Molecular and Cellular Biology, February 1999, p. 1605-1615, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, New York 10021
Received 1 October 1998/Returned for modification 30 October 1998/Accepted 12 November 1998
| |
ABSTRACT |
|---|
|
|
|---|
Human TFIIIC is a multisubunit factor that is essential for transcription by RNA polymerase III on tRNA and virus-associated RNA genes and initiates preinitiation complex assembly by direct recognition of promoter elements. We show that highly purified TFIIIC, at concentrations above those sufficient for transcription of naked DNA templates, effectively relieves nucleosome-mediated repression on an in vitro-reconstituted chromatin template. Highly purified TFIIIC alone can bind to the A and B boxes of a tRNA gene within a chromatin template and, further, displays a histone acetyltransferase activity that is intrinsic to at least one (and probably three) of its subunits. The possibility of a direct link between TFIIIC-dependent chromatin transcription and acetyltransferase activities is suggested by the partial loss of these activities, but not DNA transcription activity, following pretreatment of TFIIIC with p-hydroxymercuribenzoic acid.
| |
INTRODUCTION |
|---|
|
|
|---|
Most genes encoding small structural RNAs are transcribed by RNA polymerase III, and transcription from cognate DNA templates requires various accessory factors. These include common factors, TFIIIC and TFIIIB, that suffice for transcription of some genes (tRNA, virus-associated [VA] RNA, and yeast U6 RNA genes) and, in some cases, gene-specific factors (e.g., TFIIIA for 5S RNA genes and PTF/SNAPc for mammalian U6 and 7SK genes) (reviewed in reference 38). In the best-studied cases, preinitiation complex assembly involves direct promoter recognition by TFIIIC (A and B boxes in tRNA, VA RNA, and yeast U6 genes) or by TFIIIA and TFIIIC (A and C boxes in 5S RNA genes), TFIIIB recruitment through interactions with TFIIIC, and RNA polymerase III recruitment through interactions with TFIIIB (reviewed in references 15 and 56). Consistent with conservation of the assembly pathway from yeast to human, there is a corresponding conservation in structure and function of the TFIIIB and RNA polymerase III subunits (reviewed in reference 55). TFIIIC, by contrast, shows more divergence in structure. Saccharomyces cerevisiae TFIIIC is composed of six subunits and binds to both A and B boxes (reviewed in reference 1), whereas human TFIIIC contains at least nine subunits (55) and can be resolved into a five-subunit complex (TFIIIC2) that binds weakly to the B box and a less well characterized complex (TFIIIC1) that stabilizes TFIIIC2 binding to A and B boxes (23, 52, 60). Other factors derived from TFIIIC preparations also stabilize TFIIIC binding throughout promoter and terminator regions (reviewed in reference 55).
Several in vitro studies have shown that preassembly of class III genes
into chromatin generally blocks transcription by concentrations of RNA
polymerase III and accessory factors that suffice for transcription from cognate DNA templates, whereas prebinding of accessory factors can
prevent this repression (5, 13, 16, 44). In addition, in
vivo studies of active and inactive (mutated) class III genes have
demonstrated that active transcription interferes with local nucleosome
formation and, in the case of the yeast U6 gene, that intracellular
chromatin disruption enhances transcription only when the B box is
mutated and TFIIIC interactions are impaired (28, 31). It
was further shown that TFIIIC and the B box of the yeast U6 gene (which
also contains functional TATA- and A-box elements) are required for in
vitro transcription from chromatin templates but not from DNA templates
(8). These studies reveal a dominant role for TFIIIC and the
cognate B box in overcoming nucleosome formation and transcriptional
repression. However, they do not establish the molecular basis for
this
specifically, whether intrinsic TFIIIC-promoter DNA interactions
in the context of a chromatin template suffice, with subsequent TFIIIB
and RNA polymerase III interactions, for relief (or prevention) of
repression or whether additional factors and/or chromatin modifications
are also important.
Although several factors have been reported to bind to cognate DNA sites within chromatin in the absence of additional factors (reviewed in references 3, 36, and 47), recent studies have identified a variety of genetically and biochemically defined factors that may facilitate transcription of class II genes through chromatin remodeling. One group includes ATP-dependent nucleosome remodeling factors (e.g., NURF, SWI-SNF, ACF, and CHRAC complexes) that are thought to facilitate transcription factor binding or function through alteration of nucleosome structure or position (reviewed in references 22, 57, and ;58). A second group includes transcriptional coactivators with histone acetyltransferase (HAT) activities that, through acetylation of N-terminal lysines, alter histone-DNA interactions and nucleosomal stability (reviewed in references 40, 43, 50, and 57). Examples include GCN5 and pCAF (7, 59), CBP and p300 (2, 34), steroid receptor coactivator 1 (SRC-1) and ACTR (9, 42), and TATA-box binding protein-associated factor TAFII250 (30). Although functions in transcription activation have been identified for these factors, direct roles for the intrinsic HAT activities in transcription are not broadly established. The most notable exceptions are yeast GCN5 (25, 48, 51), whose modifications of promoter-proximal histones also appears to be causal for transcription, and human CBP (28). Effects of HAT-containing factors on transcription of class III genes have not been reported, although the incorporation of acetylated histones into 5S gene-containing chromatin templates has been reported to facilitate both TFIIIA binding and TFIIIA-dependent transcription on chromatin templates (20, 27, 45, 47, 57).
