Previous Article | Next Article 
Molecular and Cellular Biology, March 1999, p. 2021-2031, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Jun Kinase Phosphorylates and Regulates the DNA
Binding Activity of an Octamer Binding Protein, T-Cell Factor
1
Shailaja
Kasibhatla,1
Pankaj
Tailor,2
Nathalie
Bonefoy-Berard,2
Tomas
Mustelin,2
Amnon
Altman,2 and
Arun
Fotedar1,3,*
Divisions of Molecular
Biology1 and Cell
Biology,2 La Jolla Institute for Allergy and
Immunology, and Sidney Kimmel Cancer
Center,3 San Diego, California 92121
Received 8 June 1998/Returned for modification 1 July 1998/Accepted 11 November 1998
 |
ABSTRACT |
POU domain proteins have been implicated as key regulators during
development and lymphocyte activation. The POU domain protein T-cell
factor
1 (TCF
1), which binds octamer and octamer-related sequences, is a potent transactivator. In this study, we showed that
TCF
1 is phosphorylated following activation via the T-cell receptor
or by stress-induced signals. Phosphorylation of TCF
1 occurred
predominantly at serine and threonine residues. Signals which
upregulate Jun kinase (JNK)/stress-activated protein kinase activity
also lead to association of JNK with TCF
1. JNK associates with the
activation domain of TCF
1 and phosphorylates its DNA binding domain.
The phosphorylation of recombinant TCF
1 by recombinant JNK enhances
the ability of TCF
1 to bind to a consensus octamer motif. Consistent
with this conclusion, TCF
1 upregulates reporter gene transcription
in an activation- and JNK-dependent manner. In addition, inhibition of
JNK activity by catalytically inactive MEKK (in which methionine was
substituted for the lysine at position 432) also inhibits the ability
of TCF
1 to drive inducible transcription from the interleukin-2
promoter. These results suggest that stress-induced signals and T-cell
activation induce JNK, which then acts on multiple cis
sequences by modulating distinct transactivators like c-Jun and
TCF
1. This demonstrates a coupling between the JNK activation pathway and POU domain proteins and implicates TCF
1 as a
physiological target in the JNK signal transduction pathway leading to
coordinated biological responses.
 |
INTRODUCTION |
The demonstrated importance of
octamer and octamer-like motifs in expression of a number of genes
suggests that octamer-binding proteins are essential for both
constitutive (36, 37) and inducible (3, 18-20,
43) gene expression. In addition, octamer motifs have been shown
to regulate both lineage-specific (10, 37, 40) and
ubiquitous (35, 38, 40) gene expression. POU proteins are
the major transactivators which bind octamer and octamer-related
sequences and upregulate transcription in an octamer-dependent manner
(for reviews, see references 14 and
36). Spontaneous mutations or targeted disruption of
a number of POU proteins has dramatic effects during development
(5, 11, 25). We have previously cloned a novel POU domain
protein, T-cell factor
1 (TCF
1), which is the only member of a
new class (class VI) of POU domain proteins and whose transcript levels are highest in the thymus and brain (30). Although it is a
bonafide POU domain protein, it is distantly related to other known
members of the POU family of transactivators. TCF
1 binds to octamer
and octamer-related sequences from a number of genes and is a potent transactivator (30). Until we cloned TCF
1
(30), only two other POU proteins, Oct1 and Oct2, were known
to be expressed in lymphocytes (36). TCF
1 has also been
subsequently cloned by others and variously termed Brn5 (1),
pou[c] (16), Emb (33), and mPOU
(45). The ability of TCF
1 to bind an inducible element in
the proximal octamer motif in the interleukin-2 (IL-2) promoter (see
below) suggests that it might be involved in an activation-dependent
pathway. This is consistent with the observation that Oct2-null mice
have deficits in lipopolysaccharide-induced secretion of
immunoglobulins in the B-cell lineage (5).
Activation of cells by growth factors and other extracellular stimuli
is known to result in activation of a set of serine/threonine kinases.
These include the extracellular signal-related kinases (ERKs) as well
as the stress-activated protein kinases (SAPKs), or Jun kinases (JNKs).
A major function of JNK is the phosphorylation of the c-Jun component
of the AP-1 transcription factor, thereby regulating its
transactivating function in various gene promoters, including that of
the IL-2 gene (15, 39). The JNK (SAPK) family members are
activated by UV irradiation, tumor necrosis factor alpha,
cycloheximide, heat shock, and T-cell activation (6, 8, 15, 17,
22, 31, 39). The JNK family members display a sequence similarity
of ~83% to each other (8, 17, 22) and exhibit ~40%
sequence homology to other mitogen-activated protein kinases, such as
ERK2. Three JNK genes have been cloned: JNK1 (46 kDa) and its rat
homologue, SAPK
; JNK2 (55 kDa) and its rat homologue, SAPK
II; and
the SAPK
gene (8, 22). The SAPK
I transcript is an
alternatively spliced form of the JNK2 gene (17, 22). These
kinases define a subgroup of mitogen-activated protein kinases that
share the sequence Thr-Pro-Tyr in their activating phosphorylation
sites (8, 17, 22), in contrast to the Thr-Glu-Tyr sequence
in the ERK1 and ERK2 genes. The two JNKs are activated identically by a
diverse set of stimuli (8, 17, 22). The similarity in
regulation of different members of the JNK family suggests that they
may have redundant functions. Despite essentially identical regulation,
the two JNKs are differ considerably in their ability to bind c-Jun.
JNK2 binds c-Jun with a much higher affinity than does JNK1 and thus
phosphorylates it more efficiently, and it has been shown to be a
better inducer of c-Jun promoter activity (17).
In this study, we investigated the role of JNK in activation-dependent
phosphorylation of a POU domain protein, TCF
1. We showed that
TCF
1 is phosphorylated after activation via the T-cell receptor or
by stress-induced signals like UV light. In addition, we demonstrated
that JNK binds the activation domain of TCF
1 and phosphorylates its
DNA binding domain. Further, we mapped the phosphorylation site in the
DNA binding domain. Phosphorylation of TCF
1 increased its ability to
bind to octamer motifs. We also demonstrated that activation-induced
transactivation by TCF
1 is dependent on JNK activity. This suggests
a mechanism by which activation-dependent signals can integrate at
octamer motifs implicated in inducible gene expression.
 |
MATERIALS AND METHODS |
GST fusion proteins.
The cDNAs encoding TCF
1 and its
fragments were cloned in frame into the pGEX vector. The full-length
human TCF
1 (amino acid residues 1 to 301), the DNA binding domain of
TCF
1 (residues 145 to 301), and the activation domain of TCF
1
(residues 10 to 145) were expressed as glutathione
S-transferase (GST) fusion proteins in Escherichia
coli and purified as described previously (12). The
GST-c-Jun (1-223) vector was obtained from M. Karin (University of
California, San Diego [UCSD]). Site-specific mutagenesis of the
TCF
1 protein was undertaken by PCR, and the target sequence was
confirmed at least twice by sequencing. The mutant TCF
1 GST fusion
proteins were made by standard methods and had their predicted molecular weights.
Transient transfections.
Human Jurkat T cells were grown in
RPMI 1640 medium (GIBCO) supplemented with 10% fetal bovine serum
(GIBCO), 10 mM HEPES (pH 7.3), 2 mM L-glutamine, 1 mM
sodium pyruvate, and 100 U of penicillin-streptomycin/ml. The
full-length TCF
1 cDNA (residues 1 to 301) or the activation domain
of TCF
1 (residues 10 to 145) was expressed in Jurkat cells under the
control of the SR
promoter. These vectors expressed proteins which
were HA epitope (human influenza virus hemagglutinin nonapeptide,
Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala) tagged at their N termini. The
expression vectors for HA-JNK1 (8), HA-JNK2 (17),
and the dominant-negative mutant of MEKK were obtained from M. Karin
(UCSD). Jurkat cells (107) were washed twice with
serum-free RPMI 1640 medium, resuspended in 400 µl of serum-free
medium, mixed with 15 µg of DNA in a Bio-Rad 0.4-cm-light-path
cuvette, and kept on ice for 10 min. The cells were then electroporated
at 260 V and 960 µF (Gene-Pulser; Bio-Rad) and kept on ice for an
additional 10 min before being resuspended in complete RPMI 1640 medium
containing 10% fetal bovine serum. After 48 h, the cells were
stimulated for various time periods and then harvested.
Luciferase assays.
Briefly, different IL-2 promoter
constructs was cotransfected with various expression vectors. The
