Previous Article | Next Article 
Molecular and Cellular Biology, February 1999, p. 1438-1449, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
p73 Function Is Inhibited by Tumor-Derived p53
Mutants in Mammalian Cells
Charles J.
Di Como,
Christian
Gaiddon, and
Carol
Prives*
Department of Biological Sciences, Columbia
University, New York, New York 10027
Received 15 July 1998/Returned for modification 1 September
1998/Accepted 11 November 1998
 |
ABSTRACT |
The p53 tumor suppressor protein, found mutated in over 50% of all
human tumors, is a sequence-specific transcriptional activator. Recent
studies have identified a p53 relative, termed p73. We were interested
in determining the relative abilities of wild-type and mutant forms of
p53 and p73
and -
isoforms to transactivate various
p53-responsive promoters. We show that both p73
and p73
activate
the transcription of reporters containing a number of p53-responsive
promoters in the p53-null cell line H1299. However, a number of
significant differences were observed between p53 and p73 and even
between p73
and p73
. Additionally, a Saccharomyces cerevisiae-based reporter assay revealed a broad array of
transcriptional transactivation abilities by both p73 isoforms at
37°C. Recent data have shown that p73 can associate with p53 by the
yeast two-hybrid assay. When we examined complex formation in
transfected mammalian cells, we found that p73
coprecipitates with
mutant but not wild-type p53. Since many tumor-derived p53 mutants are
capable of inhibiting transactivation by wild-type p53, we tested the
effects of two representative hot-spot mutants (R175H and R248W) on
p73. By cotransfecting p73
along with either p53 mutant and a
p53-responsive reporter, we found that both R175H and R248W reduces the
transcriptional activity of p73
. This decrease in transcriptional
activity is correlated with the reduced ability of p73
to promote
apoptosis in the presence of tumor-derived p53 mutants. Our data
suggest the possibility that in some tumor cells, an outcome of the
expression of mutant p53 protein may be to interfere with the
endogenous p73 protein.
 |
INTRODUCTION |
A new gene family whose encoded
products show significant sequence similarity to the tumor suppressor
protein p53 have been identified (32, 33, 50, 59, 60, 72).
KET, the first to be identified, was cloned from a rat
circumvallate taste papilla cDNA library (59).
p73, the second identified from a COS cell cDNA library,
encodes for at least two splicing variants, p73
and p73
(32,
33). Finally, the human homolog of KET, referred to as either
p51 or p63, encodes at least six isoforms
(p63
/p51B/p73L, p63
, p63
/p51A,
Np63
,
Np63
, and
Np63
) that are expressed in a tissue-specific manner and harbor
different transactivation potentials (50, 60, 72). It has
been proposed that this family of proteins is ancestral to human p53,
in that all show significant amino acid similarity in their C-terminal
p53-unrelated extensions to the squid p53 protein (33, 59,
72).
The p53 protein is modular and can be divided into at least four
distinct domains: (i) the amino-terminal transcriptional transactivation domain (residues ~1 to 70) (6, 7, 15, 55,
68), (ii) the PXXP domain (residues ~61 to 94) (70), (iii) the sequence-specific DNA binding domain (residues ~102 to 292)
(1, 27, 51, 71), and (iv) the carboxy-terminal regulatory
and tetramerization domains (residues ~320 to 393 and ~320 to 360, respectively) (3, 4, 57, 71). The various isoforms of p73
and p51/p63 display a modular structure similar to that of p53, having
extensive homology to p53 within their DNA binding domains (63 and
60%, respectively), as well as possessing homologous amino-terminal
transcriptional transactivation domains (29 and 22% [except
Np63
isoforms], respectively) and tetramerization domains (38 and 37%, respectively).
Given this degree of amino acid similarity between p53, p51/p63, and
p73, it is not surprising that ectopic expression of p73 and p51/p63
can transactivate endogenous targets of p53, such as the cell cycle
inhibitor gene p21 (32, 33, 50) as well as p21
and RGC (ribosomal gene cluster) promoter-containing reporters in
p53-null cell lines (32, 50, 72). However, it is of interest to ascertain whether the various isoforms of p73 and p51/p63 are also
capable of transactivating additional physiologically relevant p53
targets, such as the proapoptotic genes Bax (49)
and IGF-BP3 (insulin-like growth factor binding protein 3)
(5), and others (reviewed in references
22 and 37). The percent homology
between the tetramerization domains of p53, p51/p63, and p73 suggests that these protein families may form heterotetramers. Indeed, Kaghad et
al. have shown that p73
, but not p73
, can interact modestly with
p53 in a yeast-two hybrid assay (33). It remains to be
determined if these complexes can form in mammalian cells and whether
they function during the developmental and/or pathological process.
One of the cellular functions of p53 is to induce apoptosis in response
to genotoxic stress, such as damaged DNA (reviewed in references
22, 37, and 41). Similarly, it
has been found that overexpression of both p73 and p51/p63 can inhibit
cell growth by inducing apoptosis (32, 50, 72). However,
despite these similarities to p53, p73 is not induced by exposure of
cells to DNA-damaging agents such as UV irradiation (33),
suggesting that p73 may have cellular functions distinct from those of
p53. Supporting this notion is the fact that in contrast to the
ubiquitous expression of p53, p51/p63 and KET have restricted tissue
expression patterns (50, 59, 72). Nevertheless, mutations in
p51 have been identified in some human epidermal tumors,
whereas p73 is monoallelically expressed in cancers,
including neuroblastoma, suggesting a potential tumor suppressor role
for both p51 and p73 (33, 50).
In this study, we examined the ability of ectopically expressed p73
and p73
to transactivate p53-responsive reporters in the p53-null
cell line H1299 as well as in a yeast-based reporter assay.
Additionally, we determined if p73 can associate with wild-type and
tumor-derived mutant p53 in mammalian cells. Based on these coimmunoprecipitation studies, we analyzed the effects of tumor-derived p53 mutants on p73 function in transient cotransfection assays. Finally, we discuss the role that tumor-derived p53 mutants may play in
cellular transformation by their ability to selectively inactive other
p53 family members.
 |
MATERIALS AND METHODS |
Yeast strains, media, and transformation.
All yeast strains
were isogenic with S288C except that they were wild type at
GAL2. Prior to the introduction of the wild-type or mutant
p53, p73
, and p73
constructs, CUY5 (trp1-1 ura3-52 his3,200
leu2-3-112 lys2-801) was transformed with one of the HIS3 reporter plasmids (see below) or control plasmid. Rich
(YP) and synthetic complete (SC) media were constituted as described elsewhere (58) except that the YP medium also contained
0.1 g of tryptophan per liter and 0.1 g of adenine per liter
and the SC medium contained 0.2 g of leucine, 0.1 g of all
other amino acids, 0.1 g of uracil, and 0.1 g of adenine per
liter. All strains were grown in glucose to a final concentration of
2%. Yeast strains were transformed by a modified version of the
lithium acetate method (24) as described elsewhere
(12).
Yeast and mammalian expression plasmids.
pLS76 (pCUB7) and
pFW601 (pCUB6) express full-length p53 and
p53R273H cDNAs from the ADH1 (alcohol
dehydrogenase) promoter with the CYC1 terminator downstream
of the p53 cDNA, CEN6, and ARSH4 for
stable, low-copy-number replication and the LEU2 gene for
plasmid maintenance (29). The plasmid expressing full-length mutant p53R273H was isolated by FASAY (29) and sequenced to confirm that the p53 cDNA contained the missense mutation.
pCUB274 expresses full-length hemagglutin epitope (HA) tagged
p53 (HA:p53) cDNA from the ADH1
promoter, with the CYC1 terminator downstream of the
p53 cDNA, the yeast 2 µm origin of replication, and the LEU2 gene for plasmid maintenance. pC53-SN3, pC53-175, and
pC53-248 express full-length p53, p53R175H, and
p53R248W cDNAs, respectively, from the cytomegalovirus (CMV)
promoter (35). pCUB263 expresses full-length
HA:p53 cDNA from the CMV promoter in pCDNA3. pCUB215, pCUB217, pCUB219, and pCUB221 express full-length HA:p73
,
HA:p73
R292H, HA:p73
, and
HA:p73
R292H cDNAs, respectively, from the ADH1
promoter, with the CYC1 terminator downstream of the
p53 cDNA, the yeast 2 µm origin of replication, and the
LEU2 gene for plasmid maintenance. Expression of simian
HA:p73
, HA:p73
R292H, HA:p73
,
and HA:p73
R292H cDNAs from the CMV promoter are as
described elsewhere (32).
Yeast and mammalian reporter plasmids.
Yeast p53-responsive
reporter plasmids are as described elsewhere (12). Briefly,
a duplex oligonucleotide encoding one of the p53-responsive
cis-acting elements was cloned upstream of the inactive
GAL1 promoter which drives the HIS3 coding
sequence on a TRP1/CEN plasmid. The RGC-containing
p53-responsive reporter plasmid pSS1 (29) and the mammalian
p53-responsive reporter plasmids (19) are as described
elsewhere. p21min-luc (pCUB230) contains a duplex oligonucleotide
encoding the p53-responsive cis-acting element from
p21, cloned upstream of the minimal c-fos promoter (
53 to +42) in pGL3-OFLUC (kindly provided by N. Clarke). The sequences of the synthesized oligonucleotides (CUO3 and CUO4; Operon Technologies, Inc.) encoding the p21 cis-acting
p53-responsive element were
5'GATCCTCGAGGAACATGTCCCAACATGTTGCTCGAG3' and
5'GATCCTCGAGCAACATGTTGGGACATGTTCCTCGAG3'. The resulting
plasmid was sequenced for the orientation and insert number of the oligoduplex.
Preparation of yeast whole-cell extracts and detection of p53,
p73
, and p73
by immunoprecipitation and Western immunoblot
analysis.
Procedures for preparation of yeast whole-cell extracts
and Western immunoblotting were as described elsewhere (12).
Immunoprecipitations of p53 proteins were performed by incubating 5 mg
of whole-cell extract with 4 µl of anti-p53 monoclonal antibodies
(MAbs; at 50 ng/µl) and rocking at 4°C for 1 h. After the
primary incubation, 30 µl of protein A-Sepharose beads (Pharmacia)
was added, and the samples were rocked at 4°C for 1 h. The
samples were washed four times with 1 ml of lysis buffer (100 mM
Tris-HCl [pH 7.5], 200 mM NaCl, 1 mM EDTA, 5% glycerol, 0.5 mM
dithiothreitol [DTT], 1 mM phenylmethylsulfonyl fluoride), excess
liquid was aspirated with a 1-ml syringe, and 30 µl of 2× sample
buffer (62) was added. Samples were heated to 95°C for 5 min, centrifuged for 3 min at 13,000 × g and
electrophoresed through a sodium dodecyl sulfate (SDS)-10%
polyacrylamide gel. Protein gels were transferred to polyvinylidene
fluoride membranes (Millipore). For p53 detection, we used a mixture of
purified p53 MAbs (MAb 421, MAb 1801, MAb 240, and DO-1), each at a
1/3,000 dilution of a 50-ng/ml stock; for HA:p53, HA:p73
, and
HA:p73
detection, the primary MAb was 12CA5 at a 1/3,000 dilution of
a 50-ng/ml stock. Proteins were visualized with an enhanced
chemiluminescence detection system (Amersham).
Cell culture, transfection, and luciferase assays.
H1299
cells (American Type Culture Collection) were maintained in Dulbecco's
modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum
(FBS) in 5% CO2 at 37°C. Cells were transfected by a
lipopolyamine-based (Transfectam) protocol as described previously (21). Briefly, cells were grown in DMEM-10% FBS and
transfected with various amounts of DNA. The precipitate was left on
the cells for 6 h, after which fresh DMEM-10% FBS was added for
the periods indicated. For luciferase assays, cells were seeded in
12-well, 3.8-cm2 plates and transfected with one of the
expression vectors (200 ng of each) and two different reporter
constructs (250 ng of each), a CMV-expressed luciferase cDNA from
renilla and a p53-responsive luciferase cDNA from firefly. Luciferase
activity was measured in each well 24 h later by a dual-luciferase
reporter gene assay (Promega).
Preparation of mammalian whole-cell extracts and
immunoprecipitation analysis.
H1299 cells were transfected in
10-cm plates with 20 µg of DNA and harvested at 48 h
posttransfection. Cells were lysed in 300 µl of lysis buffer (10 mM
Tris-HCl [pH 7.5], 1 mM EDTA, 0.5% NP-40, 150 mM NaCl, 1 mM DTT,
10% glycerol, 0.5 mM phenylmethylsulfonyl fluoride, protease
inhibitor), and the extracts were centrifuged at 8,000 × g for 15 min to remove cell debris. Protein concentrations were determined by the Bio-Rad Laboratories (Hercules, Calif.) assay.
Immunoprecipitations of p53 proteins were performed by incubating 1.5 mg of whole-cell extract with 100 µg each of anti-p53 MAbs 240, 421, and 1801 and rocking at 4°C for 1 h. After the primary
incubation, 20 µl of protein A-Sepharose beads (Pharmacia) was added,
and the samples were rocked at 4°C for 1 h. The samples were
washed four times with 1 ml of wash buffer (10 mM Tris-HCl [pH 7.5],
1 mM EDTA, 0.5% NP-40, 1 mM DTT, 10% glycerol), the excess liquid was
aspirated, and 30 µl of 2× sample buffer (62) was added.
Samples were heated to 95°C for 5 min, centrifuged for 3 min at
13,000 × g, and electrophoresed through an SDS-10% polyacrylamide gel. Protein gels were transferred to nitrocellulose membranes (Schleicher & Schuell). For p53 detection, a mixture of p53
MAb (MAb 421, 1801, or 240) containing supernatants was used, each at a
1/4 dilution; for HA:p73
detection (Fig. 5C), a supernatant
containing MAb 12CA5 was used at a 1/3 dilution; for HA:p73
,
HA:p73
, and HA:p53 detection (Fig. 1C), MAb 16B12 (1 mg/ml; BAbCo)
was used at 1/1,000. Proteins were visualized with an enhanced
chemiluminescence detection system (Amersham).
Apoptosis assays.
H1299 cells were cotransfected in
10-cm-diameter plates with 7 µg of expression vector containing
either p73
, wild-type p53, or mutant p53 and 7 µg of a green
fluorescent protein (GFP)-containing internal ribosomal entry site
construct (Clontech). When appropriate, 7 µg of pRC-CMV vector
(Invitrogen) was included to keep the total amount of transfected DNA
constant in each sample. At 72 h after transfection, cells were
observed under epifluorescence (Nikon Diaphot 300) and images were
photographed with an Optronics 3CCD video camera linked to a Macintosh.
For each condition, three plates were used and 500 GFP-stained cells
were counted in randomly selected fields from each plate. Among the
GFP-stained populations, apoptotic cells were identified by the
presence of apoptotic bodies or membrane blebbing.
To confirm the apoptotic phenotype, cells were also subjected to
fluorescence-activated cell sorting (FACS) analysis as described elsewhere (38). Briefly, 72 h posttransfection, cells
were fixed in paraformaldehyde 2% [100 mM NaCl, 10 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES; pH 6.8), 300 mM
sucrose, 3 mM MgCl2, 1 mM EGTA] for 20 min and then in
95% methanol for 1 h. Fixed cells were washed three times with
phosphate-buffered saline and exposed to propidium iodide (PI; 60 µg/ml) and RNase A (50 µg/ml) for 30 min before counting by FACS
(FACScalibure; Becton Dickinson). Harvesting of cells and FACS analysis
were performed on the same day to avoid loss of GFP staining. Cells
(100,000) were gated for GFP staining with a 530/20-nm bandpass filter
and then analyzed for DNA content (PI) with a 610-nm longpass filter.
An excitation wavelength of 488 nm was used for GFP and PI. Data were
analyzed with CELLQuest software (Becton Dickinson). From the DNA
content profile, the sub-G1 fraction was gated and counted.
 |
RESULTS |
p73
and p73
differentially transactivate p53-regulated
promoters in mammalian cells.
To analyze the transactivation
potential of the two naturally occurring p73 isoforms for p53 target
genes, a p53-null cell line (H1299) was transiently cotransfected with
mammalian expression plasmids encoding HA:p53, HA:p73
, or HA:p73
under the control of the CMV promoter, and reporter plasmids containing
either full-length promoters (p21, mdm2,
cyclin G, and Bax) or p53 binding sites (GADD45, IGF-BP3 box A, and IGF-BP3
box B) from p53 target genes placed upstream of a luciferase cDNA (see
Materials and Methods and reference 19). The simian
p73 isoforms that we used are 97.6% identical (98.3% similar) to
their human counterparts. As previously shown (19),
wild-type p53 transactivated all promoters (full length or partial) in
H1299 cells to various degrees (Fig. 1A and
B). In addition, as previously
demonstrated (32), p73
and p73
transactivated the
p21 promoter-luciferase reporter, albeit to a lesser degree
than p53 (Fig. 1A). Both p73
and p73
transactivated the remaining
p53-responsive promoters to various degrees (Fig. 1), with one
exception (IGF-BP3 box A, [Fig. 1B]; see below). While we
observed a 20- to 25-fold induction of the p21 and
mdm2 promoters by wild-type p53, both p73 isoforms activated transcription of these same promoters to a lesser degree (seven- to
ninefold induction [Fig. 1A]). In contrast, the Bax and
GADD45 promoters were transactivated by both p73
and
p73
as well as, or somewhat better than, wild-type p53 (Fig. 1A and
B, respectively). It should be noted that in these cells these two
promoters are transactivated by wild-type p53 to a greater degree than
any other. Interestingly, we observed significant differences between
p73
and p73
in the ability to transactivate the cyclin
G, IGF-BP3 box A, and IGF-BP3 box B
promoters (Fig. 1A and B). Whereas p73
activated the cyclin
G promoter 20-fold, p73
activated the same promoter less than
8-fold. Conversely, whereas p73
activated the IGF-BP3 box
B promoter 40-fold, p73
activated this same promoter less than
16-fold. Finally, whereas both p53 and p73
activated the
IGF-BP3 box A promoter 16 to 17-fold, p73
only activated this same promoter less than 2-fold. It should be noted as well that
under these conditions, IGF-BP3 box B appears to a better target for p73
than for wild-type p53. As detected by Western blot
analysis with MAb 16B12, the protein levels of ectopically expressed
wild-type p73
and p73
were readily detected (Fig. 1C).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Wild-type p53, p73 , and p73 transactivate
p53-responsive reporters in mammalian cells (A and B). H1299 cells
(grown in DMEM supplemented with 10% FBS) were transiently
cotransfected with the CMV-HA:p53, CMV-HA:p73 , or CMV-HA:p73
expression plasmid along with the luciferase (luc) reporter constructs
indicated in boxes at the bottom. Cells were harvested for luciferase
assay 18 h after cotransfection. Results are represented as fold
induction of luciferase activity compared to control cells transfected
with an empty CMV expression plasmid. Histograms show the mean of a
typical experiment of three performed in triplicate; bars indicate the
standard deviation of the mean. (C) Representative Western blot
analysis. A blot loaded with 100 µg of extract was probed with the
anti-HA antibody 16B12 to detect the expression levels of HA:p53,
HA:p73 , and HA:p73 in transfected cells. Ct, control plasmid.
|
|
The ability of p53 to drive transcription from a reporter gene is
dependent on the expression level of p53 (
14,
40). The
levels of p53/p73 expression constructs used for Fig.
1 were well
within the range used in other such transient transfection studies
(
30,
32,
49,
54). However, it is frequently observed that
a
dose-response assay shows progressively increasing amounts of
reporter
activity as a function of p53-expressing constructs introduced
into
cells (10 to 200 ng) until a plateau is reached, while at
still higher
concentrations (e.g., 0.5 to 1 µg of DNA) p53 can
"self-squelch"
(
53), leading to reduced transcriptional activation.
To
ensure that we were in the plateau range of activity, we examined
the
effects of increasing amounts (25 ng to 500 ng) of either
p53, p73

