Previous Article | Next Article 
Molecular and Cellular Biology, February 1999, p. 1486-1497, Vol. 19, No. 2
0270-7306/99/$00.00+0
Transcription-Dependent Nuclear-Cytoplasmic Trafficking Is
Required for the Function of the von Hippel-Lindau Tumor
Suppressor Protein
Stephen
Lee,1,*
Markus
Neumann,2,
Robert
Stearman,1
Roland
Stauber,2
Arnim
Pause,1
George N.
Pavlakis,2 and
Richard
D.
Klausner1,3
Cell Biology and Metabolism Branch, National
Institute of Child Health and Human
Development,1 and
Office of the
Director, National Cancer Institute,3 National
Institutes of Health, Bethesda, Maryland 20892, and
NCI-Frederick Cancer Research Development Center, ABL-Basic
Research Program, Frederick, Maryland 217022
Received 12 August 1998/Returned for modification 4 September
1998/Accepted 16 November 1998
 |
ABSTRACT |
Mutation of the von Hippel-Lindau tumor suppressor gene
(vhl) causes the von Hippel-Lindau cancer syndrome
as well as sporadic renal clear cell carcinoma. To pursue our study of
the intracellular localization of VHL protein in relation to its
function, we fused VHL to the green fluorescent protein (GFP) to
produce the VHL-GFP fusion protein. Like VHL, VHL-GFP binds to
elongins B and C and Cullin-2 and regulates target gene product levels,
including levels of vascular endothelial growth factor and glucose
transporter 1. VHL-GFP localizes predominantly to the cytoplasm, with
some detectable nuclear signal. Inhibition of transcription by
actinomycin D or 5,6-dichlorobenzimidazole riboside (DRB) causes VHL to
be redistributed to the nucleus. A cellular fusion assay was used to
demonstrate that inhibition of transcription induces a decrease in the
nuclear export rate of VHL. The dependence of transcription for
trafficking is lost with a deletion of exon 2, a region with a mutation
causing a splice defect in the VHL gene in sporadic renal clear cell
carcinoma. Addition of a strong nuclear export signal (NES) derived
from the Rev protein results in complete nuclear exclusion and
abrogates the redistribution of VHL-GFP-NES into the nucleus upon
inhibition of transcription. Leptomycin B, which inhibits NES-mediated
nuclear export, reverts the distribution of VHL-GFP-NES to that of
VHL-GFP and restores sensitivity to actinomycin D and DRB. Uncoupling
of VHL-GFP trafficking to transcription either by an exon 2 deletion or
fusion to NES abolishes VHL function. We suggest that VHL function
requires not only nuclear or cytoplasmic localization, but also exon
2-mediated transcription-dependent trafficking between these two
cellular compartments.
 |
INTRODUCTION |
The von Hippel-Lindau gene
(vhl) was identified in 1993 as a tumor suppressor gene
whose germ line mutations are associated with the inherited von
Hippel-Lindau cancer syndrome (22, 28, 30, 34). This
disorder is characterized by development of multiple benign and
malignant tumors in many organs, including the kidneys, retina, central
nervous system, pancreas, and adrenal gland (5, 8, 17, 38,
65). Further genetic analysis has revealed that the VHL gene is
clearly inactivated in over 80% of sporadic renal clear cell
carcinomas (RCC), the most frequent form of kidney cancer (14, 18,
21, 59).
The VHL gene, which contains three exons, codes for a 213-amino-acid
protein of 25 kDa with no similarity to other known proteins, thus
giving no clues about its function. Immunoprecipitation experiments have shown that VHL forms a stable heterotetrameric complex with elongins B and C as well as human Cullin-2 (VHL-elongin BC-Hs-Cul-2) (2, 9, 10, 25, 36, 51). Two of these proteins, elongin C and
Hs-Cul-2, share structural homology with yeast (Saccharomyces cerevisiae) SKP1 and Cdc53, respectively (3, 26, 39,
67). SKP1 and Cdc53 are part of a complex that is involved in the
targeting of pro teins for ubiquitination. Studies of the
effect of reintroduction of VHL in VHL-negative RCC have indicated that
it may play a role in the posttranscription regulation of the stability
of a specific class of mRNAs that include vascular endothelial growth
factor (VEGF), glucose transporter 1 (Glut-1), and other mRNAs
(19, 24, 27, 36, 58). It has been suggested that the
VHL-elongin BC-Hs-Cul-2 complex may target ubiquitination proteins
involved in the regulation of the stability of VEGF and other mRNAs
(36). There are several naturally occurring mutations in VHL
patients within exon 3 that abrogate assembly with elongins B and C and Hs-Cul-2, suggesting a functional role for this complex (36, 51). However, most inactivating point mutations in sporadic RCC
lie outside of the elongin BC-Hs-Cul-2 binding domain, suggesting that these sequences code for VHL tumor suppression functions which are still unknown.
Very little is known about the regulatory mechanisms underlying VHL
cellular functions. In an attempt to answer these questions, we and
others have studied the intracellular localization by indirect immunofluorescence or immunochemistry and have shown that VHL localizes
predominantly to the cytoplasm, with some detectable nuclear signal
(7, 9, 23, 31, 37, 64). Several proteins differentially
localize between the nucleus and the cytoplasm, some of which require
continuous nuclear-cytoplasmic shuttling to achieve their cellular
functions (48, 52-54, 56, 70). This prompted us to
hypothesize that VHL may need to traffic between the nucleus and the
cytoplasm to perform its functions. We also reasoned that because VHL
has been linked to the posttranscriptional regulation of specific
mRNAs, ongoing transcription might be required for the shuttling
process to occur.
We decided to further examine these possibilities by fusing VHL to
green fluorescent protein (GFP) to form the hybrid protein VHL-GFP.
Fusion to GFP enables detection in living cells without requiring
fixation, antibodies, and permeabilization, all sources of common
artifacts (35, 63). We report here that VHL-GFP reproduces
the known biochemical, functional, and cellular localization characteristics of VHL. VHL-GFP can be detected predominantly in the
cytoplasm, with some nuclear signal in all cell lines studied, regardless of expression levels. We present evidence that VHL-GFP participates in a dynamic RNA polymerase II transcription-dependent shuttling process between the cytoplasm and the nucleus.
Transcription-dependent trafficking is mediated by sequences encoded by
exon 2, which is the site of frequent mutation in human RCC. Uncoupling
of transcription dependence to VHL-GFP localization and
trafficking, either by an exon 2 deletion or fusion to a strong nuclear
export signal (NES) such as Rev NES, disrupts VHL
function. These results support a model in which VHL-GFP requires
transcription-dependent nuclear-cytoplasmic shuttling to perform its functions.
 |
MATERIALS AND METHODS |
Cell culture.
The 786-0 (VHL-negative) renal carcinoma
cells, Cos-7 African green monkey kidney cells, and HeLa cells were
obtained from the American Type Culture Collection (Rockville, Md.).
All cells were maintained in Dulbecco's modified Eagle's medium
(DMEM) supplemented with 10% (vol/vol) fetal calf serum (FCS) in a
37°C, humidified, 5% CO2-containing-atmosphere incubator.
Expression vectors.
The human VHL cDNA, which codes for a
213-amino-acid VHL protein, was subcloned into either pcDNA3.1(
)
(Invitrogen), the retrovirus pHIT111 (kindly provided by A. Kingsman),
or pSX, a modified version of the mammalian expression vector
pCDL-SR
(9). A Flag (F) epitope tag (DYKDDDDK) or a
hemagglutinin (HA) epitope was added to the N terminus of the VHL cDNA
open reading frame to produce the FVHL or HA-VHL
construct, respectively. A cDNA coding for an enhanced fluorescence
version (Fred25) (63) of the GFP was subcloned at the C
terminus of FVHL to produce the FVHL-GFP fusion protein. The VHL
version without the Flag epitope tag was also cloned into the three
vectors to produce the VHL-GFP fusion protein. Deletion mutants were
produced by the PCR and cloned between the Flag tag and GFP to replace
the wild-type VHL cDNA. The deletion mutants are referred to as
N
for N-terminal truncations,
C for C-terminal truncations, and
for internal truncations. FVHL-GFP-NES and FVHL-GFP-NESM fusions were
produced by fusion of FVHL-GFP at its C terminus to the strong NES of
HIV Rev, LPPLERLTL (NES) (11), or to a mutated form of NES
(NESM), LPPAERATL (underlining indicates
mutated amino acids). All constructs were verified by standard DNA sequencing.
Transfections and establishment of stable 786-0 cell lines.
Stable cell lines were established by different strategies. First, a
transient three-plasmid system was used to produce high-titer stocks of
pHITVHL-GFP, a VHL-GFP-producing retrovirus vector derived from pHIT
(60). Briefly, 293T cells were cotransfected with 3.4 µg
of pHIT60 (Moloney murine leukemia virus gag-pol
expression), 0.2 µg of pHCMV-G (vesicular stomatitis virus G
protein), and 14.2 µg of pHITVHL-GFP per 60-mm-diameter petri dish by
the calcium phosphate coprecipitation method. The medium (DMEM with
10% FCS) was changed after 10 h. Supernatant was harvested
48 h posttransfection, filtered (0.45-µm pore diameter), and
frozen at
80°C. A virus titer of >1 × 107
infectious particles/ml was obtained. For infection, 4 × 105 786-0 cells were plated in a 60-mm-diameter petri dish.
After 12 h, cells were washed and incubated with 2 ml of the virus
stock, including 16 µl of Polybrene (1 mg/ml) for 2 h. Three
milliliters of DMEM (10% fetal calf serum [FCS]) was added. After
24 h, cells were washed, trypsinized, and plated in a
75-cm2 cell culture flask. On the fourth day after
infection, cells were incubated under selection with 0.5 mg of G418 per
ml. A noninfected control was put under selection at the same time.
While in the control cells there was extensive cell death after 2 weeks, the infected cells showed no signs of G418-induced death,
indicating a high proportion of transduced cells. Second, 786-0 stable
cell lines expressing FVHL-GFP or mutants cloned into pcDNA3 were also produced by a standard calcium phosphate method followed by G418 selection. Cells positive for FVHL-GFP, VHL-GFP, and VHL-GFP mutants were enriched by fluorescence-activated cell sorting. Cells were trypsinized, resuspended in phenol red-free DMEM containing 2% FCS,
and sorted in a Becton Dickinson FacsStar at 488 nm. The brightest 3%
of the cells were collected and put back into culture. We were able to
obtain stable populations of cells which contained at least 99%
GFP-positive cells by using this approach. Transient transfections were
performed either by the calcium phosphate technique or electroporation
as described elsewhere (31). The 786-0 cells expressing a
VHL cDNA fused to an HA tag (WT-7) were a kind gift from William G. Kaelin, Jr. (Dana-Faber Cancer Institute, Harvard University).
Immunoprecipitation and immunoblotting.