In this study, we investigated the role of human TFIIIC in reversing the chromatin-mediated repression of a human tRNA gene. We show that elevated levels of TFIIIC can reverse this repression, that TFIIIC alone can bind to cognate DNA recognition sites in the chromatin template, that TFIIIC has an intrinsic HAT activity, and that a partial inhibition of HAT activity correlates with a partial reduction in transcription from chromatin (but not DNA) templates.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Purification of human core histones, nucleosome, and DNA topoisomerase I. Human core histones were purified from HeLa nuclear pellet. The pellet (5 ml) was homogenized with a blender in a 40 ml of buffer A (0.1 M potassium phosphate [pH 6.7], 0.1 mM EDTA, 10% glycerol, 0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM dithiothreitol [DTT]) containing 0.63 M sodium chloride and centrifuged at 25,000 rpm at 4°C. The supernatant was incubated with 18 ml of previously swollen Biogel-HTP resin (DNA grade; Bio-Rad) for 3 h. The resin was then packed into an Econo column (Bio-Rad) and washed overnight with buffer A containing 0.63 M NaCl to remove any contaminating HAT activity. The bound core histones were eluted with buffer A containing 2 M NaCl and dialyzed first against buffer B (10 mM potassium phosphate [pH 6.7], 150 mM KCl, 10% glycerol) for 3 h and then against BC100 buffer (20 mM Tris-HCl [pH 7.9], 100 mM KCl, 20% glycerol, 0.1 mM DTT) for 3 h. Native HeLa nucleosome was prepared as described elsewhere (10).
Human topoisomerase I was purified by modification of the procedure of Rossi et al. (39). The 2 to 3.9 M ammonium sulfate precipitation fraction of HeLa nuclear extract was resuspended in a buffer containing 50 mM HEPES (pH 7.0), 10 mM MgCl2, 3 mM MnCl2, 50 mM KCl, and 0.5 mM DTT and incubated with Qiagen Ni2+-nitrilotriacetic acid-agarose. The bound protein was eluted with buffer A containing 40 mM imidazole. The eluted proteins were then loaded onto a phosphocellulose (P11) column, and bound protein was step eluted with BC300, BC500, and BC1000. The DNA topoisomerase I activity was found in the BC1000 eluate. All operations were done at 4°C.Preparation of recombinant proteins.
The nucleosome assembly
protein 1 (NAP1) expression construct pET15d-NAP1 was obtained from
Tsutomu Ohta. Portions of the complete TFIIIC
cDNA (41)
were PCR amplified, and the products were subcloned into
Escherichia coli expression vector pET15d. Recombinant
proteins were expressed and purified with
Ni2+-nitrilotriacetic acid-agarose (Qiagen) as specified by
the manufacturer.
Purification of human TFIIIC, TFIIIB, TDF, and RNA polymerase
III.
Nuclear extract from a cell line expressing a FLAG-tagged
TFIIIC
subunit was used for immunopurification on M2 agarose and FLAG peptide elution of TFIIIC, in BC buffer containing 300 mM KCl and
0.1% Nonidet P-40, as described elsewhere (53). To monitor possible effects of nonspecifically bound proteins, nuclear extract from control (untagged) HeLa cells was subjected to immunoprecipitation (M2 agarose) and FLAG epitope elution under identical conditions; the
eluate is referred to as the mock immunoprecipitate. TFIIIB, TDF
(translation-dependent factor), and RNA polymerase III were prepared as
described elsewhere (53, 54).
In vitro reconstitution of chromatin. Supercoiled plasmid DNA containing a single copy of the human initiator methionine tRNA gene (55) was purified through two cesium chloride cycles, relaxed by incubation with topoisomerase I, and repurified by phenol extraction and ethanol precipitation. For chromatin assembly (14), NAP1 and core histones were incubated in assembly buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 150 mM NaCl, 100 µg of bovine serum albumin [BSA] per ml) at 37°C for 15 min, after which the relaxed DNA template was added and incubation continued for an additional 45 min at 37°C. Topoisomerase I was not added to the assembly reaction because purified core histones preparations contained trace amounts of topoisomerase I activity that appeared to be sufficient for assembly. The in vitro-assembled chromatin was chilled on ice for 30 min and either characterized by DNA supercoiling and partial micrococcal nuclease (MNase) digestion (4) assays or used directly for transcription and binding assays.
DNase I footprinting. DNase I primer extension footprinting analysis was performed as described elsewhere (17). DNA or assembled chromatin was incubated with TFIIIC in transcription buffer for 30 min at 30°C and then subjected to DNase I digestion. The DNA was purified and analyzed by primer extension using VentR (exo-) polymerase (New England Biolabs) and a primer (5'TCTTAAATTACGAGGTAGTCTGAA3') corresponding to the 5' region of the tRNA gene.
In vitro transcription assay. In vitro transcription assays were carried out as described elsewhere (53) in 50-µl reaction mixtures containing, unless otherwise noted, either 20 fmol (50 ng) of DNA or an equimolar amount of chromatin.
