
dropped by 80 to 85% (compare lanes
2 and
3 in Fig. 6B). Note
that snR78 and snR72 levels were similarly affected by the
1 to
3
deletions, which shows that their transcription is controlled by the
same sequence elements and further supports the notion that they are
cotranscribed. However, production of the 3'-most snoRNA of the
polycistronic unit, snR72, was not completely abolished by the removal
of the TATAAA box motif (Fig. 6B, lanes
4 and
5), in
contrast to what was observed for the 5'-most snoRNA, snR78, possibly
reflecting residual cryptic transcription initiation.

View larger version (36K):
[in this window]
[in a new window]

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 6.
Deletion analysis of the snoRNA gene cluster promoter.
(A) Sequence of the promoter region with the relevant promoter elements
(boxed) and the 5' ends of the various promoter deletion mutants used
(bent arrows) indicated. Vertical arrows indicate the positions of the
major transcription initiation sites (identified in the experiment
whose results are shown in Fig. 10). (B) SnoRNA levels in the yeast
strains harboring the various mutated promoters assayed by Northern
blot hybridization (5 µg of total RNA per lane). Lane WT, wild-type
yeast strain; lane Null, strain containing a chromosomal disruption of
the snoRNA gene cluster; lanes 0 to 5, the same strain
transformed with a centromeric vector bearing the entire snoRNA cluster
up to the 0, 1, 2, 3, 4, and 5 5' boundaries. The
blot was hybridized with oligonucleotide probes specific for snR78,
snR72, or U24 snoRNA. The percentages of snR78 and snR72 in the 1 to
5 mutants relative to the 0 strain, using U24 as an internal
standard, are displayed below the corresponding lanes (quantifications
were carried out by phosphorimager scanning). B, background.
|
|
Maturation of the snoRNA polycistronic transcript requires the
exonuclease Rat1p.
Production of mature snoRNA sequences from a
polycistronic transcript could occur either by direct endonucleolytic
digestion at the ends of the mature RNA sequences or by endonucleolytic cleavage within the spacers followed by 5'-to-3' and 3'-to-5' exonucleolytic trimming. Supporting the second scenario, analyses at
nucleotide resolution show a 2- to 3-nt heterogeneity for mature snoRNA
5' ends (Fig. 7A and data not shown).
Moreover, it has recently been shown that the 5' ends of the U14 and
snR190 snoRNAs are produced by the Rat1p 5'-to-3' exonuclease
(43). We therefore tested whether the two known yeast
5'-to-3' exoribonucleases, Rat1p and Xrn1p, are required for the 5'-end
formation of snoRNAs snR72 to snR78. The RAT1 gene is
essential; hence, a strain bearing a rat1-1 ts allele was
used (see reference 43 for references). Primer
extension experiments were performed with RNAs extracted from
rat1-1 ts, xrn1::URA3-disrupted, or double mutant
strains grown at the semipermissive (27°C) or nonpermissive (37°C)
temperature, using oligonucleotides specific to mature snoRNA sequences
(Fig. 7). With each of the six snR72- to snR77-specific primers, a
single 5'-extended species relative to each mature snoRNA was detected in rat1-1 ts/xrn1::URA3 cells (Fig. 7A and C).
Since the 5'-extended products must correspond to processing
intermediates of the pre-snoRNA generated by endonucleolytic cuts, the
primer extension experiment provided for a precise mapping of these
cuts in the intergenic spacer sequence. The same extension products
were also detected in the rat1-1 ts single mutant but not in
xrn1::URA3 cells (Fig. 7A, compare lanes 3 and 4 to 5 and 6; also data not shown), showing that Rat1p is by far the more
important of the two activities examined for 5'-end processing of snR72
to snR78. However, the increased levels of 5'-extended products in the
rat1-1 ts/xrn1::URA3 double mutant strain compared
to the rat1-1 ts single mutant (Fig. 7A, lanes 1 and 3, and
data not shown) indicate that Xrn1p, which is exclusively cytoplasmic
(25), can partially compensate for the lack of functional
Rat1p. Given that the snoRNA primary transcript bears a hypermethylated
cap (see below), this could point towards a cytoplasmic phase for
processing of the polycistronic transcript. Primer extensions with an
oligonucleotide specific to the 5'-most snoRNA in the polycistronic
unit, snR78, yielded somewhat more complex results, with the detection
of three major 5'-extended RNAs (Fig. 7B; see also Fig. 8A). The nature
of the 3'-to-5' exonuclease producing the 3' ends of the snoRNAs
remains to be determined.