Stable 786-0 cells
or transiently transfected Cos-7 cells were plated overnight in
DMEM-10% FCS. Transfected cells were incubated either with or without
labeling medium, which included DMEM without methionine and cysteine,
10% FCS, and 0.1 mCi of Trans-35S label per ml, for 6 h at 37°C. Cells were lysed in a mixture of 20 mM Tris-HCl (pH 8.0),
137 mM NaCl, 1% Triton X-100, 10% (vol/vol) glycerol, 1 mM
phenylmethylsulfonyl fluoride, 0.5 µg of leupeptin per ml, 1 µg
of aprotinin per ml, 1 mM NaF, and 1 mM sodium orthovanadate. Lysates
were immunoprecipitated with the anti-Flag M2 monoclonal antibody (MAb)
(1 µg/ml), anti-HA MAb (HA-11) (1 µg/ml), or anti-VHL MAb
(PharMingen) (10 µg/ml). Precipitates were washed five times with the
same buffer and analyzed on sodium dodecyl sulfate (SDS)-15%
polyacrylamide gels. For total cell lysates, cells were washed several
times in phosphate-buffered saline (PBS), scraped from the petri
dishes, centrifuged, and resuspended in 4% SDS in PBS (31).
The samples were boiled for 5 min, and the DNA was sheared by passage
of lysates through 19-gauge needles. Protein concentration was
determined by the bicinchoninic acid method (Pierce) and was used
to normalize protein loading in whole-cell immunoblot assay.
RT-PCR.
VEGF mRNA expression level in 786-0 cells was
measured by a quantitative reverse transcription (RT)-PCR approach
(44). Briefly, RNA was isolated and reverse transcribed with
random hexamers and avian myeloblastosis virus reverse transcriptase.
The cDNA was amplified with primers specific for VEGF (VEGF-S,
GAGCCTTGCCTTGCTGCTCT; VEGF-A,
GCACACAGGATGGCTTGAAGATGTAC). The sense primer was
radiolabelled with 32P. After 20 cycles of amplification
with AmpliTaq (Perkin-Elmer), the products were separated on a
denaturing 6% acrylamide-urea sequencing gel. The gel was dried and
exposed on a Phosphoimager screen (Fuji). Signals were quantified on a
FujiBas Phosphoimager. As an internal control for the amount of
RNA, primers for porphobilinogen deaminase (PBGD) were used.
To ensure the linearity of the amplification, three dilutions of the
cDNA were amplified with the VEGF-specific primers. The signal
intensity of the bands was plotted against the dilution, and a linear
regression was determined for each sample. The
r2 values ranged from 0.97 to 0.99, indicating linearity of the amplification reaction.
Fluorescence analysis and image processing.
GFP analysis was
generally performed 16 to 24 h after transient transfection or
plating of stable cell lines. Live-cell image analysis was performed as
described previously (6). Briefly, for each image, data were
collected in a single imaging session with identical filters, exposure,
and illumination settings. Images were manipulated with IPlab Spectrum,
NIH-Image, and Adobe Photoshop software on a Macintosh computer.
Nuclear and cytoplasmic values and the nuclear/cytoplasmic ratio were
measured with IPlab Spectrum as follows. Total cellular signal was
measured by multiplying the area of the cell by the integrated pixel
intensity within the cell and subtracting the background value
(obtained by measuring pixel intensity from a cell-free region of the
image). Nuclear signal was obtained by measuring the pixel intensity in
the nucleus subtracted by the mean background multiplied by the area of
the nucleus. Cytoplasmic signal equals total cellular signal minus nuclear signal. Finally, the nuclear/cytoplasmic ratio was measured by
dividing nuclear signal by cytoplasmic signal. All pixel values were
measured well below the saturation limits, even though some of the
prints may appear saturated by the signals. This is because images
obtained with a slow-scan charge-coupled device (CCD) camera have a
depth of 12 bits. Therefore, every pixel can assume an intensity value
ranging between 0 and 4095. Since current monitor and printing
technology only allows the presentation of 8-bit information (256 gray
values), the 12-bit data have to be assigned to an 8-bit range. In
IPlab Spectrum, this is done by normalization (i.e., defining a minimal
and maximal cutoff value (pixels below are black, pixels above are
white), followed by a contrast enhancement step which favors the pixels
carrying important information. This manipulation does not alter the
original 12-bit data, and quantitations are done with the original
12-bit images. This can lead to a situation in which brighter images
may appear saturated compared to weaker signals, while they are, in
fact, well below saturation levels (e.g., Fig. 4A, donor nucleus
DRB
and +DRB at 10 min).
Polykaryon assay.
HeLa cells were transfected by a standard
calcium phosphate-coprecipitation technique and inspected by 488-nm
fluorescence microscopy for VHL-GFP expression. Usually between 10 and
30% of the cells presented strong fluorescence. The cells were
trypsinized 24 h after transfection and mixed with nontransfected
HeLa cells in a ratio of 1 to 10. The cell mixture was plated at a
concentration of 1.5 × 106 cells per 60-mm-diameter
dish and left overnight for reattachment. Approximately 90% of the
transfected cells reattached under these conditions. The confluent cell
layer was visually inspected for even distribution of GFP-producing
cells surrounded by nontransfected cells. Approximately 30% of
reattached fluorescent cells appeared as doublets, indicating a recent
cell division event. Cells were washed twice with prewarmed PBS and
fused for 2 min by addition of a prewarmed 50% solution of
polyethylene glycol (PEG) 4000 in PBS (Gibco BRL no. 14030-035). PEG
was removed thoroughly by four washes with prewarmed PBS, and the cells
were incubated with warm DMEM (10% FCS plus antibiotics). Cells were
observed under phase-contrast microscopy and scanned for fusion events
involving one donor cell with surrounding acceptor cells. Briefly,
cells were observed on an inverted microscope with indirect
fluorescence equipment (Zeiss Axiovert 135TV). Culture dishes were put
on a heated stage within a mounted controlled-environment chamber
(Zeiss) providing a temperature of 37°C, high humidity, and 5%
CO2. Images of any given field were taken automatically
every few minutes by a computer-controlled, high-resolution, slow-scan
Quantix CCD camera (Photometrics, Tucson, Az.). Care was taken to
integrate individual frames under subsaturating conditions (i.e., with
no pixels reaching an intensity value of 4,095). Frames of such a series were taken with identical integration times, usually between 1 and 3 s/frame at a 2 by 2 binning with an electronic gain of 2. Images
were stored and analyzed on a Macintosh PowerPC 7600 computer with
IPLab Spectrum software (Scanalytics, Vienna, Va.). Frame series were
put together to create quicktime movies of the events. Selected time
points were chosen for quantitation. In some experiments, cells were
stained before fusion with Hoechst 33342 dye (1 µg/ml) for 10 min to
allow identification of acceptor nuclei. Cells were pretreated with
cycloheximide (10 µg/ml, a condition found to completely inhibit
protein synthesis) 2 h before fusion and kept in the presence of
cycloheximide after fusion. DRB was added at 25 µg/ml as indicated.
An example of quantitation is presented in Fig. 4B.
 |
RESULTS |
Function of FVHL-GFP and VHL-GFP fusion proteins.
A
full-length human VHL coding sequence modified by an amino-terminal
Flag (F) epitope tag was fused at the carboxy terminus to a full-length
open reading frame encoding a strong autofluorescing mutant of the GFP
(62) (Fig. 1A). This
construct, termed FVHL-GFP, a fusion protein lacking the amino-terminal
epitope (VHL-GFP), and various VHL mutants fused to GFP were cloned
into several expression vectors (see Materials and Methods). Expression
vectors were transfected into various cell lines, and the proteins
produced were analyzed with functional assays. FVHL-GFP was shown to
assemble with elongins B and C to levels equivalent to those of FVHL,
as demonstrated by immunoprecipitation of transiently transfected Cos-7
cells (Fig. 1B) (2, 9, 10, 25). VHL-negative RCC 786-0 cell
lines stably expressing FVHL-GFP or VHL-GFP were also established by
using retrovirus vectors expressing these fusions. We chose 786-0 RCC,
because one VHL allele is deleted, and the other one codes for a VHL
protein truncated at amino acid 104. This provides a suitable system
with which to study the effect of reintroduction of wild-type VHL in a
VHL-negative background (24, 27, 36, 58).
FVHL-GFP-stably-expressing 786-0 cells were also established by
standard calcium phosphate transfection. The protein product of
FVHL-GFP was of the predicted molecular weight by SDS-polyacrylamide
gel electrophoresis (PAGE) (Fig. 1C). VHL-GFP gave two products
consistent with the alternative use of the first two in-frame
methionines in the predicted VHL open reading frame, a phenomenon
sometimes observed for endogenous VHL (Fig. 1C) (23, 25).
Western blotting with an anti-VHL antibody indicated that VHL-GFP and
FVHL-GFP fusion proteins in the 786-0 stable cell lines accumulated to
levels 1- to 10-fold over those of endogenous VHL detected in different
cell lines, such as HEK293, Cos-7, Jurkat, and HeLa (data not shown).
FVHL-GFP and VHL-GFP coprecipitated similar levels of Hs-Cul-2 (Fig.
1C) compared to an HA-tagged VHL (36, 51), demonstrating
that fusion to GFP did not affect VHL complex formation with the known associated proteins.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Functional comparison of wild-type VHL and VHL linked to
the GFP. (A) Schematic diagram of VHL fusion to the GFP. The VHL cDNA
codes for a 213-amino-acid protein (open box). A Flag-tagged epitope
(F) was fused at the N-terminus (shaded box). The GFP was fused at the
C terminus (black box [not in scale]), resulting in FVHL-GFP. A
version without the Flag tag was also produced (VHL-GFP). (B) FVHL-GFP
assembles with elongins B and C. Cos-7 cells were transfected with 5 µg of plasmid DNA, plated for 16 h, incubated for 6 h in
the presence of [35S]Met, and immunoprecipitated with the
M2 anti-Flag antibody as described in Materials and Methods. Vector,
pSX. (C) FVHL-GFP and VHL-GFP assemble with Hs-Cul-2. Stable
VHL-negative RCC 786-0 cells (786-0) expressing either HA-tagged VHL
(WT-7), Flag-tagged VHL-GFP to force expression from the first
methionine of VHL (FVHL-GFP), or a GFP fusion without the Flag tag
(VHL-GFP) to produce fusion proteins initiated by two methionines were
lysed and immunoprecipitated with a monoclonal anti-VHL antibody.
Precipitated proteins were run on SDS-PAGE (12% polyacrylamide) and
transferred on a nitrocellulose membrane. The membrane was incubated in
the presence of rabbit anti-Hs-Cul-2 (top panel) or rabbit anti-VHL
(bottom panel) antibodies. Notice that FVHL-GFP and VHL-GFP assemble
with Hs-Cul-2, as does HA-VHL (WT-7) (an arrow points at Hs-Cul-2).
FVHL-GFP produces a single protein with a size of approximately 55 kDa,
whereas VHL-GFP produces two proteins presumably initiated from two
methionines, a phenomenon sometimes observed with endogenous VHL and a
VHL cDNA with an epitope tagged at the C terminus (9). (D)
VHL-GFP inhibits the production of VEGF mRNA. RT-PCR was performed as
described in Materials and Methods with primers specific for VEGF mRNA
and PBGD mRNA as a control. Also shown is a quantification of the
VEGF/PBGD signal ratios. RNA, RT-PCR was performed in buffer without
RNA. (E) FVHL-GFP and VHL-GFP downregulate levels of Glut-1 protein.
