Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 1999, p. 1159-1170, Vol. 19, No. 2
Department of Molecular and Cellular Biology,
Harvard University, Cambridge, Massachusetts
021381;
Hubert H. Humphrey Center
for Experimental Medicine and Cancer Research, Hebrew
University-Hadassah Medical School, Jerusalem 91120, Israel2; and
Imperial Cancer
Research Fund, London WC2A 3PX, United Kingdom3
Received 24 August 1998/Returned for modification 1 October
1998/Accepted 29 October 1998
The genes of the trithorax group (trxG) in
Drosophila melanogaster are required to maintain the
pattern of homeotic gene expression that is established early in
embryogenesis by the transient expression of the segmentation
genes. The precise role of each of the diverse trxG members and the
functional relationships among them are not well understood. Here, we
report on the isolation of the trxG gene moira
(mor) and its molecular characterization. mor
encodes a fruit fly homolog of the human and yeast chromatin-remodeling factors BAF170, BAF155, and SWI3. mor is widely expressed
throughout development, and its 170-kDa protein product is present in
many embryonic tissues. In vitro, MOR can bind to itself and it
interacts with Brahma (BRM), an SWI2-SNF2 homolog, with which it is
associated in embryonic nuclear extracts. The leucine zipper motif of
MOR is likely to participate in self-oligomerization; the equally conserved SANT domain, for which no function is known, may be required
for optimal binding to BRM. MOR thus joins BRM and Snf5-related 1 (SNR1), two known Drosophila SWI-SNF subunits that act as
positive regulators of the homeotic genes. These observations provide a molecular explanation for the phenotypic and genetic relationships among several of the trxG genes by suggesting that they encode evolutionarily conserved components of a chromatin-remodeling complex.
Two classes of genes maintain
regulatory decisions made during early Drosophila
development by the localized expression of segmentation gene products.
These are the Polycomb group (PcG) and the
trithorax group (trxG) genes, which sustain, respectively, the repressed or active state of homeotic gene expression (30, 42). The trxG proteins are thought to act at many different levels of gene regulation to maintain continued and efficient expression of homeotic and other genes. While genetic tests indicate that members of this group are functionally related (see, for example,
references 41 and 49), with the
exception of Brahma and Snf5-related 1 (SNR1) (14), there
has been no evidence that these proteins are components of the same
multimeric complexes. Thus, the exact functional relationships among
most members of this gene class are not yet understood.
Brahma (BRM) is a trxG protein product that is believed to increase
target gene accessibility by overcoming the repressive effects of
nucleosomal histones (9, 45). BRM is highly related to the
Saccharomyces cerevisiae protein SNF2 (SWI2)
(44), which is part of an 11-subunit, 2-MDa global
regulatory complex that assists a large number of DNA-binding proteins
to activate transcription of their target genes by facilitating their
binding to nucleosomal sites (31, 50). Another potential
fruit fly homolog of a yeast SWI-SNF component that may be involved in
the regulation of homeotic gene expression is SNR1, which coisolates
with BRM in a large protein complex (14). Although it was
not, like most of the trxG genes, isolated in screens that were based
on suppression of mutations in Polycomb, Snr1
does undergo genetic interactions with classic trxG genes
(14).
To unravel the functional relationships among the different trxG
members and to understand how the gene products exert regulatory control over other genes, it is necessary to obtain molecular information about those members that have not yet been cloned. One such
gene is moira (mor), which was isolated in three
independent screens for loci that undergo dosage-dependent interactions
with Polycomb or ectopically expressed
Antennapedia (29) and which exhibits many of the
genetic and phenotypic characteristics of brm (6, 15,
16, 29, 44).
Here we demonstrate that mor encodes a Drosophila
homolog of the S. cerevisiae SWI-SNF gene SWI3.
The MOR protein sequence closely resembles those of the human
SWI3-related proteins, BAF170 and BAF155 (53, 54). In
accordance with its known function as a regulator of homeotic gene
activity, mor is widely expressed during development and in
many embryonic tissues in a spatiotemporal pattern that overlaps that
of brm and Snr1. MOR is capable of forming
homooligomers; optimal binding of MOR to itself is likely to require
its leucine zipper motif. MOR can also bind to BRM, with which it is
associated in embryonic nuclear extracts; this interaction may be
mediated by the SANT domain of MOR, which is common to several proteins
involved in basal or activated transcription and whose function is not
known (1, 54).
Identification of MOR as an additional component of the
Drosophila SWI-SNF complex provides a physical and
biochemical explanation for the known functional relationship
between two strong and well-characterized trxG proteins, MOR and BRM.
This finding provides a conceptual framework in which to continue to
analyze the role of SWI-SNF proteins in regulation of the homeotic and
other developmentally regulated genes in eukaryotic organisms.
Fruit fly culture and stocks.
Drosophila melanogaster
was cultured at room temperature on standard cornmeal-yeast
extract-dextrose medium or at 18°C on Instant Medium (Carolina
Biological). Except for those generated in the course of this work, the
mutations and transposons used are described in the online database
FlyBase (20). mor region stocks and deficiencies
were obtained from J. Kennison. All mor alleles were
rebalanced over a TM3-ftz-lacZ balancer.
Isolation of new alleles of mor.
The original
P{lacW} insertion mutagenesis was carried out with an
attached-X ammunition chromosome that carries four copies of
P{lacW} on each arm: C(1)RM, y1?
P{lacW}5-45fD w1?
P{lacW}4-5fP P{lacW}3-52d
P{lacW}3-76a (24). Females carrying the
attached-X ammunition chromosome and P{ Cloning of the mor region and molecular analysis of
new excision alleles of mor.
The P{lacW}
element allows cloning of adjacent genomic sequences by plasmid rescue
(56). One isolate, pCK5.128A, obtained by EcoRI
digestion of flies bearing P{lacW}89B, was labeled
(random priming kit; Bethesda Research Laboratories) and used to screen a Sau3A partial genomic library of Canton-S DNA generated by
using a Lambda-FIX kit (Stratagene) and high-molecular-weight genomic DNA (prepared as described in reference 34). Three
independent genomic
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The trithorax Group Gene
moira Encodes a Brahma-Associated Putative
Chromatin-Remodeling Factor in Drosophila
melanogaster
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
2-3}99B were
crossed with w; Sbsbd-2
Ubxbxd-1 males. F1 males with the
mini-white eye color were crossed with w;
Sbsbd-2 Ubxbxd-1 females.