variations in transfection efficiencies were normalized by using the
pCMV
-galactosidase expression vector. Forty hours posttransfection,
the cells were activated with phorbol myristate acetate (PMA) plus
ionomycin and incubated for another 12 to 18 h. The cells were
harvested, washed three times with phosphate-buffered saline (PBS), and
lysed in 100 µl of the lysis buffer (see below). Cell debris was
removed by centrifugation, and the supernatant was used in the
luciferase assay employing a Monolight model 2010 luminometer.
Activation and cell lysis.
Approximately 107
Jurkat cells were washed twice with PBS, resuspended in 100 µl of
PBS, and activated at 37°C with PMA (5 ng/ml), phytohemagglutinin
(PHA; 5 µg/ml), anti-CD3 (OKT3) antibody (10 µg/ml), anti-CD28
antibody (2 µg/ml), and UV-C (40 J/m2) for various
periods of time. Stimulation was terminated by adding 1 ml of cold
lysis buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM EDTA, 1%
Brij 96, 50 µg of aprotinin/ml, 50 µg of leupeptin/ml, and 1 mM
Na3VO4. Nuclei and cell debris were removed by
centrifugation at 13,000 × g for 15 min at 4°C.
Five-microgram quantities of the control GST protein and the different
GST fusion proteins were separately mixed with 1 ml of Jurkat cell
lysate and incubated for from 4 h to overnight at 4°C prior to
incubation with 30 µl of glutathione-Sepharose beads for 1 h.
Immobilized fusion proteins were then washed four times with lysis
buffer and once with kinase buffer and then subjected to the kinase
assay as described below. Immunoprecipitation of transfected JNK was
done as described elsewhere (15). In some experiments,
transiently transfected Jurkat cells were resuspended in 0.5 ml of
phosphate-free RPMI medium and metabolically labelled for 4 h with
0.5 mCi of 32Pi (9,120 Ci/mmol; DuPont NEN,
Boston, Mass.) prior to activation for the last 30 min of labelling.
Immunoprecipitations and kinase assays.
HA epitope-tagged
proteins were immunoprecipitated from cell lysates with 5 to 10 µg of
anti-HA antibody (12CA5) at 4°C for 4 h and then incubated with
40 µl of protein A-Sepharose for 1 to 2 h. Immune complexes were
washed four times with lysis buffer and once in kinase buffer (10 mM
HEPES [pH 7.4], 5 mM MnCl2, 5 mM MgCl2, 0.1%
Nonidet P-40, 5 mM dithiothreitol) and then resuspended in 30 µl of
kinase buffer supplemented with 1 µM ATP and 10 µCi of
[
-32P]ATP (Dupont NEN; 7,000 Ci/mmol). Kinase
reactions were carried out at 30°C for 15 min and stopped by washing
once with kinase buffer; proteins eluted with 2× sodium dodecyl
sulfate (SDS) sample buffer (60 mM Tris [pH 6.8], 2.3% SDS, 10%
glycerol, 5%
-mercaptoethanol), resolved by SDS-polyacrylamide gel
electrophoresis (PAGE), transferred to Immobilon membranes (Millipore,
Bedford, Mass.), and subjected to autoradiography. Recombinant JNK2 was
used to phosphorylate TCF
1 wild-type and mutant peptides. Peptides
A, B, and C were synthesized by using the La Jolla Institute for
Allergy and Immunology peptide synthesizer and purified to homogeneity
by high-performance liquid chromatography. The phosphorylated peptides
were then analyzed on 15% Tricine gels.
Tryptic peptide mapping.
Phosphorylated TCF
1 proteins
were resolved by SDS-PAGE, transferred to Immobilon membranes,
localized by autoradiography, and excised. The membranes were then
treated with polyvinylpyrrolidone 360 and
N-tosyl-L-phenylalanine chloromethyl
ketone-treated trypsin (27). The resulting phosphopeptides
were separated by electrophoresis on cellulose thin-layer
chromatography plates at pH 1.9 for 27 min followed by ascending
chromatography in n-butanol-pyridine-acetic acid-water
(75:50:15:60). Labelled peptides were detected by autoradiography.
Phospho-amino acid (PAA) analysis.
Phosphorylated TCF
1
proteins were resolved by SDS-PAGE and transferred to Immobilon
membranes as described above. Following autoradiography, bands
corresponding to labelled proteins were excised, washed extensively
with distilled water, and subjected to hydrolysis in 100 µl of 6 N
HCl at 110°C for 1 h. The membranes were then discarded, 1 ml of
distilled water was added to the tube, and samples were lyophilized and
then resuspended in 10 µl of electrophoresis buffer (pH 1.9)
containing 1 µg of each amino acid standard (phosphoserine,
phosphothreonine, and phosphotyrosine). Samples were spotted on
cellulose thin-layer plates and analyzed by two-dimensional thin-layer
electrophoresis at pH 1.9 and then at pH 3.5. Nonradioactive standards
were detected by staining with 0.25% ninhydrin in acetone, and
labelled amino acids were detected by autoradiography.
DNA binding assays.
Purified TCF
1 fusion proteins were
phosphorylated by recombinant JNK2 in the presence or absence of 30 µM exogenous ATP and were then used in a gel shift assay
(30). DNA binding reactions were carried out for 20 min at
4°C in a buffer containing 50 mM HEPES (pH 7.8), 20 mM
MgCl2, 0.5 mM EDTA, 20 mM spermidine, 500 µg of bovine
serum albumin/ml, 10 mM dithiothreitol, 75% glycerol, and
104 cpm of labelled probe. The probe used was a 30-mer
double-stranded synthetic oligonucleotide containing the sequence
5' TTTGAAATATGTGTAATATGTAAAACAT 3' of the proximal octamer
site in the human IL-2 promoter (18). Each strand was
labelled separately with T4 polynucleotide kinase (Bethesda Research
Laboratories) and [
-32P]ATP [5,000 Ci/mmol], and the
strands were then slowly allowed to reanneal. The samples were analyzed
on a 4% nondenaturing acrylamide gel in 0.5× Tris-borate-EDTA. In
some experiments, nuclear extracts from transfected Jurkat cells were
made as described previously (28). Binding reaction mixtures
contained 5 to 10 µg of nuclear extract, 32P-labelled
probe (25,000 cpm), and 2 µg of poly(dI-dC) in the binding buffer.
For supershift experiments, extracts were preincubated with 1 µl of
anti-HA antibody at 4°C for 45 min before addition of the probe.
 |
RESULTS |
Activation-dependent phosphorylation of TCF
1.
To determine
whether TCF
1 undergoes activation-dependent phosphorylation, we
generated and purified a GST fusion protein of TCF
1 and analyzed the
abilities of resting and activated Jurkat cell lysates to
phosphorylate GST-TCF
1. Activation of Jurkat cells with diverse
stimuli such as PMA, PMA plus PHA, or stress-inducing signals like UV
light (Fig. 1) induced phosphorylation of
TCF
1. In addition, we found that activation by anti-CD3 plus
anti-CD28 antibodies also induced phosphorylation of TCF
1 (data not
shown). Incubation of GST-TCF
1 with cell lysates from Jurkat T cells activated with PMA, PMA plus PHA, or UV light for various lengths of
time showed that maximum phosphorylation of TCF
1 occurred at 30 min
after activation, whereas the control GST protein was not
phosphorylated (Fig. 1).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
TCF 1 is phosphorylated in vitro in an
activation-dependent manner. Full-length TCF 1 (residues 1 to 301)
expressed as a GST fusion protein was incubated with cell extracts from
Jurkat cells activated with PMA (5 ng/ml), PMA (5 ng/ml) plus PHA (5 µg/ml), or UV for the indicated lengths of time, processed for in
vitro kinase assay, analyzed by SDS-PAGE, and visualized by
autoradiography. GST alone was used as a negative control.
|
|
In an attempt to clarify whether TCF
1 was also phosphorylated in
vivo by activation-dependent serine/threonine kinases, we generated
TCF
1 expression vectors. These vectors expressed the full-length
TCF
1 (residues 1 to 301) as HA epitope-tagged proteins. Cells
transfected with such vectors expressed the appropriately sized HA
epitope-tagged TCF
1 protein, as determined by Western immunoblotting
of lysates from transfected Jurkat cells with 12CA5, an HA-specific
monoclonal antibody (Fig. 2B). These
experiments were done in Jurkat T cells which were stably transfected
with the simian virus 40 large T antigen to ensure a high level of expression by this vector in these cells. To detect phosphorylation of
TCF
1 in vivo, the cells were metabolically labelled with inorganic 32P for the last 4 h of transfection. During the final
30 min of labelling, Jurkat cells were activated with PHA plus PMA. A
two- to threefold increase in phosphorylation of full-length TCF
1 upon activation (Fig. 2A) was reproducibly demonstrated. A Western blot
analysis using an antibody generated against the epitope (12CA5) showed
that there were equal amounts of proteins in the two lanes (Fig. 2B). A
PAA analysis of TCF
1 phosphorylated in vivo (Fig. 2C) showed
predominantly phosphoserine and some phosphothreonine but no
phosphotyrosine content. These data suggest that TCF
1 is
phosphorylated in vivo on serine and threonine residues.