Total cell extracts obtained from 786-0, WT-7 (expressing HA-VHL),
FVHL-GFP, and VHL-GFP were run on SDS-PAGE (10% polyacrylamide) gel
and transferred to a nitrocellulose membrane, and the membrane was
incubated in the presence of an anti-Glut-1 antibody. Notice the high
levels of Glut-1 in 786-0 cell extract and that FVHL-GFP and VHL-GFP
downregulate Glut-1 levels, as does HA-VHL (WT-7). Blots were also
incubated with actin as a loading control.
|
|
To test the function of FVHL-GFP and VHL-GFP fusion proteins, we
utilized the ability of wild-type VHL to repress levels of VEGF and
Glut-1 when reintroduced in the VHL-negative 786-0 RCC (19, 24,
36, 58). The levels of VEGF mRNA were measured by quantitative
RT-PCR with PBGD mRNA as a control. The 786-0 cells expressing VHL-GFP
showed an approximately 10-fold-lower level of VEGF mRNA compared to
nonexpressing 786-0 RCC cells (Fig. 1D), consistent with previously
published results (19, 24, 27, 36, 58). HA-VHL, FVHL-GFP,
and VHL-GFP were all able to downregulate levels of Glut-1 proteins in
stable RCC 786-0 cells (Fig. 1E) (36). We concluded that the
VHL-GFP fusion proteins are functional and can be used to study the
localization and other properties of VHL.
Intracellular localization of VHL-GFP.
To determine the
intracellular localization of VHL-GFP, we first examined the
distribution of FVHL-GFP and VHL-GFP in stably expressing 786-0 cells.
These cell lines express small amounts of the fusion proteins which are
comparable to those of endogenous VHL in VHL-positive cells. Therefore,
the observed GFP fluorescence is weak and requires sensitive imaging
techniques to be detected. We observed a predominantly
cytoplasmic localization of FVHL-GFP (Fig.
2Aa) and VHL-GFP (Fig. 2Ab). The presence
of VHL-GFP in the nucleus was demonstrated by confocal microscopy (Fig.
2Ac) and detected in the nucleoplasm, excluding the nucleoli. Because of the very low level of expression of the fusion proteins in the
stable cell lines, the autofluorescence of 786-0 cells was readily
detectable as cytoplasmic green or yellow dots and should not be
confused with diffuse distribution of FVHL-GFP and VHL-GFP (Fig. 2Ad).
Flow cytometry and quantitative CCD imaging indicated that a fraction
of cells expressed up to sixfold-less VHL-GFP compared to the mean
average of a stably expressing 786-0 polyclonal population without any
significant difference in the observed cellular distribution.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Cellular localization of VHL-GFP and FVHL-GFP in live
transfected cells. (A) VHL-GFP localizes predominantly to the
cytoplasm, with some nuclear signal in stably expressing RCC 786-0 cells. (a) FVHL-GFP picture obtained by CCD camera. (b) VHL-GFP picture
obtained by CCD camera. (c) VHL-GFP picture obtained by confocal
microscopy. (d) 786-0 not expressing GFP fusion proteins (picture
obtained by CCD camera). (B) FVHL-GFP localize predominantly to the
cytoplasm with some nuclear signal in different transiently
overexpressing cells. Shown are transiently transfected Cos-7, 786-0, and HeLa cells expressing FVHL-GFP and Cos-7 cells expressing FGFP
(without VHL). (C) Quantitative comparison of the nuclear and
cytoplasmic distributions of FVHL-GFP and FGFP in transiently
transfected Cos-7 cells expressing different amounts of the fusion
proteins (total cellular signal). CCD images were quantitated as
described in Materials and Methods. A value of 1 for the total cellular
signal is approximately the same as that for the stable 786-0 cell
lines expressing either FVHL-GFP or VHL-GFP. Notice that VHL restricts
the nuclear accumulation of the reporter GFP regardless of the cellular
expression levels.
|
|
We also wanted to test the cellular distribution of the GFP fusion
proteins in transiently transfected cells expressing higher
levels than
those of the stable cell lines, making the detection
of GFP
fluorescence much easier. Essentially identical patterns
were observed
in transiently transfected Cos-7, 786-0, and HeLa
cells (Fig.
2B), as
well as several other cell lines (data not
shown) expressing from
4-fold-less to 20-fold-higher levels than
those of the stable 786-0 cells, as measured with a CCD camera.
Cos-7 cells (Fig.
2B, FGFP) or
other cell lines (data not shown)
were also transiently transfected
with Flag epitope-tagged GFP
(no VHL sequences). FGFP has a much higher
nuclear/cytoplasmic
ratio than that of the same cells expressing
FVHL-GFP. In Fig.
2C, we compared the nuclear versus cytoplasmic levels
of either
FGFP or FVHL-GFP in relation to the total amount of cellular
signal.
Cells expressing VHL-GFP show a strong cytoplasmic signal
accumulation
compared to cells expressing GFP alone. This is true for
the whole
range of expression levels obtained with transient
transfections.
Thus, the addition of VHL to GFP results in prominent
(but not
complete) exclusion of the chimeric protein from the nucleus.
The predominantly cytoplasmic distribution of VHL-GFP presented
here
reproduces the reported steady-state localization of endogenous
VHL in
kidney cells and of ectopically expressed VHL in cultured
cells
(
7,
9,
23,
31,
37,
64).
Inhibition of transcription redistributes VHL-GFP to the
nucleus.
Several proteins involved in posttranscriptional
regulation of mRNA shuttle in a transcription-dependent manner between
the nucleus and the cytoplasm (48-57). VHL cellular
distribution and its link to mRNA stability prompted us to
suggest that the function of VHL may also be linked to its
ability to engage in a transcription-dependent nuclear-cytoplasmic
shuttle. 786-0 cells stably expressing VHL-GFP were examined by
confocal microscopy before and after treatment with either actinomycin
D (ActD) or 5,6-dichlorobenzimidazole riboside (DRB) (Fig. 3A, first
row, VHL-GFP/Stable). Untreated cells (
ActD and
DRB) exhibited a
predominantly cytoplasmic signal. After 3 h of ActD treatment
(ActD), we detected a clear shift of VHL-GFP most readily appreciated
as an increase in nuclear fluorescence. The same effect was observed
after treatment with the RNA polymerase II-specific inhibitors DRB
(Fig. 3A, first row, DRB) and
-amanitin (not shown). Removal of DRB resulted in a redistribution
similar to that of the untreated state indicating that the phenomenon
is reversible (Fig. 3A, first row, Wash/out). Identical results were
observed with the RCC 786-0 cells stably expressing FVHL-GFP (data not
shown). The same effects of these two drugs were observed in
Cos-7 cells transiently transfected with FVHL-GFP (Fig. 3A, second
row, FVHL-GFP/Transient). CCD camera quantitation demonstrated
a threefold increase in nuclear signal without a change in total
cellular fluorescence levels after stable or transiently transfected
cells achieved their new steady state (data not shown). In contrast,
neither ActD nor DRB had any effect on the distribution of FGFP (Fig.
3A, third row, FGFP/Transient) (62). Inhibition of protein
synthesis with cycloheximide had no effect on the distribution of
FVHL-GFP in transiently transfected Cos-7 cells (Fig. 3B) or
stably expressing RCC 786-0 cells (data not shown). Ongoing
protein synthesis was not required for the redistribution effect of the
transcriptional inhibitors (Fig. 3B). It is likely that the effect of
ActD or DRB is the result of inhibition of new RNA synthesis and is not
mediated by the failure to synthesize a product from the transcribed
RNA.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of transcription and translation inhibition on
the cellular distribution of VHL-GFP. (A) Comparison of the
nuclear-cytoplasmic distributions of VHL-GFP in stably expressing RCC
786-0 cell lines (top row), FVHL-GFP in transiently expressing Cos-7
cells (middle row), and FGFP (without VHL) in transiently expressing
Cos-7 cells (bottom row) before ( ActD and DRB) and after the
addition of either ActD (transcription inhibitor; 5 µg/ml for 3 h) or DRB (RNA polymerase II-specific inhibitor; 25 µg/ml for 3 h). Wash/out indicates that pictures were taken 16 h after washing
out of DRB from the cultures. (B) Comparison of the nuclear-cytoplasmic
distribution of FVHL-GFP in transiently transfected Cos-7 cells
incubated either in the presence of cycloheximide (translation
inhibitor; 100 µg/ml for 3 h) or for 1 h in the presence of
cycloheximide followed by the addition of ActD for 3 h
(Cycloheximide/ActD).
|
|
Study of the dynamic trafficking properties of VHL-GFP in a
cellular fusion assay.
An established method for measuring the
ability of a nuclear protein to engage nuclear-cytoplasmic shuttling is
to monitor its accumulation into the nuclei of a newly formed
polykaryon (52, 53). However, VHL is a predominantly
cytoplasmic protein, making the demonstration of shuttling by this
technique more difficult. Therefore, we used our controlled-environment
CCD imaging setup to study the quantitative changes in fluorescence
signal intensity in both donor and acceptor nuclei in polykaryons over
time. This approach allows the study of the dynamic cellular
trafficking ability of VHL-GFP, in contrast to the static analysis
offered by immunofluorescence techniques. A single transiently
transfected HeLa cell expressing VHL-GFP was fused with an excess of
untransfected HeLa cells, and the fluorescence intensity in the
"donor" nucleus was quantified as a function of time in either the
absence or presence of DRB (Fig.
4). The nuclear areas
were identified after Hoechst 33342 staining (Fig. 4B). All
measurements were performed well under the saturation limits of the CCD
camera (see the detailed explanation in Materials and Methods
["Fluorescence analysis and image processing" and "Polykaryon
assay" sections]). These experiments were performed in the presence
of cycloheximide to prevent new protein synthesis. In the absence of
DRB, the fluorescence signal rapidly left the donor nucleus, with 50%
of the initial signal lost after less than 40 min (Fig. 4A and C,
DRB). The loss of nuclear VHL-GFP is markedly slower in the presence
of DRB, with which more than 140 min was required to see a 50% drop in
signal from the donor nucleus (Fig. 4A and C, +DRB). We also measured the effect of DRB on the accumulation of VHL-GFP in acceptor nuclei. In
the absence of DRB, most of the signal is distributed throughout the cytoplasm of the large polykaryon, with some nuclear
signal present (Fig. 4A,
DRB at 130' min, and D,
DRB).