,
or p73

expression vectors on two distinct reporter
genes. We chose
the
p21 promoter-luciferase reporter, which is
transactivated to a lesser degree by both p73 isoforms than by
p53
(Fig.
1), and the
IGF-BP3 box A promoter-luciferase
reporter,
which is transactivated by both p53 and p73

and, very
weakly,
by p73

(Fig.
1). At expression vector concentrations ranging
from 25 to 100 ng, p53, p73

, and p73

progressively increased
the
activity of the
p21 promoter-luciferase reporter (Fig.
2A).
At vector concentrations of 100 ng
and 200 ng,
p21 reporter activity
plateaued. Further
increasing the p53 and p73

, but not p73

,
expression vector
concentrations to 500 ng reduced p21 reporter
transactivation, somewhat
suggesting a squelching effect. The
IGF-BP3 box A
promoter-luciferase reporter gene, while similarly
induced by p53 and
p73

, was not strongly induced by p73

(Fig.
1), even at the
highest concentration. Importantly, at lower DNA
concentrations (50 and
100 ng), we did not observe transactivation
of the
IGF-BP3
box A reporter by p73

, ruling out the possibility
of squelching
(Fig.
2B). In contrast, the transactivation profiles
of p53 and p73

were very similar, reaching a maximum at 100 ng
and leveling off at 200 ng (Fig.
2). These results suggest that
the different isoforms of p73
can discern between these two distinct
p53-responsive reporters.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Transactivation of the p21 promoter and IGF-BP3 box A
sequence by increasing amounts of p53, p73 , or p73 . Increasing
amounts (0 to 500 ng) of CMV-HA:p53, CMV-HA:p73 , or CMV-HA:p73
expression plasmid along with one of the luciferase (luc) reporter
constructs indicated in boxes at the bottom were transiently
cotransfected into H1299 cells. DNA concentration was kept constant
with an empty CMV expression vector. Cells were harvested for
luciferase assay 18 h after cotransfection. Results are
represented as fold induction of luciferase activity compared to
control cells transfected with an empty CMV expression vector. Data
points represent the mean of a typical experiment of two performed in
triplicate; bars indicate the standard deviation of the mean.
|
|
These results taken together suggest that both isoforms of p73 have the
ability to transactivate p53-responsive genes (albeit
at possibly
higher than normal protein levels) in the absence
of endogenous p53.
They also demonstrate significant quantitative
differences in the
relative transactivation abilities of these
different related gene
products.
p73
and p73
differentially transactivate p53-regulated
promoters in yeast.
To further characterize the transactivation
potential of p73
and p73
for p53 target genes, we constructed
yeast strains (12) which contained the HIS3 gene
under the control of one of the following derived p53-responsive human
or murine target gene cis-acting elements: p21, mdm2,
GADD45, cyclin G, Bax, IGF-BP3 box A, IGF-BP3 box B, RGC
(34), and an artificial high-affinity-binding p53 consensus
element (termed SCS) (26). Each of the above-mentioned reporter strains was transformed with a plasmid expressing either human
wild-type or mutant p53 under the control of the constitutive ADH1 minimal promoter (29), which does not
express extremely high levels of p53 (12). The growth assay
used for our phenotypic analysis relies on the fact that the
HIS3 gene is under the control of an inactive
GAL1 promoter. This promoter is activated, and HIS3 is expressed only when bound by a transcriptional
activator, such as p53 (or p73 [see below]), at sites placed upstream
of the minimal GAL1 promoter. We scored transactivation as
growth or lack thereof on histidine-deficient medium.
As previously demonstrated, we observed wild-type p53-dependent
HIS3 transcription of all reporters to various degrees, with
the exception of those containing the IGF-BP3 box A and box B
cis-acting elements (Table
1
and reference
12). As a control,
isogenic strains
expressing either (i) wild-type p53 and containing
a
HIS3
reporter with no p53-responsive
cis-acting element or (ii)
vector control and any one of the p53-responsive
cis-acting
element
reporters did not grow on histidine-deficient media (Table
1).
Whereas the RGC- and Bax-containing reporter strains grew slowly
on
histidine-deficient media (Table
1), the p21-, SCS-, mdm2-,
GADD45-,
and cyclin G-containing reporter strains grew at the
wild-type rate
(Table
1). While IGF-BP3 box A and box B have
been shown to be
p53-responsive
cis-acting elements in mammalian
cells (Fig.
1 and references
5,
19, and
43),
we detected
no such activation in yeast (Table
1 and reference
12).
To examine the transactivation ability of p73 in yeast, each of the
above reporter strains was transformed with plasmids expressing
either
wild-type or mutant p73

and p73

under the control of
the
constitutive
ADH1 minimal promoter. We observed wild-type
p73-dependent
HIS3 transcription of all reporters to various
degrees,
with the exception of those containing the IGF-BP3 box A and
box
B
cis-acting elements (Table
1). In contrast, the
p73