View larger version (41K):
[in this window]
[in a new window]

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Accumulation of 5'-extended RNAs in cells lacking
functional Rat1p. (A) Primer extension products obtained with an
oligonucleotide complementary to snR76 by using 5 µg of total yeast
RNA extracted from the rat1-1/xrn1::URA3 strain
(lanes 1 and 2), the rat1-1 strain (lanes 3 and 4), the
xrn1::URA3 strain (lanes 5 and 6), and a wild-type
strain (lanes 7 and 8). Lanes 1, 3, 5, and 7, strains grown for 2 h at 37°C. Lanes 2, 4, 6, and 8, strains grown at 27°C. The
sequence ladder was generated with the same oligodeoxynucleotide
primer. (B) Mapping of the 5' ends of extended pre-snoRNAs with the
snR78 probe. The cDNAs corresponding to the mature snoRNAs and
5'-extended pre-snoRNA intermediates are indicated by hollow and filled
arrowheads, respectively, with the numbers referring to the Rnt1p cuts
in the snoRNA precursor structure as depicted in Fig. 8. (C) Mapping of
the 5' ends of extended pre-snoRNAs detected with snR72- to snR75- and
snR77-specific primers. Primer extensions were carried out with 5 µg
of total yeast RNA extracted from the
rat1-1/xrn1::URA3 strain (lanes 1 and 2) or the
wild-type strain (lanes 3 and 4). Lanes 1 and 3, strains grown for
2 h at 37°C. Lanes 2 and 4, strains grown at 27°C.
|
|
Endonucleolytic cleavages of the polycistronic snoRNA transcript
involve RNase III.
The various presumptive endonucleolytic
cleavage sites mapped by primer extensions (numbered 1 to 9 in
Fig. 7) are sufficient to free each of the snoRNAs in the primary
transcript. A comparison of the sequences in their immediate vicinity
did not reveal any obvious sequence conservation. To assess whether it
is the structure rather than the sequence per se which is critical for
cleavage, RNA folding predictions on a thermodynamical basis
(64) were carried out for the entire snoRNA polycistronic
transcript. Several very stable and extensive base-pairings, involving
both interspacer and intraspacer interactions, were identified (Fig.
8). Remarkably, all mapped cuts were
found within those extended double-helical structures, with six of them
being grouped in pairs, found next to each other on opposite strands of
the same double-helical region (Fig. 8A, C, and D). All these features
pointed to RNase III (2) as the endonuclease involved. To
directly test this possibility, we assessed the accumulation of snR78
and snR72 snoRNAs in a strain lacking RNase III. Northern blot analysis
(Fig. 9) showed that very little mature
snR78 or snR72 accumulates in the
rnt1::HIS3-disrupted strain (Fig. 9A, lanes 2).
Instead, a much longer RNA which comigrates with 18S rRNA accumulates.
This is fully consistent with the 1.8-kb RNA being the full-length
unprocessed polycistronic transcript. In addition, a series of smaller
RNAs was also detected in the rnt1::HIS3-disrupted
strain with the snR78 probe; these could result from premature
transcription termination. Accumulation of intron-encoded snoRNA U24
(Fig. 9B) or U18 (data not shown) was not affected by the absence of
RNase III, as expected.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
Locations of putative Rnt1p cleavage sites in
potentially base-paired regions of the polycistronic snoRNA transcript.
Only the parts of the polycistronic transcript structure which contain
the presumptive Rnt1p cuts identified in the experiment whose results
are shown in Fig. 7 are shown. Rnt1p cuts (arrows) are numbered as in
Fig. 7 for products accumulating in a rat1-1 ts strain at
the restrictive temperature. These cleavage sites, sufficient to free
each of the snoRNAs in the primary transcript, map within interspacer
pairings, involving spacers immediately upstream and downstream from
snoRNAs snR78, snR75, and snR73 (A, C, and D, respectively) or within a
duplex which involves only one intergenic sequence, between snR77 and
snR76 (B).
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 9.