Although the steady-state distribution is highly cytoplasmic, VHL-GFP
is still able to traffic into and out of the nuclei of the polykaryon, as demonstrated by the addition of DRB 130 min after synctium formation, which caused acute nuclear accumulation (Fig. 4E). In
contrast, the presence of DRB resulted in progressive accumulation in
the recipient nuclei, as described in single cells (Fig. 4A, compare
DRB and +DRB at 130 min, and D, +DRB). These results indicate that
DRB (or ActD) acts by slowing down the nuclear export rate, which
causes an increased nuclear residency time of VHL-GFP.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of transcription inhibition on nucleocytoplasmic
trafficking of VHL-GFP in a cellular fusion assay. HeLa cells were
transfected with VHL-GFP and fused with nontransfected HeLa cells as
described in Materials and Methods. Cells were transferred to the
incubation chamber mounted on the microscope and time-lapse images
taken at subsaturating illumination conditions. (A) Two typical
polykaryon formations over time are shown. Arrows point to the donor
nuclei of the polykaryons. The left panel shows the shuttling behavior
of VHL-GFP in the absence of DRB with a high export rate from the donor
nucleus (red arrow) and slow accumulation of VHL-GFP in the acceptor nuclei. The right
panel shows a fusion in which DRB was added prior to and during fusion,
after which VHL-GFP is exported from the donor nucleus at a much lower
rate and the acceptor nuclei acquire VHL-GFP at a much higher rate. (B)
Example of quantitative measurements of VHL-GFP signal intensity in
donor and acceptor nuclei after PEG fusion. The first and last time
point were chosen to demonstrate how quantitations were done.
Counterstaining of cells with Hoechst 33342 dye (2 µg/ml for 10 min)
provided nuclear dimensions. The brightness information from the blue
image taken at a 400-nm wavelength was used to define nuclear regions.
The donor nucleus (arrow, region 5) and the acceptor nuclei without any
detectable signal at 13 min postfusion, which accumulated VHL-GFP after
133 min, were selected for this example. The regions for the selected
acceptor nuclei were transferred to the green image taken at 488 nm.
Green images were taken with identical exposure times and under
nonsaturated conditions. Images were normalized and contrast was
enhanced with identical settings with IPLab Spectrum; this allows
direct visual comparison of signals between frames. The pixel intensity
values per se are not affected by this step. By using IPLab's
"measure segments" command, the intensity values of the selected
nuclei were determined. Region 10 was used to determine the background
fluorescence in the field. Mean pixel intensities per pixel were
determined as total pixel intensity/number of pixels, and background
was subtracted. The donor nuclei and the average of the acceptor nuclei
were determined and used for panels C and D. All measurements were
performed under the nonsaturating conditions of the CCD camera and the
screen, although the printing paper may appear saturated. (C) The
intensity decrease of VHL-GFP from the donor nucleus was quantified in
separate experiments either with or without DRB (each line represents
the mean of two experiments). Signal intensity at the first time point
(10 min postfusion) was set to 1, and the successive values were set in
relation to that. There was clearly a slower decrease in intensity of
the nuclear VHL from the DRB-treated donor nucleus. (D) The signal
intensity in the acceptor nuclei was measured over time to determine
the rate of net import. The +DRB line represents two experiments (mean
values of 19 nuclei in total), and the DRB line represents two
experiments (mean value of 16 nuclei). A faster increase in VHL-GFP
fluorescence in acceptor nuclei is observed in the presence of DRB. (E)
VHL-GFP is able to shuttle in a transcription-dependent manner between
the different nuclei and the large cytoplasm of an polykaryon. Two
examples are shown. DRB indicates that the fusion was performed in
the absence of DRB, where VHL-GFP can be detected predominantly in the
cytoplasm. +DRB indicates that the fusion was performed without DRB for
130 min, and at that time, DRB was added for 2 h. Notice that
VHL-GFP is now predominantly in the nuclei. All of the experiments
presented in Fig. 4 were performed in the presence of cycloheximide.
These results indicate that VHL-GFP is able to traffic between the
different nuclei via the cytoplasm of the fusions.
|
|
Localization of the region of VHL required for ActD-dependent
nuclear accumulation.
Data presented in Fig. 3 and 4 indicated
that VHL localization is sensitive to ongoing RNA polymerase II
activity, and the addition of transcription inhibitors caused a
partial redistribution of VHL-GFP to the nucleus. The next step was to
map a domain in VHL that mediates nuclear accumulation upon
treatment with ActD. Furthermore, we wanted to identify which domain of
VHL prevents the complete nuclear redistribution of VHL-GFP in cells
treated with ActD. For these reasons, we studied the effect of ActD
treatment on several VHL mutants (Fig.
5A). Some of these mutants showed different levels of nuclear and cytoplasmic accumulation; therefore, ActD responsiveness was defined as a clear increase in nuclear signal
after treatment. A large internal-truncation mutant,
60-113GFP, was
indistinguishable from VHL-GFP before and after addition of ActD (Fig.
5A and B). An exon 2 deletion mutant (
114-154GFP) showed increased
nuclear localization without ActD, but did not accumulate more in the
nucleus upon arrest of transcription (Fig. 5A and B). Mutants
with small deletions of exon 2 (
115-123GFP,
128-141GFP, and
141-154GFP) each showed a partial loss of ActD responsiveness. Interestingly,
C157GFP (deletion of exon 3), whose
distribution is similar to that of
141-154GFP in untreated cells
(higher nuclear content), displayed a very strong additional redistribution to the nucleus upon ActD treatment, resulting in almost
exclusive nuclear localization (Fig. 5A and B). We concluded that
exon 2 sequences are required for ActD-dependent nuclear redistribution, whereas assembly with elongin BC-Hs-Cul-2 (through exon 3 sequences) is not.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of arrest of transcription on deletion mutants of
VHL. Cos-7 cells were transfected with 5 µg of plasmid DNA encoding
either FVHL-GFP or deletion mutants of VHL. (A) Schematic diagram of
the VHL cDNA that contains three exons, FVHL-GFP, and the different
deletion mutants. On the right is the measured effect of ActD compared
to the steady-state distribution of the mutants without ActD. , no
detectable nuclear accumulation; +/ , slight nuclear accumulation; +,
strong nuclear accumulation; ++, very strong nuclear accumulation. (B)
Cellular localization of FVHL-GFP and the three key deletion mutants of
exon 1 ( 60-113GFP), exon 2 ( 114-154GFP), and exon 3 ( C157GFP) before ( ActD) and after (+ActD) the addition of ActD as
assessed by transient transfection of Cos-7 cells. (C) Cellular
localization before and after addition of ActD of FVHL-GFP and two key
deletion mutants of exon 2 ( 114-154GFP) and exon 3 ( C157GFP) in
stably expressing RCC 786-0 cells. Dots observed in stable cell lines
are 786-0 autofluorescence. (D) An exon 2 mutant is unable to
downregulate levels of Glut-1 protein. Whole-cell extracts (~30 µg
of protein/lane) from RCC 786-0, RCC 786-0 stably expressing HA-tagged
VHL (WT-7), FVHL-GFP, and a truncation mutant of exon 2 ( 114-154GFP) were run on SDS-PAGE (10% polyacrylamide) gel and
immunoblotted with an anti-Glut-1 polyclonal antibody.
|
|
Because the screening of the mutants was performed with Cos-7 cells
overexpressing the fusion proteins, we wondered if we
could reproduce
the data in stable RCC 786-0 cells expressing
near-endogenous levels of
VHL. As shown in Fig.
5C, similar results
were obtained in stable cells
expressing low levels of the fusion
proteins.
We then monitored the ability of an exon 2 mutant that failed to be
redistributed more to the nucleus upon ActD treatment
to repress levels
of Glut-1 protein in RCC VHL-negative 786-0
cells. These cells express
high levels of Glut-1 protein, which
can be significantly lowered by
the reintroduction of wild-type
VHL (
36). The introduction
of FVHL-GFP into these cells is as
effective as HA-VHL in repressing
Glut-1 levels (Fig.
5D [see
also Fig.
1E]). The naturally
occurring, cancer-causing splicing
mutant (

114-154GFP [exon
2 mutant]), which abrogated transcription-dependent
trafficking,
failed to repress Glut-1 levels (Fig.
5D). Therefore,
ActD-dependent nuclear accumulation of FVHL-GFP is mediated by
sequences encoded by exon 2, the loss of which resulted in the
inability to regulate Glut-1 protein levels. This provides the
first
clue as to the function of this domain of VHL, which is
frequently
mutated in sporadic
RCC.
Uncoupling transcription dependency from localization causes a
partial loss of VHL-GFP function.
Is transcription-dependent
nuclear-cytoplasmic trafficking of VHL required for its function? To
answer this question, we constructed a VHL fusion protein whose
localization and trafficking properties are insensitive to ongoing
transcription. FVHL-GFP was fused to a strong heterologous NES and
tested for nuclear accumulation in the presence of ActD. FVHL-GFP was
fused at the C terminus of GFP to the Rev NES (LPPLERLTL
(11) to produce the FVHL-GFP-NES fusion protein. A mutated
NES (LPPAERATL), whose capacity to convey rapid
nuclear export should be greatly diminished (69), was also
produced (FVHL-GFP-NESM). When the NES-containing protein was expressed
either stably at a low level in 786-0 or transiently in Cos-7 cells,
the GFP signal was exclusively cytoplasmic, regardless of expression
levels (Fig. 6Aa and Ab). The mutated
NESM-containing fusion protein had a distribution indistinguishable
from that of FVHL-GFP (Fig. 6Ac and Ad [also compare with Fig. 2A and
B]). When ActD was added to these cells, we did not detect any shift in the distribution of FVHL-GFP-NES protein to the nucleus (Fig. 6Ae
and Af) indicating that NES has the ability to override
transcription-dependent trafficking of VHL-GFP. FVHL-GFP-NESM responded
to the addition of ActD with a clear shift to the nucleus (Fig. 6Ag and
Ah), as observed for FVHL-GFP (Fig. 3). To show that VHL-GFP-NES is
still able to shuttle, albeit in a transcription-independent manner, we
inhibited the NES pathway by adding leptomycin B. Leptomycin B has been
shown to block the interaction of NES with its cognate CRM-1 receptor
and thereby prevent the export of NES-containing protein from the
nucleus (47, 68). After 2 to 6 h of incubation in 20 nM
leptomycin B, there was a marked redistribution of FVHL-GFP-NES to the
nucleus resembling the distribution of FVHL-GFP (Fig. 6Ai and Aj). This
demonstrated that FVHL-GFP-NES is able to shuttle in and out of the
nucleus, even if shuttling is insensitive to ActD. In contrast, either
FVHL-GFP-NESM (fig. 6Ak and Al) or FVHL-GFP (data not shown) failed to
redistribute upon addition of leptomycin D. FVHL-GFP-NES showed nuclear
accumulation in response to ActD only in the presence of leptomycin B
(Fig. 6Am and An), while the effect of ActD on VHL-GFP-NESM is
unaltered by the presence of leptomycin B (Fig. 6Ao and Ap). These
results suggest that VHL export is unrelated to the CRM-1 pathway.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 6.