View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
TCF 1 is phosphorylated in vivo by serine/threonine
kinases. (A) Phosphorylation of epitope-tagged TCF 1 in Jurkat cells
after activation. Jurkat cells that were transfected with pJF-HA vector
alone, or the same vector expressing full-length TCF 1, and then
metabolically labelled (32P) were activated with PMA (5 ng/ml) plus PHA (5 µg/ml). TCF 1 was immunoprecipitated from Jurkat
cell lysates with anti-HA antibody, resolved on SDS-PAGE gels,
transferred to Immobilon membranes, and visualized by autoradiography.
The arrow indicates the TCF 1 band. (B) Expression of epitope-tagged
TCF 1 in Jurkat cells after transient transfection. Jurkat cells were
transfected, and 48 h later, expression of HA-TCF 1 protein was
determined by Western immunoblotting. TCF 1 was immunoprecipitated
from Jurkat cell lysates with anti-HA antibody (12CA5), resolved on
SDS-polyacrylamide gels, and Western blot probed with anti-HA antibody.
The western immunoblot shows that the levels of expression of
HA-TCF 1 in activated and unactivated Jurkat cells are similar, as
evident in panel A. The arrow indicates the TCF 1 band. (C) PAA
analysis of full-length TCF 1, labelled in vivo, from activated
Jurkat cells. Phosphoserine and some phosphothreonine were detectable,
but phosphotyrosine was not.
|
|
JNK binds the activation domain of TCF
1.
The amino acid
sequence of TCF
1 revealed the presence of potential JNK
phosphorylation sites. This suggested the possibility that JNK was a
likely candidate for a kinase which could phosphorylate TCF
1. This
was especially relevant since TCF
1 was phosphorylated by T-cell
activation signals and also by stress-inducing signals like UV
irradiation (Fig. 1A). Since analysis of JNK activity had been
facilitated by its ability to bind the activation domain of c-Jun, we
decided to do "fishing" experiments with GST fusion proteins of
full-length TCF
1 or its DNA binding domain and determine whether JNK
associates with TCF
1. This was done by allowing cell lysates from
Jurkat cells activated with anti-CD3 and anti-CD28 antibodies to bind
GST fusion proteins containing either full-length TCF
1 or its
activation or DNA binding domain. Proteins bound to GST-TCF
1 were
then immobilized on glutathione-agarose beads and washed several times
to remove the unbound proteins. Exogenous GST-c-Jun was then added as
the substrate in an in vitro kinase assay. Such experiments showed that
full-length TCF
1 and the activation domain of TCF
1 bound an
activation-dependent kinase which phosphorylated c-Jun in vitro (Fig.
3). In contrast, the DNA binding domain
of TCF
1 did not bind this kinase (Fig. 3). Tryptic peptide maps of
phosphorylated c-Jun were similar to those previously described after
phosphorylation of c-Jun with JNK (data not shown), suggesting
association of JNK with the activation domain of TCF
1.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Proteins which associate with TCF 1 phosphorylate
GST-c-Jun in vitro. Bacterially expressed GST fusion proteins of
full-length TCF 1 (residues 1 to 301), the activation domain of
TCF 1 (residues 1 to 144), or the DNA binding domain of TCF 1
(residues 145 to 301) were incubated with cell lysates from unactivated
( ) Jurkat cells (left panel) or Jurkat cells activated (+) with
anti-CD3 plus anti-CD28 (left panel) or were incubated with activated
recombinant JNK2 (a kind gift from M. Karin) (right panel). The
proteins associated with GST-TCF 1 were immobilized on
glutathione-agarose beads. GST-c-Jun was subsequently added to the
kinase reaction mixture, and the phosphorylated proteins were resolved
on SDS-polyacrylamide gels and analyzed by autoradiography.
|
|
We extended these studies by performing criss-cross depletions with
TCF