Accumulation of the full-length polycistronic transcript
in cells lacking RNase III. (A and B) Northern blot analysis of RNAs
extracted from an rnt1::HIS3 strain (lanes 2) or
an otherwise-isogenic wild-type strain (lanes 1) grown at 26°C. (A)
RNAs were separated on a 1% agarose denaturing gel, blotted, and
hybridized with probes specific for snR78 or snR72 snoRNA. (B) RNAs
were separated on an 8% acrylamide gel, blotted, and hybridized with a
probe specific for U24 snoRNA.
|
|
The position(s) of the 5' end(s) of the transcript(s) accumulating in
the strain lacking RNase III was determined by primer extension with an
oligodeoxynucleotide hybridizing to the snR78 sequence (Fig.
10, lane 2). Four major extension
products were detected (Fig. 10, lane 2) corresponding to RNA 5' ends
mapping to nucleotide positions 70, 72, 79, and 91 downstream from the TATAAA box motif (Fig. 6A). Several less abundant primer
extension products could also be detected (data not shown). The fact
that RNAs 5'-extended relative to the 5' end of mature snR78 could accumulate in cells containing the wild-type Rat1p and Xrn1p
exonucleases suggested the possibility that these pre-snoRNAs were
protected from 5'-to-3' exonucleolytic digestion by a modified 5' end.
We looked for the presence of a TMG cap on these 5'-extended RNAs through immunoprecipitation experiments with anti-TMG antibodies performed on RNA from cells lacking RNase III or from isogenic wild-type cells, followed by primer extensions with the anti-snR78 oligonucleotide. All the above-described 5'-extended species revealed by primer extension were exclusively detected with the
immunoprecipitated RNA of the strain lacking RNase III (Fig. 10, lane
3), reflecting their carrying a 5' TMG cap and strongly suggesting that
their 5' ends correspond to transcription initiation sites. As
expected, mature snR78 snoRNA, serving as a control, was exclusively
detected in the supernatant (Fig. 10, lanes 7 and 8). In conclusion,
positions of the transcription initiation sites inferred from primer
extension experiments performed with RNAs from cells lacking RNase III
are fully consistent with the AT-rich stretch and the TATAAA
motif being key promoter elements of the RNA polymerase
II-transcribed polycistronic unit.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 10.
The 5' ends of the polycistronic transcripts possess a
TMG cap. Immunoprecipitations were carried out with anti-TMG antibodies
( TMG) or non-immune anti-mouse IgGs (NI) by using 20 µg of total
RNA purified from cells lacking RNase III (rnt1 ) or from
isogenic wild-type cells (WT). Following interaction with the
antibodies, RNAs were purified from the supernatants (S) or from the
protein A-Sepharose pellets (P) and used in primer extension
experiments performed with an anti-snR78 oligonucleotide. Primer
extension products were resolved on a 6% polyacrylamide sequencing
gel. As controls, primer extensions were also performed with 5 µg of
total RNA from the rnt1::HIS3 (lane 2) and
isogenic wild-type (lane 1) strains. Sequence ladders were obtained
with the same oligonucleotide primers. Two identical sets of samples
were loaded onto separate gels, one set being run longer to better
resolve the longer extension products. Only the relevant parts of each
gel are shown. Filled arrowheads point to the major long extension
products, and hollow arrowheads point to cDNA of mature snR78.
|
|
 |
DISCUSSION |
Illustrating the interest in computer searches focusing on the
non-protein-coding part of a genome, the identification of novel box
C/D snoRNAs snR72 to snR78 represents a substantial step towards the
identification of the full repertoire of snoRNAs guiding rRNA ribose
methylations in the yeast S. cerevisiae. Two other
large sets of novel yeast box C/D snoRNAs, also detected by
computer genomic searches, have been recently included in GenBank, with
8 species, Z9 to Z16, reported by L. H. Qu (47, 48) and a series of 15 additional species identified independently
(33). Together, 51 of the 55 total ribose methylations
present in S. cerevisiae rRNAs (34, 57) are now
assigned a cognate box C/D antisense snoRNA, strongly suggesting that
all sites of rRNA ribose methylation are specified through the
same snoRNA-guided process. snoRNAs snR72 to snR78 are absolutely
required for the seven cognate rRNA ribose methylations, which, except
for the one guided by snR75 (Gm2287 in 25S rRNA), are strongly
conserved in yeast and vertebrate rRNAs (34). As far as rRNA
methylation is concerned, snR73, snR74, and snR78 are functional
homologues of vertebrate snoRNAs U35, U27, and U52 (reference
5 and references therein), respectively, which have
unlinked coding regions. The seven cognate ribose methylations are
scattered within 18S or 25S rRNA structures, and there is no evidence
that these clustered snoRNAs have a more particularly related function
than other methylation guide snoRNAs. Their peculiar genomic
organization might therefore merely represent a simple means for
producing these snoRNAs in stoichiometric amounts.