Cellular distribution and function of FVHL-GFP fused to
the strong nuclear export signal of human immunodeficiency virus (HIV)
Rev. (A) FVHL-GFP was fused at its C terminus to the NES of HIV Rev
(LPPLERLTL) to produce the FVHL-GFP-NES fusion protein. FVHL-GFP was
also fused to a mutated form of NES (LPPAERATL)
to produce the FVHL-GFP-NESM fusion protein. Stably expressing RCC
786-0 cells (first and third panels from the top) or transiently
expressing Cos-7 cells (second and fourth panels from the top) were
treated without drugs ( Drug), with ActD for 3 h (ActD), with
leptomycin B for 2 to 6 h (Lepto B), or with leptomycin B for 2 to
6 h followed by the addition of ActD for 3 h (Lepto B/ActD).
Dots observed in FVHL-GFP-NESM are 786-0 autofluorescence. (B)
FVHL-GFP-NES shows a defect in downregulation of Glut-1 protein levels.
Whole-cell extracts (~30 µg of protein/lane) from RCC 786-0 and RCC
786-0 stably expressing HA-tagged VHL (WT-7), FVHL-GFP, FVHL-GFP-NES,
and FVHL-GFP-NESM were run on SDS-PAGE (10% polyacrylamide) gel and
immunoblotted with an anti-Glut-1 polyclonal antibody.
|
|
The fact that Rev NES abolished ActD-dependent nuclear accumulation
provided us with the means to test whether transcription-dependent
trafficking is required for VHL-GFP function. With this in mind,
we
tested the ability of FVHL-GFP-NES to downregulate levels of
Glut-1
protein in 786-0 cells. The addition of Rev NES to VHL
resulted in a
marked loss of VHL function (Fig.
6B, FVHL-GFP-NES)
compared to the
level of HA-VHL and FVHL-GFP function (Fig.
6B).
FVHL-GFP-NESM, which
showed trafficking sensitive to ActD, has
activity similar to that of
FVHL-GFP (Fig.
6B). These results
demonstrate that uncoupling
transcription with trafficking by
fusion to a strong NES, or by a
naturally occurring cancer causing
exon 2 deletion, alters VHL function
and suggest that the described
trafficking pattern is required for VHL
tumor suppression
function.
 |
DISCUSSION |
We have fused VHL to GFP to study the intracellular localization,
dynamic trafficking properties, and function of VHL. We performed
several control experiments to ascertain the validity of using these
fusion proteins. First, the GFP fusion proteins, with or without an
additional epitope tag (Flag), were equally capable of assembling with
the known biochemical partners of VHL. Second, several different
measures of VHL function in cells, including the regulation of VEGF and
the Glut-1 gene, could be reproduced with the GFP fusion proteins.
Third, the steady-state distributions of VHL-GFP were similar in
VHL-negative cells and other cell lines expressing different levels of
VHL. Importantly, the steady-state distribution of VHL-GFP reproduced
the reported localization of endogenous VHL in human kidney cells as
well as in overexpressed VHL in cultured cells by immunochemistry or
immunofluorescence techniques (7, 9, 23, 31, 37, 64). This
indicates that fusion to GFP and expression levels do not influence the cellular distribution and function of the VHL moiety. Taken together, these data strongly suggest that VHL-GFP is mimicking the biochemical, functional, and cellular localization attributes of VHL. By the GFP
approach, we were able to demonstrate that VHL-GFP dynamically traffics
in a transcription-dependent manner between the nucleus and the
cytoplasm. Transcription-dependent shuttling is mediated by sequences
encoded by exon 2, the site of frequent mutations in RCC. We suggest
that VHL requires not only nuclear-cytoplasmic localization, but also
transcription-dependent trafficking between these two compartments in
order to function.
Nuclear-cytoplasmic trafficking of VHL.
With the experiments
reported in this study, the VHL tumor suppressor gene product should be
added to the growing list of proteins that exhibit dynamic trafficking
between the nucleus and the cytoplasm (20, 46, 49). The most
striking aspect of the intracellular dynamics of VHL-GFP is the nuclear
accumulation in response to inhibition of RNA polymerase II-mediated
transcription. The incomplete redistribution of VHL to the nucleus upon
ActD treatment is reminiscent of the partial redistribution of nuclear proteins, such as Rev, heterogeneous nuclear ribonucleoprotein particle
A (hnRNP A), and ICP27 (just to name a few), to the cytoplasm or
cytoplasmic molecules to the nucleus [poly(A)+ binding
protein] upon treatment with ActD (1, 3, 41, 52, 53, 57,
62). One possibility is that shuttling of VHL-GFP (or another
known shuttling protein) may still occur even in the presence of ActD.
This argument is supported by data obtained with the cellular fusion
assay shown in Fig. 4. Although there is a dramatic decrease in the
nuclear export rate of VHL-GFP in the presence of DRB (RNA polymerase
II inhibitor), there is still a small fraction of VHL-GFP that is able
to export from the donor nucleus. This may occur through a nuclear
export mechanism independent of ongoing transcription or might be due
to some diffusion of VHL-GFP from the nucleus.
We have identified one deletion mutant (

C157GFP) that is able to
almost completely be redistributed to the nuclei of all
cells. It is
conceivable that exon 3 sequences regulate the shuttling
ability of
VHL-GFP through undefined signals interfering with
the complete
redistribution of VHL-GFP to the nucleus. One possibility
is that a
fraction of VHL assembles with cytoplasmic structures
and is
unavailable to engage in shuttling during the 3-h time
frame of the
experiments. Exon 3 sequences would mediate assembly
with cytoplasmic
structures, and deletion of these sequences would
render the mutant VHL
free to continuously shuttle and completely
accumulate in the nucleus
upon treatment with ActD. Supporting
this conclusion is our finding
that VHL mutants in exon 3 have
lost the ability to be cross-linked to
cytoplasmic structures
upon fixation with formaldehyde (data not
shown). More work will
be required for us to understand why exon 3 sequences are able
to hinder the complete nuclear redistribution of VHL
in ActD-treated
cells.
Regardless of the mechanisms that impede the complete nuclear
redistribution of VHL-GFP upon ActD treatment, the increase
in nuclear
VHL-GFP is most likely the consequence of impairment
of its nuclear
export, as shown by the quantitative cellular fusion
experiments. By
fusion of a cell expressing VHL-GFP with nontransfected
cells, we
introduced a strong negative gradient immediately after
fusion
initiation. This allows an estimation of initial rates
of export from
the donor nucleus even for predominantly cytoplasmic
proteins, such as
VHL-GFP. Using this approach, we demonstrated
that the initial rate of
loss of VHL-GFP from the donor nucleus
was markedly decreased (by
greater than threefold) when transcription
is inhibited. This is
sufficient to explain the steady-state shift
of VHL-GFP in the presence
of either ActD or DRB of about threefold
in the ratio of nuclear to
cytoplasmic protein in single cells.
The marked increase in
accumulation of VHL-GFP in the acceptor
nuclei is also noteworthy. The
increased nuclear accumulation
may be explained as follows. In
untreated polykaryons, immediately
after fusion initiation, cytoplasmic
VHL-GFP is diluted by the
surrounding cytoplasm. VHL-GFP is also
rapidly exported from the
donor nucleus into the cytoplasm. VHL-GFP is
imported into and
rapidly reexported from the acceptor nuclei to
eventually establish
a steady-state distribution that is largely
cytoplasmic (as with
VHL-GFP in single cells). In polykaryons treated
with DRB, nuclear
VHL-GFP enters the cytoplasm at about one-third the
rate of the
untreated cells. VHL-GFP molecules that do export from the
donor
nucleus as well as the molecules already present in the
cytoplasm
are taken up by recipient nuclei, where the export rate is
markedly
reduced, resulting in a higher level of accumulation into the
multiple nuclei of the polykaryon. The threefold decrease in the
nuclear export rate upon arrest of transcription is sufficient
to
explain the observed changes in the steady-state distribution
of
VHL-GFP in single cells. The fusion experiments strongly support
our
conclusion that VHL has the ability to shuttle between the
nucleus and
the cytoplasm and that shuttling requires ongoing
RNA polymerase II
transcription.
Transcription-dependent nuclear-cytoplasmic trafficking: a new
function for the clinically relevant exon 2 of VHL?
The
information required for ActD-dependent nuclear accumulation appears to
be contained within the second exon of VHL. While we have not precisely
identified the exon 2 sequences required for the putative
transcription-dependent nuclear export, the partial inhibition of the
effect in several nonoverlapping exon 2 deletions suggests that the
effect is due to a relatively extended sequence. A significant fraction
of naturally occurring missense mutations in VHL syndrome patients and,
more commonly, in sporadic RCC occur in exon 2 (18).
Moreover, it has been shown that a splicing defect of exon 2, which
results in VHL lacking amino acids 114 to 154, causes sporadic RCC
(18). The functions inactivated by these cancer-predisposing
mutations are still completely unknown. Elongins B and C and Hs-Cul-2,
currently the only known components of the VHL complex, are obviously
not required for nuclear accumulation in ActD-treated cells. This is
demonstrated by the fact that exon 3 deletions, which result in the
loss of elongin B and C and Hs-Cul-2 assembly, do not abrogate
ActD-dependent nuclear accumulation. It will be interesting to test
some of these missense mutations for their impact on
transcription-dependent nuclear export. Nonetheless, this is the first
demonstration of any biological activity of exon 2-encoded sequences in VHL.
The VHL export pathway is distinct from the CRM-1-exportin 1 pathway.
Great progress has been made recently in elucidating the
components of nuclear export for proteins that contain a short,
leucine-rich export signal (11, 15, 16, 55, 66). The
leucine-rich NES sequence has recently been shown to bind to the CRM-1
protein in the presence of Ran-GTP (13, 15, 29, 45, 50). The Streptomyces product leptomycin B is a potent inhibitor of
CRM-1-mediated nuclear export (47, 68). The addition of the
Rev NES to FVHL-GFP, which resulted in nuclear exclusion, abrogated the
effect of ActD and caused a partial defect in Glut-1 regulation.
Leptomycin B had no discernible effect on the distribution of VHL-GFP,
but did restore the sensitivity of VHL-GFP-NES to ActD. Our
interpretation is that the Rev NES functions through an export pathway
different from and probably independent of the one normally utilized by VHL. This NES-CRM-1 pathway seems to be dominant in the
NES-containing VHL-GFP fusion protein, perhaps because the added NES is
more potent than the VHL putative export signal. Alternatively, NES may
chaperone VHL away from a rate-limiting transcription-dependent step in VHL nuclear export. It is therefore likely that VHL utilizes a
different type of export pathway, such as that used for other nuclear-cytoplasmic trafficking proteins (12, 41-43).
Illumination of the VHL export pathway will require the identification
of nuclear proteins that specifically recognize the relevant exon 2 sequences. In addition, the data obtained with the NES fusion
demonstrate that transcription-dependent trafficking between the
nucleus and the cytoplasm is required for VHL function.
Transcription-dependent nuclear-cytoplasmic trafficking and
VHL function.