R292H and
p73

R292H mutants, homologs of the p53R273H mutant
that have been
shown to be unable to transactivate an RGC- and
p21-containing
reporter in transient cotransfection assays
(
32), were similarly
inactive for transactivation in our
yeast-based assay. A representative
example comparing the
transactivation activities of wild-type
and mutant p73

and -

to
those of wild-type p53 in the
p21:HIS3 strain is shown in
Fig.
3C. As a control, isogenic strains
expressing
wild-type p73

and p73

and containing a
HIS3
reporter with no
p53-responsive
cis-acting element did not
grow on histidine-deficient
medium (Table
1). Whereas the
RGC-containing reporter strains
grew slowly on histidine-deficient
media (Table
1, p73

and p73

)
and the Bax-containing reporter
strains grew extremely slowly
(Table
1), the p21-, SCS-, mdm2-,
GADD45-, and cyclin G-containing
reporter strains grew at rates ranging
from ++ to +++ (Table
1).
While p73

and p73

transactivated the
p21-, mdm2-, and SCS-containing
reporters as well as p53, both
transactivated the cyclin G- and
GADD45-containing reporters to lesser
extents than p53 (Table
1). Additionally, p73

transactivated the
RGC-containing reporter
better than its isoform, p73

(Table
1).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Expression levels of p73 in yeast. (A) Wild-type- and
mutant p73 -expressing strains were grown to log phase; extracts were
prepared and subjected to Western blot analysis in which 50 µg of
total cell extract was loaded. The Western blot was probed with an
anti-HA antibody at a 1/3,000 dilution. Shown is the expression from
two independently isolated wild-type and mutant p73 clones.
"Cont" (lane 1) refers to a strain containing a control vector
(ADH1 promoter on a LEU2/2µm plasmid). (B)
Wild-type p73 - and p73 -expressing strains were grown to log
phase; extracts were prepared and subjected to Western blot analysis in
which 100 µg of total cell extract was loaded. The Western blot was
probed with an anti-HA antibody at a 1/3,000 dilution (top) and a
mixture of anti-p53 antibodies at a 1/3,000 dilution (bottom). These
strains also express wild-type untagged p53, which was used as a
loading control. "Cont" (lane 1) refers to a strain containing a
control vector (ADH1 promoter on a LEU2/2µm
plasmid) and wild-type p53 (ADH1 promoter p53 on
a URA3/CEN vector). (C) Strains expressing wild-type p53,
p73 , or p73 , or mutant p73 or p73 , and containing a
p53-responsive reporter (p21:HIS3 on a TRP/CEN
plasmid) were patched onto SC-minus-leucine-minus-tryptophan plates and
grown for 1 day at 37°C. Patches were replica plated onto
SC-minus-leucine-minus-tryptophan-minus-histidine plates and grown for
1.5 days at 37°C. *, mutant p73 R292H or p73 R292H; C, strain
containing a control vector (ADH1 promoter on a
LEU2/CEN plasmid). Sizes in panels A and B are indicated in
kilodaltons on the left.
|
|
As detected by Western blot analysis with MAb 12CA5, the protein levels
of wild-type and mutant HA:p73 in their respective
reporter yeast
strains were readily detected and quite similar
(Fig.
3A and data not
shown). Therefore, the growth rate differences
are not due to
variations in the levels of wild-type and mutant
p73 protein but are
due to the ability of wild-type p73

and p73
to transactivate the
cis-acting element present in each reporter.
Interestingly,
when we examined the expression levels of wild-type
p73

and
wild-type p73

by Western blot analysis and serial dilution
of
extracts from isogenic strains, we consistently observed ~25-fold
less p73

than p73

(Fig.
3B and data not shown). We also observed
slower-migrating species for p73

(and p73

under certain gel
conditions) which were not seen for p53 (Fig.
3A and B and data
not
shown). Despite being present at a lower concentration than
p73

,
p73

can activate transcription comparably to p73

. We do
not know
whether this represents a qualitative difference in the
p73 gene
products or the presence of both at levels greater than
that required
for transactivation in this yeast-based
assay.
p73
coprecipitates with tumor-derived p53, but not wild-type
p53, in mammalian cells.
Utilizing the yeast two-hybrid system,
Kaghad et al. demonstrated both homotypic and heterotypic interactions
between p53 and p73
but not p73
(33). To test whether
p73 associates with p53 in mammalian cells, we performed
coimmunoprecipitation experiments from extracts of human H1299 cells
ectopically expressing either wild-type or mutant forms of p53 and p73.
Wild-type and mutant p53 were immunoprecipitated with a mixture of
anti-p53 MAbs 240 and 1801, and HA:p73
was detected on Western blots
of the immunoprecipitates by use of the anti-HA antibody 16B12.
Surprisingly, p73
coprecipitated both with p53R248W and p53R175H but
did not detectably coprecipitate with wild-type p53 (Fig.
4). By Western blot analysis of extracts, we estimated that 5 to 10% of p73
is stably associated with mutant p53 under these transient overexpression conditions. In contrast, despite repeated attempts using a variety of extraction and
immunoprecipitation conditions, we were unable to detect
protein-protein interactions between either wild-type or mutant p53 and
either wild-type p73
or p73
by overexpression in yeast (data not
shown).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Association of p73 with tumor-derived p53 mutants but
not wild-type p53. H1299 cells were transfected with an expression
plasmid for either wild-type p53 (p53 wt), p53R175H, p53R248W, or
p73 , alone and in combination as indicated. p53 was precipitated
from extracts (1.5 mg of protein) incubated with 100 ng each of
anti-p53 MAbs 240 and 1801. Western blots of the immunoprecipitates
(IP) were probed with either the anti-HA antibody 16B12 (upper panel)
or the anti-p53 antibody 1801 (lower panel) (see Materials and
Methods). The middle panel is a Western blot loaded with 100 µg of
extract and probed with the anti-HA antibody to detect p73 .
|
|
Tumor-derived p53 mutants reduce p73
transcriptional activity in
mammalian cells.
That we detected interactions between
tumor-derived p53 mutants and p73 suggests that p53 mutants may affect
p73 function. To test this, we cotransfected the p53-null cell line
H1299 with p73
along with two tumor-derived p53 mutants and a
reporter construct containing a p53-responsive human target gene
cis-acting element derived either from the p21
promoter (Fig. 5B; see Materials and Methods) or from the Bax promoter (Fig.
5E). We confirmed that (i) wild-type p53 and p73
are
transcriptionally active toward both reporters, while the two
tumor-derived p53 mutants, R175H and R248W, are inactive, and (ii) that
both p53 mutants reduced the transcriptional activity of wild-type p53
(Fig. 5A and E), as previously described (13, 17, 35);
reviewed in reference 69). Importantly, we found
that these same tumor-derived p53 mutants markedly reduced the
transcriptional activity of p73
(Fig. 5A and E). To normalize for
the reporter DNA utilized in each transfection, an additional reporter
containing a CMV promoter upstream of the renilla luciferase cDNA
(Promega) was employed. Under these experimental conditions, the
ectopically expressed wild-type HA:p73
, as detected by Western blot
analysis with MAb 12CA5, was readily detected and was not significantly
affected by either wild-type or mutant p53 proteins (Fig. 5C). It is
worth mentioning that in these experiments, we used a DNA transfection ratio of 1:1 for the various p53- and p73
-expressing vectors. Previous work has shown that the ratio of mutant to wild-type p53 DNA
used for transfection determines the level of transcription measured
(35, 68): more mutant p53 DNA transfected per wild-type p53
DNA leads to greater inhibition of transactivation (Fig. 5D). To
further examine this dosage-dependent abrogation of transactivation with regard to p73
, increasing amounts of the expression plasmid p53R248W were cotransfected with constant amounts of either wild-type p53 or the HA:p73
expression plasmid. We found that a fivefold excess of transfected mutant p53 DNA decreased the transcriptional activity of p53 by a factor of 10 and that of p73
by a factor of 3 (Fig. 5D). Increasing the ratio to 10-fold did not further reduce
activation in either case, although with p53 the level of repression
approached that observed with the control vector. Thus, even this level
of mutant p53 is not sufficient to completely abolish all
transcriptional activity associated with p73
.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
Tumor-derived p53 mutants reduce the transcriptional
activity of p73 . (A) H1299 cells were transiently cotransfected with
a reporter plasmid (p21min-luc) containing a derived p53-responsive
human target gene cis-acting element from the p21
promoter (see panel B and Materials and Methods), and a plasmid
expressing either p73 , wild-type p53 (p53), p53R175H (175), or
p53R248W (248). In each transfection, equivalent amounts of DNA were
used for all expression plasmids except where indicated ("2×"
refers to a twofold increase in the amount of expression plasmid DNA
transfected). (C) Representative Western blot loaded with 100 µg
of extract and probed with anti-HA antibody 12CA5 to detect
p73 in cells expressing either p73 alone, p73 plus wild-type
p53 (wt), or p73 plus p53R248W (248). Ct, control plasmid; *, a
nonspecific protein band that migrates more slowly than p73 and
cross-reacts with the anti-HA antibody. (D) H1299 cells were
cotransfected with increasing amounts of the p53R248W expression
plasmid and a constant amount of either wild-type p53 or p73 and the
p21min-luc reporter as for panel B. Ct, control plasmid; 0, 1/5, 1, 5, and 10, fold excess of p53R248W DNA used in the cotransfection. (E)
H1299 cells were cotransfected as described for panel A except that the
luciferase reporter construct used (Bax-luc) contained the full length
Bax promoter. For the luciferase assays in panels A, D, and
E, histograms represent relative luciferase units (rlu) and diagrams
show the mean of a typical experiment of three performed in triplicate
(bars indicate standard deviations).
|
|
Expression of p53 mutants inhibits the ability of p73
to induce
apoptosis.
Both isoforms of p73, analogous to p53, can induce
apoptosis (32). It was of interest to determine if the
reduction in p73 transactivation activity by p53 mutants can be
correlated with diminution of apoptosis as a result of overexpression
of p73. To test this, we transfected H1299 cells with wild-type p73
, wild-type p53, and mutant p53 variants either alone or in combination along with a GFP-containing vector and analyzed the morphology of
transfected cells. An example of the morphological changes induced in
cells expressing p73
is shown in Fig.
6B, and an example of cells expressing a
control plasmid is shown in Fig. 6A. As seen in Fig. 6B, p73
overexpression induced the apoptotic bodies and membrane blebbing
characteristic of apoptotic cells (28). By enumerating such
morphologically distinguishable cells as a function of the total
GFP-expressing cells, we could quantitate the effects of the various
forms of p53 and p73 separately and together (Fig. 6C). As expected,
wild-type p53, but not the tumor-derived p53 mutants, induced apoptosis
after transient overexpression (Fig. 6C). As previously demonstrated
for other cell types (BHK and SaOs2 [32]), ectopically
expressed p73
induced apoptosis in H1299 cells (Fig. 6B
[representative profile] and C). It should be noted that the ability
of p73
to induce apoptosis in H1299 cells is slightly better than
that of wild-type p53. Moreover, coexpression of both tumor-derived p53
mutants with either wild-type p53 or p73
resulted in a reduction of
apoptotic cells to a level approximately 50 and 44%, respectively, of
that seen with either wild-type protein alone (Fig. 6C). Since the p53
mutants also caused a modest reduction in the number of apoptotic cells
compared to the control vector, we cannot rule out the possibility that they have an additional counter apoptotic function. Nevertheless, our
results show a good correlation between the ability of tumor-derived p53 mutants to inhibit the transactivation and proapoptotic functions of both wild-type p53 and of a closely related family member, p73
.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Tumor-derived p53 mutants reduce p73 -induced
apoptosis. H1299 cells were transiently cotransfected with wild-type
p53, p53R175H, p53R248W, and p73 expression plasmids, singly or in
combination as indicated, and a GFP expression plasmid. After 72 h, the morphology of the cells was observed under an epifluorescence
microscope. (B) Representative apoptotic morphology of cells
overexpressing p73 compared to control cells in panel A transfected
with an empty CMV expression plasmid. (C) Results represented as
percentage of apoptotic cells over 500 GFP-stained cells in a
10-cm-diameter plate (mean of a typical experiment performed with
triplicates cultures; bars indicate standard deviations).
|
|
To confirm the reduction of apoptosis induced by the two p53
tumor-derived mutants, we used FACS analysis to quantify the
amount of
the sub-G
1 fraction, which represents apoptotic cells.
H1299 cells cotransfected with a p53 or p73

