Previous Article
Molecular and Cellular Biology, February 1999, p. 1605-1615, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Human TFIIIC Relieves Chromatin-Mediated Repression
of RNA Polymerase III Transcription and Contains an Intrinsic
Histone Acetyltransferase Activity
Tapas K.
Kundu,
Zhengxin
Wang, and
Robert G.
Roeder*
Laboratory of Biochemistry and Molecular
Biology, The Rockefeller University, New York, New York 10021
Received 1 October 1998/Returned for modification 30 October
1998/Accepted 12 November 1998
 |
ABSTRACT |
Human TFIIIC is a multisubunit factor that is essential for
transcription by RNA polymerase III on tRNA and virus-associated RNA
genes and initiates preinitiation complex assembly by direct recognition of promoter elements. We show that highly purified TFIIIC,
at concentrations above those sufficient for transcription of naked DNA
templates, effectively relieves nucleosome-mediated repression on an in
vitro-reconstituted chromatin template. Highly purified TFIIIC alone
can bind to the A and B boxes of a tRNA gene within a chromatin
template and, further, displays a histone acetyltransferase activity
that is intrinsic to at least one (and probably three) of its subunits.
The possibility of a direct link between TFIIIC-dependent chromatin
transcription and acetyltransferase activities is suggested by the
partial loss of these activities, but not DNA transcription activity,
following pretreatment of TFIIIC with
p-hydroxymercuribenzoic acid.
 |
INTRODUCTION |
Most genes encoding small structural
RNAs are transcribed by RNA polymerase III, and transcription from
cognate DNA templates requires various accessory factors. These include
common factors, TFIIIC and TFIIIB, that suffice for transcription of
some genes (tRNA, virus-associated [VA] RNA, and yeast U6 RNA genes)
and, in some cases, gene-specific factors (e.g., TFIIIA for 5S RNA genes and PTF/SNAPc for mammalian U6 and 7SK genes) (reviewed in
reference 38). In the best-studied cases,
preinitiation complex assembly involves direct promoter recognition by
TFIIIC (A and B boxes in tRNA, VA RNA, and yeast U6 genes) or by TFIIIA
and TFIIIC (A and C boxes in 5S RNA genes), TFIIIB recruitment through interactions with TFIIIC, and RNA polymerase III recruitment through interactions with TFIIIB (reviewed in references 15
and 56). Consistent with conservation of the
assembly pathway from yeast to human, there is a corresponding
conservation in structure and function of the TFIIIB and RNA polymerase
III subunits (reviewed in reference 55). TFIIIC, by
contrast, shows more divergence in structure. Saccharomyces
cerevisiae TFIIIC is composed of six subunits and binds to both A
and B boxes (reviewed in reference 1), whereas human
TFIIIC contains at least nine subunits (55) and can be
resolved into a five-subunit complex (TFIIIC2) that binds weakly to the
B box and a less well characterized complex (TFIIIC1) that stabilizes
TFIIIC2 binding to A and B boxes (23, 52, 60). Other factors
derived from TFIIIC preparations also stabilize TFIIIC binding
throughout promoter and terminator regions (reviewed in reference
55).
Several in vitro studies have shown that preassembly of class III genes
into chromatin generally blocks transcription by concentrations of RNA
polymerase III and accessory factors that suffice for transcription from cognate DNA templates, whereas prebinding of accessory factors can
prevent this repression (5, 13, 16, 44). In addition, in
vivo studies of active and inactive (mutated) class III genes have
demonstrated that active transcription interferes with local nucleosome
formation and, in the case of the yeast U6 gene, that intracellular
chromatin disruption enhances transcription only when the B box is
mutated and TFIIIC interactions are impaired (28, 31). It
was further shown that TFIIIC and the B box of the yeast U6 gene (which
also contains functional TATA- and A-box elements) are required for in
vitro transcription from chromatin templates but not from DNA templates
(8). These studies reveal a dominant role for TFIIIC and the
cognate B box in overcoming nucleosome formation and transcriptional
repression. However, they do not establish the molecular basis for
this
specifically, whether intrinsic TFIIIC-promoter DNA interactions
in the context of a chromatin template suffice, with subsequent TFIIIB
and RNA polymerase III interactions, for relief (or prevention) of
repression or whether additional factors and/or chromatin modifications
are also important.
Although several factors have been reported to bind to cognate DNA
sites within chromatin in the absence of additional factors (reviewed
in references 3, 36, and 47),
recent studies have identified a variety of genetically and
biochemically defined factors that may facilitate transcription of
class II genes through chromatin remodeling. One group includes
ATP-dependent nucleosome remodeling factors (e.g., NURF, SWI-SNF, ACF,
and CHRAC complexes) that are thought to facilitate transcription
factor binding or function through alteration of nucleosome structure
or position (reviewed in references 22, 57, and
;58). A second group includes transcriptional
coactivators with histone acetyltransferase (HAT) activities that,
through acetylation of N-terminal lysines, alter histone-DNA
interactions and nucleosomal stability (reviewed in references
40, 43, 50, and 57). Examples
include GCN5 and pCAF (7, 59), CBP and p300 (2,
34), steroid receptor coactivator 1 (SRC-1) and ACTR (9,
42), and TATA-box binding protein-associated factor
TAFII250 (30). Although functions in
transcription activation have been identified for these factors, direct
roles for the intrinsic HAT activities in transcription are not broadly
established. The most notable exceptions are yeast GCN5 (25, 48,
51), whose modifications of promoter-proximal histones also
appears to be causal for transcription, and human CBP (28).
Effects of HAT-containing factors on transcription of class III genes
have not been reported, although the incorporation of acetylated
histones into 5S gene-containing chromatin templates has been reported
to facilitate both TFIIIA binding and TFIIIA-dependent transcription on
chromatin templates (20, 27, 45, 47, 57).
In this study, we investigated the role of human TFIIIC in reversing
the chromatin-mediated repression of a human tRNA gene. We show that
elevated levels of TFIIIC can reverse this repression, that TFIIIC
alone can bind to cognate DNA recognition sites in the chromatin
template, that TFIIIC has an intrinsic HAT activity, and that a partial
inhibition of HAT activity correlates with a partial reduction in
transcription from chromatin (but not DNA) templates.
 |
MATERIALS AND METHODS |
Purification of human core histones, nucleosome, and DNA
topoisomerase I.
Human core histones were purified from HeLa
nuclear pellet. The pellet (5 ml) was homogenized with a blender in a
40 ml of buffer A (0.1 M potassium phosphate [pH 6.7], 0.1 mM EDTA,
10% glycerol, 0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM
dithiothreitol [DTT]) containing 0.63 M sodium chloride and
centrifuged at 25,000 rpm at 4°C. The supernatant was incubated with
18 ml of previously swollen Biogel-HTP resin (DNA grade; Bio-Rad) for
3 h. The resin was then packed into an Econo column (Bio-Rad) and
washed overnight with buffer A containing 0.63 M NaCl to remove any
contaminating HAT activity. The bound core histones were eluted with
buffer A containing 2 M NaCl and dialyzed first against buffer B (10 mM
potassium phosphate [pH 6.7], 150 mM KCl, 10% glycerol) for 3 h
and then against BC100 buffer (20 mM Tris-HCl [pH 7.9], 100 mM KCl,
20% glycerol, 0.1 mM DTT) for 3 h. Native HeLa nucleosome was
prepared as described elsewhere (10).
Human topoisomerase I was purified by modification of the procedure of
Rossi et al. (39). The 2 to 3.9 M ammonium sulfate precipitation fraction of HeLa nuclear extract was resuspended in a
buffer containing 50 mM HEPES (pH 7.0), 10 mM MgCl2, 3 mM MnCl2, 50 mM KCl, and 0.5 mM DTT and incubated with Qiagen
Ni2+-nitrilotriacetic acid-agarose. The bound protein was
eluted with buffer A containing 40 mM imidazole. The eluted proteins
were then loaded onto a phosphocellulose (P11) column, and bound
protein was step eluted with BC300, BC500, and BC1000. The DNA
topoisomerase I activity was found in the BC1000 eluate. All operations
were done at 4°C.
Preparation of recombinant proteins.
The nucleosome assembly
protein 1 (NAP1) expression construct pET15d-NAP1 was obtained from
Tsutomu Ohta. Portions of the complete TFIIIC
cDNA (41)
were PCR amplified, and the products were subcloned into
Escherichia coli expression vector pET15d. Recombinant
proteins were expressed and purified with
Ni2+-nitrilotriacetic acid-agarose (Qiagen) as specified by
the manufacturer.
Purification of human TFIIIC, TFIIIB, TDF, and RNA polymerase
III.