The mechanism by which inhibition of
transcription reduces the postulated nuclear export ability of VHL is
not known. Several RNA-binding proteins, such as hnRNP A, hnRNP K, Rev,
ICP27, and some SR proteins require ongoing transcription for
nuclear-cytoplasmic cycling. However, these are all nuclear proteins
which fail to undergo nuclear import in the absence of ongoing
transcription, leading to their cytoplasmic accumulation (4,
40-42, 52, 53, 57). VHL, in contrast, does appear to behave like
another predominantly cytoplasmic protein, the poly(A)+
binding protein, which assembles with RNA and requires ongoing transcription for nuclear export (1). That VHL shares
trafficking characteristics with the poly(A)+ binding
protein supports the hypothesis that it has the ability to escort
transcripts out of the nucleus. This raises the possibility that
VHL-GFP is exported along with newly transcribed mRNA molecules. While
there is no direct experimental evidence for this or for any
interaction between VHL or its partners with RNA, the fact that VHL has
been shown to influence the half-life of target mRNAs may point to a
still undemonstrated ability of VHL to indirectly interact with RNA
(19, 24, 32, 33). An interesting hypothesis, suggested by
Kaelin and collaborators (36), is that the VHL-elongin BC-Hs-Cul-2 complex may play a role in ubiquitin-mediated degradation of proteins involved in regulating the stability of specific mRNAs. To
do so, VHL-elongin BC-Hs-Cul-2 might need to assemble with target
mRNAs in the nucleus as part of an RNP. The RNP would then be rapidly
exported toward the cytoplasm, providing an explanation for the
cytoplasmic localization of VHL-GFP at steady state. If this is the
case, transcription-inhibiting drugs would act by reducing the amount
of target mRNAs required for VHL-elongin BC-Hs-Cul-2 export. Once in
the cytoplasm, VHL-elongin BC-Hs-Cul-2 would function to control the
fate of the mRNAs. If this model is correct, the assembly with the RNPs
may be specified by exon 2, and the deletion of these sequences would
explain the loss of ActD sensitivity.
We have shown that all perturbations that abrogated
transcription-dependent nuclear-cytoplasmic trafficking of VHL diminish
its ability to function. These include exon 2 deletions and,
interestingly,
the addition of a functional NES which exports the
protein in
a way that is no longer dependent on ongoing transcription.
The
fact that an exon 2 mutant can still accumulate in the nucleus
and
the cytoplasm and that the NES fusion shuttles in a
transcription-independent
manner establishes that the function of VHL
requires not only
localization within the nucleus and the cytoplasm,
but also transcription-dependent
trafficking. To explain these
phenomena in detail will require
further work. Whatever the details,
the abundance of naturally
occurring mutations in exon 2, especially in
sporadic RCC, may
well be explained by the loss of
transcription-dependent nuclear
export that appears to characterize
both the fate and function
of the VHL tumor suppressor gene
product.
 |
ACKNOWLEDGMENTS |
S.L. and M.N. contributed equally to this work.
We sincerely thank Heather Kontaxis, Rebecca Begley, and
Marie-Christine Fournier for their excellent technical contribution to
this work. We also thank Juan Bonifacino and Mary Dasso for critical
reviews and comments.
M.N. is a fellow of the AIDS-Stipendienprogramm des Bundesministeriums
fuer Bildung und Forschung, Germany. A.P. is supported by a fellowship
from the Deutsche Forschungsgemeinschaft. This work was supported in
part by NCI through a contract with ABL.
 |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Cellular and Molecular Medicine, Faculty of Medicine, University of
Ottawa, 451 Smyth Rd., Ottawa, Ontario, Canada K1H 8M5. Phone: (613)
562-5800, ext. 8385. Fax: (613) 562-5434. E-mail:
slee{at}uottawa.ca.
Present address: GSF-National Research Center for Environment and
Health, Institute for Molecular Virology, 85758 Neuherberg, Germany.
 |
REFERENCES |
| 1.
|
Afonina, E.,
R. Stauber, and G. N. Pavlakis.
1998.
The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm.
J. Biol. Chem.
273:13015-13021[Abstract/Free Full Text].
|
| 2.
|
Aso, T.,
W. S. Lane,
J. W. Conaway, and R. C. Conaway.
1995.
Elongin (SIII). A multisubunit regulator of elongation by RNA polymerase II.
Science
269:1439-1443[Abstract/Free Full Text].
|
| 3.
|
Bai, C.,
P. Sen,
K. Hofmann,
L. Ma,
M. Goebl,
J. W. Harper, and S. J. Elledge.
1996.
SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box.
Cell
86:263-274[Medline].
|
| 4.
|
Caceres, J. F.,
G. R. Screaton, and A. R. Krainer.
1998.
A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm.
Genes Dev.
12:55-66[Abstract/Free Full Text].
|
| 5.
|
Chen, F.,
T. Kishida,
M. Yao,
T. Hustad,
D. Glavac, et al.
1995.
Germline mutations in the von Hippel-Lindau disease tumor suppressor gene: correlations with phenotype.
Hum. Mutat.
5:66-75[Medline].
|
| 6.
|
Cole, N. B.,
N. Sciaky,
A. Marotta,
J. Song, and J. Lippincott-Schwartz.
1996.
Golgi dispersal during microtubule disruption: regeneration of Golgi stacks at peripheral endoplasmic reticulum exit sites.
Mol. Biol. Cell
7:631-650[Abstract].
|
| 7.
|
Corless, C. L.,
A. Kibel,
O. Iliopoulos, and W. G. Kaelin.
1997.
Immunostaining of the von Hippel-Lindau gene product in normal and neoplastic human tissues.
Hum. Pathol.
28:459-464[Medline].
|
| 8.
|
Crossey, P. A.,
F. M. Richards,
K. Foster,
J. S. Green,
A. Prowse,
F. Latif,
M. I. Lerman,
B. Zbar,
N. A. Affara,
M. A. Ferguson-Smith, and E. R. Maher.
1994.
Identification of intragenic mutations in the von Hippel-Lindau disease tumour suppressor gene and correlation with disease phenotype.
Hum. Mol. Genet.
3:1303-1308[Abstract/Free Full Text].
|
| 9.
|
Duan, D. R.,
J. S. Humphrey,
D. Y. T. Chen,
Y. Weng,
J. Sukegawa,
S. Lee,
J. R. Gnarra,
W. M. Linehan, and R. D. Klausner.
1995.
Characterization of the VHL tumor suppressor gene product: localization, complex formation, and the effect of natural inactivating mutation.
Proc. Natl. Acad. Sci. USA
92:6459-6463[Abstract/Free Full Text].
|
| 10.
|
Duan, D. R.,
A. Pause,
W. H. Burgess,
T. Aso,
D. Y. T. Chen,
K. P. Garrett,
R. C. Conaway,
J. W. Conaway,
W. M. Linehan, and R. D. Klausner.
1995.
Inhibition of transcription elongation by the VHL tumor suppressor protein.
Science
269:1402-1406[Abstract/Free Full Text].
|
| 11.
|
Fischer, U.,
J. Huber,
W. C. Boelens,
I. W. Mattaj, and R. Luhrmann.
1995.
The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNA.
Cell
82:475-483[Medline].
|
| 12.
|
Fischer, U.,
W. M. Michael,
R. Luhrmann, and G. Dreyfuss.
1996.
Signal-mediated nuclear export pathways of protein and RNAs.
Trends Cell. Biol.
6:290-294.
|
| 13.
|
Fornerod, M.,
M. Ohno,
M. Yoshida, and I. W. Mattaj.
1997.
CRM1 is an export receptor for leucine-rich nuclear export signals.
Cell
90:1051-1060[Medline].
|
| 14.
|
Foster, K.,
A. Prowse,
A. van den Berg,
S. Fleming,
M. M. F. Hulsbeek,
P. A. Crossey,
F. M. Richards,
P. Cairns,
N. A. Affara,
M. A. Ferguson-Smith,
C. H. Buys, and E. R. Maher.
1994.
Somatic mutations of the von Hippel-Lindau disease tumour suppressor gene in non-familial clear cell renal carcinoma.
Hum. Mol. Genet.
3:2169-2173[Abstract/Free Full Text].
|
| 15.
|
Fukuda, M.,
S. Asano,
T. Nakamura,
M. Adachi,
M. Yoshida,
M. Yanagida, and E. Nishida.
1997.
CRM1 is responsible for intracellular transport mediated by the nuclear export signal.
Nature
390:308-311[Medline].
|
| 16.
|
Fukuda, M.,
I. Gotoh,
Y. Gotoh, and E. Nishida.
1996.
Cytoplasmic localization of mitogen-activated protein kinase kinase directed by its NH2-terminal, leucine-rich short amino acid sequence, which acts as a nuclear export signal.
J. Biol. Chem.
271:20024-20028[Abstract/Free Full Text].
|
| 17.
|
Gnarra, J. R.,
D. R. Duan,
Y. Weng,
J. S. Humphrey,
D. Y. T. Chen,
S. Lee,
A. Pause, et al.
1996.
Molecular cloning of the von Hippel-Lindau tumor suppressor gene and its role in renal carcinoma.
Biochim. Biophys. Acta
1242:201-210[Medline].
|
| 18.
|
Gnarra, J. R.,
K. Tory,
Y. Weng,
L. Schmidt,
M. H. Wei,
H. Li,
F. Latif,
F. S. Liu,
F. Chen,
F. M. Duh, et al.
1994.
Mutations of the VHL tumor suppressor gene in renal carcinoma.
Nat. Genet.
7:85-90[Medline].
|
| 19.
|
Gnarra, J. R.,
S. Zhou,
M. J. Merrill,
J. R. Wagner,
A. Krumm,
E. O. Papavassiliou,
E. H. Idfield,
R. D. Klausner, and W. M. Linehan.
1996.
Post-transcriptional regulation of vascular endothelial growth factor mRNA by the product of the VHL tumor suppressor gene.
Proc. Natl. Acad. Sci. USA
93:10589-10594[Abstract/Free Full Text].
|
| 20.
|
Gorlich, D., and I. W. Mattaj.
1996.
Nucleocytoplasmic transport.
Science
271:1513-1518[Abstract].
|
| 21.
|
Herman, J. G.,
F. Latif,
Y. Weng,
M. I. Lerman,
B. Zbar,
S. Liu,
D. Samid,
D. R. Duan,
J. R. Gnarra,
W. M. Linehan, and S. B. Baylin.
1994.
Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma.
Proc. Natl. Acad. Sci. USA
91:9700-9704[Abstract/Free Full Text].
|
| 22.
|
Hinds, P. W., and R. A. Weinber.
1994.
Tumor suppressor genes.
Curr. Opin. Genet. Dev.
4:135-141[Medline].
|
| 23.
|
Iliopoulos, O.,
A. Kibel,
S. Gray, and W. G. Kaelin.
1995.
Tumor suppression by the von Hippel-Lindau gene product.
Nat. Med.
1:822-826[Medline].
|
| 24.
|
Iliopoulos, O.,
A. P. Levy,
C. Jiang,
W. G. Kaelin, and M. A. Goldberg.
1996.
Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein.
Proc. Natl. Acad. Sci. USA
93:10595-10599[Abstract/Free Full Text].
|
| 25.
|
Kibel, A.,
O. Iliopoulos,
J. A. DeCaprio, and W. G. Kaelin.
1995.
Binding of the von Hippel-Lindau tumor suppressor protein to elongin B and C.