Whenever possible, homozygous insertion lines were established. F2 or F3 males were examined for changes in
abdominal pigmentation or sternite bristle patterns. The insertion
later designated P{lacW}89B mapped very close to
Sb on the basis of segregation with the original Sbsbd-2 mutation. Mobilization of this element
was accomplished by generating dysgenic males, crossing with
w
females, and recovering
w
Sb+ animals. Of 47 w
chromosomes recovered, 2 were lethal over
Df(3R)sbd105.
clones were recognized and characterized by
restriction mapping and Southern analysis. Smaller genomic fragments
were subcloned into pBluescript II SK (Stratagene).
probe CK128
(Fig.
1A). When the original blot was reprobed with pP{CaSpeR} and pBluescript, there was no evidence that any portion of the P{lacW} element remained in either
mor9 or mor10.

View larger version (23K):
[in a new window]
FIG. 1.
Map of the genomic region around the
P{lacW}89B insertion site. The map shows the phage
isolated from a Sau3A partial genomic library (A), the
extent of the deletions in the new mor excision alleles (B),
the probes employed in Northern analyses and for isolation of the
mor cDNA (C), the map of the two mor candidate
transcripts in the vicinity of the P{lacW}89B insertion
site (D), and the genomic fragment used for rescue of the
mor phenotype (E). In panel D, the introns indicated for
89B-Helicase are (from the 5' to the 3' end) about 2,800, 60, and 100 bp in length. The introns indicated for mor
(Swi3D-1) are (from the 5' to the 3' end) 50, 63, 62, and 64 bp in length, and they are at nucleotides 1111, 1441, 2216, and 3449, respectively. The direction of transcription was determined by sequence
analysis for 89B-Helicase and by the use of single-stranded
probes for mor (Swi3D-1). Since the
srp gene is located 10 kb to the right of
89B-Helicase and preliminary data indicate that the
deficiency Df(3R)lpo4 breaks 3 to 4 kb 3' of the
mor transcript, centromere proximal is to the left.
Isolation of cDNAs and computer analyses.
To obtain the cDNA
corresponding to the 4.5-kb transcript, an early embryonic cDNA library
(8) was screened. One positive clone was recovered, and the
cDNA insert was subcloned into pBluescript II SK. DNA, prepared by
using a Wizard Miniprep kit (Promega), was sequenced at the sequencing
facility of the Life Sciences Institute, Hebrew University, Jerusalem,
Israel. Synthetic primers were made to allow complete sequencing of
both strands. To obtain additional cDNA clones, we screened a
random-primed embryonic cDNA library (27) with 5' sequences
of the one positive clone and also carried out PCR amplification (with
PWO [Boehringer]) on the same library with an oligonucleotide based
on the sequence of the noncoding strand of Swi3D-2
(5' TTCAAAGCCCTGCAGCGTC 3') and the
gt11 reverse
primer. Sequences were analyzed by using the National Center for
Supercomputer Applications electronic mail server and the Fasta
(37), Blast (2), Gap (35), and Pileup
(17) programs.
RNA preparation, Northern blotting, and determination of the direction of transcription. Developmental Northern blotting of total nucleic acids was performed by grinding frozen samples in a 7 M urea buffer, subjecting them to phenol-chloroform extractions and ethanol precipitation, and then applying approximately 12 µg of nucleic acid from each time point to a formaldehyde-morpholinepropanesulfonic acid (MOPS) denaturing gel (12).
To determine the direction of transcription of the 4.5-kb transcript, single-stranded RNA probes were generated from subclones of the 1.3-kb EcoRI fragment to the left of the P{lacW}89B insertion, placed in both orientations into pBluescript II SK. These constructs were used to probe the total nucleic acid blots.Southern blotting of DNA derived from fruit flies mutant in mor, and single-embryo PCR. Genomic DNA was isolated by homogenizing 200 flies in 1.6 ml of homogenization buffer (30 mM Tris-Cl [pH 9.0], 10 mM EDTA, 100 mM NaCl, 70 g of sucrose/liter) and 0.4 ml of lysis buffer (0.5 M Tris-Cl [pH 9.0], 0.25 M EDTA, 2.5% sodium dodecyl sulfate [SDS]), incubating at 65°C for 30 min, and, after the addition of 300 µl of 8 M potassium acetate, incubating for an additional hour at 0°C. Following centrifugation, 10 µg of ethanol-precipitated DNA was used per lane. Southern blots were prehybridized at 65°C in 6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) containing 1% N-lauroylsarcosine (Sigma) and 0.5 mg of herring sperm DNA (Sigma)/ml and, following addition of the probe, hybridized overnight. The washes reached a stringency of 0.1× SSC-0.5% N-lauroylsarcosine. The Swi3D probe, encompassing 3.6 kb of Swi3D cDNA (excluding the 5'-most 180 bp of Swi3D-1), was labeled by using a random primer labeling kit (Biological Industries, Beit HaEmek, Israel).
For PCR analysis of homozygous embryos, 3- to 12-h embryos laid by flies carrying mor alleles over a TM3-ftz-lacZ balancer were stained with 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
(21). DNA was amplified by using a RedHot Taq
polymerase (Advanced Biotechnologies), and the amplified band was
isolated for sequencing by using a QIAquick gel extraction kit (Qiagen).
P element transformation and rescue of the mor phenotype. A genomic SalI fragment approximately 11.8 kb in length (Fig. 1E) was cloned into the XhoI site of the pP{CaSpeR-4} transformation vector (20). This fragment includes approximately 3 kb of flanking sequence at both the 5' and 3' ends of the 4.5-kb transcript, as well as the 5' portion of Hel89B. Isolates with the fragment inserted in both orientations were recovered and designated pP{11.8A} and pP{11.8B}. The 4.5-kb mRNA is transcribed in the opposite direction relative to the CaSpeR mini-white gene in the pP{11.8A} construct.
y1 w1118 embryos were coinjected with pP{11.8} and p
25.7wc in accordance with standard
techniques (5, 43). Emerging adults were crossed
individually to y1 w1118 flies,
and transformants were identified. Two independent lines were recovered
and crossed with a multiple-balancer stock; chromosomal linkage was
determined, and stocks were established. Both of the transformed lines
are homozygous viable and carry the P{11.8A} version of
the construct. After rescue was demonstrated, the
P{11.8A} transposon was renamed
P{mor+11.8}. The full genotype of this
construct is P{w+mC
Hel89B5' mor+t11.8 = mor+11.8}.
Antibody preparation, affinity purification, and Western blot analyses. Antibodies were generated against MOR by inserting a 0.9-kb BamHI-EcoRI fragment into the pGEX1 expression vector (Pharmacia LKB Biotechnology Inc.), harvesting the immunogen as described previously (22), and inoculating rabbits with the immunogen in combination with Freund's adjuvant (Sigma). The antibody was affinity purified after being allowed to bind to immunoblots containing the MOR fusion protein as described in reference 25.