1 and c-Jun. Activated extracts phosphorylate both
TCF

1 and
c-Jun in an activation-dependent manner. Such extracts
were pretreated
to remove proteins which bind to the activation
domain of c-Jun. These
pretreated extracts were no longer able
to phosphorylate TCF

1 (Fig.
4). In the criss-cross experiment,
extracts were depleted with immobilized GST-TCF

1 beads, and such
depleted extracts were then unable to phosphorylate c-Jun (Fig.
4).
These studies suggested that c-Jun kinases bind and phosphorylate
TCF

1. Consistent with our conclusions that the activation domain
of
TCF

1 binds JNK, homologous conserved motifs can be identified
in
both the

region (residues 20 to 80) of c-Jun and the activation
domain (residues 1 to 145) of TCF

1 (Table
1).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
The kinase which phosphorylates TCF 1 is depleted by
using immobilized c-Jun, and the c-Jun kinase activity is depleted by
using immobilized GST-TCF 1 beads. Activated extracts which contained
c-Jun kinase activity were first incubated with immobilized
GST-TCF 1, and the ability of the flow-through to phosphorylate c-Jun
in vitro was then determined. Alternatively, the ability of extract to
phosphorylate TCF 1 was determined after running it over immobilized
GST-c-Jun. These criss-cross absorption studies suggest that the same
kinase (JNK) which binds and phosphorylates the activation domain of
c-Jun also binds and phosphorylates TCF 1.
|
|
JNK2 phosphorylates TCF
1.
To determine if TCF
1 is a
substrate for JNK2, we transfected Jurkat T cells with JNK2 expression
vectors (8, 17). These vectors drive expression of the JNK2
kinase with an N-terminal HA epitope tag. The JNK2 from such cells was
activated by UV irradiation and then immunoprecipitated with
HA-specific antibodies 48 h after transfection. The ability of
immunoprecipitated JNK2 to phosphorylate various substrates was then
tested in an in vitro kinase assay. Our results show that JNK2
phosphorylates the TCF
1 DNA binding domain, but not its activation
domain, in an activation-dependent manner (Fig.
5A). As expected, JNK2 phosphorylated
GST-c-Jun but not the control GST protein (Fig. 5A). PAA analysis of
the DNA binding domain of TCF
1, phosphorylated in vitro by JNK2,
indicated that it contained both phosphoserine and phosphothreonine
residues (Fig. 5B).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
JNK2 phosphorylates the DNA binding domain, on Ser and
Thr residues, but not the activation domain of TCF 1. (A) JNK2
phosphorylates the DNA binding domain of TCF 1. Jurkat cells were
transfected with a vector expressing HA-JNK2, and lysates were prepared
from either unactivated cells or cells activated with anti-CD3 and
anti-CD28 antibodies. The HA-JNK2 protein was immunoprecipitated with
anti-HA antibody immobilized on protein A-Sepharose beads and then used
in kinase reactions. Bacterially expressed GST fusion proteins
containing full-length TCF 1 (residues 1 to 301), the DNA binding
domain of TCF 1 (residues 145 to 301), the activation domain of
TCF 1 (residues 10 to 145), and c-Jun (residues 1 to 223) were then
added to the HA-JNK2-dependent kinase reactions. GST alone was used as
a negative control. The products of the kinase reactions were then
analyzed on SDS-polyacrylamide gels and autoradiographed. (B) PAA
analysis of the DNA binding domain of TCF 1, phosphorylated in vitro
by activated JNK2. TCF 1 is primarily phosphorylated at serine and
threonine residues. No phosphotyrosine was detected.
|
|
Identification of JNK2 phosphorylation sites in TCF
1.
Full-length TCF
1 was phosphorylated in vivo, as shown in Fig. 2, by
transfecting Jurkat cells with vectors driving expression of
epitope-tagged TCF
1. Comparison of tryptic maps generated from
unactivated (Fig. 6A, left panel) and
activated (Fig. 6A, right panel) cells showed that activated cells
contained additional phosphopeptides. If the ability of JNK2 to
phosphorylate TCF
1 in vitro reflects that TCF
1 is a physiological
target of JNK activity, when TCF
1 is phosphorylated in vivo, it
should be possible to identify phosphopeptides identical to those
generated by TCF
1 that has been phosphorylated in vitro. TCF
1 was
phosphorylated in vivo as described above. TCF
1 was phosphorylated
in vitro by JNK2 as described in the legend to Fig. 5. We then compared the two-dimensional chromatographic patterns of tryptic phosphopeptides generated from TCF
1 protein phosphorylated in vitro with JNK2 (Fig.
6B, left panel) with those generated from TCF
1 phosphorylated in
vivo (Fig. 6B, middle panel). At least one common tryptic
phosphopeptide can be identified when the in vitro panel is compared to
the in vivo panel. To strengthen this argument, we did experiments in which we mixed tryptic digests of in vitro- and in vivo-labelled TCF
1. The same peptide was found to be completely overlapping (Fig.
6B, right panel). These data suggest that at least one such site in
TCF
1 is a target of JNK2 in vivo.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Identification of phosphopeptides in TCF 1
phosphorylated in vivo or in vitro with JNK2. (A) Tryptic maps of in
vivo-phosphorylated TCF 1 from unactivated or activated Jurkat cells.
Jurkat T cells were transfected with epitope-tagged TCF 1 expression
plasmids. Parallel cultures were either left unactivated or activated
and labelled in vivo. The in vivo-phosphorylated TCF 1 was then
analyzed by two-dimensional tryptic mapping. The leftward-pointing
arrow identifies a phosphopeptide which is indistinguishable from a
phosphopeptide identified when recombinant TCF 1 is phosphorylated in
vitro with JNK2 (see below). (B) Identification of TCF 1
phosphopeptides phosphorylated in vivo or in vitro by JNK2. The tryptic
phosphopeptide maps of TCF 1 labelled in vitro (left panel) or in
vivo (middle panel) or a mix of in vitro- and in vivo-phosphorylated
TCF 1 (right panel) are shown. The three samples were run in
parallel. The middle panel is from in vivo-labelled, activated Jurkat
cells which had been transiently transfected with epitope-tagged
TCF 1 expression plasmids. Labelled proteins were analyzed as
described in Materials and Methods, and the protein of interest was
excised from the gels, digested with trypsin, and analyzed by
two-dimensional electrophoresis. The leftward-pointing arrows identify
the phosphopeptide which is completely superimposable and is present in
both in vitro- and in vivo-labelled TCF 1 maps.
|
|
A more careful examination of the primary sequence of TCF

1 revealed
two residues flanking the basic region of the POU homeodomain
of
TCF

1 which could be putative targets of JNK2 activity. (It
is of
interest that the basic region itself is also a target of
other protein
kinases in two different POU domain proteins [
4,
21,
38].) These residues are identified in Table
2. We then
determined the ability of JNK2
to phosphorylate in vitro a wild-type
peptide from this region of
TCF

1. JNK2 phosphorylated this peptide
in an activation-dependent
manner (Fig.
7, left panel). We then
generated two mutant peptides. In one, termed mutant peptide A
[T
239S
240 to A
239
A
240], residues phosphorylated by protein kinase A have
been mutated
to alanine. In mutant peptide B
[S
232T
242 to
A
232A
242], the putative JNK phosphorylation
sites in TCF

1 have been mutated.
In vitro phosphorylation
experiments with JNK2 revealed that mutant
peptide A was still
phosphorylated by JNK2 in an activation-dependent
manner whereas when
the putative JNK sites were mutated (mutant
peptide B), JNK2 could not
phosphorylate the resultant peptide
(Fig.
7, right panel), thus
suggesting that we had identified
one target of JNK2 activity in the
DNA binding domain of TCF

1.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
Mapping of a JNK2 phosphorylation site in the DNA
binding domain of TCF 1. The ability of recombinant JNK2 to
phosphorylate the wild-type peptide and two mutant peptides from a
region spanning the basic region of the POU homeodomain of TCF 1 was
determined (also see Table 1). The wild-type peptide extends from
residues 227 to 246 of the TCF 1 protein (33). In mutant
peptide A (T239S240 to
A239A240), residues which have been shown to be
the target of protein kinase A in other POU domain proteins (21,
38) have been mutated to alanine. In mutant peptide B
(S232T242 to A232A242),
the putative JNK2 phosphorylation sites in TCF 1 have been mutated to
alanine. JNK2 can phosphorylate the wild-type peptide and mutant
peptide A in an activation-dependent manner, whereas mutant peptide B
cannot be phosphorylated by JNK2. , cultures were not activated; +,
cultures were activated.
|
|
To confirm that these potential sites in TCF

1 were actually
phosphorylated by JNK2, we generated four site-specific mutants
of
TCF

1. The abilities of these mutant TCF

1 proteins to be
phosphorylated
in vitro by JNK2 were compared to that of wild-type
TCF

1. The
T
239S
240-to-A
239A
240
TCF

1 mutant, as expected, was phosphorylated by JNK2 (Fig.
8).
In contrast, and as expected from the
peptide data, the S
232-to-A
232 mutant was
phosphorylated less efficiently (Fig.
8). These results
with
site-specific mutant TCF

1 proteins and the mutant peptide
data (Fig.
7 and Table
2) support the conclusion that we had
identified one target
of JNK2 activity in the DNA binding domain
of TCF