expression vector
and a
GFP expression vector as described in the legend to Fig.
6 and in
Materials and Methods were fixed 72 h posttransfection,
stained by
PI, and analyzed by FACS. First, GFP-stained cells
were gated by
comparing cells transfected with an empty vector
(Fig.
7A) to cells transfected with the
GFP-expressing vector
(Fig.
7B); then the GFP-positive cells were
analyzed for DNA content
to quantify the sub-G
1 fraction
when only GFP is expressed (Fig.
7C), when p73

is expressed alone
(Fig.
7D), or when p73

is coexpressed
with either p53R175H (Fig.
7E)
or p53R248W (Fig.
7F). The results
of the FACS analysis are summarized
in Fig.
7G. Overexpression
of p73

alone in H1299 cells induced a
level of apoptotic cells
(sub-G
1 fraction) nearly the same
as that induced by p53 alone.
Importantly, both p53 tumor-derived
mutants reduced the sub-G
1 fraction (apoptotic cells)
induced by both p53 and p73

. Thus,
using two different assays, we
demonstrated that expression of
p53 mutants can lead to reduced
apoptosis induced by p73

.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Tumor-derived p53 mutants reduce p73 -induced
sub-G1 populations. H1299 cells were transiently
cotransfected with a wild-type p53, p53R175H, p53R248W, or p73
expression plasmid singly or in combination as indicated, and a GFP
expression plasmid. After 72 h, cells were fixed and analyzed by
FACS analysis. (A and B) Representative gating of control cells and
cells expressing GFP, respectively. Populations from gate R1 were
analyzed for DNA content (C to F) and the sub-G1 population
counted by the gate indicated M1. (G) Summary of results. Each bar
represents the percentage of sub-G1 cells (gate M1) over
the total number of GFP-stained cells.
|
|
 |
DISCUSSION |
In this study, we provide evidence that (i) p73
and p73
have
the ability to transactivate several distinct p53-responsive reporters
to various degrees, in both mammalian and yeast cells; (ii) two
representative tumor-derived p53 mutants coimmunoprecipitate with p73
in vivo; and (iii) expression of these same tumor-derived p53 mutants can reduce the transcriptional and the proapoptotic activity of p73.
Both p73 isoforms differentially transactivate p53 targets.
We
found that in transient cotransfection assays, p73
and p73
are
both capable of inducing many p53 target gene promoters in mammalian
cells and p53 binding sites in yeast cells but to variable extents. In
mammalian cells, the GADD45 and Bax promoters are
stimulated to the same extent by all three proteins, but p53 is a more
potent transactivator of p21 and mdm2 promoters
than p73. The two p73 isoforms differ in that while p73
is more
active than p73
toward the A box of the IGF-BP3 promoter,
p73
is more active toward the cyclin G promoter. An
additional confirmation of the transcriptional activity associated with
p73
and p73
was performed with a rapid and qualitative
yeast-based assay. While both p73 isoforms are able to transactivate
many of the p53-responsive reporters tested, we found lesser
differences in the relative abilities of both isoforms to
transactivate. Interestingly, in yeast p73
is expressed at higher
levels than p73
. Whether this is due to stabilization or
modification of p73
or enhanced degradation of p73
is not clear.
What is clear is that this lower level of p73
than of p73
and p53
is sufficient to activate transcription as well as p53 (for p21, SCS,
and mdm2) and better than p73
(for RGC).
While results for mammalian and yeast cells do not absolutely correlate
with regard to p73's transactivation ability, the
yeast-based assay
has proven useful for screening patients (
29),
cell lines,
blood, and tumors (
16) for somatic or germ line
mutations in
p53 as well as for monitoring adenovirus p53 transduction
efficiency
during gene therapy (
64). Moreover, this approach
allows one
to distinguish among functionally silent mutations,
inactivating
mutations, and polymorphisms, which is not easily
done by more widely
used methods such as immunohistochemistry,
single-stranded conformation
polymorphism, anti-p53 antibody screening,
and denaturing gradient gel
electrophoresis. Our demonstration
that wild-type, but not mutant,
p73

and p73

are transcriptionally
active in yeast should provide
the ability to similarly assess
the status of p73 (or p51/p63) in cell
lines and in patient
tumors.
Tumor-derived p53 mutants inhibit p73 function.
We have
demonstrated that tumor-derived p53 mutants can be coimmunoprecipitated
with other p53-related family members, specifically p73
, and that
this interaction can lead to inhibition of p73
's function. It is
known that p53 missense mutations are expressed frequently at high
levels in a wide variety of human tumors. Moreover, studies have shown
that certain p53 mutants can abrogate wild-type p53 function in a
dominant negative manner (13, 25, 35, 45, 47, 68). This
dominant negative effect can also vary depending on the particular germ
line mutation of p53 examined and the tumorigenic cell line assayed
(17, 63). Overexpression of mutant p53 can also result in
induction of a number of cellular genes, such as MDR-1,
PCNA, VEGF, EGFR, IL-6,
HSP70, and BFGF (8, 11, 36, 42, 44, 65,
66). More recently it has been demonstrated that certain
tumor-derived p53 mutants, in addition to inhibiting wild-type p53
tumor suppressor activity, possess an activity that leads to the
induction of endogenous cellular targets that promote tumorigenicity,
such as c-myc (18), as well as promote genetic
instability by disrupting spindle checkpoint control (23).
Our observation that overexpression of tumor-derived p53 mutants
inhibits transactivation by p73
and p73
-induced apoptosis
suggests another possible mechanism by which tumor-derived p53 mutants
may act, i.e., by physical association with related family members. Our
data also lend support to the contention that tumor-derived p53 mutants
may play an active role in cellular transformation, not only by
activating genes involved in tumorigenicity, such as c-myc,
but also by inactivating proapoptotic proteins such as p73. While the
cellular function(s) of p73 and p51/p63 awaits further investigation,
it is tempting to speculate that in cells which express both
tumor-derived mutant p53 and p63 or p73 isoforms, the function of the
latter may be abrogated or altered. Indeed, Prabhu et al.
(52) found that p73
, but not p73
, lacks growth
suppression activity in SW480 cells, a colon cancer cell line harboring
mutant p53.
How do p53 and p73 proteins interact?
Wild-type p53 exists
predominantly as tetramers in solution (20), and the
structure of the tetramerization domain has been solved (10, 31,
39). Additionally, wild-type and tumor-derived mutant forms of
p53 can readily form heterotetramers when cotranslationally expressed
(2, 47, 48, 61, 63). Such wild-type/mutant p53 cotetramers
are frequently inactive for DNA binding and transactivation (reviewed
in reference 69). While it has not yet been
determined whether wild-type p73 exists as tetramers, our observation
that certain p53 mutants can associate with and inhibit p73 function suggests that cotetramers may exist in vivo. Alternatively,
the association of mutant p53 with p73
may involve interactions
distinct from those engendered by their oligomerization domains or even may be mediated by as yet unidentified cellular proteins. However, why
were we not able to detect wild-type p73 complexed with wild-type p53
by coimmunoprecipitation? The crystal structure of the DNA binding
domain of p53 bound to its cognate site (9) has helped to
explain how mutations in this region interfere with DNA binding. It is
plausible that these same mutations affect the overall structure of
p53, including the transactivation and tetramerization domains, and not
just the DNA binding domain. Perhaps only in this altered configuration
does association by tumor-derived p53 mutants with p73
occur. It is
noteworthy that a subset of tumor-derived mutations when fused to the
GAL4 DNA binding domain are inert (46, 56, 67), suggesting
propagation of the mutation within the p53 DNA binding domain to either
the p53 activation region or the GAL4 DNA binding domain (or both).
Clearly, determination of the domain(s) required for association and
demonstration that other tumor-derived p53 mutants bind to p73 are
required to better understand the nature of this potentially important interaction.
The experiments investigating p73 interactions shown in Figs.
4 to
7
were performed exclusively with p73