For Western analysis, tissues were homogenized in a solution containing 50 mM Tris-Cl (pH 7.4), 25% glycerol, 6%
-mercaptoethanol, 4%
SDS, 1 mM EDTA, protease inhibitors (1 µg of leupeptin/ml, 3 µg of
aprotinin/ml, 0.06 µg of antipain/ml, 1 mM phenylmethylsulfonyl fluoride, and a 1:100 dilution of protease inhibitor cocktail P2714
[all from Sigma]). The homogenates were boiled for 5 min, and the
proteins in the supernatant were separated by SDS-polyacrylamide gel
electrophoresis (PAGE) on 7.5% gels. The gels were blotted onto a
Hybond-C membrane (Amersham) as described previously (22). The blot was incubated for 3 h with 5.0% nonfat dry milk in 10 mM
Tris-Cl (pH 7.4)-150 mM NaCl (TBS). The preimmune or anti-MOR antiserum was applied at a 1:300 dilution in TBS overnight at 4°C.
Following washes in TBS and TBS-0.05% Triton X-100 and a 1-h
incubation in TBS with 5% normal goat serum (Biological Industries), horseradish peroxidase-conjugated goat anti-rabbit antibodies (Jackson)
were applied for 2 h at room temperature at a 1:1,500 dilution.
After washes were performed as described above, the immunoreactive
bands were detected by enhanced chemiluminescence (ECL; Amersham).
Immunohistochemistry and in situ hybridization. Immunohistochemistry was carried out as described previously (22). In situ hybridizations were carried out by the method of Tautz and Pfeifle (46) with digoxigenin-labeled probes (Boehringer). An approximately 900-bp BamHI-EcoRI fragment extending from nucleotides 319 to 1234 of Swi3D-1 was inserted into pBluescript II KS to allow synthesis of RNA probes by transcription from both the T7 and T3 promoters. Following color development, the embryos were mounted in JB4 medium (Polysciences), viewed under Nomarski optics with a Zeiss Axioskop microscope, and photographed with T-MAX 100 film (Kodak).
Coimmunoprecipitation experiments. For coimmunoprecipitations, preimmune serum or antibodies to either MOR or BRM were coupled to protein A-Sepharose beads (Pharmacia) with dimethylpimelimidate (25). The anti-BRM antibodies were obtained by immunizing rabbits with a peptide corresponding to amino acids 1617 to 1632 of BRM, coupled to keyhole limpet hemocyanin, by the use of standard procedures (25). The antibodies generated in this way recognize only one band of about 190 kDa when used in Western analysis of a crude embryo nuclear extract. Next, 15 µl of a BRM-containing embryonic nuclear fraction (see below) was added to 10 µl of beads and incubated for 2 h at 4°C in a total volume of 90 µl of HEMG (25 mM HEPES-KOH [pH 7.6], 0.1 mM EDTA, 12.5 mM MgCl2, 10% glycerol, 1.5 mM dithiothreitol, 1 mM sodium metabisulfide, 0.2 mM AEBSF, 2 mg of leupeptin/ml, and 0.7 mg of pepstatin/ml) containing 0.4 M KCl and 0.1% Triton X-100. After the incubation, the beads were washed once with a 100-fold excess volume of HEMG-0.4 M KCl-0.1% Nonidet P-40 (NP-40) and five times in HEMG-0.5 M KCl-0.01% NP-40, resuspended in SDS sample buffer, and analyzed by immunoblotting with antibodies directed against either BRM or MOR.
The BRM-containing fraction was obtained by preparing nuclear extracts from 0- to 12-h-old Drosophila embryos as previously described (52). About 400 mg of protein was further purified by heparin-agarose chromatography by standard procedures (4). The eluate of the heparin-agarose column was fractionated on an 800-ml Sephacryl S-300 gel filtration column equilibrated with HEMG-0.1 M KCl-0.01% NP-40 and developed with the same buffer (4). After a 250-ml elution volume, 10-ml fractions were collected. By Western blotting, the bulk of BRM was detected in fractions 2 to 9. Fraction 3 was used for coimmunoprecipitations.In vitro interactions of GST fusion proteins and yeast two-hybrid
analysis.
35S-labeled MOR or MOR derivatives were
synthesized by using a TNT coupled rabbit reticulocyte system
(Promega). To obtain MOR
NcoI and MOR
SANT, respectively, a
1,251-nucleotide NcoI fragment or a 270-nucleotide
XbaI fragment was excised from the full-length mor pBluescript II SK cDNA while maintaining the same
reading frame. To generate MOR
LEU, a 750-bp NcoI fragment
was reinserted into MOR
NcoI. The large glutathione
S-transferase (GST)-MOR fusion protein employed is encoded
by a 2.1-kb EcoRI cDNA fragment placed into the pGEX1
vector. GST-MOR-NH2 is the fusion protein that was used for
rabbit inoculation. To generate the GST-BRM fusion proteins, genomic
fragments of brm containing no introns were PCR amplified
with PWO (Boehringer) from wild-type genomic DNA, using oligonucleotide
primers in which we incorporated synthetic BamHI sites. The
sequences of these oligonucleotides are as follows: for the large BRM
fusion protein, beginning at nucleotide 742 of the brm cDNA
(44), 5' ACCAGGGATCCAGCATGCAGGACAAC 3'; for the
small BRM fusion protein, beginning at nucleotide 1625 of brm, 5'GCAAGGATCCAAGGGAGTTCCACAGAAAT 3'; and for
both BRM fusion proteins, beginning at nucleotide 2263 of the noncoding
strand of brm, 5' GGCCTTGGGAATTCGATCCTTGGCATCCTCAT 3'.
The large amplified fragment was cloned into pGEX3 by partial
digestion with BamHI, and the small fragment was cloned into
pGEX1. Both were sequenced before use. GST fusion proteins were
harvested as described previously (22).
Nucleotide sequence accession number. The GenBank accession number for the sequences of the mor cDNA clones isolated in this study is AF033823.
| |
RESULTS |
|---|
|
|
|---|
Isolation of new alleles of mor. An insertion of the P transposon P{lacW} into the mor region was recovered during a screen for insertion-induced mutations resulting in abdominal phenotypes, such as the loss of male-specific pigmentation or changes in the patterns of sternite bristles. This insertion produces bristles on the sixth sternite of homozygous males; the phenotype is weak and variable. It was subsequently observed that the insertion, when homozygous, enhances the homozygous phenotype of Ubxbxd-1, a mutation of the bithorax complex. Since by recombination mapping it was determined to be immediately to the left of Sb, it appeared likely to be an insertion at or near the mor locus. However, test crosses with known mor alleles (mor5 and mor6) exhibited complementation.