1.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Ability of JNK2 to phosphorylate site-specific mutants
of TCF 1. A panel of mutant TCF 1-GST fusion proteins was tested
for the ability to be phosphorylated by activated recombinant JNK2 in
vitro. The TCF 1 mutants 1 (T194S197 to
A194A197), 2 (S232 to
A232), and 3 (T239S240 to
A239A240) were generated, and equal amounts of
the mutants were tested as substrates in an in vitro JNK2 kinase assay.
The sequences of the different mutants are shown at the top, and the
phosphorylation of the mutants described above is shown below. The
immunoblot of the same gel, obtained by using anti-GST antibodies, is
shown below the in vitro kinase assay results. The underlined amino
acids have been mutated to alanine in the mutants. POUsp refers to the
POU-specific domain B regions of the POU DNA binding domains.
|
|
Phosphorylation of TCF
1 by JNK2 enhances its ability to bind an
octamer motif.
We had shown earlier that recombinant TCF
1 can
bind octamer motifs in a sequence-specific manner (30). We
now wanted to determine whether TCF
1 would bind octamer sites when
other, competing POU domain proteins were also present. We addressed
this by doing supershifting experiments in Jurkat cells. As shown in
Fig. 9A, TCF
1 can effectively bind an
octamer motif in the presence of other POU domain proteins.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 9.
JNK2 phosphorylation of TCF 1 enhances its
ability to bind octamer motifs from the IL-2 promoter. (A) TCF 1
binds to the proximal octamer in the IL-2 promoter. Nuclear extracts
were prepared, as described previously (29), from Jurkat
cells transfected 48 h earlier with a vector expressing HA
epitope-tagged full-length TCF 1. An end-labelled proximal octamer
motif from the IL-2 promoter was used as a probe. Binding reactions
were done as described previously (30) and analyzed on 4%
nondenaturing acrylamide gels. As expected, extracts from cells
transfected with vector expressing full-length TCF 1 bound octamer
motifs and were supershifted in the presence of 1 or 2 µl of anti-HA
antibody. Extracts containing the epitope-tagged activation domain of
TCF 1 were not supershifted with anti-HA antibody, suggesting that
the supershifted band (indicated by the arrow) was indeed due to
binding of TCF 1 to the octamer motif via its DNA binding domain. (B)
The ability of the DNA binding domain of TCF 1 to bind to the octamer
motif increases with increasing amounts of JNK2. As described above,
the recombinant JNK2 was purified and used in increasing amounts to
phosphorylate the DNA binding domain of TCF 1 in the presence of 30 µM cold ATP. As expected, the ability of the DNA binding domain to
bind the octamer motif increased with increasing amounts of the kinase,
but only in the presence of exogenous ATP. (C) Phosphorylation of
full-length TCF 1 by JNK2 enhances its ability to bind an octamer
motif. COS-1 cells were transfected with an HA-JNK2 expression vector
and activated by UV irradiation, and JNK2 was purified from activated
Jurkat cell lysates by immunoprecipitation with anti-HA antibodies. The
HA-JNK2 was used to phosphorylate TCF 1. Each preparation of purified
HA-JNK2 was first tested for its ability to phosphorylate GST-c-Jun.
To ascertain that the DNA binding activity of TCF 1 was indeed due to
JNK phosphorylation, we performed the kinase reaction, using activated
kinase in the presence or absence of exogenous ATP. Phosphorylation of
TCF 1 by JNK2 (in the presence of ATP) enhanced the ability of
TCF 1 to bind a consensus octamer motif in a gel shift assay. The
arrow indicates the TCF 1 DNA-protein complex.
|
|
Phosphorylation of transcription factors has been found to be an
important regulator of transcriptional activity, acting to
perturb
nuclear translocation, transactivation ability (
17),
or DNA
binding ability (
21). To determine whether JNK
phosphorylation
of TCF

1 affects its DNA binding ability, we examined
the effect
of phosphorylation of recombinant TCF

1 in vitro by JNK2
on its
ability to bind an octamer motif (
43). COS-1 cells
were transfected
with a vector expressing HA epitope-tagged JNK2 and,
48 h later,
were activated by UV irradiation. The JNK2 was then
immunoprecipitated,
and the immunoprecipitates were used to
phosphorylate recombinant
GST-TCF

1 fusion proteins. To rule out any
artifactual effects,
we performed our kinase reaction with activated
JNK2 in the presence
and in the absence of exogenous cold ATP. The
phosphorylated TCF

1
proteins were then used in an electromobility
shift assay with
an end-labelled octamer motif from the IL-2 promoter
(
43). Phosphorylation
of the TCF

1 DNA binding domain by
JNK2 enhanced its ability to
bind to an octamer motif (Fig.
9B) in a
JNK2 concentration-dependent
manner (Fig.
9C). The ability of
full-length TCF

1 to bind an
octamer motif was also dramatically
enhanced by JNK2 in the presence
of exogenous ATP (Fig.
9C). We
therefore conclude that JNK binds
to the activation domain of TCF