Surprisingly, the lack of the seven rRNA methylations has no detectable
effect on yeast growth under the laboratory conditions examined
so far, similar to what has been observed after single-gene disruption
of a few methylation guide snoRNAs (references 36 and 53 and references therein), which precludes any
further indication about the elusive role of these rRNA modifications in the assembly or function of eukaryotic ribosomes (6).
Common components for the biosynthesis of snoRNAs and rRNAs.
Our data conclusively show that snoRNAs snR72 to snR78 are
cotranscribed and that the mature snoRNA sequences are processed from a
polycistronic transcript. Taken together with the demonstration that
snoRNAs snR190 and U14 are synthesized from a dicistronic unit in yeast
(16, 43), these results suggest that other snoRNAs processed
from polycistronic precursors might still await identification in
S. cerevisiae, even if the snR72-to-snR78 gene cluster could represent a unique situation because of the high number of snoRNA cistrons involved.
Remarkably, processings of the precursor to snoRNAs snR72 to snR78 and
of the snR190-U14 dicistronic transcript (16, 43) involve
very similar mechanisms, with in both cases monocistronic snoRNAs
released by endonucleolytic cleavage within the intergenic sequences of
the precursor followed by exonucleolytic trimming. While the 3'-to-5'
exonuclease(s) catalyzing formation of the 3' ends of mature snoRNAs
remains unidentified, both snoRNA precursors are cleaved by the same
endonuclease, Rnt1p, and degraded by the same 5'-to-3' exonucleases,
Rat1p and to a lesser extent Xrn1p. Interestingly, Rat1p, which
functions in the nucleus, is also the major 5' processing activity of
intronic snoRNAs U18 and U24 in wild-type yeast cells, while Xrn1p,
which is cytoplasmic, can partially compensate for the lack of
functional Rat1p (25, 43), similar to what we have observed
for the processing of the precursor of snoRNAs snR72 to snR78. This
points again to the existence of redundant processing/degradation
pathways involving a few enzymes with a wide range of substrate
specificities. Illustrating this notion, Rat1p and Xrn1p are also
responsible for the degradation of several spacer regions within
pre-rRNA (43), which could provide a basis for coregulating
rRNA and snoRNA processings. Likewise, endonuclease RNase III is
proposed to be one of E. coli's global regulators because
of its ability to affect the expression of a large number of unrelated
genes by influencing posttranscriptional control of mRNA stability or
translational efficiency, in addition to its multiple roles in the
processing of rRNAs, tRNAs, and other small stable RNAs or in the
conversion into monocistronic mRNAs of the polycistronic transcript of
the bacteriophage T7 early region (18). Paradoxically,
prokaryotic RNase III is not essential for bacterial viability.
Similarly, the yeast equivalent of RNase III is not strictly required
for yeast growth (16). Multifunctional Rnt1p, also involved
in the processing of rRNA (2) and U2 and U5 snRNAs (1,
15), seems to have a key role in snoRNA metabolism (16,
16a; also this study). It is therefore tempting to
propose that the endonucleolytic activity probably required for
the processing of plant polycistronic snoRNA precursors (30,
31, 51) is provided by a plant homologue of Rnt1p. Likewise, the
minor, splicing-independent, endonuclease-mediated processing pathway
for the maturation of a few intronic snoRNAs, both in yeast
(58) and in vertebrates (9), could also involve
Rnt1p (or its vertebrate homologue).
Most S. cerevisiae ribosomal protein genes contain a Rap1p
or Abf1p binding site(s) followed by a T-rich sequence which together are essential for promoter activity (49, 60, 61). Deletion analysis of the polycistronic snoRNA transcript promoter showed that an
88-bp region, containing the two canonical Rap1p sites, and the AT-rich
sequence upstream from the TATAAA box are sufficient for
full transcriptional activity and that the latter element alone can
provide 50% of the wild-type transcriptional level, as was found for
the promoter of the Rp59p ribosomal protein gene (29). This
suggests that coordinated production of some snoRNAs and components of
cytoplasmic ribosomes might also involve common transcriptional
controls, in addition to coregulated RNA processing pathways.