. Similar experiments
with p73

are in progress; interestingly, we have preliminary
indication that
this isoform differs from p73

in that it can
interact with both
wild-type and mutant forms of p53 (data not
shown). We are currently
determining (i) which regions of the
p53 and p73 proteins are required
for their interactions and (ii)
why p73

and p73

differ from each
other.
There are a number of plausible explanations for the lack of detectable
association between either wild-type or mutant p53
and p73 in yeast. If
the interaction that we detect in mammalian
cells requires an as yet
unidentified adaptor protein, we would
not see coimmunoprecipitation of
both proteins if yeast cells
lack such a factor. Suggestive of this are
the results of Kaghad
et al. (
33), who detected no
interaction between wild-type p53
and p73

in the yeast two-hybrid
assay. Additionally, p73

and
p73

may be posttranslationally
modified in a yeast-specific manner,
and it is this modification that
may preclude any association
with p53, wild type or mutant. Moreover,
if an adaptor protein
is required, this modification might also
preclude association
between p53 and p73 if the adaptor were modified.
These possibilities,
or others, remain to be
tested.
Do p53 and p73 have overlapping functions?
The discovery that
additional p53-related proteins exist requires a reexamination of the
functions that we had previously attributed to p53. Not only do p73 and
p51/p63 show structural similarities to p53, but the results of Jost et
al. (32), Kaghad et al. (33), Osada et al.
(50), and Yang et al. (72), as well as those
presented here, demonstrate that p73 and p51/p63 show functional
similarities to p53. That p73 and p51/p63 have activities overlapping
those of p53 suggests that these proteins may be functionally
interchangeable. However, the fact that p53
/
mice
develop tumors argues against this assumption. Our results have
demonstrated that both isoforms of p73, when overexpressed, can
transactivate those target genes once thought of as being p53 specific,
and they do so in a p53-independent context. What we have not shown is
that these same target genes are transactivated by physiologically
relevant levels of p73 in vivo. However, given the previous
demonstration by Jost et al. (32) that p73 can indeed
transactivate endogenous p21, it is possible that most, if
not all, of these additional p53-responsive promoters can also be
targets of p73 under the appropriate conditions in vivo. It is also of interest to examine whether in cells expressing both p53 and
p73, the two factors compete or collaborate to activate the
above-mentioned targets. Moreover, since p73
and p73
are not
induced by DNA damage, it will be of interest to determine how p73
expression is regulated in cell types where it is found and what
role(s) the two proteins play in p53-mediated growth arrest and/or
apoptosis. Finally, we cannot exclude that one or both isoforms of p73
hetero-oligomerize with wild-type p53 under certain as yet unidentified
physiological conditions and modulate some or all of their target
genes. Elucidation of these questions, as well as the specific signals
which regulate p73, will be necessary to uncover p73's role in the
cell. As more information about the normal expression of p73 is
obtained, these and other questions can be approached.
 |
ACKNOWLEDGMENTS |
We gratefully thank W. Kaelin, Jr., for the simian p73
and
p73
mammalian expression plasmids. We also thank R. Iggo for the
human p53 yeast expression plasmids, the
UAS pGAL1:HIS3 construct, and RGC:HIS3 reporter. Critical comments and discussion on
the manuscript were made by J. Ahn, G. Bond, and K. Okamoto.
C.J.D. is supported by the Cancer Research Fund of the Damon
Runyon-Walter Winchell Foundation (fellowship DRG-1427). C.G. is
supported by Human Frontier Foundation long-term fellowship LT0776/1997-M. This work was supported by grant {DAMD17-94}4275 from the U.S. Army.
The first two authors contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, Columbia University, 1212 Amsterdam Ave., New
York, NY 10027. Phone: (212) 854-2557. Fax: (212) 865-8246. E-mail: prives{at}cubsps.bio.columbia.edu.
 |
REFERENCES |
| 1.
|
Bargonetti, J.,
J. J. Manfredi,
X. Chen,
D. R. Marshak, and C. Prives.
1993.
A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein.
Genes Dev.
7:2565-2574[Abstract/Free Full Text].
|
| 2.
|
Bargonetti, J.,
I. Reynisdottir,
P. N. Friedman, and C. Prives.
1992.
Site-specific binding of wild-type p53 to cellular DNA is inhibited by SV40 T antigen and mutant p53.
Genes Dev.
6:1886-1898[Abstract/Free Full Text].
|
| 3.
|
Bayle, J. H.,
B. Elenbaas, and A. J. Levine.
1995.
The carboxyl-terminal domain of the p53 protein regulates sequence-specific DNA binding through its nonspecific nucleic acid-binding activity.
Proc. Natl. Acad. Sci. USA
92:5729-5733[Abstract/Free Full Text].
|
| 4.
|
Brain, R., and J. R. Jenkins.
1994.
Human p53 directs DNA strand reassociation and is photolabelled by 8-azido ATP.
Oncogene
9:1775-1780[Medline].
|
| 5.
|
Buckbinder, L.,
R. Talbott,
S. Velasco-Miguel,
I. Takenaka,
B. Faha,
B. R. Seizinger, and N. Kley.
1995.
Induction of the growth inhibitor IGF-binding protein 3 by p53.
Nature
377:646-649[Medline].
|
| 6.
|
Candau, R.,
D. M. Scolnick,
P. Darpino,
C. Y. Ying,
T. D. Halazonetis, and S. L. Berger.
1997.
Two tandem and independent sub-activation domains in the amino terminus of p53 require the adaptor complex for activity.
Oncogene
15:807-816[Medline].
|
| 7.
|
Chang, J.,
D.-H. Kim,
S. W. Lee,
K. Y. Choi, and Y. C. Sung.
1995.
Transactivation ability of p53 transcriptional activation domain is directly related to the binding affinity to TATA-binding protein.
J. Biol. Chem.
270:25014-25019[Abstract/Free Full Text].
|
| 8.
|
Chin, K.-V.,
K. Ueda,
I. Pastan, and M. M. Gottesman.
1992.
Modulation of activity of the promoter of the human MDR1 gene by ras and p53.
Science
255:459-462[Abstract/Free Full Text].
|
| 9.
|
Cho, Y.,
S. Gorina,
P. D. Jeffrey, and N. P. Pavletich.
1994.
Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations.
Science
265:346-355[Abstract/Free Full Text].
|
| 10.
|
Clore, G. M.,
J. G. Omichinski,
K. Sakaguchi,
N. Zambrano,
H. Sakamoto,
E. Appella, and A. M. Gronenborn.
1994.
High-resolution structure of the oligomerization domain of p53 by multidimensional NMR.
Science
265:386-394[Abstract/Free Full Text].
|
| 11.
|
Deb, S.,
C. T. Jackson,
M. A. Subler, and D. W. Martin.
1992.
Modulation of cellular and viral promoters by mutant human p53 proteins found in tumor cells.
J. Virol.
66:6164-6170[Abstract/Free Full Text].
|
| 12.
|
Di Como, C. J., and C. Prives.
1998.
Human tumor-derived p53 proteins exhibit binding site selectivity and temperature sensitivity for transactivation in a yeast-based assay.
Oncogene
16:2627-2539.
|
| 13.
|
Farmer, G.,
J. Bargonetti,
H. Zhu,
P. Friedman,
R. Prywes, and C. Prives.
1992.
Wild-type p53 activates transcription in vitro.
Nature
358:83-86[Medline].
|
| 14.
|
Farmer, G.,
P. Friedlander,
J. Colgan,
J. L. Manley, and C. Prives.
1996.
Transcriptional repression by p53 involves molecular interactions distinct from those with the TATA box binding protein.
Nucleic Acids Res.
24:4281-4288[Abstract/Free Full Text].
|
| 15.
|
Fields, S., and S. K. Jang.
1990.
Presence of a potent transcription activating sequence in the p53 protein.
Science
249:1046-1049[Abstract/Free Full Text].
|
| 16.
|
Flaman, J.-M.,
T. Frebourg,
V. Moreau,
F. Charbonnier,
C. Martin,
P. Chappuis,
A.-P. Sappino,
J.-L. Limacher,
L. Bron,
J. Benhattar,
M. Tada,
E. G. Van Meir,
A. Estreicher, and R. D. Iggo.
1995.
A simple p53 functional assay for screening cell lines, blood, and tumors.
Proc. Natl. Acad. Sci. USA
92:3963-3967[Abstract/Free Full Text].
|
| 17.
|
Forrester, K.,
S. E. Lupold,
V. L. Ott,
C. H. Chay,
V. Band,
X. W. Wang, and C. C. Harris.
1995.
Effects of p53 mutants on wild-type p53-mediated transactivation are cell type dependent.
Oncogene
10:2103-2111[Medline].
|
| 18.
|
Frazier, M. W.,
X. He,
J. Wang,
Z. Gu,
J. L. Cleveland, and G. P. Zambetti.
1998.
Activation of c-myc gene expression by tumor-derived p53 mutants requires a discrete C-terminal domain.
Mol. Cell. Biol.
18:3735-3743[Abstract/Free Full Text].
|
| 19.
|
Friedlander, P.,
Y. Haupt,
C. Prives, and M. Oren.
1996.
A mutant p53 that discriminates between p53-responsive genes cannot induce apoptosis.
Mol. Cell. Biol.
16:4961-4971[Abstract].
|
| 20.
|
Friedman, P. N.,
X. Chen,
J. Bargonetti, and C. Prives.
1993.
The p53 protein is an unusually shaped tetramer that binds directly to DNA.
Proc. Natl. Acad. Sci. USA
90:3319-3323[Abstract/Free Full Text].
|
| 21.
|
Gaiddon, C. B.,
A.-L. Monnier,
L. Mercken, and J.-P. Loeffler.
1994.
Genomic effects of the putative oncogene G alpha s. Chronic transcriptional activation of the c-fos proto-oncogene in endocrine cells.
J. Biol. Chem.
269:22663-22671[Abstract/Free Full Text].
|
| 22.
|
Gottlieb, T., and M. Oren.
1996.
p53 in growth control and neoplasia.
Biochim. Biophys. Acta
1287:77-102[Medline].
|
| 23.
|
Gualberto, A.,
K. Aldape,
K. Kozakiewicz, and T. Tlsty.
1998.
An oncogenic form of p53 confers a dominant, gain-of-function phenotype that disrupts spindle checkpoint control.
Proc. Natl. Acad. Sci. USA
95:5166-5171[Abstract/Free Full Text].
|
| 24.
|
Guthrie, J. A., and G. R. Fink (ed.).
1991.
Methods in enzymology, vol. 194.
Academic Press, Inc., San Diego, Calif.
|
| 25.
|
Hachiya, M.,
A. Chumakov,
C. W. Miller,
M. Akashi,
J. Said, and H. P. Koeffler.
1994.
Mutant p53 proteins behave in a dominant, negative fashion in vivo.