Science
269:1444-1446[Abstract/Free Full Text].
|
| 26.
|
Kipreos, E. T.,
L. E. Lander,
J. P. Wing,
W. W. He, and E. M. Hedgecock.
1996.
Cul-1 is required for cell cycle exit in C. elegans and identifies a novel gene family.
Cell
85:829-839[Medline].
|
| 27.
|
Knebelmann, B.,
S. Ananth,
H. T. Cohen, and V. P. Sukhatme.
1998.
Transforming growth factor alpha is a target for the von Hippel-Lindau tumor suppressor.
Cancer Res.
58:226-231[Abstract/Free Full Text].
|
| 28.
|
Knudson, A. G.
1993.
Antioncogenes and human cancer.
Proc. Natl. Acad. Sci. USA
90:10914-10921[Abstract/Free Full Text].
|
| 29.
|
Kudo, N.,
S. Khochbin,
K. Nishi,
K. Kitano,
M. Yanagida,
M. Yoshida, and S. Horinouchi.
1997.
Molecular cloning and cell cycle-dependent expression of mammalian CRM1, a protein involved in nuclear export of proteins.
J. Biol. Chem.
272:29742-29749[Abstract/Free Full Text].
|
| 30.
|
Latif, F.,
K. Tory,
J. R. Gnarra,
M. Yao,
F. Dub,
M. L. Orcutt,
T. Stackhouse,
I. Kuzmin,
W. Modi,
L. Geil, et al.
1993.
Identification of the von Hippel-Lindau disease tumor suppressor gene.
Science
260:1317-1320[Abstract/Free Full Text].
|
| 31.
|
Lee, S.,
D. Y. T. Chen,
J. S. Humphrey,
J. R. Gnarra,
W. M. Linehan, and R. D. Klausner.
1996.
Nuclear/cytoplasmic localization of the von Hippel-Lindau tumor suppressor gene product is determined by cell density.
Proc. Natl. Acad. Sci. USA
93:1770-1775[Abstract/Free Full Text].
|
| 32.
|
Levy, A. P.,
N. S. Levy, and M. A. Goldberg.
1996.
Post-transcriptional regulation of vascular endothelial growth factor by hypoxia.
J. Biol. Chem.
271:2746-2753[Abstract/Free Full Text].
|
| 33.
|
Levy, A. P.,
N. S. Levy, and M. A. Goldberg.
1996.
Hypoxia-inducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein.
J. Biol. Chem.
271:25492-25497[Abstract/Free Full Text].
|
| 34.
|
Linehan, W. M.,
M. I. Lerman, and B. Zbar.
1995.
Identification of the von Hippel-Lindau (VHL) gene. Its role in renal cancer.
JAMA
273:564-570[Abstract/Free Full Text].
|
| 35.
| Lippincott-Schwartz, J. Uses of GFP in mammalian
cells. In M. Chalfic et al. (ed.), Applications of green
fluorescent proteins, in press. John Wiley and Sons, New York, N.Y.
|
| 36.
|
Lonergan, K. M.,
O. Iliopoulos,
M. Ohh,
T. Kamura,
R. C. Conaway,
J. W. Conaway, and W. G. Kaelin, Jr.
1998.
Regulation of hypoxia-inducible mRNAs by the von Hippel-Lindau tumor suppressor protein requires binding to complexes containing elongins B/C and Cul2.
Mol. Cell. Biol.
18:732-741[Abstract/Free Full Text].
|
| 37.
|
Los, M.,
G. H. Jansen,
W. G. Kaelin,
C. J. Lips,
G. H. Blijham, and E. E. Voest.
1996.
Expression pattern of the von Hippel-Lindau protein in human tissues.
Lab. Investig.
75:231-238[Medline].
|
| 38.
|
Lubensky, I. A.,
J. R. Gnarra,
P. Bertheau,
M. M. Walther, and W. M. Linehan.
1996.
Allelic deletions of the VHL gene detected in multiple microscopic clear cell renal lesions in von Hippel-Lindau disease patients.
Am. J. Pathol.
149:2089-2095[Abstract].
|
| 39.
|
Mathias, N.,
S. L. Johnson,
M. Winey,
A. E. M. Adams,
L. Goetsch,
J. R. Pringle,
B. Byers, and M. G. Goebl.
1996.
Cdc53p acts in concert with Cdc4p and Cdc34p to control the G1-to-S-phase transition and identifies a conserved family of proteins.
Mol. Cell. Biol.
16:6634-6643[Abstract].
|
| 40.
|
Meyer, B. E., and M. H. Malim.
1994.
The HIV-1 Rev trans-activator shuttles between the nucleus and the cytoplasm.
Genes Dev.
8:1538-1547[Abstract/Free Full Text].
|
| 41.
|
Michael, W. M.,
M. D. Choi, and G. Dreyfuss.
1995.
Nuclear export signal in hnRNP A1: a signal-mediated temperature-dependent nuclear protein export pathway.
Cell
83:415-422[Medline].
|
| 42.
|
Michael, W. M.,
P. S. Eder, and G. Dreyfuss.
1997.
The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein.
EMBO J.
16:3587-3598[Medline].
|
| 43.
|
Nakielny, S., and G. Dreyfuss.
1998.
Import and export of the nuclear protein import receptor transportin by a mechanism independent of GTP hydrolysis.
Curr. Biol.
8:89-95[Medline].
|
| 44.
|
Neumann, M.,
J. Harrison,
M. Saltarelli,
E. Hadziyannis,
V. Erfle,
B. K. Felder, and G. N. Pavlakis.
1994.
Splicing variability in HIV-1 revealed by quantitative RNA-PCR.
AIDS Res. Hum. Retroviruses
10:1531-1542[Medline].
|
| 45.
|
Neville, M.,
F. Stutz,
L. Lee,
L. I. Davis, and M. Rosbash.
1997.
The importin-beta family member Crm1p bridges the interaction between Rev and the nuclear pore complex during nuclear export.
Curr. Biol.
7:767-775[Medline].
|
| 46.
|
Nigg, E. A.
1997.
Nucleocytoplasmic transport: signals, mechanisms and regulation.
Nature
386:779-787[Medline].
|
| 47.
|
Nishi, K.,
M. Yoshida,
D. Fujiwara,
M. Nishikawa,
S. Horinouchi, and T. Beppu.
1994.
Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression.
J. Biol. Chem.
269:6320-6324[Abstract/Free Full Text].
|
| 48.
|
Nix, D. A., and M. C. Beckerle.
1997.
Nuclear-cytoplasmic shuttling of the focal contact protein, zyxin: a potential mechanism for communication between sites of cell adhesion and the nucleus.
J. Cell Biol.
138:1139-1147[Abstract/Free Full Text].
|
| 49.
|
Ohno, M.,
M. Fornerod, and I. W. Mattaj.
1998.
Nucleocytoplasmic transport: the last 200 nanometers.
Cell
92:327-336[Medline].
|
| 50.
|
Ossareh-Nazari, B.,
F. Bachelerie, and C. Dargemont.
1997.
Evidence for a role of CRM1 in signal-mediated nuclear protein export.
Science
278:141-144[Abstract/Free Full Text].
|
| 51.
|
Pause, A.,
S. Lee,
R. A. Worrell,
D. Y. T. Chen,
W. H. Burgess,
W. M. Linehan, and R. D. Klausner.
1997.
The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins.
Proc. Natl. Acad. Sci. USA
94:2156-2161[Abstract/Free Full Text].
|
| 52.
|
Pinol-Roma, S., and G. Dreyfuss.
1991.
Transcription-dependent and transcription-independent nuclear transport of hnRNP proteins.
Science
253:312-314[Abstract/Free Full Text].
|
| 53.
|
Pinol-Roma, S., and G. Dreyfuss.
1992.
Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm.
Nature
355:730-732[Medline].
|
| 54.
|
Pollard, V. W.,
W. M. Micheal,
S. Nakielny,
M. C. Siomi,
F. Wang, and G. Dreyfuss.
1996.
A novel receptor-mediated nuclear protein import pathway.
Cell
86:985-994[Medline].
|
| 55.
|
Roth, J.,
M. Dobbelstein,
D. A. Freedman,
T. Shenk, and A. J. Levine.
1998.
Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus Rev protein.
EMBO J.
17:554-564[Medline].
|
| 56.
|
Roux, P.,
J. M. Blanchard,
A. Fernandez,
N. Lamb,
P. Jeanteur, and M. Piechaczyk.
1990.
Nuclear localization of c-Fos, but not v-Fos proteins, is controlled by extracellular signals.
Cell
63:341-351[Medline].
|
| 57.
|
Sandri-Goldin, R. M.
1998.
ICP27 mediates HSV RNA export by shuttling through a leucine-rich nuclear export signal and binding viral intronless RNAs through an RGG motif.
Genes Dev.
12:868-879[Abstract/Free Full Text].
|
| 58.
|
Seimeister, G.,
K. Weidel,
K. Mohrs,
B. Barleon,
G. Martiny-Baron, and D. Marne.
1996.
Reversion of deregulated expression of vascular endothelial growth factor in human renal carcinoma cells by von Hippel-Lindau tumor suppressor gene.
Cancer Res.
56:2299-2301[Abstract/Free Full Text].
|
| 59.
|
Shuin, T.,
K. Kondo,
S. Torigoe,
T. Kishida,
Y. Kubota,
M. Hosaka,
Y. Nagashima,
H. Kitamura,
F. Latif,
B. Zbar,
M. I. Lerman, and M. Yao.
1994.
Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas.
Cancer Res.
54:2852-2855[Abstract/Free Full Text].
|
| 60.
|
Soneoka, Y.,
P. M. Cannon,
E. E. Ramsdale,
J. C. Griffiths,
G. Romano,
S. M. Kingsman, and A. J. Kingsman.
1995.
A transient three-plasmid expression system for the production of high titer retroviral vectors.
Nucleic Acids Res.
23:628-633[Abstract/Free Full Text].
|
| 61.
|
Stade, K.,
C. S. Ford,
C. Guthrie, and K. Weis.
1997.
Exportin 1 (Crm1p) is an essential nuclear export factor.
Cell
90:1041-1050[Medline].
|
| 62.
|
Stauber, R.,
G. A. Gaitanaris, and G. N. Pavlakis.
1995.
Analysis of trafficking of Rev and transdominant Rev proteins in living cells using green fluorescent protein fusions: transdominant Rev blocks the export of Rev from the nucleus to the cytoplasm.
Virology
213:439-449[Medline].
|
| 63.
|
Stauber, R. H.,
K. Horie,
P. Carney,
E. A. Hudson,
N. I. Tarasova,
G. A. Gaitanaris, and G. N. Pavlakis.
1998.
Development and applications of enhanced green fluorescent protein mutants.
BioTechniques
24:462-466[Medline].
|
| 64.
|
Tsuchiya, H.,
T. Iseda, and O. Hino.
1996.
Identification of a novel protein (VBP-1) binding to the von Hippel-Lindau (VHL) tumor suppressor gene product.
Cancer Res.
56:2881-2885[Abstract/Free Full Text].
|
| 65.
|
Walther, M. M.,
I. A. Lubensky,
D. Venzon,
B. Zbar, and W. M. Linehan.
1995.