1
and phosphorylates its DNA binding
domain, which increases the ability
of TCF

1 to bind octamer
motifs.
TCF
1 transactivates the IL-2 promoter in a JNK-dependent
manner.
Using reporter genes in which octamer motifs are located
upstream of the minimal promoter, we have previously shown that TCF
1 can transactivate in an octamer-dependent manner (30). The
IL-2 promoter contains octamer binding sites (proximal and distal) which are critical for activation-dependent transcription
(9). We performed transient-transfection experiments in
Jurkat cells to determine whether TCF
1 could transactivate the IL-2
promoter in an activation-dependent manner. Consistent with our
observations that TCF
1 could bind the IL-2 promoter octamer motifs
in supershifting experiments (Fig. 9A), TCF
1 was found to drive
transcription from the IL-2 promoter in an activation-dependent manner
(Fig. 10A). Furthermore, consistent
with our observation that JNK2 increases the binding of TCF
1 to
octamer motifs, we found that JNK2 enhances the ability of TCF
1 to
transactivate the minimal IL-2 promoter in an activation-dependent
manner (Fig. 10A). In previous studies, MEKK has been shown to be the
rate-limiting step in the JNK activation pathway. MEKK phosphorylates
the JNK kinase, which activates JNK activity. If TCF
1 is a target of
JNK2 activity, it should be possible to demonstrate that a
dominant-negative mutant of MEKK (in which methionine has been
substituted for the lysine at position 432 [(K432M]) inhibits the
activation-dependent induction of the IL-2 promoter by TCF
1 but has
no effect on activation-independent transactivation of the IL-2
promoter by TCF
1. We found that the catalytically inactive MEKK
(K432M), which inhibits the activation-dependent induction of JNK
activity, also inhibits the activation-dependent induction of the IL-2
promoter by TCF
1 (Fig. 10B). The dominant-negative mutant of MEKK
had no effect on TCF
1-dependent basal transcription. The data
presented in this paper therefore suggest a mechanism by which the
functional activity of TCF
1 is coupled to the JNK signal
transduction pathway.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 10.
The ability of TCF 1 to induce activation-dependent
transactivation of the IL-2 promoter is JNK dependent. (A) TCF 1
enhances the activation-inducible transcription of the IL-2 promoter.
Jurkat T cells were transfected with a minimal promoter from the IL-2
gene cloned into a luciferase reporter plasmid (9). The
activation-dependent transcription from the IL-2 promoter was enhanced
by cotransfection with a TCF 1 expression plasmid or a JNK2
expression plasmid. Cotransfection of both TCF 1 and JNK2 expression
plasmids further enhanced transcription from the cotransfected IL-2
reporter plasmid. Cells were activated with PMA plus ionomycin for 12 to 18 h, harvested, and assayed for luciferase activity as
described in Materials and Methods. (B) The dominant-negative mutant of
MEKK (K432M) inhibits the ability of TCF 1 to enhance inducible
transcription from the IL-2 promoter. Jurkat T cells were transfected
with the IL-2 reporter plasmid and either left unactivated or activated
with PMA plus ionomycin (P+I) for 12 to 18 h. Cells were
cotransfected with TCF 1 alone or with the catalytically inactive
MEKK (K432M) expression plasmid. The dominant-negative mutant of MEKK
inhibits inducible, but not basal, transactivation by TCF 1.
|
|
 |
DISCUSSION |
The potent regulatory effect of phosphorylation on the ability of
transactivators to bind DNA has been underlined by studies of many
families of transactivators. Fibroblast growth factor induces protein
kinase C, which phosphorylates the basic region of the DNA binding
domain of myogenin and decreases its DNA binding activity
(24). Myogenin is a helix-loop-helix protein which is
essential for muscle development. Phosphorylation of the PU.1 transactivator (a member of the ETS family of transactivators) by
casein kinase II (34) leads to the recruitment of Pip to sites in the immunoglobulin lambda enhancer (10). Pip by
itself does not bind to this motif. Pip is probably identical to the previously identified nuclear factor EM5. Pip and PU.1 function as
mutually dependent transcriptional activators of the composite element
(10).
A number of cases in which the JNK binds and phosphorylates
transcriptional activators involved in T-cell costimulation and stress-induced gene expression have been documented. The best-studied example remains the c-Jun transactivator (15, 32). The
phosphorylation of c-Jun at Ser-63 and Ser-73 in the activation domain
increases c-Jun transactivation. In a similar manner, JNK also
increases transactivation by the ATF-2 transactivator (13, 26,
44) and the TCF protein Elk1 transactivator (46). The
ATF-2 transcription factor mediates adenovirus E1A-inducible
transcriptional activation, and Elk-1 belongs to the subfamily of ETS
domain transcription factors and is a key factor in serum response
element-dependent gene transcription. We have now
extended the model to include POU domain proteins. TCF
1, a POU
protein, is phosphorylated by JNK, and JNK activity determines the
ability of TCF
1 to upregulate inducible transcription from the IL-2 promoter.
The
domain in c-Jun, which is responsible for binding of c-Jun to
JNK1 and JNK2, has been mapped (6, 8, 17). Similarly, a
region in ATF-2 flanking the phosphorylated residues Thr69 and Thr71,
which bind JNK, has been mapped (13, 26, 44). The region in
TCF
1 that binds JNK2 has also been mapped to the activation domain,
and three modestly conserved motifs homologous to the
region in
c-Jun have been identified in the activation domain of TCF
1 (Table
1). The conservation of such motifs in JNK2 binding sites in c-Jun and
TCF
1 suggests their involvement in JNK binding. These motifs are
absent in v-Jun, which does not bind JNK. These studies, while
integrating the JNK signaling pathway with multiple transactivators,
also suggest that there are two distinct mechanisms by which JNK
influences transactivator activity; both involve binding of JNK to the
activation domain, but one involves phosphorylation of the activation
domain (c-Jun and ATF-2) and enhanced transactivation. The second
mechanism involves binding of JNK to the activation domain of TCF
1
and phosphorylation of the DNA binding domain, which increases the
ability of TCF
1 to bind DNA. These studies also underline the
relevance of studying in parallel the multiple transcriptional targets
of the JNK signaling pathway.
Phosphorylation of POU transactivators has been shown to be a potent
regulatory mechanism which influences DNA binding. Oct1 is
phosphorylated at Ser385 during mitosis (38).
This residue is conserved in all POU proteins. Pit1 is also
phosphorylated at the homologous residue, Thr220, during
mitosis (4). This phosphorylation of Pit1 and Oct1 during
mitosis inhibits DNA binding (4, 38). These homologous residues in Pit1 (Thr220) and Oct1 (Ser385) are
phosphorylated in vitro by protein kinase A (4, 21, 38).
Although cyclic AMP agonists induce phosphorylation of Pit1 in vitro
(4, 21), there have been conflicting reports as to whether
this site is phosphorylated by such agents in vivo (4, 21).
The homologous amino acid residue in TCF
1 is not phosphorylated by
JNK2, but a flanking site in TCF
1 is phosphorylated by that protein
(Table 2). This was shown by determining the ability of JNK2 to
phosphorylate wild-type and mutated peptides from this region of
TCF
1 (Table 2 and Fig. 7, right panel). This was also supported by
the data from studies using TCF