Anticancer Res.
14:1853-1860[Medline].
|
| 26.
|
Halazonetis, T. D.,
L. J. Davis, and A. N. Kandil.
1993.
Wild-type p53 adopts a `mutant'-like conformation when bound to DNA.
EMBO J.
12:1021-1028[Medline].
|
| 27.
|
Halazonetis, T. D., and A. N. Kandil.
1993.
Conformational shifts propagate from the oligomerization domain of p53 to its tetrameric DNA binding domain and restore DNA binding to select p53 mutants.
EMBO J.
12:5057-5064[Medline].
|
| 28.
|
Hale, A. J.,
C. A. Smith,
L. C. Sutherland,
V. E. A. Stoneman,
V. L. Longthorne,
A. C. Culhane, and G. T. Williams.
1996.
Apoptosis: molecular regulation of cell death.
Eur. J. Biochem.
236:1-26[Medline].
|
| 29.
|
Ishioka, C.,
T. Frebourg,
Y.-X. Yan,
M. Vidal,
S. H. Friend,
S. Schmidt, and R. Iggo.
1993.
Screening patients for heterozygous p53 mutations using a functional assay in yeast.
Nat. Genet.
5:124-129[Medline].
|
| 30.
|
Jayaraman, L.,
K. G. K. Murthy,
C. Zhu,
T. Curran,
S. Xanthoudakis, and C. Prives.
1997.
Identification of redox/repair protein Ref-1 as a potent activator of p53.
Genes Dev.
11:558-570[Abstract/Free Full Text].
|
| 31.
|
Jeffrey, P. D.,
S. Gorina, and N. P. Pavletich.
1995.
Crystal structure of the tetramerization domain of the p53 tumor suppressor at 1.7 angstroms.
Science
267:1498-1502[Abstract/Free Full Text].
|
| 32.
|
Jost, C. A.,
M. C. Marin, and W. G. Kaelin, Jr.
1997.
p73 is a human p53-related protein that can induce apoptosis.
Nature
389:191-194[Medline].
|
| 33.
|
Kaghad, M.,
H. Bonnet,
A. yang,
L. Creancier,
J.-C. Biscan,
A. Valent,
A. Minty,
P. Chalon,
J.-M. Lelias,
X. Dumont,
P. Ferrara,
F. McKeon, and D. Caput.
1997.
Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers.
Cell
90:809-819[Medline].
|
| 34.
|
Kern, S. E.,
K. W. Kinzler,
A. Bruskin,
D. Jarosz,
P. Friedman,
C. Prives, and B. Vogelstein.
1991.
Identification of p53 as a sequence-specific DNA-binding protein.
Science
252:1708-1711[Abstract/Free Full Text].
|
| 35.
|
Kern, S. E.,
J. A. Pientenpol,
S. Thiagalingam,
A. Seymour,
K. W. Kinzler, and B. Vogelstein.
1992.
Oncogenic forms of p53 inhibit p53-regulated gene expression.
Science
256:827-830[Abstract/Free Full Text].
|
| 36.
|
Kieser, A.,
H. A. Weich,
G. Brandner,
D. Marme, and W. Kolch.
1994.
Mutant p53 potentiates protein kinase C induction of vascular endothelial growth factor expression.
Oncogene
9:963-969[Medline].
|
| 37.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 38.
|
Lamm, G. M.,
P. Steinlein,
M. Cotten, and G. Christofori.
1997.
A rapid, quantitative and inexpensive method for detecting apoptosis by flow cytometry in transiently transfected cells.
Nucleic Acids Res.
25:4855-4857[Abstract/Free Full Text].
|
| 39.
|
Lee, W.,
T. S. Harvey,
Y. Yin,
P. Yau,
D. Litchfield, and C. H. Arrowsmith.
1994.
Solution structure of the tetrameric minimum transforming domain of p53.
Nat. Struct. Biol.
1:877-890[Medline].
|
| 40.
|
Lee, Y.,
Y. Chen,
L. S. Chang, and L. F. Johnson.
1997.
Inhibition of mouse thymidylate synthase promoter activity by the wild-type p53 tumor suppressor protein.
Exp. Cell Res.
234:270-276[Medline].
|
| 41.
|
Levine, A. J.
1997.
p53, the cellular gatekeeper for growth and division.
Cell
88:323-331[Medline].
|
| 42.
|
Ludes-Meyers, J. H.,
M. A. Subler,
C. V. Shivakumar,
R. M. Munoz,
P. Jiang,
J. E. Bigger,
D. R. Brown,
S. P. Deb, and S. Deb.
1996.
Transcriptional activation of the human epidermal growth factor receptor promoter by human p53.
Mol. Cell. Biol.
16:6009-6019[Abstract].
|
| 43.
|
Ludwig, R. L.,
S. Bates, and K. H. Vousden.
1996.
Differential activation of target cellular promoters by p53 mutants with impaired apoptotic function.
Mol. Cell. Biol.
16:4952-4960[Abstract].
|
| 44.
|
Margulies, L., and P. B. Sehgal.
1993.
Modulation of the human interleukin-6 promoter (IL-6) and transcription factor C/EBP beta (NF-IL6) activity by p53 species.
J. Biol. Chem.
268:15096-15100[Abstract/Free Full Text].
|
| 45.
|
Michalovitz, D.,
O. Halevy, and M. Oren.
1990.
Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53.
Cell
62:671-680[Medline].
|
| 46.
|
Miller, C. W.,
A. Chumakov,
J. Said,
D. L. Chen,
A. Aslo, and H. P. Koeffler.
1993.
Mutant p53 proteins have diverse intracellular abilities to oligomerize and activate transcription.
Oncogene
8:1815-1824[Medline].
|
| 47.
|
Milner, J., and E. A. Medcalf.
1991.
Cotranslation of activated mutant p53 with wild type drives the wild-type p53 protein into the mutant conformation.
Cell
65:765-774[Medline].
|
| 48.
|
Milner, J.,
E. A. Medcalf, and A. C. Cook.
1991.
Tumor suppressor p53: analysis of wild-type and mutant p53 complexes.
Mol. Cell. Biol.
11:12-19[Abstract/Free Full Text].
|
| 49.
|
Miyashita, T., and J. C. Reed.
1995.
Tumor suppressor p53 is a direct transcriptional activator of the human bax gene.
Cell
80:293-299[Medline].
|
| 50.
|
Osada, M.,
M. Ohba,
C. Kawahara,
C. Ishioka,
R. Kanamaru,
I. Katoh,
Y. Ikawa,
Y. Nimura,
A. Nakagawara,
M. Obinata, and S. Ikawa.
1998.
Cloning and functional analysis of human p51, which structurally and functionally resembles p53.
Nat. Med.
4:839-843[Medline].
|
| 51.
|
Pavletich, N. P.,
K. A. Chambers, and C. O. Pabo.
1993.
The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots.
Genes Dev.
7:2556-2564[Abstract/Free Full Text].
|
| 52.
|
Prabhu, N. S.,
K. Somasundaram,
K. Satyamoorthy,
M. Herlyn, and W. El-Deiry.
1998.
P73 , unlike p53, suppresses growth and induces apoptosis of human papillomavirus E6-expressing cancer cells.
Int. J. Oncol.
13:5-9[Medline].
|
| 53.
|
Ptashne, M., and A. A. F. Gann.
1990.
Activators and targets.
Nature
346:329-331[Medline].
|
| 54.
|
Rainwater, R.,
D. Parks,
M. E. Anderson,
P. Tegtmeyer, and K. Mann.
1995.
Role of cysteine residues in regulation of p53 function.
Mol. Cell. Biol.
15:3892-3903[Abstract].
|
| 55.
|
Raycroft, L.,
H. Wu, and G. Lozano.
1990.
Transcriptional activation by wild-type p53 but not transforming mutants of the p53 anti-oncogene.
Science
249:1049-1051[Abstract/Free Full Text].
|
| 56.
|
Raycroft, L.,
J. R. Schmidt,
K. Yoas,
M. Hao, and G. Lozano.
1991.
Analysis of p53 mutants for transcriptional activity.
Mol. Cell. Biol.
11:6067-6074[Abstract/Free Full Text].
|
| 57.
|
Reed, M.,
B. Woelker,
P. Wang,
Y. Wang,
M. E. Anderson, and P. Tegtmeyer.
1995.
The C-terminal domain of p53 recognizes DNA damaged by ionizing radiation.
Proc. Natl. Acad. Sci. USA
92:9455-9459[Abstract/Free Full Text].
|
| 58.
|
Rose, M. D.,
F. Winston, and P. Heiter.
1990.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 59.
|
Schmale, H., and C. Bamberger.
1997.
A novel protein with strong homology to the tumor suppressor p53.
Oncogene
15:1363-1367[Medline].
|
| 60.
|
Senoo, M.,
N. Seki,
M. Ohira,
S. Sugano,
M. Watanabe,
M. Tachibana,
T. Tanaka,
Y. Shinkai, and H. Kato.
1998.
A second p53-related protein, p73L, with high homology to p73.
Biochem. Biophys. Res. Commun.
248:603-607[Medline].
|
| 61.
|
Shaulian, E.,
A. Zauberman,
D. Ginsberg, and M. Oren.
1992.
Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence-specific DNA binding.
Mol. Cell. Biol.
12:5581-5592[Abstract/Free Full Text].
|
| 62.
|
Silhavy, T. J.,
M. L. Berman, and L. W. Enquist.
1984.
Experiments with gene fusions.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 63.
|
Srivastava, S.,
S. Wang,
Y. A. Tong,
K. Pirollo, and E. H. Chang.
1993.
Several mutant p53 proteins detected in cancer-prone families with Li-Fraumeni syndrome exhibit transdominant effects on the biochemical properties of the wild-type p53.
Oncogene
8:2449-2456[Medline].
|
| 64.
|
Tada, M.,
S. Sakuma,
R. D. Iggo,
H. Saya,
Y. Sawamura,
T. Fujiwara, and J. A. Roth.
1998.
Monitoring adenoviral p53 transduction efficiency by yeast functional assay.
Gene Ther.
5:339-344[Medline].
|
| 65.
|
Tsutsumi-Ishi, Y.,
A. Tadokoro,
F. Hanaoka, and N. Tsuchida.
1995.
Response of heat shock element within the human HSP70 promoter to mutated p53 genes.
Cell Growth Differ.
6:1-8[Abstract].
|
| 66.
|
Ueba, T.,
T. Nosaka,
J. A. Takahashi,
F. Shibata,
R. Z. Florkiewicz,
B. Vogelstein,
Y. Oda,
H. Kikuchi, and M. Hatanaka.
1994.
Transcriptional regulation of basic fibroblast growth factor gene by p53 in human glioblastoma and hepatocellular carcinoma cells.
Proc. Natl. Acad. Sci. USA
91:9009-9013[Abstract/Free Full Text].
|
| 67.
|
Unger, T.,
J. A. Mietz,
M. Scheffner,
C. L. Yee, and P. M. Howley.
1993.
Functional domains of wild-type and mutant p53 proteins involved in transcriptional regulation, transdominant inhibition, and transformation suppression.
Mol. Cell. Biol.
13:5186-5194[Abstract/Free Full Text].
|
| 68.
|
Unger, T.,
M. M. Nau,
S. Segal, and J. D. Minna.
1992.
p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer.
EMBO J.
11:1383-1390[Medline].
|
| 69.
|
Vogelstein, B., and K. W. Kinzler.
1992.
p53 function and dysfunction.
Cell
70:523-526[Medline].
|
| 70.
|
Walker, K. K., and A. J. Levine.
1996.
Identification of a novel p53 functional domain that is necessary for efficient growth suppression.
Proc. Natl. Acad. Sci. USA
93:15335-15340[Abstract/Free Full Text].
|
| 71.
|
Wang, Y.,
M. Reed,
P. Wang,
J. E. Stenger,
G. Mayr,
M. E. Anderson,
J. F. Schwedes, and P. Tegtmeyer.
1993.
p53 domains: identification and characterization of two autonomous DNA-binding regions.
Genes Dev.
7:2575-2586[Abstract/Free Full Text].
|
| 72.
|
Yang, A.,
M. Kaghad,
Y. Wang,
E. Gillett,
M. D. Fleming,
V. Dotsch,
N. C. Andrews,
D. Caput, and F. McKeon.
1998.
p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities.
Mol. Cell
2:305-316[Medline].
|