HAT assays. HAT assays were performed as described elsewhere (6, 30). For filter binding and electrophoretic solution assays, purified HeLa core histones (1 µg) were incubated for 30 min at 30°C with the indicated amounts of TFIIIC or control proteins in 30-µl reaction mixtures containing 50 mM Tris-HCl (pH 8.0), 10% glycerol, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM EDTA, 10 mM butyric acid, and 25 nCi of [3H]acetyl coenzyme A (acetyl-CoA). Radiolabeled histones were monitored either by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography or by Whatman P-81 filter binding and, after washing with 50 mM sodium carbonate buffer (pH 9.2), scintillation counting. In-gel HAT activity assays were performed as described elsewhere (30).
| |
RESULTS |
|---|
|
|
|---|
Reconstitution of a chromatin template. A chromatin template was assembled by incubation of a 3-kb plasmid containing a single copy of the human initiator methionine tRNA gene with core histones purified from HeLa nuclear pellet (Fig. 1A, lane 4), recombinant mouse NAP1 (Fig. 1A, lane 2), and topoisomerase I purified from HeLa nuclear extract (14). To optimize assembly, the extent of nucleosome formation was measured under various conditions by a DNA supercoiling assay (32). The results shown in Fig. 1B indicate that the previously relaxed plasmid (lane 1) gained the highest number of supercoils, with no intermediate forms, at a histone-to-DNA ratio of 1.5 (lane 2). At lower histone-to-DNA ratios, the extent of supercoiling (and hence chromatin assembly) was lower (Fig. 1B, lanes 3 and 4). A similar analysis at variable NaCl concentrations revealed an optimum of 150 mM for the maximal number of supercoils at a histone-to-DNA ratio of 1.5 (Fig. 1C, lane 6, and data not shown).
|
Human TFIIIC can relieve chromatin-mediated transcription repression. Although many class III genes, notably those encoding ubiquitously expressed tRNA genes, are constitutively active and devoid of a conventional nucleosome structure in vivo (reviewed in references 11, 28, and 31), this may reflect the activity of endogenous activators that prevent or reverse an otherwise repressive nucleosomal structure. Indeed, several studies have shown that prior assembly of class III genes (5S and tRNA) into nucleosomal structures in vitro represses their ability to be transcribed in various crude and partially purified systems (see the introduction). Consistent with these latter observations, the reconstituted chromatin template containing the tRNA gene was nearly completely inert in a HeLa nuclear extract, whereas an equimolar amount of the corresponding DNA template was highly active (Fig. 2B, lane 1 versus lane 3). Since TFIIIC is the primary promoter recognition factor for tRNA genes, the effect of ectopic TFIIIC addition to the extract was examined. For this purpose, TFIIIC containing a FLAG epitope-tagged subunit was affinity purified on M2 agarose by a method (Materials and Methods) that yields a TFIIIC complex containing both the 220-, 110-, 102-, 90-, and 63-kDa polypeptides of TFIIIC2 and other polypeptides that likely represent the subunits of TFIIIC1 (Fig. 2A, lane 2 versus lane 1) (55).
|
TFIIIC binds to the chromatin template.
Various DNA binding
and transcription studies with wild-type and mutated naked DNA
templates have shown that TFIIIC specifically binds to the A- and B-box
elements of the tRNA promoter and that this binding is essential for
transcription initiation (15, 52). Thus, given that
preincubation of TFIIIC with the almost completely inactive chromatin
can relieve the repression, the next step was to determine the
mechanism and, especially, whether TFIIIC could bind directly to
cognate sites in chromatin. To address this question, the chromatin
template that was used for the transcription experiments (Fig. 2B) was
incubated with affinity-purified TFIIIC and then subjected to a primer
extension-based DNase I footprint analysis (17). The
analysis in Fig. 3A clearly demonstrates that TFIIIC can bind to the promoter of the tRNA gene, as evidenced both by protection (positions +79 to +12) from cleavage on the A- and
B-box regions (mapped by sequencing free DNA) and by an enhanced
cleavage site at +89 (Fig. 3A, lane 6 versus lane 5). A comparative
analysis (Fig. 3A, lane 6, versus lanes 8 and 3 of Fig. 3B) revealed
similar interactions of TFIIIC on naked DNA and chromatin templates,
although the stronger interactions of human TFIIIC with the B-box
region (+79 to +33) relative to the A-box region on the naked DNA
template (52) may be more pronounced on the chromatin
template. Binding of TFIIIC to the chromatin template generates two
hypersensitive sites at +89 and
10 (Fig. 3A and B). The fact that a
10-fold-higher level of DNase I was needed for a comparable level of
DNA digestion within chromatin is further indicative of the presence of
the promoter region within a chromatin structure. Thus, a highly
purified human TFIIIC can directly recognize promoter sequences within
chromatin, consistent with similar observations for a number of other
DNA binding transcriptional activators, including nuclear hormone
receptors, TFIIIA, Gal4, Sp1, USF, and NF-
B (reviewed in references
3, 36, and 47).