1 proteins which had been mutagenized
in a site-specific manner (Fig. 8). The basic region of the homeodomain
of POU proteins is critical for DNA binding, as suggested by the
observation that i-pou, which does not bind DNA (41), is
generated by alternative splicing of two amino acids in the basic
region of the homeodomain of the "twin of pou" gene
(42). The contention that this region of the POU homeodomain
is critical for binding DNA is further supported by crystal
structural analysis of Oct1 and Oct2 (2, 7).
In our studies, we have demonstrated that JNK2 can bind and
phosphorylate TCF
1, thereby increasing its ability to bind an octamer motif. It is possible that after phosphorylating TCF
1, JNK
phosphorylates an adjacent protein even though it does not directly
bind to it. It has been reported that E2F associates with p107, cyclin
A, and cdk2 (23). This was suggested as a means of
recruiting cdk2 to phosphorylate other DNA binding proteins. It has
also been demonstrated that the KU antigen associates with DNA-dependent protein kinase (SCID kinase), allowing it to
phosphorylate other DNA binding proteins (for a review, see reference
1a). In a similar manner, TCF
1 may recruit JNK to
phosphorylate other components of the transcriptional machinery and
thereby influence their activity. One particularly interesting example
is the proximal octamer motif in the IL-2 enhancer (43). It
is a composite binding site for both Jun-Fos heterodimers and POU
proteins (43). The ability of JNK to upregulate c-Jun
transactivation (8, 17, 22) and DNA binding of TCF
1 (this
paper) suggests an additional mechanism of synergy between these two
transactivators. In this regard, the ability of both proteins to bind
JNK and the adjacent location of these sites in the proximal octamer
motif suggest that the JNK signaling pathway can act via both AP-1 and
POU proteins to ensure IL-2 gene induction after T-cell activation. Our
demonstration that TCF
1 in Jurkat extracts binds the proximal
octamer motif from the IL-2 enhancer (Fig. 9), and the expression of
TCF
1 in thymus and T-cell lines (30) as well as the
JNK-dependent transactivation of the IL-2 promoter by TCF
1 (Fig.
10), suggests a role for TCF
1 in IL-2 gene induction.
In summary, we have shown in this study that the POU domain protein
TCF
1 is phosphorylated after T-cell costimulation or UV treatment.
JNK2 binds the activation domain of TCF
1 and phosphorylates its DNA
binding domain. This phosphorylation of TCF
1 by JNK2 increases its
ability to bind octamer motifs. In addition, JNK activity dictates the
ability of TCF
1 to drive inducible transcription from the IL-2
promoter. These results suggest a critical role for JNK in regulating
gene transcription via an octamer-binding transcription factor.
 |
ACKNOWLEDGMENTS |
We thank Douglas Green (La Jolla Institute of Allergy and
Immunology) for invaluable suggestions with regard to the manuscript. We acknowledge the kind gifts of c-Jun, JNK1, JNK2, and DN-MEKK expression plasmids from M. Karin (UCSD). We acknowledge the invaluable help of members of the Fotedar lab, especially Howard Brickner, Vincent
Pennaneach, and Patrick Fitzgerald.
This work was supported by grants from the American Cancer Society
(DB-107) and the National Institutes of Health (NIH) (AI45301, CA74435] to A.F. and from the NIH (CA35299) to A.A.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Sidney Kimmel
Cancer Center, 10835 Altman Row, San Diego, CA 92121. Phone: (619)
450-5990. Fax: (619) 550-3998. E-mail: FOTEDAR{at}aol.com.
Manuscript 138 from the La Jolla Institute for Allergy and Immunology.
 |
REFERENCES |
| 1.
|
Andersen, B.,
M. D. Schonemann,
R. V. Pearse,
K. Jenne,
J. Sugarman, and M. G. Rosenfeld.
1993.
Brn-5 is a divergent POU domain factor highly expressed in layer IV of the neocortex.
J. Biol. Chem.
268:23390-23398[Abstract/Free Full Text].
|
| 1a.
|
Anderson, C. W., and S. Lees-Miller.
1992.
The nuclear serine/threonine protein kinase DNAPK.
Crit. Rev. Eukaryot. Gene Expr.
2:282-314.
|
| 2.
|
Assa-Munt, N.,
R. J. Mortishire-Smith,
R. Aurora,
W. Herr, and P. E. Wright.
1993.
The solution structure of Oct-1 POU-specific domain reveals a striking similarity to the bacteriophage repressor DNA-binding domain.
Cell
73:193-205[Medline].
|
| 3.
|
Bhargava, A. K.,
Z. Li, and S. M. Weissman.
1993.
Differential expression of four members of the POU family of proteins in activated and phorbol 12-myristate 13-acetate treated Jurkat T cells.
Proc. Natl. Acad. Sci. USA
90:10260-10264[Abstract/Free Full Text].
|
| 4.
|
Caelles, C.,
H. Hennemann, and M. Karin.
1995.
M-phase-specific phosphorylation of the POU transcription GHF-1 by a cell cycle-regulated protein kinase inhibits DNA binding.
Mol. Cell. Biol.
15:6694-6701[Abstract].
|
| 5.
|
Cochrane, L.,
M. Karvelas,
G. Nossal,
Z. Ye,
T. Jacks, and D. Baltimore.
1993.
Oct-2, although not required for early B cell development, is critical for later B-cell maturation and for postnatal survival.
Genes Dev.
7:570-582[Abstract/Free Full Text].
|
| 6.
|
Dai, T.,
E. Rubie,
C. C. Franklin,
A. Kraft,
D. A. F. Gillespie,
J. Avruch,
J. M. Kyriakis, and J. R. Woodgett.
1995.
Stress-activated protein kinases bind directly to the domain of c-jun in resting cells: implications for repression of c-jun function.
Oncogene
10:849-855[Medline].
|
| 7.
|
Dekker, N.,
M. Cox,
R. Boelens,
C. P. Verrijzer,
P. C. vander Vliet, and R. Kaptein.
1993.
Solution structure of the POU-specific DNA-binding domain of Oct-1.
Nature
362:852-855[Medline].
|
| 8.
|
Derijard, B.,
M. Hibi,
I.-H. Wu,
T. Barrett,
B. Su,
T. Deng,
M. Karin, and R. Davis.
1994.
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-jun activation domain.
Cell
76:1025-1037[Medline].
|
| 9.
|
Durand, D. B.,
J.-P. Shaw,
M. R. Bush,
R. E. Replogle,
R. Belagaje, and G. R. Crabtree.
1988.
Characterization of antigen receptor response elements within the interleukin-2 enhancer.
Mol. Cell. Biol.
8:1715-1724[Abstract/Free Full Text].
|
| 10.
|
Eisenbeis, C. F.,
H. Singh, and U. Storb.
1995.
Pip, a novel IRF family member, is a lymphoid specific, PU.1 dependent transactivator.
Genes Dev.
9:1377-1387[Abstract/Free Full Text].
|
| 11.
|
Finney, M.,
G. Ruvkun, and H. R. Horvitz.
1988.
The C. elegans cell lineage and differentiation gene unc-86 encodes a protein containing a homeo domain and extended sequence similarity to mammalian transcription factors.
Cell
55:757-769[Medline].
|
| 12.
|
Fotedar, R.,
P. Fitzgerald,
T. Rousselle,
D. Cannella,
M. Doree,
H. Messier, and A. Fotedar.
1996.
p21 contains independent binding sites for cyclin and cdk2: both sites are required to inhibit cdk2 kinase activity.
Oncogene
12:2155-2164[Medline].
|
| 13.
|
Gupta, G.,
D. Campbell,
B. Derijard, and R. G. Davis.
1995.
Transcription factor ATF2 regulation by the JNK signal transduction pathway.
Nature
267:389-393.
|
| 14.
|
Herr, W.,
R. Sturm,
R. Clerc,
L. Corcoran,
D. Baltimore,
P. Sharp,
H. Ingraham,
M. Rosenfeld,
M. Finney,
G. Ruvkun, and H. Horvitz.
1988.
The POU domain: a large conserved region in the mammalian Pit-1, Oct-1, Oct-2, and C. elegans unc-86 gene products.
Genes Dev.
2:1513-1516[Free Full Text].
|
| 15.
|
Hibi, M.,
A. Lin,
T. Smeal,
A. Minden, and M. Karin.
1993.
Identification of an oncoprotein and UV-responsive protein kinase that binds and phosphorylates the c-Jun activation domain.
Genes Dev.
7:2135-2148[Abstract/Free Full Text].
|
| 16.
|
Johansen, T.,
U. Moens,
T. Holm,
A. Fjose, and S. Krauss.
1993.
Zebrafish pou[c], a divergent POU family gene ubiquitously expressed during embryogenesis.
Nucleic Acids Res.