Molecular and Cellular Biology, February 1999, p. 1438-1449, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Huang, Y.-F., Chang, M. D.-T., Shieh, S.-Y.
(2009). TTK/hMps1 Mediates the p53-Dependent Postmitotic Checkpoint by Phosphorylating p53 at Thr18. Mol. Cell. Biol.
29: 2935-2944
[Abstract]
[Full Text]
-
Nyman, U., Vlachos, P., Cascante, A., Hermanson, O., Zhivotovsky, B., Joseph, B.
(2009). Protein Kinase C-Dependent Phosphorylation Regulates the Cell Cycle-Inhibitory Function of the p73 Carboxy Terminus Transactivation Domain. Mol. Cell. Biol.
29: 1814-1825
[Abstract]
[Full Text]
-
Rosenbluth, J. M., Pietenpol, J. A.
(2008). The jury is in: p73 is a tumor suppressor after all. Genes Dev.
22: 2591-2595
[Abstract]
[Full Text]
-
Tozluoglu, M., Karaca, E., Haliloglu, T., Nussinov, R.
(2008). Cataloging and organizing p73 interactions in cell cycle arrest and apoptosis. Nucleic Acids Res
36: 5033-5049
[Abstract]
[Full Text]
-
Jegga, A. G., Inga, A., Menendez, D., Aronow, B. J., Resnick, M. A.
(2008). Functional evolution of the p53 regulatory network through its target response elements. Proc. Natl. Acad. Sci. USA
105: 944-949
[Abstract]
[Full Text]
-
Kommagani, R., Payal, V., Kadakia, M. P.
(2007). Differential Regulation of Vitamin D Receptor (VDR) by the p53 Family: p73-DEPENDENT INDUCTION OF VDR UPON DNA DAMAGE. J. Biol. Chem.
282: 29847-29854
[Abstract]
[Full Text]
-
Lind, H., Ekstrom, P. O., Ryberg, D., Skaug, V., Andreassen, T., Stangeland, L., Haugen, A., Zienolddiny, S.
(2007). Frequency of TP53 Mutations in Relation to Arg72Pro Genotypes in Non Small Cell Lung Cancer. Cancer Epidemiol. Biomarkers Prev.
16: 2077-2081
[Abstract]
[Full Text]
-
Thottassery, J. V., Westbrook, L., Someya, H., Parker, W. B.
(2006). c-Abl-independent p73 stabilization during gemcitabine- or 4'-thio-{beta}-D-arabinofuranosylcytosine-induced apoptosis in wild-type and p53-null colorectal cancer cells.. Molecular Cancer Therapeutics
5: 400-410
[Abstract]
[Full Text]
-
Concin, N., Hofstetter, G., Berger, A., Gehmacher, A., Reimer, D., Watrowski, R., Tong, D., Schuster, E., Hefler, L., Heim, K., Mueller-Holzner, E., Marth, C., Moll, U. M., Zeimet, A. G., Zeillinger, R.
(2005). Clinical Relevance of Dominant-Negative p73 Isoforms for Responsiveness to Chemotherapy and Survival in Ovarian Cancer: Evidence for a Crucial p53-p73 Cross-talk In vivo. Clin. Cancer Res.
11: 8372-8383
[Abstract]
[Full Text]
-
Cui, R., Nguyen, T. T., Taube, J. H., Stratton, S. A., Feuerman, M. H., Barton, M. C.
(2005). Family Members p53 and p73 Act Together in Chromatin Modification and Direct Repression of {alpha}-Fetoprotein Transcription. J. Biol. Chem.
280: 39152-39160
[Abstract]
[Full Text]
-
Nyman, U., Sobczak-Pluta, A., Vlachos, P., Perlmann, T., Zhivotovsky, B., Joseph, B.
(2005). Full-length p73{alpha} Represses Drug-induced Apoptosis in Small Cell Lung Carcinoma Cells. J. Biol. Chem.
280: 34159-34169
[Abstract]
[Full Text]
-
Vikhanskaya, F., Siddique, M. M., Kei Lee, M., Broggini, M., Sabapathy, K.
(2005). Evaluation of the Combined Effect of p53 Codon 72 Polymorphism and Hotspot Mutations in Response to Anticancer Drugs. Clin. Cancer Res.
11: 4348-4356
[Abstract]
[Full Text]
-
Hanamoto, T., Ozaki, T., Furuya, K., Hosoda, M., Hayashi, S., Nakanishi, M., Yamamoto, H., Kikuchi, H., Todo, S., Nakagawara, A.
(2005). Identification of Protein Kinase A Catalytic Subunit {beta} as a Novel Binding Partner of p73 and Regulation of p73 Function. J. Biol. Chem.
280: 16665-16675
[Abstract]
[Full Text]
-
Ou, Y.-H., Chung, P.-H., Sun, T.-P., Shieh, S.-Y.
(2005). p53 C-Terminal Phosphorylation by CHK1 and CHK2 Participates in the Regulation of DNA-Damage-induced C-Terminal Acetylation. Mol. Biol. Cell
16: 1684-1695
[Abstract]
[Full Text]
-
Li, C.-Y., Zhu, J., Wang, J. Y. J.
(2005). Ectopic Expression of p73{alpha}, but Not p73{beta}, Suppresses Myogenic Differentiation. J. Biol. Chem.
280: 2159-2164
[Abstract]
[Full Text]
-
Weisz, L., Zalcenstein, A., Stambolsky, P., Cohen, Y., Goldfinger, N., Oren, M., Rotter, V.
(2004). Transactivation of the EGR1 Gene Contributes to Mutant p53 Gain of Function. Cancer Res.
64: 8318-8327
[Abstract]
[Full Text]
-
Scheckenbach, K., Lieven, O., Gotte, K., Bockmuhl, U., Zotz, R., Bier, H., Balz, V.
(2004). p53 Codon 72 Polymorphic Variants, Loss of Allele-Specific Transcription, and Human Papilloma Virus 16 and/or 18 E6 Messenger RNA Expression in Squamous Cell Carcinomas of the Head and Neck. Cancer Epidemiol. Biomarkers Prev.
13: 1805-1809
[Abstract]
[Full Text]
-
Yap, D. B. S., Hsieh, J.-K., Zhong, S., Heath, V., Gusterson, B., Crook, T., Lu, X.
(2004). Ser392 Phosphorylation Regulates the Oncogenic Function of Mutant p53. Cancer Res.
64: 4749-4754
[Abstract]
[Full Text]
-
Moll, U. M., Slade, N.
(2004). p63 and p73: Roles in Development and Tumor Formation. Mol Cancer Res
2: 371-386
[Abstract]
[Full Text]
-
Chen, H.-H., Wang, D. L.
(2004). Nitric Oxide Inhibits Matrix Metalloproteinase-2 Expression via the Induction of Activating Transcription Factor 3 in Endothelial Cells. Mol. Pharmacol.
65: 1130-1140
[Abstract]
[Full Text]
-
Melino, G., Bernassola, F., Ranalli, M., Yee, K., Zong, W. X., Corazzari, M., Knight, R. A., Green, D. R., Thompson, C., Vousden, K. H.
(2004). p73 Induces Apoptosis via PUMA Transactivation and Bax Mitochondrial Translocation. J. Biol. Chem.
279: 8076-8083
[Abstract]
[Full Text]
-
Fulco, M., Costanzo, A., Merlo, P., Mangiacasale, R., Strano, S., Blandino, G., Balsano, C., Lavia, P., Levrero, M.
(2003). p73 Is Regulated by Phosphorylation at the G2/M Transition. J. Biol. Chem.
278: 49196-49202
[Abstract]
[Full Text]
-
Barrera, F. N., Poveda, J. A., Gonzalez-Ros, J. M., Neira, J. L.
(2003). Binding of the C-terminal Sterile {alpha} Motif (SAM) Domain of Human p73 to Lipid Membranes. J. Biol. Chem.
278: 46878-46885
[Abstract]
[Full Text]
-
Gonzalez, S., Prives, C., Cordon-Cardo, C.
(2003). p73{alpha} Regulation by Chk1 in Response to DNA Damage. Mol. Cell. Biol.
23: 8161-8171
[Abstract]
[Full Text]
-
Puig, P., Capodieci, P., Drobnjak, M., Verbel, D., Prives, C., Cordon-Cardo, C., Di Como, C. J.
(2003). p73 Expression in Human Normal and Tumor Tissues: Loss of p73{alpha} Expression Is Associated with Tumor Progression in Bladder Cancer. Clin. Cancer Res.
9: 5642-5651
[Abstract]
[Full Text]
-
Hann, B., Balmain, A.
(2003). Replication of an E1B 55-Kilodalton Protein-Deficient Adenovirus (ONYX-015) Is Restored by Gain-of-Function Rather than Loss-of-Function p53 Mutants. J. Virol.
77: 11588-11595
[Abstract]
[Full Text]
-
Ben-Yehoyada, M., Ben-Dor, I., Shaul, Y.
(2003). c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association. J. Biol. Chem.
278: 34475-34482
[Abstract]
[Full Text]
-
Gaiddon, C., Lokshin, M., Gross, I., Levasseur, D., Taya, Y., Loeffler, J.-P., Prives, C.
(2003). Cyclin-dependent Kinases Phosphorylate p73 at Threonine 86 in a Cell Cycle-dependent Manner and Negatively Regulate p73. J. Biol. Chem.
278: 27421-27431
[Abstract]
[Full Text]
-
Kaye, F. J., Komiya, T.
(2003). New Leads Suggest a Clinically Relevant Genotype-Phenotype Relationship for the p53 Gene. JNCI J Natl Cancer Inst
95: 926-927
[Full Text]
-
Stiewe, T., Stanelle, J., Theseling, C. C., Pollmeier, B., Beitzinger, M., Putzer, B. M.
(2003). Inactivation of Retinoblastoma (RB) Tumor Suppressor by Oncogenic Isoforms of the p53 Family Member p73. J. Biol. Chem.
278: 14230-14236
[Abstract]
[Full Text]
-
Bensaad, K., Le Bras, M., Unsal, K., Strano, S., Blandino, G., Tominaga, O., Rouillard, D., Soussi, T.
(2003). Change of Conformation of the DNA-binding Domain of p53 Is the Only Key Element for Binding of and Interference with p73. J. Biol. Chem.
278: 10546-10555
[Abstract]
[Full Text]
-
Koivusalo, R., Krausz, E., Ruotsalainen, P., Helenius, H., Hietanen, S.
(2002). Chemoradiation of Cervical Cancer Cells: Targeting Human Papillomavirus E6 and p53 Leads to Either Augmented or Attenuated Apoptosis Depending on the Platinum Carrier Ligand. Cancer Res.
62: 7364-7371
[Abstract]
[Full Text]
-
Langerod, A., Bukholm, I. R. K., Bregard, A., Lonning, P. E., Andersen, T. I., Rognum, T. O., Meling, G. I., Lothe, R. A., Borresen-Dale, A.-L.
(2002). The TP53 Codon 72 Polymorphism May Affect the Function of TP53 Mutations in Breast Carcinomas but not in Colorectal Carcinomas. Cancer Epidemiol. Biomarkers Prev.
11: 1684-1688
[Abstract]
[Full Text]
-
Martinez, L. A., Naguibneva, I., Lehrmann, H., Vervisch, A., Tchenio, T., Lozano, G., Harel-Bellan, A.
(2002). Synthetic small inhibiting RNAs: Efficient tools to inactivate oncogenic mutations and restore p53 pathways. Proc. Natl. Acad. Sci. USA
99: 14849-14854
[Abstract]
[Full Text]
-
Fontemaggi, G., Kela, I., Amariglio, N., Rechavi, G., Krishnamurthy, J., Strano, S., Sacchi, A., Givol, D., Blandino, G.
(2002). Identification of Direct p73 Target Genes Combining DNA Microarray and Chromatin Immunoprecipitation Analyses. J. Biol. Chem.
277: 43359-43368
[Abstract]
[Full Text]
-
Hackzell, A., Uramoto, H., Izumi, H., Kohno, K., Funa, K.
(2002). p73 Independent of c-Myc Represses Transcription of Platelet-derived Growth Factor beta -Receptor through Interaction with NF-Y. J. Biol. Chem.
277: 39769-39776
[Abstract]
[Full Text]
-
Urist, M. J., Di Como, C. J., Lu, M.-L., Charytonowicz, E., Verbel, D., Crum, C. P., Ince, T. A., McKeon, F. D., Cordon-Cardo, C.
(2002). Loss of p63 Expression Is Associated with Tumor Progression in Bladder Cancer. Am. J. Pathol.
161: 1199-1206
[Abstract]
[Full Text]
-
Zaika, A. I., Slade, N., Erster, S. H., Sansome, C., Joseph, T. W., Pearl, M., Chalas, E., Moll, U. M.