|
Human TFIIIC is a unique HAT complex. Having demonstrated that TFIIIC can directly access DNA binding sites within chromatin and relieve the chromatin-mediated transcription repression, we investigated the underlying mechanism(s). It has been suggested that chromatin-mediated restrictions to transcription may be overcome by histone modifications, such as acetylation or phosphorylation, that facilitate promoter interactions either of primary DNA binding factors or of secondarily recruited general transcription factors (reviewed in references 12, 47, and 50). Given the demonstration of HAT-containing coactivators (reviewed in reference 43) and the ability of histone acetylation to facilitate both transcription factor binding (27) and RNA polymerase III-mediated transcription (47), we investigated the possibility of a HAT activity in TFIIIC. In a filter binding assay (Fig. 4A), affinity-purified TFIIIC gave levels of [3H]acetate incorporation (from [3H]acetyl-CoA) into core histone substrates that were significantly (12-fold) above the level observed with a mock immunoprecipitate (Fig. 4A, lane 1 versus lane 2). No HAT activity was detected in either highly purified RNA polymerase III or TFIIIB preparations (Fig. 4A, lanes 3 and 4). Further analysis in a solution assay followed by electophoretic resolution of radiolabeled proteins revealed a specific acetylation of histones H3 and H4 that was dependent on the presence of purified TFIIIC (Fig. 4B, lane 1; Fig. 4C, lane 2). More interestingly, we found that TFIIIC can also acetylate histones in native HeLa nucleosomes, with a specificity predominantly for histone H4 and to a lesser extent for histones H3 and H2A (Fig. 4D, lane 3). The recombinant p300 HAT domain (Fig. 4D, lane 1) and a mock immunoprecipitate (for TFIIIC) (Fig. 4D, lane 2) were used as positive and negative controls, respectively. Cumulatively, these results suggested that TFIIIC may contain an intrinsic HAT activity.
|
The 110-kDa subunit of human TFIIIC (TFIIIC
) is a bona fide
HAT.
Although the in-gel activity assay suggested the possibility
of HAT activity in three TFIIIC subunits, the present study has focused
on the 110-kDa (TFIIIC
) subunit. Three deletion mutants containing
amino acids 1 to 175 (N), 176 to 560 (M), and 561 to 911 (C) were made
to localize the HAT domain in TFIIIC
(Fig. 5A). After expression in and purification
from E. coli, equimolar amounts of purified recombinant
proteins (Fig. 5B) were analyzed by the in-gel activity assay with
either histones or BSA as substrates (Fig. 5C and D). With histone
substrates, the recombinant N and M fragments did not show any HAT
activity (Fig. 5C), whereas significant activity was observed for C
fragment. The gel activity assay with BSA as a substrate did not show
any radiolabeled band even with the C fragment (Fig. 5D), which
indicates again that TFIIIC
does not have autoacetylation activity.
Although we were unable to perform a solution assay with the C fragment
because of its complete insolubility when expressed in bacteria,
secondary analysis of the radiolabeled band from the in-gel assay
confirmed the specific labeling of histones (data not shown).
|
) subunit of human
TFIIIC has an intrinsic HAT activity and that the catalytic domain is
located at the C-terminal portion of the polypeptide. While confirming
that the HAT activity of TFIIIC is intrinsic to a bona fide TFIIIC
subunit, these results also suggest the possibility of intrinsic HAT
activities in other subunits. In support of this possibility, the
purified recombinant (baculovirus-expressed) 90 kDa subunit of TFIIIC
showed very strong HAT activity in solution assay (24).
Possible involvement of TFIIIC HAT activities in activating transcription from the chromatin template. Given effects of histone acetylation on chromatin structure and subsequent effects on transcription factor binding and function, as well as transcription activation function requiring the HAT activities (see the introduction), we explored the role of the TFIIIC HAT activity in activating transcription of the tRNA gene on the chromatin template. We found only a modest effect (10 to 15% increase) of ectopic acetyl-CoA on TFIIIC-enhanced transcription from the chromatin template in a partially purified reconstituted system (data not shown), which may have reflected the presence of endogenous acetyl-CoA (possibly protein bound) in the assay system. As an alternative approach, we investigated the use of p-hydroxymercuribenzoic acid (PMA), which was previously shown to inhibit the GCN5 HAT activity (6). To avoid potentially nonspecific effects of PMA on the activity of other factors, TFIIIC was first treated with various concentrations of PMA and then diluted 17-fold into HAT or transcription assay mixtures. A filter binding assay revealed up to 70% inhibition of HAT activity at 0.05 mM PMA (Fig. 6A), consistent with the results observed with GCN5 (6).
|
| |
DISCUSSION |
|---|
|
|
|---|
The general class III factor TFIIIC, as the primary promoter recognition factor for tRNA and VA RNA genes, plays a key role in nucleating the assembly of preinitiation complexes on cognate DNA templates (see the introduction). We report here that (i) highly purified human TFIIIC both binds to cognate promoter recognition sites (A and B boxes) in the context of a chromatin template and facilitates reversal of the chromatin-mediated repression of tRNA gene transcription in vitro and (ii) TFIIIC contains an intrinsic HAT activity that may be involved in relief of chromatin-mediated repression. These results suggest a role for TFIIIC beyond preinitiation complex assembly and are discussed with respect to established relationships of histone acetylation and HAT-containing coactivators to gene activation and the dominant effect of transcription over nucleosome assembly on tRNA genes in vivo.
Human TFIIIC binds to promoter elements within chromatin and relieves repression of chromatin-mediated transcription. Although it is generally difficult to observe tRNA gene repression and concomitant nucleosome formation in vivo, the latter can be observed with promoter mutations that inhibit transcription (28, 31). Consistent with the possibility of nucleosome-mediated tRNA gene repression in vivo in the absence of appropriate factors, and with chromatin-mediated repression of other class III genes in vitro (see the introduction), preassembled tRNA gene-containing chromatin templates are inactive in nuclear extracts that are fully competent for transcription of corresponding DNA templates. Importantly, however, ectopic TFIIIC relieves chromatin-mediated repression of tRNA gene transcription (i.e., activates the chromatin template) but has no effect on transcription of an equimolar amount of purified DNA template that nonetheless requires endogenous TFIIIC.