Nuclear extract from a cell line expressing a FLAG-tagged
TFIIIC
subunit was used for immunopurification on M2 agarose and FLAG peptide elution of TFIIIC, in BC buffer containing 300 mM KCl and
0.1% Nonidet P-40, as described elsewhere (53). To monitor possible effects of nonspecifically bound proteins, nuclear extract from control (untagged) HeLa cells was subjected to immunoprecipitation (M2 agarose) and FLAG epitope elution under identical conditions; the
eluate is referred to as the mock immunoprecipitate. TFIIIB, TDF
(translation-dependent factor), and RNA polymerase III were prepared as
described elsewhere (53, 54).
In vitro reconstitution of chromatin.
Supercoiled plasmid
DNA containing a single copy of the human initiator methionine tRNA
gene (55) was purified through two cesium chloride cycles,
relaxed by incubation with topoisomerase I, and repurified by phenol
extraction and ethanol precipitation. For chromatin assembly
(14), NAP1 and core histones were incubated in assembly
buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 150 mM NaCl, 100 µg of
bovine serum albumin [BSA] per ml) at 37°C for 15 min, after which
the relaxed DNA template was added and incubation continued for an
additional 45 min at 37°C. Topoisomerase I was not added to the
assembly reaction because purified core histones preparations contained
trace amounts of topoisomerase I activity that appeared to be
sufficient for assembly. The in vitro-assembled chromatin was chilled
on ice for 30 min and either characterized by DNA supercoiling and
partial micrococcal nuclease (MNase) digestion (4) assays or
used directly for transcription and binding assays.
DNase I footprinting.
DNase I primer extension footprinting
analysis was performed as described elsewhere (17). DNA or
assembled chromatin was incubated with TFIIIC in transcription buffer
for 30 min at 30°C and then subjected to DNase I digestion. The DNA
was purified and analyzed by primer extension using VentR
(exo-) polymerase (New England Biolabs) and a primer
(5'TCTTAAATTACGAGGTAGTCTGAA3') corresponding to the 5'
region of the tRNA gene.
In vitro transcription assay.
In vitro transcription assays
were carried out as described elsewhere (53) in 50-µl
reaction mixtures containing, unless otherwise noted, either 20 fmol
(50 ng) of DNA or an equimolar amount of chromatin.
HAT assays.
HAT assays were performed as described elsewhere
(6, 30). For filter binding and electrophoretic solution
assays, purified HeLa core histones (1 µg) were incubated for 30 min
at 30°C with the indicated amounts of TFIIIC or control proteins in
30-µl reaction mixtures containing 50 mM Tris-HCl (pH 8.0), 10%
glycerol, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM EDTA, 10 mM butyric acid, and 25 nCi of [3H]acetyl coenzyme A
(acetyl-CoA). Radiolabeled histones were monitored either by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
autoradiography or by Whatman P-81 filter binding and, after washing
with 50 mM sodium carbonate buffer (pH 9.2), scintillation counting.
In-gel HAT activity assays were performed as described elsewhere
(30).
 |
RESULTS |
Reconstitution of a chromatin template.
A chromatin template
was assembled by incubation of a 3-kb plasmid containing a single copy
of the human initiator methionine tRNA gene with core histones purified
from HeLa nuclear pellet (Fig. 1A, lane
4), recombinant mouse NAP1 (Fig. 1A, lane 2), and topoisomerase I
purified from HeLa nuclear extract (14). To optimize
assembly, the extent of nucleosome formation was measured under various
conditions by a DNA supercoiling assay (32). The results
shown in Fig. 1B indicate that the previously relaxed plasmid (lane 1)
gained the highest number of supercoils, with no intermediate forms, at
a histone-to-DNA ratio of 1.5 (lane 2). At lower histone-to-DNA ratios,
the extent of supercoiling (and hence chromatin assembly) was lower
(Fig. 1B, lanes 3 and 4). A similar analysis at variable NaCl
concentrations revealed an optimum of 150 mM for the maximal number of
supercoils at a histone-to-DNA ratio of 1.5 (Fig. 1C, lane 6, and data
not shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
Reconstitution of chromatin in assays using purified
proteins. (A) Analysis of purified proteins by SDS-PAGE (15% gel) and
Coomassie blue staining. Lane 2, 3 µg of recombinant
His6-tagged mouse NAP1; lane 4, 5 µg of human core
histones; lanes 1 and 3, molecular weight markers (Bio-Rad). (B) DNA
supercoiling assay for the optimum histone-to-DNA ratio. Chromatin was
assembled with fixed amounts of histones and NAP1 but increasing
concentrations (as indicated or the actual amounts) of relaxed circular
DNA. (C) DNA supercoiling assay for the optimum salt concentration.
Chromatin was assembled at NaCl concentrations of 0, 20, 25, 50, 100, and 150 mM. (D) MNase digestion analysis. Assembled chromatin was
treated with increasing concentrations of MNase at room temperature.
After deproteinization, the resulting DNA was resolved on a 1.5%
agarose gel, transferred to nitrocellulose, and hybridized with a
5'-32P-labeled probe
(5'TTCGGGGCGAAAACTCTCAAGGATCTTACCG3') corresponding to plasmid
sequence just outside the promoter region. The bands were visualized by
autoradiography.
|
|
Since H3-H4 tetramers and various nonhistone proteins can also
supercoil DNA, MNase digestion of the assembled chromatin was
used to
assess whether the observed supercoiling was due to the
formation of
complete nucleosomes (
33). When probed with sequences
corresponding to a region outside of tRNA gene promoter (see the
legend
to Fig.
1D), the cleavage pattern of the reconstituted
chromatin
template showed well-resolved, regularly spaced nucleosomes
with a
repeat length of 150 to 160 bp, very similar to that observed
for
histone H1-depleted HeLa nuclear chromatin (Fig.
1D). The
use of probes
with sequences corresponding to A- and B-box regions
gave the same type
of MNase pattern, indicating that a majority
of the tRNA gene promoters
are within MNase-resistant nucleosomal
DNA (data not shown). These
results indicate that the reconstituted
chromatin is similar in
structure to natural chromatin and appropriate
for in vitro
transcription
experiments.
Human TFIIIC can relieve chromatin-mediated transcription
repression.
Although many class III genes, notably those encoding
ubiquitously expressed tRNA genes, are constitutively active and devoid of a conventional nucleosome structure in vivo (reviewed in references 11, 28, and 31), this may reflect
the activity of endogenous activators that prevent or reverse an
otherwise repressive nucleosomal structure. Indeed, several studies
have shown that prior assembly of class III genes (5S and tRNA) into
nucleosomal structures in vitro represses their ability to be
transcribed in various crude and partially purified systems (see the
introduction). Consistent with these latter observations, the
reconstituted chromatin template containing the tRNA gene was nearly
completely inert in a HeLa nuclear extract, whereas an equimolar amount
of the corresponding DNA template was highly active (Fig.
2B, lane 1 versus lane 3). Since TFIIIC
is the primary promoter recognition factor for tRNA genes, the effect
of ectopic TFIIIC addition to the extract was examined. For this
purpose, TFIIIC containing a FLAG epitope-tagged subunit was affinity
purified on M2 agarose by a method (Materials and Methods) that yields
a TFIIIC complex containing both the 220-, 110-, 102-, 90-, and 63-kDa
polypeptides of TFIIIC2 and other polypeptides that likely represent
the subunits of TFIIIC1 (Fig. 2A, lane 2 versus lane 1)
(55).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Ectopic TFIIIC can relieve chromatin-mediated repression
of RNA polymerase III transcription in nuclear extracts. (A) Analysis
of immunopurified TFIIIC by SDS-PAGE (8% gel) and silver staining.
Lane 1, molecular weight markers; lane 2, control immunoprecipitation;
lane 3, immunopurified purified TFIIIC. The marked bands in lane 3 represent the TFIIIC2 polypeptides. (B) Transcription from chromatin
and naked DNA templates. Freshly assembled chromatin and naked DNA (20 fmol) were preincubated with or without TFIIIC (260 fmol [100 ng]) at
30°C for 20 min before nuclear extract (NE) addition, as indicated.
The amount of endogenous TFIIIC in the added nuclear extract (1 µl)
was 1.2 fmol. Lanes 1 and 2, chromatin transcription; lanes 3 and 4, DNA transcription. (C) Effect of TFIIIC addition before (pre) or after
(post) chromatin assembly. Either 100 or 200 ng of TFIIIC was added
before (lanes 2 and 3) or after assembly (lanes 4 and 5) chromatin
assembly. Assembled templates were subjected to in vitro transcription
as described above. (D) Ectopic TFIIIC does not enhance transcription
at limiting concentrations of DNA template. Transcription of 2 ng (lane
1 and 2), 4 ng (lanes 3 and 4), 6 ng (lanes 5 and 6), and 50 ng (lanes
7 and 8) of DNA was performed with HeLa nuclear extract in the absence
(lanes 1, 3, 5, and 7) or presence (lanes 2, 4, 6, and 8) of 100 ng of
TFIIIC. (E) Histones and NAP1 do not affect transcription from the DNA
template. Histones and NAP1 were incubated in chromatin assembly buffer
for 15 min and then added to in vitro transcription reactions with or
without TFIIIC. Transcription reaction mixtures contained nuclear
extract only (lane 1), nuclear extract and 100 ng TFIIIC (lane 2),
nuclear extract and histones plus NAP1 (lane 3), or nuclear extract,
100 ng TFIIIC, and histones plus NAP1 (lane 4). (F) An equimolar amount
of chromatin template does not affect transcription from the DNA
template. Transcription reaction mixtures with nuclear extract
contained 20 fmol of DNA (lane 1), 20 fmol of DNA, and 20 fmol of
chromatin (chro) (lane 2), 20 fmol of chromatin (lane 3), or 20 fmol of
chromatin with 100 ng of purified TFIIIC.
|
|
Surprisingly, when preincubated with the preassembled chromatin
template, purified TFIIIC relieved the chromatin-mediated
repression of
tRNA gene transcription (Fig.