The P{lacW}89B element was mobilized, and the recovered excision chromosomes were tested for viability over Df(3R)sbd105, which uncovers the 89B region. Two chromosomes that are lethal when homozygous and when placed in trans to Df(3R)sbd105 were recovered; both failed to complement the lethality of all mor alleles tested and of each other but were wild type over a serpent allele, srp3. Based on these results, the new excision alleles were designated mor9 and mor10. However, they differ from the other mor alleles in that they fail to complement the phenotype of the P{lacW}89B insertion; males of the genotype P{lacW}89B/mor9 or P{lacW}89B/mor10 display one to four small bristles on the sixth abdominal sternite.Cloning of mor and identification of candidate
transcripts.
Genomic sequences immediately adjacent to the
P{lacW}89B insertion were recovered by plasmid rescue
and used to screen a Canton-S genomic library. Three overlapping
clones, spanning approximately 30 kb, were recovered (Fig. 1A). A
restriction-level map was derived, and P{lacW}89B,
mor9, and mor10 were
placed on the map based on genomic Southern analyses (Fig. 1B). Both
mor9 and mor10 are small
deletions that remove the entire P{lacW} element and an
additional 2 to 3 kb of genomic sequence.
|
The 4.5-kb transcript encodes a Drosophila BAF170/BAF155/SWI3 homolog. A cDNA clone corresponding to the approximately 4.5-kb transcript was obtained from an early embryonic cDNA library, using the 2.3-kb genomic EcoRI fragment (labeled C in Fig. 1C) as a probe. This cDNA, 3.8 kb in length, was sequenced, revealing a single long open reading frame followed by 210 bp of untranslated sequence. The cDNA appears to be incomplete since it lacks a poly(A) sequence at its 3' end and there is no stop codon upstream of the first ATG at the 5' end.
The 3.8-kb cDNA encodes a protein of 1,189 amino acids whose sequence is shown in Fig. 3A. Comparison of the predicted protein with the data bank sequences revealed that it exhibits a high degree of homology to yeast SWI3 and even greater similarity to human and mouse SWI3-related proteins. Thus, we refer to it as SWI3D. The degree of overall identity between SWI3D and the human protein BAF170 (54) is marginally higher than that between SWI3D and human BAF155 (54) (48% identity and 58% similarity versus 47% identity and 56% similarity). The SWI3D protein is as identical to the mouse SWI3 homolog, SRG3 (28), as it is to BAF155. A lower level of overall identity is exhibited to SWI3 itself (37% identity and 47% similarity).
|
Analysis of DNA derived from mor mutants with Swi3D probes. To ascribe mor function to either 89B-Helicase or Swi3D, we carried out Southern analyses of DNA extracted from heterozygous flies carrying mor alleles 1 through 6 over the same balancer chromosome. While no differences in the pattern of restriction fragments recognized by the 89B-Helicase probe were observed (data not shown), the Swi3D probe recognized one additional band in DNA extracted from flies heterozygous for the mor6 allele and digested with either EcoRI (Fig. 4A, left panel), EcoRI plus HincII (Fig. 4A, right panel), or HincII plus XbaI (data not shown). In comparison with those of the other mor alleles, the intensity of the 2.3-kb EcoRI-generated band in mor6 was reduced to the level of the same band in DNA derived from flies heterozygous for Df(3R)mor7, in which the mor locus is completely removed (7). In addition, a new, smaller, cross-hybridizing band appeared. This indicated that the 2.3-kb genomic EcoRI fragment that contains sequences of the Swi3D gene was disrupted in the mor6 allele.
|
Rescue of the mor lethal phenotype with a Swi3D transgene. A large SalI fragment, approximately 11.8 kb, that encompasses all of the genomic region known to correspond to the Swi3D transcript (Fig. 1E) was cloned into the P transformation vector pP{CaSpeR-4}. This fragment extends into the 5' end of the transcribed region of 89B-Helicase but does not include most of the coding sequence of that gene; specifically, the essential ATPase domain (3) is not included. The resulting transformation construct, pP{mor+11.8}, was injected into y1 w1118 embryos. Two transformed lines that carry the P{mor+11.8} transposon on the second chromosome and are homozygous viable were established.
One copy of the P{mor+11.8} transgene was able to rescue all heteroallelic mor1, mor2, mor5, and mor6 combinations tested (Table 1). While in the absence of P{mor+11.8} these combinations behaved as complete lethals, in the presence of the transgene they all yielded fertile progeny of the rescued class with a frequency that did not deviate significantly from that expected assuming complete rescue (
2 test, P > 0.05). Identical results
were obtained when the rescue of mor6 was tested
over the deletion Df(3R)mor7. Given the complete
rescue observed for the heteroallelic combinations, the observations
that homozygous combinations of these alleles were not rescued (in the
cases of mor1 and mor2)
or showed reduced viability and/or fertility
(mor5 and mor6) is almost
certainly due to the accretion of other deleterious mutations on these
chromosomes. Despite this problem, a homozygous stock of
P{mor+11.8}; mor6
flies has been established.
|
2, P < 0.005 and P < 0.025 in two different crosses). Survivors exhibited reduced
fertility and had a smaller wing size. Males exhibited a weak A6
sternite bristle phenotype, similar to that of the original
P{lacW}89B insertion. Rescue of
mor9 over Df(3R)mor7 gave
very similar results (Table 1), while
P{mor+11.8};
mor9/mor9 and
P{mor+11.8};
mor10/mor10 flies
displayed more severe reductions in viability and fertility. Nonetheless, a homozygous P{mor+11.8};
mor9 fly stock has been established. Partial
rescue of the mor9 and
mor10 phenotypes by the
P{mor+11.8} transgene constituted a second
case in which the genetic behavior of these alleles differed from that
of other mor alleles and suggested that their effects are
not restricted to the mor gene (see Discussion).
We conclude that the trxG gene mor encodes SWI3D, a
Drosophila homolog of proteins known to function as part of
the SWI-SNF complex in yeast and mammals. In the descriptions given
below, the SWI3D protein is referred to as the MOR protein. To compare the distribution of MOR with that of BRM, which is also a trxG gene
product, and SNR1, which is present in a complex with BRM, and to
investigate the association of MOR with BRM, we generated antibodies against MOR.