How might elevated levels of TFIIIC facilitate transcription of a chromatin template? Studies of gene-specific DNA binding transcriptional activators have revealed that most are unable to bind effectively to cognate DNA sites within chromatin without the aid of chromatin remodeling factors such the various ATP-dependent complexes, HATs, or other DNA binding proteins. Some, however, directly recognize cognate sites in a manner dependent on their rotational positions within nucleosomes (reviewed in references 3, 36, 47, and 58). In the present study, TFIIIC was shown to resemble the latter class of factors and to bind directly to chromatin templates reconstituted with homogeneous components. TFIIIC interactions are strong over the B box and weak over the A box in comparison to the relatively strong interactions over both the A and B boxes on DNA templates. The basis for the difference is not known, but the B box is the primary binding site for the TFIIIC2 component of TFIIIC (reviewed in reference 52), and the A-box interactions within chromatin could depend either on cooperative interactions with other RNA polymerase III accessory factors (see the introduction) or on secondary functions of TFIIIC (see below). Changes in chromatin structure upon TFIIIC binding are also evident from induced hypersensitive sites in both standard DNase footprinting (Fig. 3) and indirect end labeling (data not shown) assays. These results indicate that the antirepressive effects of TFIIIC may reflect, at least in part, direct site-specific binding to chromatin and that the higher threshold for TFIIIC function with chromatin templates may reflect a lower affinity for promoter sites (in chromatin) and/or a secondary function (below) requiring a high TFIIIC concentration.TFIIIC has an intrinsic HAT activity. Recently several transcriptional coactivators for class II genes have been shown to have intrinsic HAT activities (see the introduction), which in some cases have been shown to be essential for coactivator function (below). The human TFIIIC-associated HAT activity described here acetylates both free and nucleosomal histones H3 and H4 in solution (Fig. 4). Moreover, TFIIIC also acetylates histone H2A, as well as histones H3 and H4, in native HeLa nucleosomes. In this regard, the TFIIIC HAT activity does not resemble that of the core promoter recognition factor TFIID (activity contributed by the largest TAF subunit), which acetylates only free histones H3 and H4 (29). The ability of TFIIIC to acetylate nucleosomal histones also suggests that the HAT activity may be directly involved in TFIIIC-mediated chromatin transcription.
Somewhat surprisingly, the present results have indicated the presence of three TFIIIC subunits (220, 110, and 90 kDa) with HAT activity, and intrinsic HAT activities have been verified by analysis of recombinant bacterially (110 kDa)- and baculovirus (90 kDa)-expressed polypeptides. This apparently novel situation is thus far unique to TFIIIC, as the HAT activities of other multisubunit complexes (TFIID, yeast SAGA, and human GCN5 and pCAF complexes) have been ascribed to single polypeptides (reviewed in references 18 and 35). Although other HAT-containing coactivators (CBP/p300, pCAF, and SRC family members) may act synergistically through interactions with each other and with common targets (9, 42, 43), there is no indication that they form highly stable complexes comparable to TFIIIC (55). Interestingly, homology searches thus far have failed to reveal any sequence relationships between the broadly mapped TFIIIC
HAT domain and other HAT domains.
Possible role of human TFIIIC HAT activity on chromatin-templated transcription by RNA polymerase III. A role for histone acetylation in transcription from natural (chromatin) templates is suggested by (i) a general (but not absolute) correlation between specific gene activity and the presence of hyperacetylated histones (reviewed in reference 46), (ii) the enhanced transcription factor binding and template capabilities of chromatin reconstituted with highly acetylated histones (27, 49), (iii) the requirement of coactivator HAT activities for both promoter-directed histone acetylation and coactivator function in vivo (25, 29, 51), (iv) an acetyl-CoA-dependent transcription function of a GCN5-containing complex on a chromatin template in vitro (48), and (v) the association of various transcriptional corepressors with histone deacetylases and enhanced transcription in response to deacetylase inhibitors (reviewed in reference 37).