2B, lane 2 versus
lane 1). In contrast,
purified TFIIIC had no effect on transcription
of an equimolar amount
(20 fmol) of the purified DNA template
in the extract (Fig.
2B, lane 4 versus lane 3). Although derepression
of the chromatin was incomplete,
with total activity reaching
30% of the DNA template value, the level
of enhancement of activity
by ectopic TFIIIC (20-fold) was nevertheless
very significant;
the level of derepression was comparable to that
observed in other
cases of chromatin transcription in vitro (
8,
26). Moreover,
the level of transcription from the chromatin
template was as
high when TFIIIC was added before chromatin assembly as
when it
was added after chromatin assembly (Fig.
2C). Thus, the lower
transcriptional activity of the chromatin template likely represents
some intrinsic property of the chromatin template other than an
ability
for promoter recognition by TFIIIC. However, preincubation
of the
chromatin template with a mock immunoprecipitate (Materials
and
Methods) did not relieve chromatin-mediated repression (data
not
shown), which indicates that enhanced transcription is due
to ectopic
purified TFIIIC and not to other proteins bound nonspecifically
to the
M2 agarose affinity
matrix.
One possible explanation of the chromatin template response to ectopic
TFIIIC is that this reflects transcription of a residual
level of free
DNA template for which endogenous TFIIIC is limiting.
However, as shown
in Fig.
2D, there was no significant increase
in transcription in
response to ectopic TFIIIC in nuclear extract
at DNA template levels (2 to 6 ng) 9- to 25-fold lower than those
(50 ng or 20 fmol) in the
chromatin template assay of Fig.
2B.
In fact, addition of ectopic
TFIIIC to reaction mixtures containing
low amounts of DNA template
actually inhibited transcription (Fig.
2D, lane 4 versus lane 3 and
lane 6 versus lane 5). Another possibility
is a potentially inhibitory
effect of free core histones and NAP1,
present in slight stoichiometric
excess in the chromatin reconstitution
system, on activity from
presumptive residual DNA templates. However,
as shown in Fig.
2E, the
direct addition of ectopic core histones
and NAP1 to reaction mixture
containing purified DNA template
(20 fmol) had no effect on
transcription in the presence or absence
of TFIIIC. Moreover, in a
mixing experiment, the chromatin template
(and associated assembly
components) also had no effect on transcription
of the DNA template in
the nuclear extract (Fig.
2F). The results
of these control experiments
further substantiate the suggestion
that TFIIIC can relieve a bona fide
chromatin-mediated repression
of tRNA gene transcription by RNA
polymerase
III.
TFIIIC binds to the chromatin template.
Various DNA binding
and transcription studies with wild-type and mutated naked DNA
templates have shown that TFIIIC specifically binds to the A- and B-box
elements of the tRNA promoter and that this binding is essential for
transcription initiation (15, 52). Thus, given that
preincubation of TFIIIC with the almost completely inactive chromatin
can relieve the repression, the next step was to determine the
mechanism and, especially, whether TFIIIC could bind directly to
cognate sites in chromatin. To address this question, the chromatin
template that was used for the transcription experiments (Fig. 2B) was
incubated with affinity-purified TFIIIC and then subjected to a primer
extension-based DNase I footprint analysis (17). The
analysis in Fig. 3A clearly demonstrates that TFIIIC can bind to the promoter of the tRNA gene, as evidenced both by protection (positions +79 to +12) from cleavage on the A- and
B-box regions (mapped by sequencing free DNA) and by an enhanced
cleavage site at +89 (Fig. 3A, lane 6 versus lane 5). A comparative
analysis (Fig. 3A, lane 6, versus lanes 8 and 3 of Fig. 3B) revealed
similar interactions of TFIIIC on naked DNA and chromatin templates,
although the stronger interactions of human TFIIIC with the B-box
region (+79 to +33) relative to the A-box region on the naked DNA
template (52) may be more pronounced on the chromatin
template. Binding of TFIIIC to the chromatin template generates two
hypersensitive sites at +89 and
10 (Fig. 3A and B). The fact that a
10-fold-higher level of DNase I was needed for a comparable level of
DNA digestion within chromatin is further indicative of the presence of
the promoter region within a chromatin structure. Thus, a highly
purified human TFIIIC can directly recognize promoter sequences within
chromatin, consistent with similar observations for a number of other
DNA binding transcriptional activators, including nuclear hormone
receptors, TFIIIA, Gal4, Sp1, USF, and NF-
B (reviewed in references
3, 36, and 47).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
DNase I footprinting shows selectively binding of TFIIIC
to the promoter in a chromatin template. Aliquots (containing 2 fmol)
of DNA and chromatin samples used in the transcription reactions were
incubated with TFIIIC at 30°C for 30 min prior to DNase I digestion
and primer extension analyses. (A) Lanes 1 to 4, sequencing ladder of
DNA template; lane 5, DNA alone; lane 6, DNA plus 100 ng of TFIIIC;
lane 7, chromatin template alone; lane 8, chromatin with 100 ng of
TFIIIC. (B) Lane 1, chromatin template alone; lanes 2 and 3, chromatin
plus 100 ng or 200 ng of TFIIIC; lanes 1' to 3', longer exposure of
lanes 1 to 3 to more clearly show the footprint over the tRNA gene.
Arrows indicate the hypersensitive sites generated upon binding of
TFIIIC. Positions of the A box, B box, termination sequences, and
transcription start site are depicted on the left.
|
|
Human TFIIIC is a unique HAT complex.
Having demonstrated that
TFIIIC can directly access DNA binding sites within chromatin and
relieve the chromatin-mediated transcription repression, we
investigated the underlying mechanism(s). It has been suggested that
chromatin-mediated restrictions to transcription may be overcome by
histone modifications, such as acetylation or phosphorylation, that
facilitate promoter interactions either of primary DNA binding factors
or of secondarily recruited general transcription factors (reviewed in
references 12, 47, and 50). Given
the demonstration of HAT-containing coactivators (reviewed in reference
43) and the ability of histone acetylation to
facilitate both transcription factor binding (27) and RNA polymerase III-mediated transcription (47), we investigated the possibility of a HAT activity in TFIIIC. In a filter binding assay
(Fig. 4A), affinity-purified TFIIIC gave
levels of [3H]acetate incorporation (from
[3H]acetyl-CoA) into core histone substrates that were
significantly (12-fold) above the level observed with a mock
immunoprecipitate (Fig. 4A, lane 1 versus lane 2). No HAT activity was
detected in either highly purified RNA polymerase III or TFIIIB
preparations (Fig. 4A, lanes 3 and 4). Further analysis in a solution
assay followed by electophoretic resolution of radiolabeled proteins revealed a specific acetylation of histones H3 and H4 that was dependent on the presence of purified TFIIIC (Fig. 4B, lane 1; Fig. 4C,
lane 2). More interestingly, we found that TFIIIC can also acetylate
histones in native HeLa nucleosomes, with a specificity predominantly
for histone H4 and to a lesser extent for histones H3 and H2A (Fig. 4D,
lane 3). The recombinant p300 HAT domain (Fig. 4D, lane 1) and a mock
immunoprecipitate (for TFIIIC) (Fig. 4D, lane 2) were used as positive
and negative controls, respectively. Cumulatively, these results
suggested that TFIIIC may contain an intrinsic HAT activity.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Human TFIIIC has an associated HAT activity. (A) TFIIIC,
but not TFIIIB or RNA polymerase III, contains an associated HAT
activity. The filter binding HAT assay was performed with 1 µg of
core histones, [3H]acetyl-CoA, and 200 ng of highly
purified human TFIIIC (lane 1), RNA polymerase III (lane 3), TFIIIB
(lane 4), and mock-purified TFIIIC from the M2 agarose affinity column
(lane 2). (B and C) TFIIIC acetylates free histones H3 and H4. (B) Core
histones were incubated with affinity purified TFIIIC (lane 1), mock
immunoprecipitate (lane 2), RNA polymerase III (lane 3), and TFIIIB
(lane 4) and then resolved on an SDS-12% polyacrylamide gel that was
stained with Coomassie brilliant blue (left) and then analyzed by
fluorography (right). (C) Core histones were incubated either with
assay buffer (lane 1) or with 50 ng (lane 2), 75 ng (lane 3), or 200 ng
(lane 4) of TFIIIC and analyzed as for panel B. (D) TFIIIC acetylates
HeLa nucleosomal histones. The HAT assay was performed as described
above. Nucleosomes were incubated with 25 ng of recombinant p300 HAT
domain (lane 1), mock immunoprecipitate (for TFIIIC) (lane 2), and 0.5 µg of TFIIIC (lane 3). (E) TFIIIC contains three polypeptides with
HAT activity. In-gel HAT activity assays were performed following
resolution of TFIIIC on SDS-8% polyacrylamide gels containing
histones (lane 1) or BSA (lane 2).
|
|
To identify the polypeptide(s) responsible for the TFIIIC-associated
HAT activity, we used a gel-based activity assay (
6).