Antibodies against MOR recognize a 170-kDa nuclear protein in embryos. Polyclonal antibodies against a bacterial fusion protein containing amino acids 105 to 411 from the relatively nonconserved amino-terminal domain of MOR upstream of region I were raised in two rabbits. Both of the anti-MOR antisera, but neither of their preimmune controls, recognized a 170-kDa polypeptide when used in Western analysis of proteins extracted from embryos and adult ovaries (data not shown). Because both antisera also recognized additional polypeptides, one of the two anti-MOR antisera was affinity purified against the original immunogen as described in Materials and Methods. When used in Western analysis as described above, the affinity-purified immune serum specifically recognized a prevalent 170-kDa band (Fig. 5, right panel) that was not seen in blots probed with the preimmune serum (Fig. 5, left panel). The endogenous protein is of the same molecular weight as the MOR protein whose synthesis is directed in vitro by Swi3D-1, suggesting that the embryonic mor cDNA clone that we have isolated is complete or nearly so. The molecular mass of 170 kDa was larger than anticipated for MOR, but its human homologs, BAF155 and BAF170, also exhibited slower electrophoretic mobilities than predicted (54). An additional, faint band of about 100-kDa seen in the embryonic and ovarian extracts likely represented a degradation product of the 170-kDa polypeptide because it, as well as the 170-kDa band, was absent from extracts of late-stage homozygous mor6 embryos selected from among their blue (i.e., heterozygous) siblings (data not shown). In these embryos, the predicted truncated protein was also not seen, probably because of its instability when it cannot be incorporated into a multiprotein complex (see below).
|
|
MOR is associated with BRM in embryonic nuclear extracts. The sequence similarity of MOR to SWI3 and BAF170/155 suggests that it may function as part of an SWI-SNF complex that includes an SWI2-SNF2 homolog. To test for the association of MOR with BRM, a coimmunoprecipitation assay was used on a BRM-containing nuclear fraction obtained as described in Materials and Methods. Aliquots of this fraction were immunoprecipitated with preimmune serum or with antiserum directed against MOR or BRM. The immunoprecipitates were washed in the presence of 0.5 M KCl and detergent, resolved by SDS-PAGE, and analyzed by Western blotting with either anti-MOR or anti-BRM antiserum (Fig. 7). BRM was present in the immunoprecipitate formed with the anti-MOR antibodies, but it was not present in the preimmune-serum immunoprecipitate. Conversely, MOR was present in the immunoprecipitate formed with the anti-BRM antibodies, but it was not present in the preimmune-serum immunoprecipitate. These results indicate that the two proteins are physically complexed in embryonic nuclear extracts.
|
MOR is able to oligomerize. To begin to examine the protein-protein interaction capabilities of MOR, we determined whether it is able to self-associate, as might be anticipated from the presence of a candidate leucine zipper domain near its carboxyl terminus. MOR was tested by the GST fusion protein interaction assay for its ability to bind to itself. In the presence of 200 mM (data not shown) or 300 mM (Fig. 8B) NaCl, full-length labeled MOR was efficiently retained on a GST-MOR fusion protein that contained most of region I and all of regions II (the SANT domain) and III (the leucine zipper domain) (16-fold greater retention than to GST alone, as judged by PhosphorImager analysis (Fig. 8A; Fig. 8B, lane 3). In contrast, MOR bound very poorly to GST alone (Fig. 8B, lane 1) or to the GST-MOR-NH2 fusion protein that included 306 amino acids from the amino terminus of MOR (less than twofold greater retention than to GST alone) (Fig. 8A; Fig. B, lane 2). Self-association of MOR was not affected by the presence of ethidium bromide at 200 µg/ml (17-fold greater retention than in lane 1) (Fig. 8B, lane 7), indicating that DNA is not necessary for this interaction.
|
NcoI, which lacks the entire highly
conserved leucine zipper domain and extensive flanking sequence;
MOR
LEU, which is missing 38 of 90 amino acids in the leucine zipper
motif and the proline- and glutamine-rich carboxy-terminal region; and
MOR
SANT, from which half (56 amino acids) of the SANT domain, as
well as 37 somewhat-less-conserved residues N terminal to it, has been
deleted. The MOR derivatives were tested for retention by the
immobilized GST-MOR fusion protein. Removal of half of the SANT domain
in MOR
SANT did not appear to affect the ability of MOR to
homooligomerize (14-fold greater retention than binding of
full-length MOR to GST alone) (Fig. 8B, lane 6). (Note that slightly
less radiolabeled MOR
SANT was loaded onto the GST-MOR fusion protein
[Fig. 8B, lane 11], thus largely accounting for the smaller amount
retained.) However, self-association was severely compromised by
removal of the extended leucine zipper domain in MOR
NcoI (only
fourfold greater retention in lane 4 than in lane 1). Reintroduction of
part of the leucine zipper motif in the MOR
LEU construct appeared to
restore some of the binding activity (sevenfold greater retention)
(lane 5). These data indicate that MOR is capable of forming
homooligomers and that region III, the leucine zipper motif, is likely
to contribute to this interaction.
MOR binds to BRM. MOR was tested for its ability to interact with BRM, with which it is associated in embryonic nuclear extracts. In these experiments, we focused on domain II of BRM because deletion of this region causes a decrease in the size of the BRM complex, presumably due to the loss of one or several subunits (16), and because yeast two-hybrid analysis revealed an interaction between this domain of SWI2-SNF2 and the SWI3 subunit of the yeast complex (47, 48). While domain II of BRM consists of residues 549 to 610, the two GST fusion proteins that were generated for the interaction assay were more extensive and included amino acids 230 to 736 or 524 to 736. At 200 mM NaCl, labeled full-length MOR was retained on the immobilized GST-BRM fusion protein containing residues 230 to 736 approximately as well as it was retained by immobilized GST-MOR (12- and 13-fold-greater retention than of full-length MOR to GST alone) (Fig. 8C, lanes 1 and 3). In contrast, binding of MOR to beads bearing the same amount of a GST-BRM fragment containing only amino acids 524 to 736 was much less efficient (sevenfold greater retention) (lane 6). Thus, MOR is able to interact with BRM and this association can be mediated by 507 amino acids in BRM that include domain II.
To examine the role of different protein domains of MOR in binding to BRM, we tested the ability of the MOR deletion constructs to be retained by the BRM fusion proteins. MOR
NcoI
was efficiently retained by GST-BRM 230-736 (15-fold greater retention
in lane 4 than in lane 2), implying that the association of MOR with
itself or another leucine zipper-containing protein is not necessary for its binding to BRM. This is not the case for MOR
SANT, whose binding to an equivalent amount of the large BRM fusion protein was
significantly reduced relative to the binding of full-length MOR (only
fourfold-greater retention in lane 5 than in the control). While
MOR
NcoI was retained, albeit poorly, by the smaller BRM fusion
protein (sixfold-greater retention in lane 7 than in lane 2), the level
of retention of MOR
SANT fell almost to that of the negative control
(twofold-greater retention than binding of the full-length protein to
beads carrying GST alone) (compare lanes 8 and 2). These results
suggest that the SANT domain of MOR may play a role in the association
of MOR with domain II and adjacent residues of BRM.
| |
DISCUSSION |
|---|
|
|
|---|
The fruit fly BAF170/BAF155/SWI3 homolog is a member of the trxG
proteins.