Consistent with a possible role of TFIIIC HAT activity in the TFIIIC-dependent reversal of chromatin-mediated repression, the HAT inhibitor PMA was found to partially inhibit both the HAT and chromatin transcription activities of TFIIIC but not the DNA transcription activity. These results, though not conclusive, suggest that the TFIIIC HAT activity may be at least partially required for the relief of chromatin-mediated repression. More definitive studies await the development of more potent and more specific inhibitors of HAT activities, a more purified in vitro transcription system (possibly with artificially positioned nucleosomes [48]) that responds to acetyl-CoA, and the ability to reconstitute TFIIIC with mutations in component subunit HAT domain(s). The latter is complicated by the multiplicity of subunits with HAT activity, a current lack of information on the actual HAT domains, and the lack of an in vitro system that would allow assembly of TFIIIC with multiple mutated subunits. The lack of an ectopic acetyl-CoA requirement for TFIIIC-dependent transcription of chromatin in the present study may reflect endogenous acetyl-CoA in the incompletely purified assay system, whereas the failure of acetyl-CoA to alter the binding of highly purified TFIIIC to the chromatin template (data not shown) also suggests that the initial binding of TFIIIC is independent of histone acetylation. Overall, the results presented here suggest dual functions for TFIIIC in activation of tRNA gene transcription from chromatin templates and lead us to tentatively suggest the following working model. First, consistent with its documented role in preinitiation complex assembly on DNA templates, TFIIIC recognizes and binds to one or more of the core promoter DNA recognition sites within chromatin; however, these interactions may be weaker and incomplete compared to those observed on naked DNA. Second, through additional interactions with RNA polymerase III and other general initiation factors, and possibly in conjugation with the intrinsic TFIIIC HAT activity on adjacent nucleosomes, chromatin remodeling is completed and a functional preinitiation complex is formed. This model is the one that is most obvious and most consistent with the surprising finding of an intrinsic HAT activity in TFIIIC, which otherwise remains to be explained. However, it does not exclude the participation of other nucleosome remodeling activities or a possible role for TFIIIC in directly modulating the action of an interacting transcription factor through acetylation (19). The same arguments about the possible involvement of nucleosome remodeling activities may also pertain to the case of yeast U6 gene transcription, which was shown to exhibit a conditional (chromatin-imposed) requirement for TFIIIC in vitro and to be activated by histone depletion in vivo only when presumptive natural TFIIIC-promoter interactions are compromised by promoter mutation (8, 28). However, these studies demonstrated neither direct binding of TFIIIC to chromatin independently of other factors nor any associated enzyme activity that might be involved in the antirepression functions. Interestingly, although the HAT-containing subunits of human TFIIIC show no significant sequence relationship to known S. cerevisiae TFIIIC subunits or to database sequences, the 102- and 63-kDa human TFIIIC subunits are related in sequence and function to the 135- and 95-kDa subunits of yeast TFIIIC (21). Along with the fact that domains responsible for the human TFIIIC HAT activities are not highly conserved, this finding leaves open the possibility of TFIIIC-associated HAT activity in yeast as well.| |
ACKNOWLEDGMENTS |
|---|
We thank Y. Nakatani for the p300 HAT domain expression vector and for critical comments on the manuscript, Tsutomu Ohta for providing the NAP1 expression plasmid, S. Malik for help with the HeLa topoisomerase I purification, and V. Palhan for critical reading of the manuscript.
This work was supported by a grant from the NIH to R.G.R.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-7600. Fax: (212) 327-7949. E-mail: Roeder{at}rockvax.rockefeller.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Arrebola, R.,
N. Manaud,
S. Rosenfeld,
M. C. Marsolier,
O. Lefebvre,
C. Carles,
P. Thuriaux,
C. Conesa, and A. Sentenac.
1998.
91, an essential subunit of yeast transcription factor IIIC, cooperates with 138 in DNA binding.
Mol. Cell. Biol.
18:1-9 |
| 2. | Bannister, A. J., and T. Kouzarides. 1996. The CBP coactivator is a histone acetyltransferase. Nature 384:641-643[Medline]. |
| 3. |
Beato, M., and K. Eisfeld.
1997.
Transcription factor access to chromatin.
Nucleic Acids Res.
25:3559-3563 |
| 4. |
Becker, P. B., and C. Wu.
1992.
Cell-free system for assembly of transcriptionally repressed chromatin from Drosophila embryos.
Mol. Cell. Biol.
12:2241-2249 |
| 5. | Bogenhagen, D. F., W. M. Wormington, and D. D. Brown. 1982. Stable transcription complex of Xenopus 5S RNA genes: a means to maintain the differentiated state. Cell 28:413-421[Medline]. |
| 6. |
Brownell, J. E., and C. D. Allis.
1995.
An activity gel assay detects a single, catalytically active histone acetyltransferase subunit in tetrahymena macronuclei.
Proc. Natl. Acad. Sci. USA
92:6364-6368 |
| 7. | Brownell, J. E., J. Zhou, T. Ranalli, R. Kobayashi, D. G. Edmondson, S. Y. Roth, and C. D. Allis. 1996. Tetrahymena histone acetyltransferase A: a homolog of yeast Gcn5p linking histone acetylation to gene activation. Cell 84:843-851[Medline]. |
| 8. | Burnol, A.-F., F. Margottin, J. Huet, G. Almouzni, M.-N. Prioleau, M. Mechali, and A. Setenac. 1993. TFIIIC relieves repression of U6 snRNA transcription by chromatin. Nature 362:475-477[Medline]. |
| 9. | Chen, H., R. J. Lin, R. I. Schiltz, D. Chakaroborty, A. Nash, L. Nagy, M. L. Privalsky, Y. Nakatani, and R. M. Evans. 1997. Nuclear receptor coactivator ACTR is a novel histone acetyl transferase and forms a multimeric activation complex with p/CAF and CBP/p300. Cell 90:569-580[Medline]. |
| 10. | Cote, J., R. T. Utley, and J. L. Workman. 1995. Basic analysis of transcription factor binding to nucleosomes. Methods Mol. Genet. 6:108-152. |
| 11. | Dammann, R., and G. P. Pfeifer. 1997. Lack of gene- and strand-specific DNA repair in RNA polymerase III-transcribed human tRNA genes. Mol. Cell. Biol. 17:219-229[Abstract]. |
| 12. | Felsenfeld, G. 1996. Chromatin unfolds. Cell 86:3-19. |
| 13. |
Felts, S. J.,
P. A. Weil, and R. Chalkley.
1990.
Transcription factor requirements for in vitro formation of transcriptionally 5S competent rRNA gene chromatin.
Mol. Cell. Biol.