Supporting this notion, a canonical Rap1p binding site, again closely
associated with an AT-rich stretch and a TATAAA box motif,
is present at a very similar location with respect to the transcription
initiation site upstream of the snR190-U14 dicistronic unit.
Remarkably, canonical Rap1p (or Abf1p) sites followed by an AT-rich
stretch are also found upstream of several other yeast snoRNA-coding
regions (Fig. 11).
Recurrent themes in snoRNA gene organization and expression.
snoRNAs are produced according to a large diversity of pathways among
distant eukaryotic organisms, occasionally even within a species. While
most yeast snoRNAs are independently transcribed from mono-, di-, or
polycistronic units, the relatively compact S. cerevisiae
genome does encode a few intronic snoRNAs, U24, U18, snR38, snR39, and
snR59, processed according to the vertebrate mode (4, 33,
45). The different modes of snoRNA formation are unambiguously
related in their basically requiring the formation, within the snoRNA
precursor, of a free entry point for a multipurpose exonuclease.
Moreover, differences between these modes are blurred in a few
outstanding cases. Thus, some vertebrate host genes exhibit multiple
single-snoRNA-containing introns, constituting in effect snoRNA
polycistronic units fused to protein-coding genes, reminiscent of the
plant and yeast snoRNA polycistronic units, although the latter ones
involve a splicing-independent snoRNA processing (16, 30, 31,
51; also this study). Furthermore, three host genes for
mammalian intronic snoRNA do not code for proteins, exhibiting exon
sequences which are not conserved between mammals, unlike the
snoRNA-encoding sequences (8, 42, 56). This strongly suggests that the major if not the sole function of these genes is to
express their intronic snoRNAs and that such snoRNAs have in effect a
transcription unit of their own. Remarkably, one of these genes, UHG,
also displays a polycistronic organization, with a cluster of seven
different box C/D snoRNAs, each located in a different intron
(56). Moreover, primary transcripts of the three peculiar
mammalian snoRNA host genes have closely related 5'-terminal sequences,
highly reminiscent of the 5'-terminal oligopyrimidine tract of
ribosomal protein-coding mRNAs (37). Given the absence of
protein-coding potential of the corresponding spliced RNAs, this motif
is unlikely to have a role in translation and probably rather reflects
the presence of promoter elements in common with ribosomal protein
genes, likely providing for a coordinate expression at the
transcriptional level. These three mammalian snoRNA transcription units
appear thereby to be unexpectedly related to the conventional intron-encoded snoRNA units, generally hosted in genes coding for
proteins directly involved in ribosome biogenesis or function (5,
6, 27, 36, 39), and also, remarkably, to the yeast independent
polycistronic unit characterized in this study.
 |
ACKNOWLEDGMENTS |
We thank Guillaume Chanfreau for communicating results prior to
publication. We are particularly grateful to the following persons for
their gifts: M. Ares and S. Abou Elela for strains SAE-52/1 and SAE-6,
S. Kearsey for strains R934 and 966-1C, C. Cole for strain DAH18, and
R. Lührmann for anti-TMG antibodies. We thank A. Chambers for
advice and Marlène Faubladier for experimental help and helpful discussions.
This research was supported by the National Natural Science Foundation
of China (Key Project 39730300 and Fund for Distinguished Young Scholar
395250070 to L.-H.Q.), by the CNRS (Programme Physique et Chimie du
Vivant 1997), the Ministère de l'Education Nationale, de
l'Enseignement Supérieur et de la Recherche (MENESR, grant ACC-SV1), Université Paul Sabatier, Région
Midi-Pyrénées, Association pour la Recherche sur le Cancer
(ARC), and Ligue Nationale contre le Cancer. The collaboration between
our labs was supported by a grant (Programme de Recherches
Avancées 1998) from the Association Franco-Chinoise pour la
Recherche Scientifique et Technique. A.H. was supported by a Ph.D.
fellowship from MENESR.