The
TFIIIC complex was resolved by electrophoresis in SDS-polyacrylamide
gels containing histones (0.1 mg/ml). After gel processing, endogenous
renatured proteins were subjected to an in-gel assay with
[
3H]acetyl-CoA. Somewhat surprisingly, this assay
revealed three
radiolabeled polypeptide bands (Fig.
4D, lane 1) whose
sizes,
based on electrophoretic mobilities, correspond to the 220-, 110-,
and 90-kDa subunits of TFIIIC2. These radiolabeled bands were
absent when BSA was incorporated into the polyacrylamide gel in
place
of histones (Fig.
4D, lane 2), suggesting that the activity
is specific
for histones and not due to autoacetylation. Taken
together, these
results suggest that human TFIIIC is a HAT complex
that contains three
polypeptides with intrinsic HAT
activity.
The 110-kDa subunit of human TFIIIC (TFIIIC
) is a bona fide
HAT.
Although the in-gel activity assay suggested the possibility
of HAT activity in three TFIIIC subunits, the present study has focused
on the 110-kDa (TFIIIC
) subunit. Three deletion mutants containing
amino acids 1 to 175 (N), 176 to 560 (M), and 561 to 911 (C) were made
to localize the HAT domain in TFIIIC
(Fig. 5A). After expression in and purification
from E. coli, equimolar amounts of purified recombinant
proteins (Fig. 5B) were analyzed by the in-gel activity assay with
either histones or BSA as substrates (Fig. 5C and D). With histone
substrates, the recombinant N and M fragments did not show any HAT
activity (Fig. 5C), whereas significant activity was observed for C
fragment. The gel activity assay with BSA as a substrate did not show
any radiolabeled band even with the C fragment (Fig. 5D), which
indicates again that TFIIIC
does not have autoacetylation activity.
Although we were unable to perform a solution assay with the C fragment
because of its complete insolubility when expressed in bacteria,
secondary analysis of the radiolabeled band from the in-gel assay
confirmed the specific labeling of histones (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
The C-terminal region of TFIIIC harbors the HAT
domain. (A) Diagrammatic representation of TFIIIC (41).
Hatched areas indicate positions of WD40 repeats. The lower panel shows
TFIIIC deletion mutants N, M, and C. (B) Coomassie blue stain of
equimolar amounts of the His6-tagged TFIIIC deletion
mutants after SDS-PAGE (10% gel). (C and D) In-gel HAT activity assays
with purified mutants. TFIIIC mutants were resolved on SDS-10%
polyacrylamide gels containing either histones (0.1 mg/ml) (C) or BSA
(0.1 mg/ml) as a control (D).
|
|
These results suggest that the 110-kDa (TFCIII

) subunit of human
TFIIIC has an intrinsic HAT activity and that the catalytic
domain is
located at the C-terminal portion of the polypeptide.
While confirming
that the HAT activity of TFIIIC is intrinsic
to a bona fide TFIIIC
subunit, these results also suggest the
possibility of intrinsic HAT
activities in other subunits. In
support of this possibility, the
purified recombinant (baculovirus-expressed)
90 kDa subunit of TFIIIC
showed very strong HAT activity in solution
assay (
24).
Possible involvement of TFIIIC HAT activities in activating
transcription from the chromatin template.
Given effects of
histone acetylation on chromatin structure and subsequent effects on
transcription factor binding and function, as well as transcription
activation function requiring the HAT activities (see the
introduction), we explored the role of the TFIIIC HAT activity in
activating transcription of the tRNA gene on the chromatin template. We
found only a modest effect (10 to 15% increase) of ectopic acetyl-CoA
on TFIIIC-enhanced transcription from the chromatin template in a
partially purified reconstituted system (data not shown), which may
have reflected the presence of endogenous acetyl-CoA (possibly protein
bound) in the assay system. As an alternative approach, we investigated
the use of p-hydroxymercuribenzoic acid (PMA), which was
previously shown to inhibit the GCN5 HAT activity (6). To
avoid potentially nonspecific effects of PMA on the activity of other
factors, TFIIIC was first treated with various concentrations of PMA
and then diluted 17-fold into HAT or transcription assay mixtures. A
filter binding assay revealed up to 70% inhibition of HAT activity at 0.05 mM PMA (Fig. 6A), consistent with
the results observed with GCN5 (6).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
PMA inhibits proportionately the HAT and chromatin
transcription activities of TFIIIC but not the DNA transcription
activity. (A) Inhibition of TFIIIC HAT activity by PMA. TFIIIC (200 ng
[2 µl]) was incubated with the indicated concentration of PMA (1 µl) on ice for 10 min and used for the filter binding HAT assay (this
panel) or for the transcription assay (below). (B) Inhibition of
TFIIIC-mediated chromatin transcription. TFIIIC treated with 0.05 mM
PMA (A) was assayed in 50-µl reaction mixtures containing RNA
polymerase III, TFIIIB, TDF, and TFIIIC (55) and 20 pmol of
either naked DNA (lanes 1 and 2) or reconstituted chromatin (lanes 3 and 4). (C) Quantitative correlation of TFIIIC HAT and chromatin
transcription activities. Experiments were performed as for panels A
and B to analyze TFIIIC HAT, chromatin transcription, and DNA
transcription (Txn) activities. The data are normalized to untreated
TFIIIC activities (set at 100%). (D) Transcription activity of control
and PMA-treated TFIIIC at limiting TFIIIC concentrations for
transcription from the DNA template. Reactions mixtures contained DNA
(50 ng), the transcription factors used for panel B, and the indicated
amounts of either untreated or 0.05 mM PMA-treated TFIIIC. Top
autoradiographic analysis of the transcription assays; bottom,
quantitation of the same data with a PhosphoImager (Molecular
Dynamics). The highest intensity value has been taken as 100%
transcription.
|
|
In an in vitro transcription assay with naked DNA templates, the level
of transcription observed with 0.05 mM PMA-treated
TFIIIC was almost
the same as that observed with control (non-PMA-treated)
TFIIIC (Fig.
6B, lane 2 versus lane 1). In contrast, transcription
from the
chromatin template was reduced by 60% with PMA-treated
TFIIIC in
comparison to nontreated TFIIIC (Fig.
6B, lane 4 versus
lane 3). A
careful titration revealed that transcription on naked
DNA was
unaffected when TFIIIC was treated with concentrations
of PMA ranging
from 0.01 to 0.05 mM, whereas the inhibition of
transcription from the
chromatin template correlated with a corresponding
decrease in the HAT
activity of TFIIIC (Fig.
6C). It was not possible
to use higher
concentrations of PMA to more completely inhibit
HAT and chromatin
transcription activities since nonspecific effects
on DNA transcription
also became
apparent.
The above results suggested that the HAT activity of TFIIIC might be
involved in relieving the chromatin-mediated transcriptional
repression. However, since chromatin transcription requires a
concentration of TFIIIC higher than that required by DNA transcription,
these results could also have reflected nonspecific inhibition
of
TFIIIC with a residual amount of active TFIIIC that is sufficient
for
transcription from naked DNA but not from chromatin. To rule
out this
possibility, we performed a TFIIIC dose-response analysis
with
PMA-treated and untreated TFIIIC on the DNA template. The
results in
Fig.
6D clearly demonstrate that even at levels of
TFIIIC 8- to 40-fold
lower than those used in the experiment shown
in Fig.
6B, no
significant difference in transcriptional activity
between the
PMA-treated and untreated TFIIIC was apparent (Fig.
6D). Hence, the
effect of PMA on TFIIIC-mediated transcription
appears to be restricted
to a function(s) specifically required
for activation of chromatin
template.
 |
DISCUSSION |
The general class III factor TFIIIC, as the primary promoter
recognition factor for tRNA and VA RNA genes, plays a key role in
nucleating the assembly of preinitiation complexes on cognate DNA
templates (see the introduction). We report here that (i) highly
purified human TFIIIC both binds to cognate promoter recognition sites
(A and B boxes) in the context of a chromatin template and facilitates
reversal of the chromatin-mediated repression of tRNA gene
transcription in vitro and (ii) TFIIIC contains an intrinsic HAT
activity that may be involved in relief of chromatin-mediated repression. These results suggest a role for TFIIIC beyond
preinitiation complex assembly and are discussed with respect to
established relationships of histone acetylation and HAT-containing
coactivators to gene activation and the dominant effect of
transcription over nucleosome assembly on tRNA genes in vivo.