10:2390-2401 |
| 14. |
Fuji-Nakata, T.,
Y. Ishimi,
A. Okuda, and A. Kikuchi.
1992.
Functional analysis of nucleosome assembly protein, NAP-1: the negatively charged COOH-terminal region is not necessary for the intrinsic assembly activity.
J. Biol. Chem.
267:20980-20986 |
| 15. | Geiduscheck, E. P., and G. A. Kassavetis. 1992. RNA polymerase III transcription complex, p. 247-279. In S. L. McKnight, and K. R. Yamamoto (ed.), Transcription regulation. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. |
| 16. | Gottesfeld, J., and L. S. Bloomer. 1982. Assembly of transcriptionally active 5S RNA gene chromatin in vitro. Cell 28:781-791[Medline]. |
| 17. |
Gralla, J. D.
1985.
Rapid "footprinting" on supercoiled DNA.
Proc. Natl. Acad. Sci. USA
82:3078-3081 |
| 18. | Grant, P. A., D. Schieltz, M. G. Pray-Grant, D. J. Steger, J. C. Reese, J. R. Yates III, and J. L. Workman. 1998. A subset of TBP-associated factors, TAFIIs, are integral components of the SAGA complex that are required for nucleosome acetylation and transcription stimulation. Cell 94:45-53[Medline]. |
| 19. | Gu, W., and R. G. Roeder. 1997. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595-606[Medline]. |
| 20. |
Howe, L., and J. Ausio.
1998.
Nucleosome translational position, not histone acetylation, determines TFIIIA binding to nucleosomal Xenopus laevis 5S rRNA genes.
Mol. Cell. Biol.
18:1156-1162 |
| 21. | Hseih, J.-H., Z. Wang, R. Covelman, and R. G. Roeder. Cloning and characterization of two evolutionary-conserved subunits (TFIIIC 102 and TFIIIC 63) of human TFIIIC and their involvement in functional interactions with TFIIIB and RNA polymerase III. Submitted for publication. |
| 22. | Ito, T., J. K. Tyler, and J. T. Kadonaga. 1997. Chromatin assembly factors: a dual function in nucleosome formation and mobilization? Genes Cells 2:593-600[Abstract]. |
| 23. |
Kovelman, R., and R. G. Roeder.
1992.
Purification and characterization of two forms of human transcription factor TFIIIC.
J. Biol. Chem.
267:24446-24456 |
| 24. | Kundu, T. K., Y.-H. Hseih, and R. G. Roeder. Unpublished data. |
| 25. |
Kuo, M-H.,
J. Zhou,
P. Jambeck,
M. E. A. Churchill, and C. D. Allis.
1998.
Histone acetyltransferase activity of yeast Gcn5 is required for the activation of target genes in vivo.
Genes Dev.
12:627-639 |
| 26. | Langst, G., T. A. Blank, P. B. Becker, and I. Grummt. 1997. RNA polymerase I transcription on nucleosomal templates: the transcription termination factor TTF-I induces chromatin remodeling and relieves transcriptional repression. EMBO J. 16:760-768[Medline]. |
| 27. | Lee, D. Y., J. J. Hayes, D. Pruss, and A. P. Wolffe. 1993. A positive role of histone acetylation in transcription factor access to nucleosomal DNA. Cell 72:73-74[Medline]. |
| 28. |
Marsolier, M. C.,
S. Tanaka,
M. Livingstone-Zatchej,
M. Grunstein,
F. Thoma, and A. Sentenac.
1995.
Reciprocal interferences between nucleosomal organization and transcriptional activity of the yeast SNR6 gene.
Genes Dev.
9:410-422 |
| 29. | Martinez-Balbas, M. A., A. J. Bannister, K. Martin, P. Haus-Seuffert, M. Meisterernst, and T. Kouzarides. 1998. The acetyltransferase activity of CBP stimulates transcription. EMBO J. 17:2886-2893[Medline]. |
| 30. | Mizzen, C. A., X. J. Yang, T. Kokubo, J. E. Brownell, A. J. Bannister, T. Owen-Hughes, J. Workman, L. Wang, S. L. Berger, T. Kouzarides, Y. Nakatani, and C. D. Allis. 1996. The TAF¶250 subunit of TFIID has histone acetyltransferase activity. Cell 87:1261-1270[Medline]. |
| 31. |
Morse, R. H.,
S. Y. Roth, and R. T. Simpson.
1992.
A transcriptional active tRNA gene interferes with nucleosome positioning in vivo.
Mol. Cell. Biol.
12:4015-4025 |
| 32. |
Nelson, T.,
T. Hsieh, and D. Brutlag.
1979.
Extract of Drosophila embryos mediate chromatin assembly in vitro.