21:475-483[Abstract/Free Full Text].
|
| 17.
|
Kallunki, T.,
B. Su,
I. Tsigelny,
K. H. Sluss,
B. Derijard,
G. Moore,
R. Davis, and M. Karin.
1994.
JNK2 contains a specificity-determining region responsible for efficient c-jun binding and phosphorylation.
Genes Dev.
8:2996-3007[Abstract/Free Full Text].
|
| 18.
|
Kamps, M. P.,
L. Corcoran,
J. H. LeBowitz, and D. Baltimore.
1990.
The promoter of the human interleukin-2 gene contains two octamer-binding sites and is partially activated by the expression of Oct-2.
Mol. Cell. Biol.
10:5464-5472[Abstract/Free Full Text].
|
| 19.
|
Kang, S.-M.,
B. Beverly,
A.-C. Tran,
K. Brorson,
R. H. Schwartz, and M. J. Lenardo.
1992.
Transactivation by AP-1 is a molecular target of T cell anergy.
Science
257:1134-1138[Abstract/Free Full Text].
|
| 20.
|
Kang, S.-M.,
W. Tsang,
S. Doll,
P. Scherle,
H.-S. Ko,
A.-C. Tran,
M. J. Lenardo, and L. M. Staudt.
1992.
Induction of the POU domain transcription factor Oct-2 during T-cell activation by cognate antigen.
Mol. Cell. Biol.
12:3149-3154[Abstract/Free Full Text].
|
| 21.
|
Kapiloff, M. S.,
Y. Farkash,
M. Wegner, and M. G. Rosenfeld.
1991.
Variable effects of phosphorylation of Pit-1 dictated by the DNA response elements.
Science
254:786-789.
|
| 22.
|
Kyriakis, J. M.,
P. Banerjee,
E. Nikolakaki,
T. Dia,
E. A. Rubie,
M. F. Ahmad,
J. Avruch, and J. R. Woodgett.
1994.
The stress activated protein kinase subfamily of c-jun kinases.
Nature
369:156-160[Medline].
|
| 23.
|
Lees, E.,
B. F. Faha,
V. Dulic,
S. I. Reed, and E. Harlow.
1992.
Cyclin E/cdk2 and cyclin A/cdk2 kinases associate with p107 and E2F in a temporally distinct manner.
Genes Dev.
6:1874-1885[Abstract/Free Full Text].
|
| 24.
|
Li, L.,
J. Zhou,
G. James,
R. Heller-Harrison,
M. P. Czech, and E. N. Olson.
1992.
FGF inactivates myogenic helix-loop-helix proteins through phosphorylation of a conserved protein kinase C site in their DNA binding domains.
Cell
71:1181-1194[Medline].
|
| 25.
|
Li, S.,
E. B. Crenshaw,
E. J. Rawson,
D. M. Simmons,
L. W. Swanson, and M. G. Rosenfeld.
1990.
Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU domain gene Pit-1.
Nature
347:528-533[Medline].
|
| 26.
|
Livingstone, C.,
G. Patel, and N. Jones.
1995.
ATF-2 contains a phosphorylation-dependent transcriptional activation domain.
EMBO J.
14:1785-1797[Medline].
|
| 27.
|
Luo, K. X.,
T. R. Hurley, and B. M. Sefton.
1990.
Transfer of proteins to membranes facilitates both CNBR cleavage and two dimensional proteolytic mapping.
Oncogene
5:921-923[Medline].
|
| 28.
|
Messier, H.,
J. Ratnavongsiri,
T. Fuller,
S. Mangal,
P. Kilgannon,
R. Fotedar, and A. Fotedar.
1992.
Mapping of an inducible element in the T cell receptor V 2 promoter.
J. Immunol.
149:1980-1986[Abstract].
|
| 29.
|
Messier, H.,
T. Fuller,
S. Mangal,
H. Brickner,
S. Igarashi,
J. Gaikwad,
R. Fotedar, and A. Fotedar.
1993.
p70 lupus autoantigen binds the TCR enhancer.
Proc. Natl. Acad. Sci. USA
90:2685-2689[Abstract/Free Full Text].
|
| 30.
|
Messier, H.,
H. Brickner,
J. Gaikwad, and A. Fotedar.
1993.
A novel POU domain protein which binds to the T-cell receptor enhancer.
Mol. Cell. Biol.
13:5450-5460[Abstract/Free Full Text].
|
| 31.
|
Minden, A.,
A. Lin,
F. X. Claret,
A. Abo, and M. Karin.
1995.
Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs.
Cell
81:1147-1157[Medline].
|
| 32.
|
Minden, A.,
A. Lin,
T. Smeal,
B. Dérijard,
M. Cobb,
R. Davis, and M. Karin.
1994.
c-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated protein kinases.
Mol. Cell. Biol.
14:6683-6688[Abstract/Free Full Text].
|
| 33.
|
Okamoto, K.,
M. Wakamiya,
S. Noji,
E. Koyama,
S. Taniguchi,
R. Takemura,
N. Copeland,
D. Gilbert,
N. A. Jenkins,
M. Muramatsu, and H. Hamada.
1993.
A novel class of murine POU gene predominantly expressed in central nervous system.
J. Biol. Chem.
268:7449-7457[Abstract/Free Full Text].
|
| 34.
|
Pongubala, J. M. R.,
C. van Beveren,
S. Nagulapalli,
M. J. Klemz,
S. R. McKeron,
R. A. Maki, and M. L. Atchison.
1993.
Effect of PU.1 phosphorylation on interaction with NF-EM5 and transcriptional activation.
Science
259:1622-1625[Abstract/Free Full Text].
|
| 35.
|
Roberts, S. B.,
N. Segil, and N. Heintz.
1991.
Differential phosphorylation of the transcription factor Oct1 during the cell cycle.
Science
253:1022-1026[Abstract/Free Full Text].
|
| 36.
|
Rosenfeld, M. G.
1991.
POU-domain transcription factors: pou-er-ful development regulators.
Genes Dev.
5:897-907[Free Full Text].
|
| 37.
|
Scheidereit, C.,
J. A. Cromlish,
T. Gerster,
K. Kawakami,
C. Balmaceda,
R. Currie, and R. G. Roeder.
1988.
A human lymphoid specific transcription factor that activates Ig genes is a homeobox protein.
Nature
336:552-557.
|
| 38.
|
Segil, N.,
S. B. Roberts, and N. Heintz.
1991.
Mitotic phosphorylation of the Oct-1 homeo domain and regulation of Oct-1 DNA binding activity.
Science
254:1814-1816[Abstract/Free Full Text].
|
| 39.
|
Su, B.,
E. Jacinto,
M. Hibi,
T. Kallunki,
M. Karin, and Y. Ben-Neriah.
1994.
JNK is involved in signal integration during costimulation of T lymphocytes.
Cell
77:727-736[Medline].
|
| 40.
|
Tanaka, M.,
J.-S. Lai, and W. Herr.
1992.
Promoter selective activation domains in Oct1 and Oct2 direct differential activation of an snRNA and mRNA promoter.
Cell
68:755-767[Medline].
|
| 41.
|
Treacy, R.,
X. He, and M. G. Rosenfeld.
1991.
i-pou, a POU domain protein that inhibits neuron specific gene activation.
Nature
350:577-584[Medline].
|
| 42.
|
Treacy, R.,
L. I. Neilson,
E. E. Turner,
X. He, and M. G. Rosenfeld.
1992.
Twin of i-pou: a two amino acid difference in the i-pou homeodomain distinguishes an activator from an inhibitor of transcription.
Cell
68:491-505[Medline].
|
| 43.
|
Ullman, K.,
W. Flanagan,
C. Edwards, and G. Crabtree.
1991.
Activation of early gene expression in T cells by Oct-1 and an inducible protein, OAP40.
Science
254:558-562[Abstract/Free Full Text].
|
| 44.
|
van Dam, H.,
D. Wilhelm,
I. Herr,
A. Steffen,
P. Herrlich, and P. Angel.
1995.
ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents.
EMBO J.
14:1798-1811[Medline].
|
| 45.
|
Wey, E.,
G. E. Lyons, and B. W. Schafer.
1994.
A human POU domain gene, mPOU, is expressed in developing brain and specific adult tissues.
Eur. J. Biochem.
220:753-762[Medline].
|
| 46.
|
Whitmarsh, J. A.,
P. Shore,
D, A. Sharrocks, and R. Davis.
1995.
Integration of MAP kinase signal transduction pathways at the serum response element.
Science
269:403-407[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 1999, p. 2021-2031, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bogoyevitch, M. A., Kobe, B.
(2006). Uses for JNK: the Many and Varied Substrates of the c-Jun N-Terminal Kinases. Microbiol. Mol. Biol. Rev.
70: 1061-1095
[Abstract]
[Full Text]
-
Edmunds, J. W., Mahadevan, L. C.
(2004). MAP kinases as structural adaptors and enzymatic activators in transcription complexes. J. Cell Sci.
117: 3715-3723
[Abstract]
[Full Text]
-
Yang, Y.-M., Bost, F., Charbono, W., Dean, N., McKay, R., Rhim, J. S., Depatie, C., Mercola, D.
(2003). C-Jun NH2-terminal Kinase Mediates Proliferation and Tumor Growth of Human Prostate Carcinoma. Clin. Cancer Res.
9: 391-401
[Abstract]
[Full Text]
-
Andersen, B., Rosenfeld, M. G.
(2001). POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease. Endocr. Rev.
22: 2-35
[Abstract]
[Full Text]
-
Spiegelman, V. S., Stavropoulos, P., Latres, E., Pagano, M., Ronai, Z.'e., Slaga, T. J., Fuchs, S. Y.
(2001). Induction of beta -Transducin Repeat-containing Protein by JNK Signaling and Its Role in the Activation of NF-kappa B. J. Biol. Chem.
276: 27152-27158
[Abstract]
[Full Text]