Human TFIIIC binds to promoter elements within chromatin and
relieves repression of chromatin-mediated transcription.
Although
it is generally difficult to observe tRNA gene repression and
concomitant nucleosome formation in vivo, the latter can be observed
with promoter mutations that inhibit transcription (28, 31).
Consistent with the possibility of nucleosome-mediated tRNA gene
repression in vivo in the absence of appropriate factors, and with
chromatin-mediated repression of other class III genes in vitro (see
the introduction), preassembled tRNA gene-containing chromatin
templates are inactive in nuclear extracts that are fully competent for
transcription of corresponding DNA templates. Importantly, however,
ectopic TFIIIC relieves chromatin-mediated repression of tRNA gene
transcription (i.e., activates the chromatin template) but has no
effect on transcription of an equimolar amount of purified DNA template
that nonetheless requires endogenous TFIIIC.
How might elevated levels of TFIIIC facilitate transcription of a
chromatin template? Studies of gene-specific DNA binding
transcriptional activators have revealed that most are unable
to bind
effectively to cognate DNA sites within chromatin without
the aid of
chromatin remodeling factors such the various ATP-dependent
complexes,
HATs, or other DNA binding proteins. Some, however,
directly recognize
cognate sites in a manner dependent on their
rotational positions
within nucleosomes (reviewed in references
3,
36,
47, and
58). In the present study, TFIIIC
was
shown to resemble the latter class of factors and to bind directly
to chromatin templates reconstituted with homogeneous components.
TFIIIC interactions are strong over the B box and weak over the
A box
in comparison to the relatively strong interactions over
both the A and
B boxes on DNA templates. The basis for the difference
is not known,
but the B box is the primary binding site for the
TFIIIC2 component of
TFIIIC (reviewed in reference
52), and
the A-box
interactions within chromatin could depend either on
cooperative
interactions with other RNA polymerase III accessory
factors (see the
introduction) or on secondary functions of TFIIIC
(see below). Changes
in chromatin structure upon TFIIIC binding
are also evident from
induced hypersensitive sites in both standard
DNase footprinting (Fig.
3) and indirect end labeling (data not
shown) assays. These results
indicate that the antirepressive
effects of TFIIIC may reflect, at
least in part, direct site-specific
binding to chromatin and that the
higher threshold for TFIIIC
function with chromatin templates may
reflect a lower affinity
for promoter sites (in chromatin) and/or a
secondary function
(below) requiring a high TFIIIC
concentration.
TFIIIC has an intrinsic HAT activity.
Recently several
transcriptional coactivators for class II genes have been shown to have
intrinsic HAT activities (see the introduction), which in some cases
have been shown to be essential for coactivator function (below). The
human TFIIIC-associated HAT activity described here acetylates both
free and nucleosomal histones H3 and H4 in solution (Fig. 4). Moreover,
TFIIIC also acetylates histone H2A, as well as histones H3 and H4, in
native HeLa nucleosomes. In this regard, the TFIIIC HAT activity does not resemble that of the core promoter recognition factor TFIID (activity contributed by the largest TAF subunit), which acetylates only free histones H3 and H4 (29). The ability of TFIIIC to acetylate nucleosomal histones also suggests that the HAT activity may
be directly involved in TFIIIC-mediated chromatin transcription.
Somewhat surprisingly, the present results have indicated the presence
of three TFIIIC subunits (220, 110, and 90 kDa) with
HAT activity, and
intrinsic HAT activities have been verified
by analysis of recombinant
bacterially (110 kDa)- and baculovirus
(90 kDa)-expressed polypeptides.
This apparently novel situation
is thus far unique to TFIIIC, as the
HAT activities of other multisubunit
complexes (TFIID, yeast SAGA, and
human GCN5 and pCAF complexes)
have been ascribed to single
polypeptides (reviewed in references
18 and
35). Although other HAT-containing coactivators
(CBP/p300,
pCAF, and SRC family members) may act synergistically
through
interactions with each other and with common targets (
9,
42,
43), there is no indication that they form highly stable
complexes
comparable to TFIIIC (
55). Interestingly, homology
searches
thus far have failed to reveal any sequence relationships
between
the broadly mapped TFIIIC

HAT domain and other HAT
domains.
Possible role of human TFIIIC HAT activity on chromatin-templated
transcription by RNA polymerase III.
A role for histone
acetylation in transcription from natural (chromatin) templates is
suggested by (i) a general (but not absolute) correlation between
specific gene activity and the presence of hyperacetylated histones
(reviewed in reference 46), (ii) the enhanced
transcription factor binding and template capabilities of chromatin
reconstituted with highly acetylated histones (27, 49),
(iii) the requirement of coactivator HAT activities for both
promoter-directed histone acetylation and coactivator function in vivo
(25, 29, 51), (iv) an acetyl-CoA-dependent transcription function of a GCN5-containing complex on a chromatin template in vitro
(48), and (v) the association of various transcriptional corepressors with histone deacetylases and enhanced transcription in
response to deacetylase inhibitors (reviewed in reference
37).
Consistent with a possible role of TFIIIC HAT activity in the
TFIIIC-dependent reversal of chromatin-mediated repression,
the HAT
inhibitor PMA was found to partially inhibit both the
HAT and chromatin
transcription activities of TFIIIC but not the
DNA transcription
activity. These results, though not conclusive,
suggest that the TFIIIC
HAT activity may be at least partially
required for the relief of
chromatin-mediated repression. More
definitive studies await the
development of more potent and more
specific inhibitors of HAT
activities, a more purified in vitro
transcription system (possibly
with artificially positioned nucleosomes
[
48]) that
responds to acetyl-CoA, and the ability to reconstitute
TFIIIC with
mutations in component subunit HAT domain(s). The
latter is complicated
by the multiplicity of subunits with HAT
activity, a current lack of
information on the actual HAT domains,
and the lack of an in vitro
system that would allow assembly of
TFIIIC with multiple mutated
subunits. The lack of an ectopic
acetyl-CoA requirement for
TFIIIC-dependent transcription of chromatin
in the present study may
reflect endogenous acetyl-CoA in the
incompletely purified assay
system, whereas the failure of acetyl-CoA
to alter the binding of
highly purified TFIIIC to the chromatin
template (data not shown) also
suggests that the initial binding
of TFIIIC is independent of histone
acetylation.
Overall, the results presented here suggest dual functions for TFIIIC
in activation of tRNA gene transcription from chromatin
templates and
lead us to tentatively suggest the following working
model. First,
consistent with its documented role in preinitiation
complex assembly
on DNA templates, TFIIIC recognizes and binds
to one or more of the
core promoter DNA recognition sites within
chromatin; however, these
interactions may be weaker and incomplete
compared to those observed on
naked DNA. Second, through additional
interactions with RNA polymerase
III and other general initiation
factors, and possibly in conjugation
with the intrinsic TFIIIC
HAT activity on adjacent nucleosomes,
chromatin remodeling is
completed and a functional preinitiation
complex is formed. This
model is the one that is most obvious and most
consistent with
the surprising finding of an intrinsic HAT activity in
TFIIIC,
which otherwise remains to be explained. However, it does not
exclude the participation of other nucleosome remodeling activities
or
a possible role for TFIIIC in directly modulating the action
of an
interacting transcription factor through acetylation (
19).
The same arguments about the possible involvement of nucleosome
remodeling activities may also pertain to the case of yeast
U6 gene
transcription, which was shown to exhibit a conditional
(chromatin-imposed) requirement for TFIIIC in vitro and to be
activated
by histone depletion in vivo only when presumptive natural
TFIIIC-promoter interactions are compromised by promoter mutation
(
8,
28). However, these studies demonstrated neither direct
binding of TFIIIC to chromatin independently of other factors
nor any
associated enzyme activity that might be involved in the
antirepression
functions. Interestingly, although the HAT-containing
subunits of human
TFIIIC show no significant sequence relationship
to known
S. cerevisiae TFIIIC subunits or to database sequences,
the 102- and
63-kDa human TFIIIC subunits are related in sequence
and function to
the 135- and 95-kDa subunits of yeast TFIIIC (
21).
Along
with the fact that domains responsible for the human TFIIIC
HAT
activities are not highly conserved, this finding leaves open
the
possibility of TFIIIC-associated HAT activity in yeast as
well.
 |
ACKNOWLEDGMENTS |
We thank Y. Nakatani for the p300 HAT domain expression vector
and for critical comments on the manuscript, Tsutomu Ohta for providing
the NAP1 expression plasmid, S. Malik for help with the HeLa
topoisomerase I purification, and V. Palhan for critical reading of the manuscript.