(2002). {Delta}Np73, A Dominant-Negative Inhibitor of Wild-type p53 and TAp73, Is Up-regulated in Human Tumors. JEM
196: 765-780
[Abstract]
[Full Text]
-
Strano, S., Fontemaggi, G., Costanzo, A., Rizzo, M. G., Monti, O., Baccarini, A., Del Sal, G., Levrero, M., Sacchi, A., Oren, M., Blandino, G.
(2002). Physical Interaction with Human Tumor-derived p53 Mutants Inhibits p63 Activities. J. Biol. Chem.
277: 18817-18826
[Abstract]
[Full Text]
-
Watanabe, K.-i., Ozaki, T., Nakagawa, T., Miyazaki, K., Takahashi, M., Hosoda, M., Hayashi, S., Todo, S., Nakagawara, A.
(2002). Physical Interaction of p73 with c-Myc and MM1, a c-Myc-binding Protein, and Modulation of the p73 Function. J. Biol. Chem.
277: 15113-15123
[Abstract]
[Full Text]
-
Nakagawa, T., Takahashi, M., Ozaki, T., Watanabe, K.-i., Todo, S., Mizuguchi, H., Hayakawa, T., Nakagawara, A.
(2002). Autoinhibitory Regulation of p73 by {Delta}Np73 To Modulate Cell Survival and Death through a p73-Specific Target Element within the {Delta}Np73 Promoter. Mol. Cell. Biol.
22: 2575-2585
[Abstract]
[Full Text]
-
Stiewe, T., Theseling, C. C., Putzer, B. M.
(2002). Transactivation-deficient Delta TA-p73 Inhibits p53 by Direct Competition for DNA Binding. IMPLICATIONS FOR TUMORIGENESIS. J. Biol. Chem.
277: 14177-14185
[Abstract]
[Full Text]
-
Balint, E., Phillips, A. C., Kozlov, S., Stewart, C. L., Vousden, K. H.
(2002). Induction of p57KIP2 expression by p73beta. Proc. Natl. Acad. Sci. USA
99: 3529-3534
[Abstract]
[Full Text]
-
Stros, M., Ozaki, T., Bacikova, A., Kageyama, H., Nakagawara, A.
(2002). HMGB1 and HMGB2 Cell-specifically Down-regulate the p53- and p73-dependent Sequence-specific Transactivation from the Human Bax Gene Promoter. J. Biol. Chem.
277: 7157-7164
[Abstract]
[Full Text]
-
Ishimoto, O., Kawahara, C., Enjo, K., Obinata, M., Nukiwa, T., Ikawa, S.
(2002). Possible Oncogenic Potential of {Delta}Np73: A Newly Identified Isoform of Human p73. Cancer Res.
62: 636-641
[Abstract]
[Full Text]
-
Douc-Rasy, S., Barrois, M., Echeynne, M., Kaghad, M., Blanc, E., Raguenez, G., Goldschneider, D., Terrier-Lacombe, M.-J., Hartmann, O., Moll, U., Caput, D., Benard, J.
(2002). {Delta}N-p73{alpha} Accumulates in Human Neuroblastic Tumors. Am. J. Pathol.
160: 631-639
[Abstract]
[Full Text]
-
Sasaki, Y., Ishida, S., Morimoto, I., Yamashita, T., Kojima, T., Kihara, C., Tanaka, T., Imai, K., Nakamura, Y., Tokino, T.
(2002). The p53 Family Member Genes Are Involved in the Notch Signal Pathway. J. Biol. Chem.
277: 719-724
[Abstract]
[Full Text]
-
Hall, P A, Woodman, A C, Campbell, S J, Shepherd, N A
(2001). Expression of the p53 homologue p63{alpha} and {Delta}Np63{alpha} in the neoplastic sequence of Barrett's oesophagus: correlation with morphology and p53 protein. Gut
49: 618-623
[Abstract]
[Full Text]
-
Park, C., Lee, I., Kang, W. K.
(2001). Lovastatin-induced E2F-1 modulation and its effect on prostate cancer cell death. Carcinogenesis
22: 1727-1731
[Abstract]
[Full Text]
-
Irwin, M. S., Kaelin, W. G.
(2001). p53 Family Update: p73 and p63 Develop Their Own Identities. Cell Growth Differ.
12: 337-349
[Full Text]
-
El-Naggar, A. K., Lai, S., Clayman, G. L., Mims, B., Lippman, S. M., Coombes, M., Luna, M. A., Lozano, G.
(2001). p73 gene alterations and expression in primary oral and laryngeal squamous carcinomas. Carcinogenesis
22: 729-735
[Abstract]
[Full Text]
-
Gaiddon, C., Lokshin, M., Ahn, J., Zhang, T., Prives, C.
(2001). A Subset of Tumor-Derived Mutant Forms of p53 Down-Regulate p63 and p73 through a Direct Interaction with the p53 Core Domain. Mol. Cell. Biol.
21: 1874-1887
[Abstract]
[Full Text]
-
Ratovitski, E. A., Patturajan, M., Hibi, K., Trink, B., Yamaguchi, K., Sidransky, D.
(2001). p53 associates with and targets Delta Np63 into a protein degradation pathway. Proc. Natl. Acad. Sci. USA
98: 1817-1822
[Abstract]
[Full Text]
-
Wang, X. Q., Ongkeko, W. M., Lau, A. W. S., Leung, K. M., Poon, R. Y. C.
(2001). A Possible Role of p73 on the Modulation of p53 Level through MDM2. Cancer Res.
61: 1598-1603
[Abstract]
[Full Text]
-
Porrello, A., Cerone, M. A., Coen, S., Gurtner, A., Fontemaggi, G., Cimino, L., Piaggio, G., Sacchi, A., Soddu, S.
(2000). P53 Regulates Myogenesis by Triggering the Differentiation Activity of Prb. JCB
151: 1295-1304
[Abstract]
[Full Text]
-
Sigal, A., Rotter, V.
(2000). Oncogenic Mutations of the p53 Tumor Suppressor: The Demons of the Guardian of the Genome. Cancer Res.
60: 6788-6793
[Abstract]
[Full Text]
-
Brooks, L. A., Tidy, J. A., Gusterson, B., Hiller, L., ONions, J., Gasco, M., Marin, M. C., Farrell, P. J., Kaelin, W. G. Jr., Crook, T.
(2000). Preferential Retention of Codon 72 Arginine p53 in Squamous Cell Carcinomas of the Vulva Occurs in Cancers Positive and Negative for Human Papillomavirus. Cancer Res.
60: 6875-6877
[Abstract]
[Full Text]
-
MURPHY, K. L., DENNIS, A. P., ROSEN, J. M.
(2000). A gain of function p53 mutant promotes both genomic instability and cell survival in a novel p53-null mammary epithelial cell model. FASEB J.
14: 2291-2302
[Abstract]
[Full Text]
-
Zhu, J., Chen, X.
(2000). MCG10, a Novel p53 Target Gene That Encodes a KH Domain RNA-Binding Protein, Is Capable of Inducing Apoptosis and Cell Cycle Arrest in G2-M. Mol. Cell. Biol.
20: 5602-5618
[Abstract]
[Full Text]
-
Scharnhorst, V., Dekker, P., van der Eb, A. J., Jochemsen, A. G.
(2000). Physical Interaction between Wilms Tumor 1 and p73 Proteins Modulates Their Functions. J. Biol. Chem.
275: 10202-10211
[Abstract]
[Full Text]
-
Wade, M., Allday, M. J.
(2000). Epstein-Barr Virus Suppresses a G2/M Checkpoint Activated by Genotoxins. Mol. Cell. Biol.
20: 1344-1360
[Abstract]
[Full Text]
-
Levrero, M, De Laurenzi, V, Costanzo, A, Gong, J, Wang, J., Melino, G
(2000). The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J. Cell Sci.
113: 1661-1670
[Abstract]
-
Ozaki, T., Naka, M., Takada, N., Tada, M., Sakiyama, S., Nakagawara, A.
(1999). Deletion of the COOH-Terminal Region of p73{{alpha}} Enhances Both Its Transactivation Function and DNA-binding Activity but Inhibits Induction of Apoptosis in Mammalian Cells. Cancer Res.
59: 5902-5907
[Abstract]
[Full Text]
-
Fang, L., Lee, S. W., Aaronson, S. A.
(1999). Comparative Analysis of P73 and P53 Regulation and Effector Functions. JCB
147: 823-830
[Abstract]
[Full Text]
-
Marutani, M., Tonoki, H., Tada, M., Takahashi, M., Kashiwazaki, H., Hida, Y., Hamada, J.-i., Asaka, M., Moriuchi, T.
(1999). Dominant-Negative Mutations of the Tumor Suppressor p53 Relating to Early Onset of Glioblastoma Multiforme. Cancer Res.
59: 4765-4769
[Abstract]
[Full Text]
-
Peters, U. R., Tschan, M. P., Kreuzer, K. A., Baskaynak, G., Lass, U., Tobler, A., Fey, M. F., Schmidt, C. A.
(1999). Distinct Expression Patterns of the p53-Homologue p73 in Malignant and Normal Hematopoiesis Assessed by a Novel Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Protein Analysis. Cancer Res.
59: 4233-4236
[Abstract]
[Full Text]
-
Kawano, S., Miller, C. W., Gombart, A. F., Bartram, C. R., Matsuo, Y., Asou, H., Sakashita, A., Said, J., Tatsumi, E., Koeffler, H. P.
(1999). Loss of p73 Gene Expression in Leukemias/Lymphomas Due to Hypermethylation. Blood
94: 1113-1120
[Abstract]
[Full Text]
-
Zaika, A. I., Kovalev, S., Marchenko, N. D., Moll, U. M.
(1999). Overexpression of the Wild Type p73 Gene in Breast Cancer Tissues and Cell Lines. Cancer Res.
59: 3257-3263
[Abstract]
[Full Text]
-
Davison, T. S., Vagner, C., Kaghad, M., Ayed, A., Caput, D., Arrowsmith, C. H.
(1999). p73 and p63 Are Homotetramers Capable of Weak Heterotypic Interactions with Each Other but Not with p53. J. Biol. Chem.
274: 18709-18714
[Abstract]
[Full Text]
-
Shimada, A., Kato, S., Enjo, K., Osada, M., Ikawa, Y., Kohno, K., Obinata, M., Kanamaru, R., Ikawa, S., Ishioka, C.
(1999). The Transcriptional Activities of p53 and Its Homologue p51/p63: Similaritiesand Differences. Cancer Res.
59: 2781-2786
[Abstract]
[Full Text]
-
Ruiz-Lozano, P., Hixon, M. L., Wagner, M. W., Flores, A. I., Ikawa, S., Baldwin, A. S. Jr., Chien, K. R., Gualberto, A.
(1999). p53 Is a Transcriptional Activator of the Muscle-specific Phosphoglycerate Mutase Gene and Contributesin Vivo to the Control of Its Cardiac Expression. Cell Growth Differ.
10: 295-306
[Abstract]
[Full Text]
-
Zeng, X., Lee, H., Zhang, Q., Lu, H.
(2001). p300 Does Not Require Its Acetylase Activity to Stimulate p73 Function. J. Biol. Chem.
276: 48-52
[Abstract]
[Full Text]
-
Strano, S., Munarriz, E., Rossi, M., Cristofanelli, B., Shaul, Y., Castagnoli, L., Levine, A. J., Sacchi, A., Cesareni, G., Oren, M., Blandino, G.
(2000). Physical and Functional Interaction between p53 Mutants and Different Isoforms of p73. J. Biol. Chem.
275: 29503-29512
[Abstract]
[Full Text]
-
Zaika, A., Irwin, M., Sansome, C., Moll, U. M.
(2001). Oncogenes Induce and Activate Endogenous p73 Protein. J. Biol. Chem.
276: 11310-11316
[Abstract]
[Full Text]
-
Strano, S., Munarriz, E., Rossi, M., Castagnoli, L., Shaul, Y., Sacchi, A., Oren, M., Sudol, M., Cesareni, G., Blandino, G.
(2001). Physical Interaction with Yes-associated Protein Enhances p73 Transcriptional Activity. J. Biol. Chem.
276: 15164-15173
[Abstract]
[Full Text]
-
Lemasson, I., Nyborg, J. K.
(2001). Human T-cell Leukemia Virus Type I Tax Repression of p73beta Is Mediated through Competition for the C/H1 Domain of CBP. J. Biol. Chem.
276: 15720-15727
[Abstract]
[Full Text]
-
Klein, C., Georges, G., Kunkele, K.-P., Huber, R., Engh, R. A., Hansen, S.
(2001). High Thermostability and Lack of Cooperative DNA Binding Distinguish the p63 Core Domain from the Homologous Tumor Suppressor p53. J. Biol. Chem.
276: 37390-37401
[Abstract]
[Full Text]