We have isolated a Drosophila homolog of the
yeast SWI3 gene and the human BAF170 and
BAF155 genes and demonstrated that it is encoded by the
previously known trxG locus mor. Its identification as
mor was achieved by Southern analyses of DNA derived from
flies with mutations in mor, by characterization of a
genomic Swi3D fragment derived from homozygous
mor6 embryos, and by rescue of the
mor phenotype. The origin of mor6 by
-ray mutagenesis (29) is consistent with our observation that it encodes an altered form of mor in which 541 bp have
been deleted and a 233-bp insertion of foreign DNA has occurred,
leading to loss of the leucine zipper motif as well as the
carboxy-terminal proline- and glutamine-rich sequences.
MOR is a component of the Drosophila counterpart of the yeast SWI-SNF complex. We have observed that the Drosophila BAF170/BAF155/SWI3 homolog, encoded by mor, is physically associated with BRM in embryonic nuclear extracts. The presence of an identical protein, named BAP155, in a highly purified 2-MDa BRM complex isolated from Drosophila embryos was very recently reported by Papoulas et al. (36). Significantly, analysis of the eight subunits of the BRM complex revealed that MOR/BAP155 is the only component, other than BRM and the previously identified SNR1 (14), that is encoded by a trxG gene. Two additional trxG proteins, ASH1 and ASH2, were found to be present in distinct high-molecular-mass complexes.
The identification of mor as a gene encoding a component of the Drosophila BRM-containing complex provides a biochemical basis for the close functional relationship between mor and brm, both strong and well-characterized trxG member. Indeed, the phenotypes resulting from mutations in each of these two genes exhibit many similarities. For example, alleles of both mor and brm were repeatedly isolated in genetic screens for dosage-dependent modifiers of dominant mutations in Pc (29); mutations in either gene affect transcription of multiple homeotic genes and the segmentation gene, engrailed; both of them are required for oogenesis; and both may be involved in cell viability of imaginal disc cells but not abdominal histoblasts (6, 7, 16, 44). More recently, mor was the only trxG gene found to interact with a dominant-negative brm transgene (36). Further analysis will be required to clarify the relationships of the trxG genes that are not components of the BRM complex to MOR and BRM.Comparison of mor gene product distribution with those of brm and Snr1. The expression pattern of mor overlaps with those of brm and Snr1 but is more widespread. The presence of mor transcripts in unfertilized eggs, as determined by Northern analysis, suggests that there is a maternal contribution of the mor gene product, as has been reported for brm and Snr1 (6, 14). In addition, mor, like brm and Snr1, is most highly expressed in young embryos up to 8 h of age (14, 15). Unlike those of brm and Snr1, mor transcripts are also present in adult males. Although brm transcripts were not detected in adult males, low levels of BRM protein have been reported (16).
During early embryonic development, mor transcripts and the nucleus-localized MOR protein exhibit a ubiquitous distribution like that of BRM and SNR1 (14, 16). After germ band retraction, they are observed at high levels in the central nervous system (CNS) and in the mid- and hindgut. This contrasts with SNR1, which is almost exclusively found in the ventral nerve cord and brain at the end of embryogenesis (14), and BRM, which is ubiquitously expressed and only somewhat localized to the CNS (16). Expression of mor transcripts and protein in the endodermal primordium is consistent with the midgut abnormalities described in mor mutant embryos (7) and suggests that MOR is functional in this tissue. It will be interesting to determine whether MOR is more stable in the cytoplasm, since in Df(3R)mor7 embryos what we assume to be a small amount of residual maternally derived MOR protein appears to be preferentially retained in the midgut and stomodeum, tissues in which nuclear enrichment of MOR has not been observed.Protein interactions of MOR. The protein-protein interactions that stabilize the SWI-SNF complex are not well understood. Some of the direct associations that have been reported are binding of TFG3/TAF30 and SNF5 (10) and an interaction between SNF11 and SNF2 (47). Because of the presence of a putative leucine zipper motif in MOR, we examined the ability of MOR to self-associate, using a GST fusion protein interaction assay and the yeast two-hybrid system. Our data indicate that MOR is able to oligomerize in vitro and in vivo in the yeast two-hybrid system. In addition to demonstrating an in vivo interaction between two molecules of MOR, our results indicate that a MOR derivative containing most of domain I, all of domains II and III, and most of the proline- and glutamine-rich tail cannot activate transcription when artificially tethered to DNA. This could be due to the absence of some essential MOR sequences or to the inability of the fruit fly protein to nucleate assembly of the entire yeast complex. By comparison, SWI2-SNF2, SNF5, and SNF6 all function as activators when targeted to a promoter as LexA fusions (32, 33).
Neither region I nor the SANT domain has to be complete for self-binding of MOR to occur. Since oligomerization is sensitive to the extent of removal of the leucine zipper domain, our results strongly suggest that the leucine zipper motif of MOR contributes to the ability of this protein to self-associate in vitro, but they do not eliminate the possibility that the carboxy-terminal region is involved. The demonstration that MOR is able to self-associate raises the possibility that it is present in two copies in each complex, similar to BAF170 and BAF155, which are both present in each human complex (53, 54). These results support a dimer-like model for the structure of the SWI-SNF complex, with duplication of some or all subunits. Such a model has been proposed previously because the overall molecular mass of the complex is much greater than the sum of its individual components (54). It is also possible, however, that in vivo, the leucine zipper motif of MOR is involved in an association between MOR and a different leucine zipper-containing protein. In either case, the embryonic-lethal phenotype resulting from deletion of the leucine zipper and carboxy terminus in the polypeptide encoded by the mor6 allele suggests that these domains are functionally required in vivo. Robust assembly into the BRM-containing complex via interactions involving the leucine zipper motif may affect the stability of the MOR protein, since we are unable to visualize the truncated protein whose synthesis is directed by the mor6 allele. This is similar to the reduced stability of SWI3 that was noted in the absence of SWI1 and SWI2 (38) and may also derive from the failure of SWI3 to be incorporated into a complex. We tested whether MOR, which is complexed with BRM in embryonic nuclear extracts, is able to interact with this protein in vitro. The data indicate that such an interaction can occur and that it involves domain II of BRM, as well as adjacent residues on the amino-terminal side of this domain. The motif in MOR which may mediate the interaction with BRM is the SANT domain. The possible role of the SANT domain is suggested by the significant reduction in the binding of MOR to BRM when 56 amino acids of this domain are deleted, but a role for an additional 37 non-SANT domain residues that were also removed cannot be excluded. Unlike the related DNA-binding domain in the MYB family of proteins, the SANT domain in BAF170 was not shown to have detectable DNA-binding activity in gel shift assays (54), and its function is unknown. These findings, for the first time, ascribe a possible role for the SANT domain in protein-protein interactions.| |
ACKNOWLEDGMENTS |
|---|
We thank Daniel Jay, in whose laboratory portions of this work were carried out; James Kennison, who provided moira stocks; Yossi Markson for limitless patience in preparing the figures; Simon Greenberg, who assisted in DNA analysis; and Benny Shilo for reading the manuscript.