This work was supported by a grant from the NIH to R.G.R.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-7600. Fax: (212) 327-7949. E-mail: Roeder{at}rockvax.rockefeller.edu.
 |
REFERENCES |
| 1.
|
Arrebola, R.,
N. Manaud,
S. Rosenfeld,
M. C. Marsolier,
O. Lefebvre,
C. Carles,
P. Thuriaux,
C. Conesa, and A. Sentenac.
1998.
91, an essential subunit of yeast transcription factor IIIC, cooperates with 138 in DNA binding.
Mol. Cell. Biol.
18:1-9[Abstract/Free Full Text].
|
| 2.
|
Bannister, A. J., and T. Kouzarides.
1996.
The CBP coactivator is a histone acetyltransferase.
Nature
384:641-643[Medline].
|
| 3.
|
Beato, M., and K. Eisfeld.
1997.
Transcription factor access to chromatin.
Nucleic Acids Res.
25:3559-3563[Abstract/Free Full Text].
|
| 4.
|
Becker, P. B., and C. Wu.
1992.
Cell-free system for assembly of transcriptionally repressed chromatin from Drosophila embryos.
Mol. Cell. Biol.
12:2241-2249[Abstract/Free Full Text].
|
| 5.
|
Bogenhagen, D. F.,
W. M. Wormington, and D. D. Brown.
1982.
Stable transcription complex of Xenopus 5S RNA genes: a means to maintain the differentiated state.
Cell
28:413-421[Medline].
|
| 6.
|
Brownell, J. E., and C. D. Allis.
1995.
An activity gel assay detects a single, catalytically active histone acetyltransferase subunit in tetrahymena macronuclei.
Proc. Natl. Acad. Sci. USA
92:6364-6368[Abstract/Free Full Text].
|
| 7.
|
Brownell, J. E.,
J. Zhou,
T. Ranalli,
R. Kobayashi,
D. G. Edmondson,
S. Y. Roth, and C. D. Allis.
1996.
Tetrahymena histone acetyltransferase A: a homolog of yeast Gcn5p linking histone acetylation to gene activation.
Cell
84:843-851[Medline].
|
| 8.
|
Burnol, A.-F.,
F. Margottin,
J. Huet,
G. Almouzni,
M.-N. Prioleau,
M. Mechali, and A. Setenac.
1993.
TFIIIC relieves repression of U6 snRNA transcription by chromatin.
Nature
362:475-477[Medline].
|
| 9.
|
Chen, H.,
R. J. Lin,
R. I. Schiltz,
D. Chakaroborty,
A. Nash,
L. Nagy,
M. L. Privalsky,
Y. Nakatani, and R. M. Evans.
1997.
Nuclear receptor coactivator ACTR is a novel histone acetyl transferase and forms a multimeric activation complex with p/CAF and CBP/p300.
Cell
90:569-580[Medline].
|
| 10.
|
Cote, J.,
R. T. Utley, and J. L. Workman.
1995.
Basic analysis of transcription factor binding to nucleosomes.
Methods Mol. Genet.
6:108-152.
|
| 11.
|
Dammann, R., and G. P. Pfeifer.
1997.
Lack of gene- and strand-specific DNA repair in RNA polymerase III-transcribed human tRNA genes.
Mol. Cell. Biol.
17:219-229[Abstract].
|
| 12.
|
Felsenfeld, G.
1996.
Chromatin unfolds.
Cell
86:3-19.
|
| 13.
|
Felts, S. J.,
P. A. Weil, and R. Chalkley.
1990.
Transcription factor requirements for in vitro formation of transcriptionally 5S competent rRNA gene chromatin.
Mol. Cell. Biol.
10:2390-2401[Abstract/Free Full Text].
|
| 14.
|
Fuji-Nakata, T.,
Y. Ishimi,
A. Okuda, and A. Kikuchi.
1992.
Functional analysis of nucleosome assembly protein, NAP-1: the negatively charged COOH-terminal region is not necessary for the intrinsic assembly activity.
J. Biol. Chem.
267:20980-20986[Abstract/Free Full Text].
|
| 15.
|
Geiduscheck, E. P., and G. A. Kassavetis.
1992.
RNA polymerase III transcription complex, p. 247-279.
In
S. L. McKnight, and K. R. Yamamoto (ed.), Transcription regulation. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Gottesfeld, J., and L. S. Bloomer.
1982.
Assembly of transcriptionally active 5S RNA gene chromatin in vitro.
Cell
28:781-791[Medline].
|
| 17.
|
Gralla, J. D.
1985.
Rapid "footprinting" on supercoiled DNA.
Proc. Natl. Acad. Sci. USA
82:3078-3081[Abstract/Free Full Text].
|
| 18.
|
Grant, P. A.,
D. Schieltz,
M. G. Pray-Grant,
D. J. Steger,
J. C. Reese,
J. R. Yates III, and J. L. Workman.
1998.
A subset of TBP-associated factors, TAFIIs, are integral components of the SAGA complex that are required for nucleosome acetylation and transcription stimulation.
Cell
94:45-53[Medline].
|
| 19.
|
Gu, W., and R. G. Roeder.
1997.
Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain.
Cell
90:595-606[Medline].
|
| 20.
|
Howe, L., and J. Ausio.
1998.
Nucleosome translational position, not histone acetylation, determines TFIIIA binding to nucleosomal Xenopus laevis 5S rRNA genes.
Mol. Cell. Biol.
18:1156-1162[Abstract/Free Full Text].
|
| 21.
| Hseih, J.-H., Z. Wang, R. Covelman, and
R. G. Roeder. Cloning and characterization of two
evolutionary-conserved subunits (TFIIIC 102 and TFIIIC 63) of human
TFIIIC and their involvement in functional interactions with TFIIIB and
RNA polymerase III. Submitted for publication.
|
| 22.
|
Ito, T.,
J. K. Tyler, and J. T. Kadonaga.
1997.
Chromatin assembly factors: a dual function in nucleosome formation and mobilization?
Genes Cells
2:593-600[Abstract].
|
| 23.
|
Kovelman, R., and R. G. Roeder.
1992.
Purification and characterization of two forms of human transcription factor TFIIIC.
J. Biol. Chem.
267:24446-24456[Abstract/Free Full Text].
|
| 24.
| Kundu, T. K., Y.-H. Hseih, and R. G. Roeder. Unpublished data.
|
| 25.
|
Kuo, M-H.,
J. Zhou,
P. Jambeck,
M. E. A. Churchill, and C. D. Allis.
1998.
Histone acetyltransferase activity of yeast Gcn5 is required for the activation of target genes in vivo.
Genes Dev.
12:627-639[Abstract/Free Full Text].
|
| 26.
|
Langst, G.,
T. A. Blank,
P. B. Becker, and I. Grummt.
1997.
RNA polymerase I transcription on nucleosomal templates: the transcription termination factor TTF-I induces chromatin remodeling and relieves transcriptional repression.
EMBO J.
16:760-768[Medline].
|
| 27.
|
Lee, D. Y.,
J. J. Hayes,
D. Pruss, and A. P. Wolffe.
1993.
A positive role of histone acetylation in transcription factor access to nucleosomal DNA.
Cell
72:73-74[Medline].
|
| 28.
|
Marsolier, M. C.,
S. Tanaka,
M. Livingstone-Zatchej,
M. Grunstein,
F. Thoma, and A. Sentenac.
1995.
Reciprocal interferences between nucleosomal organization and transcriptional activity of the yeast SNR6 gene.
Genes Dev.
9:410-422[Abstract/Free Full Text].
|
| 29.
|
Martinez-Balbas, M. A.,
A. J. Bannister,
K. Martin,
P. Haus-Seuffert,
M. Meisterernst, and T. Kouzarides.
1998.
The acetyltransferase activity of CBP stimulates transcription.
EMBO J.
17:2886-2893[Medline].
|
| 30.
|
Mizzen, C. A.,
X. J. Yang,
T. Kokubo,
J. E. Brownell,
A. J. Bannister,
T. Owen-Hughes,
J. Workman,
L. Wang,
S. L. Berger,
T. Kouzarides,
Y. Nakatani, and C. D. Allis.
1996.
The TAF¶250 subunit of TFIID has histone acetyltransferase activity.
Cell
87:1261-1270[Medline].
|
| 31.
|
Morse, R. H.,
S. Y. Roth, and R. T. Simpson.
1992.
A transcriptional active tRNA gene interferes with nucleosome positioning in vivo.
Mol. Cell. Biol.
12:4015-4025[Abstract/Free Full Text].
|
| 32.
|
Nelson, T.,
T. Hsieh, and D. Brutlag.
1979.
Extract of Drosophila embryos mediate chromatin assembly in vitro.
Proc. Natl. Acad. Sci. USA
76:5510-5514[Abstract/Free Full Text].
|
| 33.
|
Noll, M., and R. D. Kornberg.
1977.
Action of micrococcal nuclease on chromatin and the location of histone H1.