Liang-Hu Qu and Anthony Henras contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Biologie Moléculaire Eucaryote du CNRS, Université Paul
Sabatier, 118 Route de Narbonne, 31062 Toulouse Cédex 04, France.
Phone: (33) 5 61 33 59 34. Fax: (33) 5 61 33 58 86. E-mail:
bachel{at}ibcg.biotoul.fr.
 |
REFERENCES |
| 1.
|
Abou-Elela, S., and M. Ares, Jr.
1998.
Depletion of yeast RNase III blocks correct U2 3' end formation and results in polyadenylated but functional U2 snRNA.
EMBO J.
17:3738-3746[Medline].
|
| 2.
|
Abou-Elela, S. A.,
H. Igel, and M. Ares, Jr.
1996.
RNase III cleaves eukaryotic preribosomal RNA at a U3 snoRNP-dependent site.
Cell
85:115-124[Medline].
|
| 3.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 4.
|
Bachellerie, J. P.,
B. Michot,
M. Nicoloso,
A. Balakin,
J. Ni, and M. J. Fournier.
1995.
Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA.
Trends Biochem. Sci.
20:261-264[Medline].
|
| 5.
|
Bachellerie, J. P., and J. Cavaillé.
1997.
Guiding ribose methylation of rRNA.
Trends Biochem. Sci.
22:257-261[Medline].
|
| 6.
|
Bachellerie, J. P., and J. Cavaillé.
1998.
Small nucleolar RNAs guide the ribose methylations of eukaryotic rRNAs, p. 255-272.
In
H. Grosjean, and R. Benne (ed.), Modification and editing of RNA. ASM Press, Washington, D.C.
|
| 7.
|
Balakin, A. G.,
L. Smith, and M. J. Fournier.
1996.
The RNA world of the nucleolus: two major families of small nucleolar RNAs defined by different box elements with related functions.
Cell
86:823-834[Medline].
|
| 8.
|
Bortolin, M. L., and T. Kiss.
1998.
Human U19 intron-encoded snoRNA is processed from a long primary transcript that possesses little potential for protein coding.
RNA
4:445-454[Abstract].
|
| 9.
|
Caffarelli, E.,
M. Arese,
B. Santoro,
P. Fragapane, and I. Bozzoni.
1994.
In vitro study of processing of the intron-encoded U16 small nucleolar RNA in Xenopus laevis.
Mol. Cell. Biol.
14:2966-2974[Abstract/Free Full Text].
|
| 10.
|
Caffarelli, E.,
A. Fatica,
S. Prislei,
E. De Gregorio,
P. Fragapane, and I. Bozzoni.
1996.
Processing of the intron-incoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing and the stability of the mature snoRNA.
EMBO J.
15:1121-1131[Medline].
|
| 11.
|
Cavaillé, J.,
M. Nicoloso, and J. P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[Medline].
|
| 12.
|
Cavaillé, J., and J. P. Bachellerie.
1998.
SnoRNA-guided ribose-methylation of rRNA: structural features of the guide RNA duplex influencing the extent of the reaction.
Nucleic Acids Res.
26:1576-1587[Abstract/Free Full Text].
|
| 13.
|
Cavaillé, J., and J. P. Bachellerie.
1996.
Processing of fibrillarin-associated snoRNAs from pre-mRNA introns: an exonucleolytic process exclusively directed by the common stem-box terminal structure.
Biochimie (Paris)
78:443-456[Medline].
|
| 14.
|
Cecconi, F.,
P. Mariottini, and F. Amaldi.
1995.
The Xenopus intron-encoded U17 snoRNA is produced by exonucleolytic processing of its precursor in oocytes.
Nucleic Acids Res.
23:4670-4676[Abstract/Free Full Text].
|
| 15.
|
Chanfreau, G.,
S. Abou-Elela,
M. Ares, Jr., and C. Guthrie.
1997.
Alternative 3' end processing of U5 snRNA by RNase III.
Genes Dev.
11:2741-2751[Abstract/Free Full Text].
|
| 16.
|
Chanfreau, G.,
G. Rotondo,
P. Legrain, and A. Jacquier.
1998.
Processing of a dicistronic small nucleolar RNA precursor by the RNA endonuclease Rnt1.
EMBO J.
17:3726-3737[Medline].
|
| 16a.
|
Chanfreau, G.,
P. Legrain, and A. Jacquier.
1998.