M.A.C. was supported by a grant from the National Science Foundation; N.B.Z. was supported by grants from the Israel Cancer Research Fund and the Israel Academy of Science.
M.A.C. and C.M. contributed equally to this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Hubert H. Humphrey Center for Experimental Medicine and Cancer Research, Hebrew University-Hadassah Medical School, P.O. Box 12272, Jerusalem 91120, Israel. Phone: 972-2-6758470. Fax: 972-2-6414583. E-mail: zakn{at}md2.huji.ac.il.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aasland, R., A. F. Stewart, and T. Gibson. 1996. The SANT domain: a putative DNA-binding domain in the SWI-SNF and ADA complexes, the transcriptional co-repressor N-CoR and TFIIIB. Trends Biochem. Sci. 21:87-88[Medline]. |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 3. |
Auble, D. T.,
K. E. Hansen,
C. G. F. Mueller,
W. S. Lane,
J. Thorner, and S. Hahn.
1994.
MOT1, a global repressor of RNA polymerase II transcription, inhibits TBP binding to DNA by an ATP-dependent mechanism.
Genes Dev.
8:1920-1934 |
| 4. |
Austin, R. J., and M. D. Biggin.
1996.
Purification of the Drosophila RNA polymerase II general transcription factors.
Proc. Natl. Acad. Sci. USA
93:5788-5792 |
| 5. |
Blackman, R. K.,
L. Sanicola,
L. A. Raftery,
T. Gillevet, and W. M. Gelbart.
1991.
An extensive 3' cis-regulatory region directs the imaginal disk expression of decapentaplegic, a member of the TGF- family in Drosophila.
Development
111:657-665[Abstract].
|
| 6. | Brizuela, B. J., L. Elfring, J. Billard, J. W. Tamkun, and J. A. Kennison. 1994. Genetic analysis of the brahma gene of Drosophila melanogaster and polytene chromosome subdivisions 72AB. Genetics 137:803-813[Abstract]. |
| 7. | Brizuela, B. J., and J. A. Kennison. 1997. The Drosophila homeotic gene moira regulates expression of engrailed and HOM genes in imaginal tissues. Mech. Dev. 65:209-220[Medline]. |
| 8. | Brown, N., and F. C. Kafatos. 1988. Functional Drosophila cDNA libraries from Drosophila embryos. J. Mol. Biol. 203:425-437[Medline]. |
| 9. | Burns, L. G., and C. L. Peterson. 1997. Protein complexes for remodeling chromatin. Biochim. Biophys. Acta 1350:159-168[Medline]. |
| 10. | Cairns, B. R., N. L. Henry, and R. D. Kornberg. 1996. TFG3/TAF30/ANC1, a component of the yeast SWI/SNF complex that is similar to the leukemogenic proteins ENL and AF-9. Mol. Cell. Biol. 16:3308-3316[Abstract]. |
| 11. |
Chicca, J. J., II,
D. T. Auble, and B. F. Pugh.
1998.
Cloning and biochemical characterization of TAF-170, a human homolog of yeast Mot1.
Mol. Cell. Biol.
18:1701-1710 |
| 12. | Crosby, M. A., and E. M. Meyerowitz. 1986. Drosophila glue gene Sgs-3: sequences required for puffing and transcriptional regulation. Dev. Biol. 118:593-607[Medline]. |
| 13. |
Davis, J. L.,
R. Kunisawa, and J. Thorner.
1992.
A presumptive helicase (MOT1 gene product) affects gene expression and is required for viability in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:1879-1892 |
| 14. | Dingwall, A. K., S. J. Beek, C. M. McCallum, J. W. Tamkun, G. V. Kalpana, S. P. Goff, and M. P. Scott. 1995. The Drosophila SNR1 and BRM proteins are related to yeast SWI/SNF proteins and are components of a large protein complex. Mol. Biol. Cell 6:777-791[Abstract]. |
| 15. |
Elfring, L. K.,
R. Deuring,
C. M. McCallum,
C. L. Peterson, and J. W. Tamkun.
1994.
Identification and characterization of Drosophila relatives of the yeast transcriptional activator SNF2/SWI2.
Mol. Cell. Biol.
14:2225-2234 |
| 16. |
Elfring, L. K.,
C. Daniel,
O. Papoulas,
R. Deuring,
M. Sarte,
S. Moseley,
S. J. Beek,
W. R. Waldrip,
G. Daubresse,
A. DePace,
J. A. Kennison, and J. W. Tamkun.
1998.
Genetic analysis of brahma: the Drosophila homolog of the yeast chromatin remodeling factor SW12/SNF2.
Genetics
148:251-265 |
| 17. | Feng, D. F., and R. F. Doolittle. 1987. Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J. Mol. Evol. 25:351-360[Medline]. |
| 18. | Fields, S., and O. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245-246[Medline]. |
| 19. | Finley, R. L., Jr., and R. Brent. 1995. Interaction trap cloning with yeast, p. 169-203. In D. Hames, and D. Glover (ed.), Gene probes: a practical approach. Oxford University Press, Oxford, United Kingdom. |
| 20. |
FlyBase.
1998.
FlyBase a Drosophila database.
Nucleic Acids Res.
26:85-88 |
| 21. | Garazzo, M., and A. C. Christenson. 1994. Technical note: preparation of DNA from single embryos for PCR. Drosophila Inf. Serv. 75:204-205. |
| 22. |
Goldman-Levi, R.,
C. Miller,
J. Bogoch, and N. B. Zak.
1996.
Expanding the MOT1 subfamily: 89B-Helicase encodes a new Drosophila melanogaster SNF-2 related protein which binds to multiple sites on polytene chromosomes.
Nucleic Acids Res.
24:3121-3128 |
| 23. | Gyuris, J., E. Golemis, H. Chertkov, and R. Brent. 1993. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75:791-803[Medline]. |
| 24. |
Hamilton, B. A.,
M. J. Palazzolo,
J. H. Chang,
K. Vijay Raghavan,
C. A. Mayeda,
M. A. Whitney, and E. M. Meyerowitz.
1991.
Large scale screen for transposon insertions into cloned genes.
Proc. Natl. Acad. Sci. USA
88:2731-2735 |
| 25. | Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 26. | Hartenstein, V. 1993. Atlas of Drosophila development. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 27. |
Hovemann, B. T.
1991.
Construction of a random primed embryonic Drosophila cDNA expression library cloned into phage -gt11.