J. Mol. Biol.
109:393-404[Medline].
|
| 34.
|
Ogryzko, V. V.,
R. L. Schiltz,
V. Russanvoa,
B. H. Howard, and Y. Nakatani.
1996.
The transcriptional coactivators p300 and CBP are histone acetyltransferases.
Cell
87:953-959[Medline].
|
| 35.
|
Ogryzko, V. V.,
T. Kotani,
X. Zhang,
R. L. Schiltz,
T. Howard,
X.-J. Yang,
B. H. Howard,
J. Qion, and Y. Nakatani.
1998.
A histone octamer like structure within the PCAF histone acetyltransferase complex.
Cell
94:35-44[Medline].
|
| 36.
|
Owen-Hughes, T. A., and J. L. Workman.
1996.
Remodeling the chromatin structure of a nucleosome array by transcription factor-targeted trans-displacement of histones.
EMBO J.
15:4702-4712[Medline].
|
| 37.
|
Pazin, M. J., and J. T. Kadonaga.
1997.
What's up and down with histone deacetylation and transcription?
Cell
89:325-328[Medline].
|
| 38.
|
Roeder, R. G.
1996.
Nuclear RNA polymerases: role of general initiation factors and cofactors in eukaryotic transcription.
Methods Enzymol.
273:165-171[Medline].
|
| 39.
|
Rossi, F.,
E. Labourier,
T. Forne,
G. Divita,
J. Derancourt,
J. F. Riou,
E. Antoine,
G. Cathala,
C. Brunel, and J. Tazi.
1996.
Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I.
Nature
381:80-82[Medline].
|
| 40.
|
Roth, S. Y., and C. D. Allis.
1996.
The subunit-exchange model of histone acetylation.
Trends Cell Biol.
6:371-375.
[Medline] |
| 41.
|
Sinn, E.,
Z. Wang,
R. Kovelman, and R. G. Roeder.
1995.
Cloning and characterization of a TFIIIC2 subunit (TFIIIC ) whose presence correlates with activation of RNA polymerase III mediated transcription by adenovirus E1A expression and serum factors.
Genes Dev.
9:675-685[Abstract/Free Full Text].
|
| 42.
|
Spencer, T. E.,
G. Jenster,
M. M. Burcin,
C. D. Allis,
J. Zhou,
C. A. Mizzen,
N. J. McKenna,
S. A. Onate,
S. Y. Tasi,
M. J. Tasi, and B. W. O'Malley.
1997.
Steroid receptor coactivator-1 is a histone acetyltransferase.
Nature
389:194-198[Medline].
|
| 43.
|
Struhl, K.
1998.
Histone acetylation and transcriptional regulatory mechanisms.
Genes Dev.
12:599-606[Free Full Text].
|
| 44.
|
Tremethick, D.,
K. Zucker, and A. Worcel.
1990.
The transcription complex of the 5S RNA gene, but not transcription factor IIIA alone, prevents nucleosomal repression of transcription.
J. Biol. Chem.
265:5014-5023[Abstract/Free Full Text].
|
| 45.
|
Tse, C.,
T. Sera,
A. P. Wolffe, and J. C. Hansen.
1998.
Disruption of higher-order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III.
Mol. Cell. Biol.
18:4629-4638[Abstract/Free Full Text].
|
| 46.
|
Turner, B. M., and L. P. O'Neill.
1995.
Histone acetylation in chromatin and chromosomes.
Semin. Cell Biol.
6:229-236[Medline].
|
| 47.
|
Ura, K.,
H. Kurumizaka,
S. Dimitrov,
G. Almouzni, and A. P. Wolffe.
1997.
Histone acetylation: influence on transcription, nucleosome mobility and positioning, and linker histone-dependent transcriptional repression.
EMBO J.
16:2096-2107[Medline].
|
| 48.
|
Utley, R. T.,
K. Ikeda,
P. A. Grant,
J. Cote,
D. J. Steger,
A. Eberharter,
S. John, and J. L. Workman.
1998.
Transcriptional activators direct histone acetyltransfersae complexes to nucleosomes.
Nature
394:498-502[Medline].
|
| 49.
|
Vettese-Dadey, M.,
P. A. Grant,
T. R. Hebbes,
C. Crane-Robinson,
C. D. Allis, and J. L. Workman.
1996.
Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro.
EMBO J.
15:2508-2518[Medline].
|
| 50.
|
Wade, P. A.,
D. Pruss, and A. P. Wolffe.
1997.
Histone acetylation: chromatin in action.
Trends Biochem. Sci.
22:128-188[Medline].
|
| 51.
|
Wang, L.,
L. Lin, and S. L. Berger.
1998.
Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo.
Genes Dev.
12:640-653[Abstract/Free Full Text].
|
| 52.
|
Wang, Z., and R. G. Roeder.
1996.
TFIIIC1 acts through a downstream region to stabilize TFIIIC2 binding to RNA polymerase III promoters.
Mol. Cell. Biol.
12:6841-6850.
|
| 53.
|
Wang, Z., and R. G. Roeder.
1997.
Three human RNA polymerase III-specific subunits from a subcomplex with a selective function in specific transcription initiation.
Genes Dev.
11:1315-1326[Abstract/Free Full Text].
|
| 54.
|
Wang, Z.,
T. Luo, and R. G. Roeder.
1997.
Identification of an autonomously initiating RNA polymerase III holoenzyme containing a novel factor that is selectively inactivated during protein synthesis inhibition.
Genes Dev.
11:2371-2382[Abstract/Free Full Text].
|
| 55.
|
Wang, Z., and R. G. Roeder.
1998.
DNA topoisomerase I and PC4 can interact with human TFIIIC to promote both accurate termination and transcription initiation by RNA polymerase III.
Mol. Cell.
1:749-757[Medline].
|
| 56.
|
Willis, I. M.
1993.
RNA polymerase III: genes, factors and transcriptional specificity.
Eur. J. Biochem.
212:1-11[Medline].
|
| 57.
|
Wolffe, A. P.,
J. Wong, and P. Dmitry.
1997.
Activator and repressor: making use of chromatin to regulate transcription.
Genes Cells
2:291-302[Abstract].
|
| 58.
|
Wu, C.
1997.
Chromatin remodeling and the control of gene expression.
J. Biol. Chem.
272:28171-28174[Free Full Text].
|
| 59.
|
Yang, X.,
V. Ogryzko,
J. Nishikawa,
B. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.
Nature
382:319-324[Medline].
|
| 60.
|
Yoshinaga, S. T.,
N. D. L'Etoile, and A. J. Berk.
1989.
Purification and characterization of transcription factor TFIIIC2.
J. Biol. Chem.
264:10726-10731[Abstract/Free Full Text].
|
Molecular and Cellular Biology, February 1999, p. 1605-1615, Vol. 19, No. 2
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Obrdlik, A., Kukalev, A., Louvet, E., Ostlund Farrants, A.-K., Caputo, L., Percipalle, P.
(2008). The Histone Acetyltransferase PCAF Associates with Actin and hnRNP U for RNA Polymerase II Transcription. Mol. Cell. Biol.
28: 6342-6357
[Abstract]
[Full Text]
-
Mertens, C., Roeder, R. G.
(2008). Different Functional Modes of p300 in Activation of RNA Polymerase III Transcription from Chromatin Templates. Mol. Cell. Biol.
28: 5764-5776
[Abstract]
[Full Text]
-
Yuan, C.-C., Zhao, X., Florens, L., Swanson, S. K., Washburn, M. P., Hernandez, N.
(2007). CHD8 Associates with Human Staf and Contributes to Efficient U6 RNA Polymerase III Transcription. Mol. Cell. Biol.
27: 8729-8738
[Abstract]
[Full Text]
-
Batta, K., Kundu, T. K.
(2007). Activation of p53 Function by Human Transcriptional Coactivator PC4: Role of Protein-Protein Interaction, DNA Bending, and Posttranslational Modifications. Mol. Cell. Biol.
27: 7603-7614
[Abstract]
[Full Text]
-
Kenneth, N. S., Ramsbottom, B. A., Gomez-Roman, N., Marshall, L., Cole, P. A., White, R. J.
(2007). TRRAP and GCN5 are used by c-Myc to activate RNA polymerase III transcription. Proc. Natl. Acad. Sci. USA
104: 14917-14922
[Abstract]
[Full Text]
-
Das, C., Hizume, K., Batta, K., Kumar, B. R. P., Gadad, S. S., Ganguly, S., Lorain, S., Verreault, A., Sadhale, P. P., Takeyasu, K., Kundu, T. K.
(2006). Transcriptional Coactivator PC4, a Chromatin-Associated Protein, Induces Chromatin Condensation. Mol. Cell. Biol.
26: 8303-8315
[Abstract]
[Full Text]
-
Fukuda, H., Sano, N., Muto, S., Horikoshi, M.