Prevalence of microscopic lesions in grossly normal renal parenchyma from patients with von Hippel-Lindau disease, sporadic renal cell carcinoma and no renal disease: clinical implications.
J. Urol.
154:2010-2014[Medline].
|
| 66.
|
Wen, W.,
J. L. Meinkoth,
R. Y. Tsien, and S. S. Taylor.
1995.
Identification of a signal for rapid export of proteins from the nucleus.
Cell
82:463-473[Medline].
|
| 67.
|
Willems, A. R.,
S. Lanker,
E. E. Patton,
K. L. Craig,
T. F. Nason,
N. Mathias,
R. Kobayashi,
C. Wittenberg, and M. Tyers.
1996.
Cdc53 targets phosphorylated G1 cyclins for degradation by the ubiquitin proteolytic pathway.
Cell
86:453-463[Medline].
|
| 68.
|
Wolff, B.,
J. J. Sanglier, and Y. Wang.
1997.
Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA.
Chem. Biol.
4:139-147[Medline].
|
| 69.
|
Zhang, M. J., and A. I. Dayton.
1998.
Tolerance of diverse amino acid substitutions at conserved positions in the nuclear export signal (NES) of HIV-1 Rev.
Biochem. Biophys. Res. Commun.
243:113-116[Medline].
|
| 70.
|
Zinszner, H.,
J. Sok,
D. Immanuel,
Y. Yin, and D. Ron.
1997.
TLS (FUS) binds RNA in vivo and engages in nucleo-cytoplasmic shuttling.
J. Cell Sci.
110:1741-1750[Abstract].
|
Molecular and Cellular Biology, February 1999, p. 1486-1497, Vol. 19, No. 2
0270-7306/99/$00.00+0
This article has been cited by other articles:
-
Khacho, M., Mekhail, K., Pilon-Larose, K., Pause, A., Cote, J., Lee, S.
(2008). eEF1A Is a Novel Component of the Mammalian Nuclear Protein Export Machinery. Mol. Biol. Cell
19: 5296-5308
[Abstract]
[Full Text]
-
Khacho, M., Mekhail, K., Pilon-Larose, K., Payette, J., Lee, S.
(2008). Cancer-Causing Mutations in a Novel Transcription-Dependent Nuclear Export Motif of VHL Abrogate Oxygen-Dependent Degradation of Hypoxia-Inducible Factor. Mol. Cell. Biol.
28: 302-314
[Abstract]
[Full Text]
-
Mylonis, I., Chachami, G., Samiotaki, M., Panayotou, G., Paraskeva, E., Kalousi, A., Georgatsou, E., Bonanou, S., Simos, G.
(2006). Identification of MAPK Phosphorylation Sites and Their Role in the Localization and Activity of Hypoxia-inducible Factor-1{alpha}. J. Biol. Chem.
281: 33095-33106
[Abstract]
[Full Text]
-
O'Hare, M. J., Kushwaha, N., Zhang, Y., Aleyasin, H., Callaghan, S. M., Slack, R. S., Albert, P. R., Vincent, I., Park, D. S.
(2005). Differential Roles of Nuclear and Cytoplasmic Cyclin-Dependent Kinase 5 in Apoptotic and Excitotoxic Neuronal Death. J. Neurosci.
25: 8954-8966
[Abstract]
[Full Text]
-
Mekhail, K., Khacho, M., Carrigan, A., Hache, R. R.J., Gunaratnam, L., Lee, S.
(2005). Regulation of ubiquitin ligase dynamics by the nucleolus. JCB
170: 733-744
[Abstract]
[Full Text]
-
KAELIN, W.G. JR.
(2005). The von Hippel-Lindau Tumor Suppressor Protein: Roles in Cancer and Oxygen Sensing. Cold Spring Harb Symp Quant Biol
70: 159-166
[Abstract]
-
Kim, W. Y., Kaelin, W. G.
(2004). Role of VHL Gene Mutation in Human Cancer. JCO
22: 4991-5004
[Abstract]
[Full Text]
-
Kaelin, W. G. Jr.
(2004). The Von Hippel-Lindau Tumor Suppressor Gene and Kidney Cancer. Clin. Cancer Res.
10: 6290S-6295S
[Abstract]
[Full Text]
-
Rafalska, I., Zhang, Z., Benderska, N., Wolff, H., Hartmann, A. M., Brack-Werner, R., Stamm, S.
(2004). The intranuclear localization and function of YT521-B is regulated by tyrosine phosphorylation. Hum Mol Genet
13: 1535-1549
[Abstract]
[Full Text]
-
Champagne, C., Landry, M.-C., Gingras, M.-C., Lavoie, J. N.
(2004). Activation of Adenovirus Type 2 Early Region 4 ORF4 Cytoplasmic Death Function by Direct Binding to Src Kinase Domain. J. Biol. Chem.
279: 25905-25915
[Abstract]
[Full Text]
-
Kaelin, W. G. Jr.
(2003). The von Hippel-Lindau Gene, Kidney Cancer, and Oxygen Sensing. J. Am. Soc. Nephrol.
14: 2703-2711
[Abstract]
[Full Text]
-
Walther, R. F., Lamprecht, C., Ridsdale, A., Groulx, I., Lee, S., Lefebvre, Y. A., Hache, R. J. G.
(2003). Nuclear Export of the Glucocorticoid Receptor Is Accelerated by Cell Fusion-dependent Release of Calreticulin. J. Biol. Chem.
278: 37858-37864
[Abstract]
[Full Text]
-
Schraml, P., Hergovitz, A., Hatz, F., Amin, M. B., Lim, S. D., Krek, W., Mihatsch, M. J., Moch, H.
(2003). Relevance of Nuclear and Cytoplasmic von Hippel Lindau Protein Expression for Renal Carcinoma Progression. Am. J. Pathol.
163: 1013-1020
[Abstract]
[Full Text]
-
Robert, A., Miron, M.-J., Champagne, C., Gingras, M.-C., Branton, P. E., Lavoie, J. N.
(2002). Distinct cell death pathways triggered by the adenovirus early region 4 ORF 4 protein. JCB
158: 519-528
[Abstract]
[Full Text]
-
Groulx, I., Lee, S.
(2002). Oxygen-Dependent Ubiquitination and Degradation of Hypoxia-Inducible Factor Requires Nuclear-Cytoplasmic Trafficking of the von Hippel-Lindau Tumor Suppressor Protein. Mol. Cell. Biol.
22: 5319-5336
[Abstract]
[Full Text]
-
Hansen, W. J., Ohh, M., Moslehi, J., Kondo, K., Kaelin, W. G., Welch, W. J.
(2002). Diverse Effects of Mutations in Exon II of the von Hippel-Lindau (VHL) Tumor Suppressor Gene on the Interaction of pVHL with the Cytosolic Chaperonin and pVHL-Dependent Ubiquitin Ligase Activity. Mol. Cell. Biol.
22: 1947-1960
[Abstract]
[Full Text]
-
Pioli, P. A., Rigby, W. F. C.
(2001). The Von Hippel-Lindau Protein Interacts with Heteronuclear Ribonucleoprotein A2 and Regulates Its Expression. J. Biol. Chem.
276: 40346-40352
[Abstract]
[Full Text]
-
Yang, H., Kaelin, W. G. Jr.
(2001). Molecular Pathogenesis of the Von Hippel-Lindau Hereditary Cancer Syndrome: Implications for Oxygen Sensing. Cell Growth Differ.
12: 447-455
[Full Text]
-
Yu, F., White, S. B., Zhao, Q., Lee, F. S.
(2001). Dynamic, Site-specific Interaction of Hypoxia-inducible Factor-1{{alpha}} with the von Hippel-Lindau Tumor Suppressor Protein. Cancer Res.
61: 4136-4142
[Abstract]
[Full Text]
-
Neumann, M, Afonina, E, Ceccherini-Silberstein, F, Schlicht, S, Erfle, V, Pavlakis, G., Brack-Werner, R
(2001). Nucleocytoplasmic transport in human astrocytes: decreased nuclear uptake of the HIV Rev shuttle protein. J. Cell Sci.
114: 1717-1729
[Abstract]
-
Mendell, J. T., Medghalchi, S. M., Lake, R. G., Noensie, E. N., Dietz, H. C.
(2000). Novel Upf2p Orthologues Suggest a Functional Link between Translation Initiation and Nonsense Surveillance Complexes. Mol. Cell. Biol.
20: 8944-8957
[Abstract]
[Full Text]
-
Lavoie, J. N., Champagne, C., Gingras, M.-C., Robert, A.
(2000). Adenovirus E4 Open Reading Frame 4-Induced Apoptosis Involves Dysregulation of Src Family Kinases. JCB
150: 1037-1056
[Abstract]
[Full Text]
-
Shiao, Y.-H., Resau, J. H., Nagashima, K., Anderson, L. M., Ramakrishna, G.
(2000). The von Hippel-Lindau Tumor Suppressor Targets to Mitochondria. Cancer Res.
60: 2816-2819
[Abstract]
[Full Text]
-
Harris, A. L.
(2000). von Hippel-Lindau Syndrome: Target for Anti-Vascular Endothelial Growth Factor (VEGF) Receptor Therapy. The Oncologist
5: 32-36
[Abstract]
[Full Text]
-
Groulx, I., Bonicalzi, M.-E., Lee, S.
(2000). Ran-mediated Nuclear Export of the von Hippel-Lindau Tumor Suppressor Protein Occurs Independently of Its Assembly with Cullin-2. J. Biol. Chem.
275: 8991-9000
[Abstract]
[Full Text]
-
Ludwig, E., Silberstein, F. C., van Empel, J., Erfle, V., Neumann, M., Brack-Werner, R.
(1999). Diminished Rev-Mediated Stimulation of Human Immunodeficiency Virus Type 1 Protein Synthesis Is a Hallmark of Human Astrocytes. J. Virol.
73: 8279-8289
[Abstract]
[Full Text]
-
Marx, S. J.
(1999). CLINICAL REVIEW 109: Contrasting Paradigms for Hereditary Hyperfunction of Endocrine Cells. J. Clin. Endocrinol. Metab.
84: 3001-3009
[Full Text]
-
Lisztwan, J., Imbert, G., Wirbelauer, C., Gstaiger, M., Krek, W.
(1999). The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity. Genes Dev.
13: 1822-1833
[Abstract]
[Full Text]
-
Bonicalzi, M.-E., Groulx, I., de Paulsen, N., Lee, S.
(2001). Role of Exon 2-encoded beta -Domain of the von Hippel-Lindau Tumor Suppressor Protein. J. Biol. Chem.
276: 1407-1416
[Abstract]
[Full Text]
-
Devarajan, P., De Leon, M., Talasazan, F., Schoenfeld, A. R., Davidowitz, E. J., Burk, R. D.
(2001). The von Hippel-Lindau Gene Product Inhibits Renal Cell Apoptosis via Bcl-2-dependent Pathways. J. Biol. Chem.
276: 40599-40605
[Abstract]
[Full Text]