Drosophila Inf. Serv.
70:250.
|
| 28. |
Jeon, S. H.,
M. G. Kang,
Y. H. Kim,
Y. H. Jin,
C. Lee,
H.-Y. Chung,
H. Kwon,
S. D. Park, and R. H. Seong.
1997.
A new mouse gene, SRG3, related to SWI3 of Saccharomyces cerevisiae, is required for apoptosis induced by glucocorticoids in a thymoma cell line.
J. Exp. Med.
185:1827-1836 |
| 29. |
Kennison, J. A., and J. W. Tamkun.
1988.
Dosage-dependent modifiers of Polycomb and Antennapedia mutations in Drosophila.
Proc. Natl. Acad. Sci. USA
85:8136-8140 |
| 30. | Kennison, J. A. 1995. The Polycomb and trithorax group proteins of Drosophila: trans-regulators of homeotic gene function. Annu. Rev. Genet. 29:289-303[Medline]. |
| 31. |
Kingston, R. E.,
C. A. Bunker, and A. N. Imbalzano.
1996.
Repression and activation by multiprotein complexes that alter chromatin structure.
Genes Dev.
10:905-920 |
| 32. |
Laurent, B. C.,
M. A. Treitel, and M. Carlson.
1991.
Functional interdependence of the yeast SNF2, SNF5 and SNF6 proteins in transcriptional activation.
Proc. Natl. Acad. Sci. USA
88:2687-2691 |
| 33. |
Laurent, B. C.,
I. Treich, and M. Carlson.
1993.
The yeast SNF2/SWI2 protein has DNA-stimulated ATPase activity required for transcriptional activation.
Genes Dev.
7:583-591 |
| 34. | Meyerowitz, E. M., and C. H. Martin. 1984. Adjacent chromosomal regions can evolve at very different rates: evolution of the Drosophila 68C glue gene cluster. J. Mol. Evol. 20:251-264[Medline]. |
| 35. | Needleman, S. B., and C. D. Wunsch. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48:443-453[Medline]. |
| 36. | Papoulas, O., S. J. Beek, S. L. Moseley, C. M. McCallum, M. Sarte, A. Shearn, and J. W. Tamkun. 1998. The Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits of distinct protein complexes. Development 125:3955-3966[Abstract]. |
| 37. |
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448 |
| 38. | Peterson, C. L., and I. Herskowitz. 1992. Characterization of the yeast SWI1, SWI2, and SWI3 genes, which encode a global activator of transcription. Cell 68:573-583[Medline]. |
| 39. |
Poon, D.,
A. M. Campbell,
Y. Bai, and P. A. Weil.
1994.
Yeast Taf170 is encoded by MOT1 and exists in a TATA box-binding protein (TBP)-TBP-associated factor complex distinct from transcription factor IID.
J. Biol. Chem.
269:23135-23140 |
| 40. | Ruden, D. M., J. Ma, Y. Li, K. Wood, and M. Ptashne. 1991. Generating yeast transcriptional activators containing no yeast protein sequences. Nature 350:250-252[Medline]. |
| 41. |
Shearn, A.
1989.
The ash-1, ash-2 and trithorax genes of Drosophila melanogaster are functionally related.
Genetics
121:517-525 |
| 42. | Simon, J. 1995. Locking in stable states of gene expression: transcriptional control during Drosophila development. Curr. Opin. Cell Biol. 7:376-385[Medline]. |
| 43. |
Spradling, A., and G. M. Rubin.
1982.
Transposition of cloned P element into Drosophila germ line chromosomes.
Science
218:341-347 |
| 44. |
Tamkun, J. W.,
R. Deuring,
M. P. Scott,
M. Kissinger,
A. M. Pattatucci,
T. C. Kaufman, and J. A. Kennison.
1992.
Brahma a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SWI2.
Cell
68:561-572[Medline].
|
| 45. | Tamkun, J. W. 1995. The role of Brahma and related proteins in transcription and development. Curr. Opin. Genet. Dev. 5:473-477[Medline]. |
| 46. | Tautz, D., and C. Pfeifle. 1989. A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98:81-85[Medline]. |
| 47. | Treich, I., B. R. Cairns, T. De Los Santos, E. Brewster, and M. Carlson. 1995. SNF11, a new component of the yeast SNF-SWI complex that interacts with a conserved region of SNF2. Mol. Cell. Biol. 15:4240-4248[Abstract]. |
| 48. | Treich, I., and M. Carlson. 1997. Interaction of a Swi3 homolog with Sth1 provides evidence for a Swi/Snf-related complex with an essential function in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:1768-1775[Abstract]. |
| 49. | Tripoulas, N. A., E. Hersperger, D. La Jeunesse, and A. Shearn. 1994. Molecular genetic analysis of the Drosophila melanogaster gene absent, small or homeotic discs1 (ash1). Genetics 137:1027-1038[Abstract]. |
| 50. | Tsukiyama, T., and C. Wu. 1997. Chromatin remodeling and transcription. Curr. Opin. Genet. Dev. 7:182-191[Medline]. |
| 51. |
van der Knaap, J. A.,
J. W. Borst,
P. C. van der Vliet,
R. Gentz, and H. T. M. Timmers.
1997.
Cloning of the cDNA for the TATA-binding protein-associated factor II170 subunit of transcription factor B-TFIID reveals homology to global transcription regulators in yeast and Drosophila.
Proc. Natl. Acad. Sci. USA
94:11827-11832 |
| 52. |
Wampler, S. L.,
C. M. Tyree, and J. T. Kadonaga.
1990.
Fractionation of the general RNA polymerase II transcription factors from Drosophila embryos.
J. Biol. Chem.
265:21223-21231 |
| 53. | Wang, W., J. Cote, Y. Xue, S. Zhou, P. A. Khavari, S. R. Biggar, C. Muchardt, G. V. Kalpana, S. P. Goff, M. Yaniv, J. L. Workman, and G. R. Crabtree. 1996. Purification and biochemical heterogeneity of the mammalian SW1-SNF complex. EMBO J. 15:5370-5382[Medline]. |
| 54. |
Wang, W.,
Y. Xue,
S. Zhou,
A. Kuo,
B. R. Cairns, and G. R. Crabtree.
1996.
Diversity and specialization of mammalian SWI/SNF complexes.
Genes Dev.
10:2117-2130 |
| 55. | Watson, K. L., M. A. Crosby, and N. B. Zak. Unpublished data. |
| 56. |
Wilson, C.,
R. K. Pearson,
H. J. Bellen,
C. J. O'Kane,
U. Grossniklaus, and W. J. Gehring.
1989.
P-element-mediated enhancer detection: an efficient method for isolating and characterizing developmentally regulated genes in Drosophila.
Genes Dev.
3:1301-1313 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»