Yeast RNase III as a key processing enzyme in nucleolar RNA metabolism.
J. Mol. Biol.
284:975-988[Medline].
|
| 17.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 18.
|
Court, D.
1993.
RNase III: a double strand processing enzyme, p. 70-116.
In
G. Brawerman, and J. Belasco (ed.), Control of messenger RNA stability. Academic Press, New York, N.Y.
|
| 19.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA snoRNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 20.
|
Ganot, P.,
M. L. Bortolin, and T. Kiss.
1997.
Site-specific pseudouridine formation in eukaryotic pre-rRNAs is guided by small nucleolar RNAs.
Cell
89:799-809[Medline].
|
| 21.
|
Graham, I. R., and A. Chambers.
1994.
Use of a selection technique to identify the diversity of binding sites for the yeast RAP1 transcription factor.
Nucleic Acids Res.
22:124-130[Abstract/Free Full Text].
|
| 22.
|
Herruer, M. H.,
W. H. Mager,
L. P. Woudt,
R. T. M. Nieuwint,
G. M. Waseenaar,
P. Groeneveld, and R. J. Planta.
1987.
Transcriptional control of yeast ribosomal protein synthesis during carbon-source upshift.
Nucleic Acids Res.
15:10133-10144[Abstract/Free Full Text].
|
| 23.
|
Huang, G. M.,
A. Jarmolowski,
J. C. R. Struck, and M. J. Fournier.
1992.
Accumulation of U14 small nuclear RNA in Saccharomyces cerevisiae requires box C, box D, and a 5', 3' terminal stem.
Mol. Cell. Biol.
12:4456-4463[Abstract/Free Full Text].
|
| 24.
|
Hurt, E. C.,
A. McDowall, and T. Schimmang.
1988.
Nucleolar and nuclear envelope proteins of the yeast Saccharomyces cerevisiae.
Eur. J. Cell Biol.
46:554-563[Medline].
|
| 25.
|
Johnson, A. W.
1997.
Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.
Mol. Cell. Biol.
17:6122-6130[Abstract].
|
| 26.
|
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424[Abstract/Free Full Text].
|
| 27.
|
Kiss-Laszlo, Z.,
Y. Henry,
J. P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 28.
|
Klein, C., and K. Struhl.
1994.
Protein kinase A mediates growth-regulated expression of yeast ribosomal protein genes by modulating RAP1 transcriptional activity.
Mol. Cell. Biol.
14:1920-1928[Abstract/Free Full Text].
|
| 29.
|
Larkin, J. C.,
J. R. Thompson, and J. L. Woolford, Jr.
1987.
Structure and expression of the Saccharomyces cerevisiae CRY1 gene: a highly conserved ribosomal protein gene.
Mol. Cell. Biol.
7:1764-1775[Abstract/Free Full Text].
|
| 30.
|
Leader, D. J.,
G. P. Clark,
J. Watters,
A. F. Beven,
P. J. Shaw, and J. W. S. Brown.
1997.
Clusters of multiple different small nucleolar RNA genes in plants are expressed as and processed from polycistronic pre-snoRNAs.
EMBO J.
16:5742-5751[Medline].
|
| 31.
|
Leader, D. J.,
J. F. Sanders,
R. Waugh,
P. Shaw, and J. W. Brown.
1994.
Molecular characterization of plant U14 small nucleolar RNA genes: closely linked genes are transcribed as a polycistronic U14 transcript.
Nucleic Acids Res.
22:5196-5203[Abstract/Free Full Text].
|
| 32.
|
Leverette, R. D.,
M. T. Andrews, and E. S. Maxwell.
1992.
Mouse U14 snRNA is a processed intron of the cognate hsc70 heat-shock pre-messenger RNA.
Cell
71:1215-1221[Medline].
|
| 33.
| Lowe, T. M., and S. R. Eddy. 1998. GenBank accession no. AF064263, AF064265, AF064266, AF064268, AF064269,
AF064271, AF064274 to AF064277, and AF064279 to AF064283.
|
| 33a.
|
Lührmann, R.,
B. Appel,
P. Bringmann,
J. Rinke,
R. Reuter,
S. Rothe, and R. Bald.
1982.
Isolation and characterization of rabbit anti-m32,2,7 antibodies.
Nucleic Acids Res.
10:7103-7113 |