(2006). Simple histone acetylation plays a complex role in the regulation of gene expression.. Brief Funct Genomic Proteomic
5: 190-208
[Abstract]
[Full Text]
-
Soutourina, J., Bordas-Le Floch, V., Gendrel, G., Flores, A., Ducrot, C., Dumay-Odelot, H., Soularue, P., Navarro, F., Cairns, B. R., Lefebvre, O., Werner, M.
(2006). Rsc4 Connects the Chromatin Remodeler RSC to RNA Polymerases.. Mol. Cell. Biol.
26: 4920-4933
[Abstract]
[Full Text]
-
Ducrot, C., Lefebvre, O., Landrieux, E., Guirouilh-Barbat, J., Sentenac, A., Acker, J.
(2006). Reconstitution of the Yeast RNA Polymerase III Transcription System with All Recombinant Factors. J. Biol. Chem.
281: 11685-11692
[Abstract]
[Full Text]
-
Kimura, A., Matsubara, K., Horikoshi, M.
(2005). A Decade of Histone Acetylation: Marking Eukaryotic Chromosomes with Specific Codes. J Biochem
138: 647-662
[Abstract]
[Full Text]
-
Swaminathan, V., Kishore, A. H., Febitha, K. K., Kundu, T. K.
(2005). Human Histone Chaperone Nucleophosmin Enhances Acetylation-Dependent Chromatin Transcription. Mol. Cell. Biol.
25: 7534-7545
[Abstract]
[Full Text]
-
Sjolinder, M., Bjork, P., Soderberg, E., Sabri, N., Ostlund Farrants, A.-K., Visa, N.
(2005). The growing pre-mRNA recruits actin and chromatin-modifying factors to transcriptionally active genes. Genes Dev.
19: 1871-1884
[Abstract]
[Full Text]
-
Balasubramanyam, K., Varier, R. A., Altaf, M., Swaminathan, V., Siddappa, N. B., Ranga, U., Kundu, T. K.
(2004). Curcumin, a Novel p300/CREB-binding Protein-specific Inhibitor of Acetyltransferase, Represses the Acetylation of Histone/Nonhistone Proteins and Histone Acetyltransferase-dependent Chromatin Transcription. J. Biol. Chem.
279: 51163-51171
[Abstract]
[Full Text]
-
Balasubramanyam, K., Altaf, M., Varier, R. A., Swaminathan, V., Ravindran, A., Sadhale, P. P., Kundu, T. K.
(2004). Polyisoprenylated Benzophenone, Garcinol, a Natural Histone Acetyltransferase Inhibitor, Represses Chromatin Transcription and Alters Global Gene Expression. J. Biol. Chem.
279: 33716-33726
[Abstract]
[Full Text]
-
Shivaswamy, S., Kassavetis, G. A., Bhargava, P.
(2004). High-Level Activation of Transcription of the Yeast U6 snRNA Gene in Chromatin by the Basal RNA Polymerase III Transcription Factor TFIIIC. Mol. Cell. Biol.
24: 3596-3606
[Abstract]
[Full Text]
-
Hosohata, K., Li, P., Hosohata, Y., Qin, J., Roeder, R. G., Wang, Z.
(2003). Purification and Identification of a Novel Complex Which Is Involved in Androgen Receptor-Dependent Transcription. Mol. Cell. Biol.
23: 7019-7029
[Abstract]
[Full Text]
-
Banerjee, S., Kundu, T. K.
(2003). The acidic C-terminal domain and A-box of HMGB-1 regulates p53-mediated transcription. Nucleic Acids Res
31: 3236-3247
[Abstract]
[Full Text]
-
Balasubramanyam, K., Swaminathan, V., Ranganathan, A., Kundu, T. K.
(2003). Small Molecule Modulators of Histone Acetyltransferase p300. J. Biol. Chem.
278: 19134-19140
[Abstract]
[Full Text]
-
Schramm, L., Hernandez, N.
(2002). Recruitment of RNA polymerase III to its target promoters. Genes Dev.
16: 2593-2620
[Full Text]
-
Bodmer-Glavas, M., Edler, K., Barberis, A.
(2001). RNA polymerase II and III transcription factors can stimulate DNA replication by modifying origin chromatin structures. Nucleic Acids Res
29: 4570-4580
[Abstract]
[Full Text]
-
Martin, M. P., Gerlach, V. L., Brow, D. A.
(2001). A Novel Upstream RNA Polymerase III Promoter Element Becomes Essential When the Chromatin Structure of the Yeast U6 RNA Gene Is Altered. Mol. Cell. Biol.
21: 6429-6439
[Abstract]
[Full Text]
-
Huang, Y., Maraia, R. J.
(2001). Comparison of the RNA polymerase III transcription machinery in Schizosaccharomyces pombe, Saccharomyces cerevisiae and human. Nucleic Acids Res
29: 2675-2690
[Abstract]
[Full Text]
-
Sutcliffe, J. E., Brown, T. R. P., Allison, S. J., Scott, P. H., White, R. J.
(2000). Retinoblastoma Protein Disrupts Interactions Required for RNA Polymerase III Transcription. Mol. Cell. Biol.
20: 9192-9202
[Abstract]
[Full Text]
-
Winter, A. G., Sourvinos, G., Allison, S. J., Tosh, K., Scott, P. H., Spandidos, D. A., White, R. J.
(2000). RNA polymerase III transcription factor TFIIIC2 is overexpressed in ovarian tumors. Proc. Natl. Acad. Sci. USA
10.1073/pnas.230224097v1
[Abstract]
[Full Text]
-
Li, T.-H., Kim, C., Rubin, C. M., Schmid, C. W.
(2000). K562 cells implicate increased chromatin accessibility in Alu transcriptional activation. Nucleic Acids Res
28: 3031-3039
[Abstract]
[Full Text]
-
Sterner, D. E., Berger, S. L.
(2000). Acetylation of Histones and Transcription-Related Factors. Microbiol. Mol. Biol. Rev.
64: 435-459
[Abstract]
[Full Text]
-
John, S., Howe, L., Tafrov, S. T., Grant, P. A., Sternglanz, R., Workman, J. L.
(2000). The Something About Silencing protein, Sas3, is the catalytic subunit of NuA3, a yTAFII30-containing HAT complex that interacts with the Spt16 subunit of the yeast CP (Cdc68/Pob3)-FACT complex. Genes Dev.
14: 1196-1208
[Abstract]
[Full Text]
-
Paule, M. R., White, R. J.
(2000). SURVEY AND SUMMARY Transcription by RNA polymerases I and III. Nucleic Acids Res
28: 1283-1298
[Abstract]
[Full Text]
-
Hsieh, Y.-J., Kundu, T. K., Wang, Z., Kovelman, R., Roeder, R. G.
(1999). The TFIIIC90 Subunit of TFIIIC Interacts with Multiple Components of the RNA Polymerase III Machinery and Contains a Histone-Specific Acetyltransferase Activity. Mol. Cell. Biol.
19: 7697-7704
[Abstract]
[Full Text]
-
Larminie, C. G. C., Sutcliffe, J. E., Tosh, K., Winter, A. G., Felton-Edkins, Z. A., White, R. J.
(1999). Activation of RNA Polymerase III Transcription in Cells Transformed by Simian Virus 40. Mol. Cell. Biol.
19: 4927-4934
[Abstract]
[Full Text]
-
Hsieh, Y.-J., Wang, Z., Kovelman, R., Roeder, R. G.
(1999). Cloning and Characterization of Two Evolutionarily Conserved Subunits (TFIIIC102 and TFIIIC63) of Human TFIIIC and Their Involvement in Functional Interactions with TFIIIB and RNA Polymerase III. Mol. Cell. Biol.
19: 4944-4952
[Abstract]
[Full Text]
-
Moir, R. D., Puglia, K. V., Willis, I. M.
(2000). Interactions between the Tetratricopeptide Repeat-containing Transcription Factor TFIIIC131 and Its Ligand, TFIIIB70. EVIDENCE FOR A CONFORMATIONAL CHANGE IN THE COMPLEX. J. Biol. Chem.
275: 26591-26598
[Abstract]
[Full Text]
-
Huang, Y., Hamada, M., Maraia, R. J.
(2000). Isolation and Cloning of Four Subunits of a Fission Yeast TFIIIC Complex That Includes an Ortholog of the Human Regulatory Protein TFIIICbeta. J. Biol. Chem.
275: 31480-31487
[Abstract]
[Full Text]
-
Kumar, B. R. P., Swaminathan, V., Banerjee, S., Kundu, T. K.
(2001). p300-mediated Acetylation of Human Transcriptional Coactivator PC4 Is Inhibited by Phosphorylation. J. Biol. Chem.
276: 16804-16809
[Abstract]
[Full Text]
-
Winter, A. G., Sourvinos, G., Allison, S. J., Tosh, K., Scott, P. H., Spandidos, D. A., White, R. J.
(2000). RNA polymerase III transcription factor TFIIIC2 is overexpressed in ovarian tumors. Proc. Natl. Acad. Sci. USA
97: 12619-12624
[Abstract]
[Full Text]