Proc. Natl. Acad. Sci. USA
76:5510-5514 |
| 33. | Noll, M., and R. D. Kornberg. 1977. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109:393-404[Medline]. |
| 34. | Ogryzko, V. V., R. L. Schiltz, V. Russanvoa, B. H. Howard, and Y. Nakatani. 1996. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953-959[Medline]. |
| 35. | Ogryzko, V. V., T. Kotani, X. Zhang, R. L. Schiltz, T. Howard, X.-J. Yang, B. H. Howard, J. Qion, and Y. Nakatani. 1998. A histone octamer like structure within the PCAF histone acetyltransferase complex. Cell 94:35-44[Medline]. |
| 36. | Owen-Hughes, T. A., and J. L. Workman. 1996. Remodeling the chromatin structure of a nucleosome array by transcription factor-targeted trans-displacement of histones. EMBO J. 15:4702-4712[Medline]. |
| 37. | Pazin, M. J., and J. T. Kadonaga. 1997. What's up and down with histone deacetylation and transcription? Cell 89:325-328[Medline]. |
| 38. | Roeder, R. G. 1996. Nuclear RNA polymerases: role of general initiation factors and cofactors in eukaryotic transcription. Methods Enzymol. 273:165-171[Medline]. |
| 39. | Rossi, F., E. Labourier, T. Forne, G. Divita, J. Derancourt, J. F. Riou, E. Antoine, G. Cathala, C. Brunel, and J. Tazi. 1996. Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I. Nature 381:80-82[Medline]. |
| 40. | Roth, S. Y., and C. D. Allis. 1996. The subunit-exchange model of histone acetylation. Trends Cell Biol. 6:371-375. [Medline] |
| 41. |
Sinn, E.,
Z. Wang,
R. Kovelman, and R. G. Roeder.
1995.
Cloning and characterization of a TFIIIC2 subunit (TFIIIC ) whose presence correlates with activation of RNA polymerase III mediated transcription by adenovirus E1A expression and serum factors.
Genes Dev.
9:675-685 |
| 42. | Spencer, T. E., G. Jenster, M. M. Burcin, C. D. Allis, J. Zhou, C. A. Mizzen, N. J. McKenna, S. A. Onate, S. Y. Tasi, M. J. Tasi, and B. W. O'Malley. 1997. Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194-198[Medline]. |
| 43. |
Struhl, K.
1998.
Histone acetylation and transcriptional regulatory mechanisms.
Genes Dev.
12:599-606 |
| 44. |
Tremethick, D.,
K. Zucker, and A. Worcel.
1990.
The transcription complex of the 5S RNA gene, but not transcription factor IIIA alone, prevents nucleosomal repression of transcription.
J. Biol. Chem.
265:5014-5023 |
| 45. |
Tse, C.,
T. Sera,
A. P. Wolffe, and J. C. Hansen.
1998.
Disruption of higher-order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III.
Mol. Cell. Biol.
18:4629-4638 |
| 46. | Turner, B. M., and L. P. O'Neill. 1995. Histone acetylation in chromatin and chromosomes. Semin. Cell Biol. 6:229-236[Medline]. |
| 47. | Ura, K., H. Kurumizaka, S. Dimitrov, G. Almouzni, and A. P. Wolffe. 1997. Histone acetylation: influence on transcription, nucleosome mobility and positioning, and linker histone-dependent transcriptional repression. EMBO J. 16:2096-2107[Medline]. |
| 48. | Utley, R. T., K. Ikeda, P. A. Grant, J. Cote, D. J. Steger, A. Eberharter, S. John, and J. L. Workman. 1998. Transcriptional activators direct histone acetyltransfersae complexes to nucleosomes. Nature 394:498-502[Medline]. |
| 49. | Vettese-Dadey, M., P. A. Grant, T. R. Hebbes, C. Crane-Robinson, C. D. Allis, and J. L. Workman. 1996. Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J. 15:2508-2518[Medline]. |
| 50. | Wade, P. A., D. Pruss, and A. P. Wolffe. 1997. Histone acetylation: chromatin in action. Trends Biochem. Sci. 22:128-188[Medline]. |
| 51. |
Wang, L.,
L. Lin, and S. L. Berger.
1998.
Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo.
Genes Dev.
12:640-653 |
| 52. | Wang, Z., and R. G. Roeder. 1996. TFIIIC1 acts through a downstream region to stabilize TFIIIC2 binding to RNA polymerase III promoters. Mol. Cell. Biol. 12:6841-6850. |
| 53. |
Wang, Z., and R. G. Roeder.
1997.
Three human RNA polymerase III-specific subunits from a subcomplex with a selective function in specific transcription initiation.
Genes Dev.
11:1315-1326 |
| 54. |
Wang, Z.,
T. Luo, and R. G. Roeder.
1997.
Identification of an autonomously initiating RNA polymerase III holoenzyme containing a novel factor that is selectively inactivated during protein synthesis inhibition.
Genes Dev.
11:2371-2382 |
| 55. | Wang, Z., and R. G. Roeder. 1998. DNA topoisomerase I and PC4 can interact with human TFIIIC to promote both accurate termination and transcription initiation by RNA polymerase III. Mol. Cell. 1:749-757[Medline]. |
| 56. | Willis, I. M. 1993. RNA polymerase III: genes, factors and transcriptional specificity. Eur. J. Biochem. 212:1-11[Medline]. |
| 57. | Wolffe, A. P., J. Wong, and P. Dmitry. 1997. Activator and repressor: making use of chromatin to regulate transcription. Genes Cells 2:291-302[Abstract]. |
| 58. |
Wu, C.
1997.
Chromatin remodeling and the control of gene expression.
J. Biol. Chem.
272:28171-28174 |
| 59. | Yang, X., V. Ogryzko, J. Nishikawa, B. Howard, and Y. Nakatani. 1996. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319-324[Medline]. |
| 60. |
Yoshinaga, S. T.,
N. D. L'Etoile, and A. J. Berk.
1989.
Purification and characterization of transcription factor TFIIIC2.
J. Biol. Chem.
264:10726-10731 |
This article has been cited by other articles: