Molecular and Cellular Biology, March 1999, p. 2032-2043, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Vascular Endothelial Growth Factor Activates
Nuclear Factor of Activated T Cells in Human Endothelial Cells: a
Role for Tissue Factor Gene Expression
Angel Luis
Armesilla,1,2
Elisa
Lorenzo,1
Pablo
Gómez
del Arco,1
Sara
Martínez-Martínez,1
Arantzazu
Alfranca,2 and
Juan Miguel
Redondo1,*
Centro de Biología Molecular Severo
Ochoa, Consejo Superior de Investigaciones Científicas
(CSIC)-Universidad Autónoma de Madrid, Facultad de Ciencias,
Cantoblanco, Madrid 28049,1 and Servicio
de Inmunología, Hospital de la Princesa, Madrid
28006,2 Spain
Received 25 June 1998/Returned for modification 11 September
1998/Accepted 12 November 1998
 |
ABSTRACT |
Vascular endothelial growth factor (VEGF) is a potent angiogenic
inducer that stimulates the expression of tissue factor (TF), the major
cellular initiator of blood coagulation. Here we show that signaling
triggered by VEGF induced DNA-binding and transcriptional activities of
nuclear factor of activated T cells (NFAT) and AP-1 in human umbilical
vein endothelial cells (HUVECs). VEGF also induced TF mRNA expression
and gene promoter activation by a cyclosporin A (CsA)-sensitive
mechanism. As in lymphoid cells, NFAT was dephosphorylated and
translocated to the nucleus upon activation of HUVECs, and these
processes were blocked by CsA. NFAT was involved in the VEGF-mediated
TF promoter activation as evidenced by cotransfection experiments with
a dominant negative version of NFAT and site-directed mutagenesis of a
newly identified NFAT site within the TF promoter that overlaps with a
previously identified
B-like site. Strikingly, this site bound
exclusively NFAT not only from nuclear extracts of HUVECs activated by
VEGF, a stimulus that failed to induce NF-
B-binding activity, but
also from extracts of cells activated with phorbol esters and calcium
ionophore, a combination of stimuli that triggered the simultaneous
activation of NFAT and NF-
B. These results implicate NFAT in the
regulation of endothelial genes by physiological means and shed light
on the mechanisms that switch on the gene expression program induced by
VEGF and those regulating TF gene expression.
 |
INTRODUCTION |
Angiogenesis, the sprouting of new
capillaries from preexisting vascular beds, is a multistep program that
involves the activation, proliferation, and migration of endothelial
cells. Vascular endothelial growth factor (VEGF) is a potent angiogenic
inducer that has been implicated in physiological and
physiopathological conditions associated with angiogenesis
(19). Thus, VEGF plays a major role in vasculogenesis and
angiogenesis during embryonic development (6, 18), and
enhanced expression of VEGF has been detected in processes associated
with the menstrual cycle, pregnancy, rheumatoid arthritis, wound
healing, diabetic retinopathy, and atherosclerosis (4, 19).
In addition, there is considerable evidence to support a critical role
of VEGF in tumorigenesis, which may be related to the
neovascularization required for tumor growth and dissemination. Thus,
VEGF mRNA is significantly enhanced in most tumors analyzed so far, and
multiple cell lines have been found to synthesize and secrete VEGF.
Furthermore, anti-VEGF antibodies inhibit the growth of tumors in vivo
(4, 27, 63).
VEGF displays a potent mitogenic activity for endothelial cells and
increases endothelial-cell permeability and migration (19).
The biological effects of VEGF on endothelial cells are exerted through
its binding to Flt-1 and Flk-1/KDR, two high-affinity tyrosine kinase
receptors, both of which are related to the platelet-derived growth
factor receptors (16, 40, 48). Signaling through such
receptors initiates the activation of the intracellular signal transduction cascades that switch on the expression of genes that control the specific response to VEGF. Thus, VEGF induces the expression of the plasminogen activators (PA) uPA and tPA, the urokinase receptor (uPAR), and the metalloproteinase interstitial collagenase, facilitating the extracellular matrix degradation and
further migration and sprouting of endothelial cells (19). VEGF also induces the expression of tissue factor (TF) (9), a glycoprotein expressed by monocytes and endothelial cells that functions as the high-affinity receptor and cofactor for the
coagulation factors VII/VIIa and is the main initiator of the extrinsic
pathway of the coagulation cascade. The induction of TF expression on the surface of monocytes and endothelial cells is upregulated upon
activation with a number of stimuli including the proinflammatory cytokines tumor necrosis factor alpha (TNF-
) and interleukin-1
(IL-1
), the bacterial lipopolysaccharide (LPS), phorbol esters, and
thrombin, as well as VEGF (34). TF is thought to play a major role in thrombogenic disorders in the setting of inflammation, septic shock, or cancer (34, 35, 52). Besides these
properties, the targeted disruption of TF results in embryonic death
due to a defective yolk sac vessel and abnormal vitelloembryonic
circulation (7), a phenotype that in part resembles that
found in VEGF-deficient embryos (6, 18).
Although many reports have addressed the biological responses of
endothelial cells to VEGF, the intracellular transduction pathways that
connect the signals between the cell membrane receptors and the
nucleus, as well as the transcription factors that couple such
signaling to the expression of the genes that regulate the cellular
response to VEGF, are beginning to be understood. In this regard, a
number of intracellular signaling components targeted by VEGF have been
recently identified in different cell systems. VEGF induces tyrosine
phosphorylation of molecules containing SH2 domains as well as other
signaling molecules including phospholipase C
, phosphatidylinositol
3-kinase, GTPase-activating protein, p125FAK, paxillin, and
the adapter proteins Nck and shc (1, 12, 21, 28, 56, 62). In
addition, a number of recent reports have implicated VEGF in the
activation of different members of the family of mitogen-activated
protein kinases (MAPKs) including the extracellular signal-regulated
kinases (ERKs), the stress-activated protein kinases/c-jun N-terminal
kinases (SAPKs/JNKs), and the p38/HOG kinase (1, 12, 28, 30, 53,
56).
In accordance with a functional activation of phospholipase C
, VEGF
has also been reported to induce turnover of inositol phosphates,
diacylglycerol production, and elevation of intracellular Ca2+ concentrations (3, 45, 67). In different
cell types, calcium signals lead to the activation of NFAT proteins, a
family of transcription factors composed of at least four structurally
related members, NFATp (NFAT1), NFATc (NFAT2), NFAT3, and NFAT4
(51). Calcineurin, a Ca2+/calmodulin-dependent
phosphatase, regulates the processes of dephosphorylation and nuclear
import of NFAT, both of which are blocked by the immunosuppressive
drugs cyclosporin A (CsA) and FK506 (58, 59). Once in the
nucleus, NFAT proteins can cooperate with transcription factors of the
Fos and Jun families to regulate the inducible expression of a number
of genes involved in the regulation and function of the immune response
(50). Thus, NFAT proteins have been involved in the
regulation of the gene expression of IL-2, IL-4, granulocyte-macrophage
colony-stimulating factor (GM-CSF), TNF-
, or CD40 and Fas ligands
(11, 51). Recently, NFATp has been found in endothelial
cells, where it participates in the inducible expression of the GM-CSF
gene in response to pharmacological activation by phorbol myristate
acetate (PMA) plus Ca2+ ionophore (10). In
addition, during embriogenesis NFATc is expressed in the endocardium, a
highly specialized endothelium that is involved in the morphogenesis of
cardiac valves and septum, which are not developed in mice bearing a
targeted disruption in the NFATc gene (13, 49). However, a
functional role of NFAT proteins regulating the expression of
endothelial genes in response to physiological stimuli has not yet been addressed.
Because of the involvement of MAPK cascades and increases in the
intracellular calcium concentration in the signaling induced by VEGF,
we here analyzed the role of NFAT and AP-1 in the activation of primary
human endothelial cells by VEGF. We show that in human umbilical vein
endothelial cells (HUVECs), VEGF triggers the dephosphorylation, translocation, and transcriptional activity of NFATp, which is accompanied by AP-1 activation. Further analysis involved NFAT in the
regulation of the TF gene expression induced by VEGF. These results
provide information on the mechanisms that mediate the gene expression
program induced by VEGF and involve the transcription factors NFAT and
AP-1 in the regulation of the expression of endothelial genes by
physiological means. Moreover, the inhibitory effects of CsA on TF gene
expression may be related to the beneficial effects displayed by this
drug in pathological processes associated with a deregulation of TF expression.
 |
MATERIALS AND METHODS |
Cell culture and reagents.
Human umbilical vein endothelial
cells (HUVECs) were isolated from umbilical veins as previously
described (42) and routinely grown on 0.5% gelatin-coated
tissue culture flasks in medium 199 (Biowhittaker) supplemented with
20% fetal calf serum (FCS), 50 µg of bovine brain extract per ml,
and 100 µg of heparin per ml. The cells were used between passages 6 and 10. Jurkat cells were maintained in RPMI 1640 medium (Gibco-BRL)
supplemented with 10% FCS. The recombinant human VEGF165 was purchased
from Peprotech EC Ltd., (London, United Kingdom) or provided by H. Riese and I. Prieto (Pharmacia-Upjohn, Madrid, Spain). CsA was from
Sandoz. TNF-
(3.2 × 107 U/mg) was from Wichem
(Vienna, Austria). PMA, the calcium ionophore A23187, and actinomycin D
were from Sigma Chemical Co. (St. Louis, Mo).
Immunofluorescence experiments.
HUVECs grown on 1%
gelatin-coated coverslips in 24-well tissue culture plates were either
left untreated or incubated for 2 h with CsA (200 ng/ml) before
stimulation with VEGF (50 ng/ml), Ca2+ ionophore (1 µM),
or TNF-
(25 ng/ml) for 20 min. The cells were then fixed with 3%
paraformaldehyde in phosphate-buffered saline (PBS) for 15 min at room
temperature and washed three times (5 min each) with washing buffer
(PBS, 0.01% [vol/vol] Nonidet P-40 [NP-40]). After blocking for 30 min at 37°C with TNB buffer (0.1 M Tris-HCl [pH 7.5], 0.15 M NaCl,
0.5% blocking reagent [Boehringer Mannheim]), the coverslips were
incubated for 45 min at 37°C with the anti-NFATp monospecific
antiserum 67.1 (22) (0.01% [vol/vol] in TNB), provided by
Anjana Rao. Unbound antibody was removed by rinsing twice with washing
buffer (5 min at room temperature), and the coverslips were incubated
for 20 min at 37°C with a fluorescein-conjugated anti-rabbit
immunoglobulin (Ig; Amersham) (0.1% [vol/vol] in TNB), washed twice,
and mounted in Mowiol mountant on glass slides. The cells were
visualized with a Nikon Labophot-2 photomicroscope.
Subcellular fractionation and Western blot analysis.
After
the different treatments, confluent HUVECs grown in 35-mm culture
dishes (one dish per condition) were washed with cold PBS and lysed in
100 µl of hypotonic buffer (10 mM Tris-HCl [pH 7.5] containing 10 mM NaCl, 3 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride,
0.5 mM dithiothreitol [DTT], 0.1 mM EGTA, 2 µM leupeptin, 1 µg of
aprotinin per ml, and 0.05% NP-40). The supernatant containing the
cytosolic extracts was removed and resuspended in Laemmli buffer, and
the nuclei were washed twice in hypotonic buffer without detergent and
resuspended in Laemmli buffer. Whole-cell extracts from Jurkat cells
were prepared by direct lysis in Laemmli buffer of PBS-washed cells
collected after centrifugation. To determine the effect of RNA
synthesis inhibition on the nuclear export of NFATp, HUVECs were
pretreated with actinomycin D (5 µg/ml) for 4 h, washed, and
lysed 5 min, 1 h, and 4 h after activation with VEGF.
The different extracts were boiled and resolved, under reducing
conditions, by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (6 or 12% polyacrylamide) for NFATp or
proliferating-cell nuclear antigen detection, respectively. The gels
were transferred to nitrocellulose membranes and blocked with a 5%
(wt/vol) skim milk solution in Tris-buffered saline (TBS) buffer at
4°C overnight. After being washed twice in TBS-T (TBS, 0.05% Tween
20), the membranes were incubated for 2 h at room temperature with
0.03% or 0.01% (vol/vol) 67.1 and anti-PCNA (clone PC10; Dako)
monoclonal antibody (64), respectively, in TBS-T. The
membranes were washed five times for 5 min in TBS-T, incubated for
2 h at room temperature with the corresponding secondary antibody
(peroxidase-labeled goat anti-rabbit IgG or anti-mouse IgG plus IgM
[Pierce]), washed three times with TBS-T, and briefly rinsed in
distilled H2O. Bound antibodies were detected with the ECL
Western blotting analysis kit (Amersham).
Nuclear extracts and EMSAs.
For nuclear protein extraction,
attached HUVECs grown in 150-mm dishes were lysed with 2 ml of
hypotonic buffer containing 0.05% NP-40 (described above), except that
0.75 mM spermidine, 0.15 mM spermine, 10 mM
Na2MoO4, and pepstatin (1 µg/ml) were also
included. Nuclei were detached from the plates, collected, incubated in
buffer C (20 mM HEPES [pH 7.6], 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 10 mM
Na2MoO4, 1 µg of pepstatin per ml, 4 µg of
leupeptin per ml, 4 µg of aprotinin per ml) for 30 min in a rocking
platform, and centrifuged at 15,000 × g for 10 min and the
supernatants, containing the nuclear extracts, were frozen immediately
in liquid nitrogen and stored at
80°C. The protein concentration
was quantified by the Bradford procedure.
Electrophoretic mobility shift assays (EMSAs) were performed by
incubating the nuclear proteins (1.5 to 2 µg) with 1 µg of poly(dI-dC) and 4 µl of 5× DNA binding buffer (10% [wt/vol]
polivinylethanol, 12.5% [vol/vol] glycerol, 50 mM Tris [pH 8], 2.5 mM EDTA, 2.5 mM DTT) in a final volume of 18 µl on ice for 10 min.
Then 2 µl (1 ng/µl) of 32P-labeled double-stranded
oligonucleotide (5 × 107 to 1 × 108
cpm/µg), was added to the reaction mixture, which was incubated at
4°C for an additional 30 min. For competition experiments, a 30-fold
molar excess of unlabeled oligonucleotide was added before the addition
of the probe. When indicated, nuclear extracts were incubated with 0.5 µl of either a preimmune serum, the anti-NFATp antiserum 67.1, or the
796 anti-all NFAT antiserum (33) or with 1 µl of the
antiserum 1226 raised against the p65 NF-
B subunit. Antisera were
incubated for 15 min at 4°C before the addition of the probe.
DNA-protein complexes were resolved by electrophoresis in 4%
nondenaturing polyacrylamide gels. The sequences of the oligonucleotides (5' to 3') used in these experiments were as follows:
gatcATAAAATTTTCCAATGTAAAC (mouse NFAT P sequence
60 to
80 of the murine IL-4 promoter), gatcGTAGACCGTGATTCAAGCTTAGC (human AP-1
284 site of the ICAM-1 promoter),
gatcGGGATTTCACCT (NF-
B-binding site of the human IL-2
promoter), ctagCCGGAGTTTCCTACC (nucleotides
183
to
197 of the human TF promoter [positions
186 to
191
boldface]), ctagCCGGAGGAATTCACC (nucleotides
183 to
197 of the human TF promoter containing mutated bases at
positions
186 to
191 [boldface]), and AGTTGAGGGGACTTTCCCAGGC (oligonucleotide including the prototypic NF-
B site of the
murine
light-chain enhancer).
Plasmid constructs and transient-transfection assays.
The
luciferase reporter plasmid NFAT-Luc, containing three tandem copies of
the distal NFAT-binding site of the IL-2 gene promoter coupled to the
IL-2 minimal promoter, and the pSH102C
418 NFATc expression plasmid,
a derivative of plasmid pBJ5 that encodes a dominant negative truncated
version of NFAT, have been previously described (17, 43) and
were provided by G. Crabtree. The reporter plasmids pL1 (
2106 to
+121) and pL4 (
278 to +121), containing deletion fragments of the TF
promoter inserted into the cloning site of the p19luc luciferase vector
(37), were provided by N. Mackman. The pCMV-TAM67, a
derivative of pCMV plasmid that encodes a c-Jun dominant negative
version (47), was a gift from C. M. Zacharchuk. The
AP-1-dependent reporter plasmid
73 Col Luc containing the
73 to +63
region of the human collagenase promoter coupled to the luciferase gene
(15) was provided by M. Karin. The AP-1-dependent luciferase
construct driven by the
36 to +37 rat prolactin minimal promoter
under the control of four tandem copies of the TPA-responsive element
(TRE) consensus motif TGACTCA (AP-1 PROL Luc) and the
parental vector (PROL Luc) were provided by M. Rincón.
For transient-transfection experiments, HUVECs were plated in 100-mm
tissue culture dishes (1.5 × 106 cells/plate) the day
before transfection. The cells were transfected in 4 ml of Dulbecco's
minimal essential medium plus 0.5% FCS using 10 µg of the indicated
luciferase reporter plasmids, by the calcium phosphate procedure as
previously described (42). Briefly, HUVECs were incubated
with precipitated DNA for 4.5 h, washed twice with PBS, and
detached with trypsin from the 100-mm plates. After centrifugation (1,200 rpm for 5 min in a Sorvall H1000B rotor), the cells were resuspended in OPTI-MEM (Life Technologies) supplemented with 0.5% FCS
and split among six-well (35-mm) tissue culture plates (2.5 35-mm
dishes were plated from one 100-mm plate) precoated with 0.5% of
gelatin. Transfected cells were incubated at 37°C for 16 h and
exposed to different stimuli for an additional 6 h unless
otherwise specified. Then the cells were lysed and luciferase activity
was measured in a Lumat LB 9501 luminometer (Berthold, Wildbad,
Germany) as specified in the instructions of a Luciferase system kit
(Promega). In cotransfection experiments, 5 µg of pBJ5 and
pSH102C
418 or 1.7 µg of pCMV-TAM67 and pCMV-
-galactosidase expression plasmids were coprecipitated together with the reporter vector. Transfection experiments were performed in triplicate. The data
presented are expressed as the mean and standard deviation of the
determinations performed in triplicate. A representative experiment is
shown in the reporter assays in all cases. The expression of Renilla
luciferase was used as an internal control to normalize the values
obtained with the firefly luciferase constructs. A total of 0.5 µg of
the Renilla luciferase expression vector pRLCMV (Promega) was used in
cotransfection experiments. In these experiments, 1/10 of cells
cotransfected with both types of luciferase plasmids were plated in
24-well tissue culture plates, incubated at 37°C for 24 h, and
lysed with passive lysis buffer. Renilla luciferase activity was
measured by using the Dual luciferase assay kit (Promega), as specified
by the manufacturer, to discriminate the activity of the two types of luciferases.
Northern blot analysis.
After different treatments, total
RNA was isolated from attached HUVECs by using the Ultraspect system
(Biotecx Laboratories, Inc.). Denatured RNA (20 µg per sample) was
electrophoresed on 1% formaldehyde-agarose gels and blotted onto a
nitrocellulose membrane. After UV cross-linking, the membranes were
hybridized overnight at 42°C with specific probes. A tissue factor
probe spanning positions 95 to 925 of the TF cDNA was generated by PCR and cloned into the pCR2.1 plasmid (Invitrogen) by using the
oligonucleotides and conditions previously reported for this purpose
(23). The resulting plasmid was digested with
EcoRI and the fragment of the TF cDNA from 95 to 853 was
used as a probe. For c-fos and c-jun mRNA
detection, the 0.8-kb BglII-NcoI fragment of the
c-fos cDNA and a 0.8-kb
HindIII-PstI fragment of c-jun
cDNA were used.
Site-directed mutagenesis.
Mutation of the NFAT binding site
localized at positions
186 to
194 of the TF promoter was performed
by PCR with the pL4 plasmid as a template. Primer pL4
HindIII sense (5' tttaagcttGGGCAACTAGACCCGCCTGC) and pL4 EcoRI antisense (5'
tttgaattcCTCCGGGACCCTGCAAGGG 3') were used to generate PCR
fragment A. Primer Mut EcoRI sense (5'
tttgaattcACCGGGAGGAGGCGGGGC) and TF XmaI antisense
(5' CCGGCCCGGGTCACTTGCC) were used to generate fragment B. Fragments A and B were subjected to 35 cycles of amplification with the
following thermal cycle: 94°C for 30 s, 64°C for 30 s, and 72°C for 90 s. Primers pL4 EcoRI antisense and
Mut EcoRI sense were partially complementary and carried
point mutations that transform the NFAT core-binding site into an
EcoRI restriction site. PCR fragments A and B were digested
with HindIII and EcoRI or with
EcoRI and XmaI, respectively, and the resulting
fragments were ligated into the
HindIII-XmaI-digested pL4 vector to generate the pL4 mut (
186 to
194) plasmid. The nucleotide sequence of the mutant was confirmed by DNA sequencing.
 |
RESULTS |
VEGF triggers NFATp dephosphorylation and nuclear translocation in
HUVECs by a CsA-sensitive mechanism.
To determine whether NFAT
could mediate transcriptional responses in endothelial cells stimulated
with VEGF, we first performed immunocytochemical analysis with HUVECs
by using a specific anti-NFAT1/NFATp antiserum. As shown in Fig.
1A, endogenous NFATp was present in the
cytoplasm of resting cells and translocated to the nucleus upon
activation with calcium ionophore. Strikingly, stimulation by VEGF also
resulted in complete translocation of NFATp to the nucleus whereas
TNF-
failed to modify the cytoplasmic localization of the
transcription factor. Furthermore, preincubation with pharmacological concentrations of CsA resulted in the total prevention of the nuclear
translocation of NFATp triggered by both VEGF or calcium ionophore
(Fig. 1A, bottom panels).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 1.
VEGF induces dephosphorylation and nuclear
localization of NFATp in HUVECs. (A) Immunocytochemical staining of
HUVECs unstimulated ( ) or treated with VEGF (50 ng/ml), the calcium
ionophore A23187 (1 µM) (I0), or 25 ng of TNF- per ml
for 20 min. The cells were either untreated (top panels) or incubated
with 200 ng of CsA per ml (bottom panels) for 2 h prior to the
addition of the stimuli. After stimulation, the cells were fixed and
stained with the anti-NFATp antiserum 67.1. (B and C) HUVECs, either
pretreated or not ( ) with CsA (200 ng/ml) for 2 h, were left
untreated ( ) or stimulated with VEGF (50 ng/ml) or calcium ionophore
(I0) (1 µM) for the indicated times. Fractionated
cytoplasmic or nuclear extracts were analyzed by Western blotting with
the 67.1 antiserum for NFATp detection. The mobilities of the
upper and lower bands, corresponding to phosphorylated and
dephosphorylated forms of NFATp, respectively, are indicated by arrows.
(D) As a control for the fractionation process, aliquots of the
extracts used for NFATp detection were analyzed by Western blotting for
the presence of nuclear PCNA. Cyt, cytoplasmic; V, VEGF.
|
|
Since, CsA targets the phosphatase activity of calcineurin, precluding
the dephosphorylation and translocation of NFAT, in other cell systems
(29, 55), we designed Western blot experiments to analyze
the phosphorylation status of NFAT in fractionated cellular extracts
prepared at different time points after activation with VEGF. These
experiments revealed that exposure of HUVECs to VEGF induced a rapid
dephosphorylation and nuclear translocation of NFATp that was complete
as early as 5 min upon activation. Although dephosphorylated NFATp was
present in the nucleus for at least 2 h, after 20 min of treatment
the presence in the nucleus of phosphorylated NFATp was already evident
and the amount of nuclear NFATp was declining to undetectable levels by
4 h. Conversely, phosphorylated NFATp was progressively
reappearing in the cytosolic fractions to reach maximal levels by 2 to
4 h (Fig. 1B). The dephosphorylation, nuclear translocation, and
further expression of NFATp in the cytoplasm of VEGF-treated cells were
also observed when the RNA synthesis of HUVECs was inhibited by
actinomycin D (data not shown). Parallel Western blot analysis
indicated that both the dephosphorylation and nuclear translocation of
NFATp induced by either VEGF or calcium ionophore were prevented by CsA
(Fig. 1C). Control experiments showed that the upper and lower bands of
NFATp detected in HUVECs displayed identical mobility to that of the
phosphorylated and dephosphorylated NFATp forms (data not shown)
previously characterized in T cells (33, 39, 46). In
addition, the subcellular fractionation process of the extracts used to
analyze the import and export of NFATp was controlled by Western blots
that revealed the presence of the proliferating-cell nuclear antigen
(64) in nuclear extracts but not in the cytosolic fractions
of VEGF-treated cells (Fig. 1D). These results, on the one hand,
suggest that NFATp imported to the nucleus is rapidly phosphorylated
and further exported to the cytoplasm after 1 to 2 h of activation
with VEGF and, on the other hand, indicate that the dephosphorylation
and translocation of NFATp in endothelial cells were sensitive to the
calcineurin inhibitor CsA. Therefore, the nuclear import and export of
NFATp induced by VEGF in endothelial cells appears to be regulated in a
similar fashion to that demonstrated for lymphocytes activated by
different stimuli.
VEGF induces NFAT DNA-binding activity.
We further analyzed
the effect of VEGF on the activation of NFAT by determining the binding
of the transcription factor to an NFAT site of the IL-4 promoter that
has been shown to bind NFAT independently of AP-1 transcription factor
(65). In agreement with the results of the Western blot
experiments, EMSAs with nuclear extracts from HUVECs exposed to VEGF
for different periods showed that NFAT-binding activity was
significantly induced as early as 5 min and was maximal after 20 min of
treatment. High levels of binding were still found after 60 min of
treatment and markedly declined by 4 h (Fig.
2A). Similarly, pharmacological
activation of HUVECs with the combination of PMA with calcium
ionophore, a very potent stimulus for NFAT activation in T lymphocytes,
also resulted in a strong increase in NFAT binding activity. In both cases, the specific bands were competed with an excess of cold oligonucleotide and CsA blocked the induction of NFAT DNA-binding activity (Fig. 2A and data not shown). The identity of the nuclear factor(s) responsible for the retardation of the DNA-protein complexes generated with the NFAT probe was further characterized by EMSAs in the
presence of anti-NFAT antisera. These assays detected the sole presence
of NFATp (NFAT1) in the nuclear extracts of activated HUVECs. Thus, the
addition of specific anti-NFATp antiserum 67.1 (22)
completely supershifted the NFAT complex generated with nuclear
extracts from HUVECs stimulated with both VEGF and PMA plus ionophore.
In addition, NFAT complex formation was inhibited by incubation with
the 796 anti-all-NFAT antiserum (33) directed against a
conserved sequence among the NFAT proteins located in the DNA-binding
domain (Fig. 2B). We also performed control experiments by analyzing
the effect of VEGF and PMA plus ionophore on NF-
B-binding activity
by using aliquots of the nuclear extracts where we detected induction
of NFAT binding. These EMSAs showed a clear induction of NF-
B in
nuclear extracts from HUVECs treated with PMA plus ionophore that was
not affected by CsA, whereas no substantial differences were found in
the binding to the NF-
B probe of cells treated or not with VEGF for
different periods (Fig. 2C).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Kinetic analysis and serological characterization of the
NFAT DNA-binding complexes induced by VEGF. Nuclear extracts from
HUVECs stimulated for the indicated times with VEGF (50 ng/ml) (V) or a
combination of PMA (20 ng/ml) plus ionophore (1 µM)
(P/I0) or pretreated with CsA (200 ng/ml) for 2 h
before stimulation were analyzed by EMSA. (A) Analysis of the
DNA-binding activity to the NFAT probe of the IL-4 promoter in nuclear
extracts from HUVECs activated for different times with VEGF (VEGF or
V). EMSAs with extracts from VEGF-activated cells pretreated with CsA
as well as control extracts from PMA- plus ionophore-treated cells are
shown. The mobility of the specific VEGF-induced (CsA-sensitive)
complex is indicated by an arrow. (B) Serological characterization of
the NFAT DNA-binding complexes. EMSAs were performed in the presence
(+) or absence ( ) of nuclear extracts from cells activated with VEGF
or PMA plus ionophore that were incubated with 0.5 µl of either
preimmune serum (Preim.), anti-NFATp antiserum 67.1, or the anti-NFAT
family antiserum 796 for 15 min prior to the addition of the labeled
probe. The VEGF-induced NFAT complex and the supershifted complexes
induced by the anti-NFATp 67.1 are indicated by an arrow and asterisks,
respectively. (C) Nuclear extracts from HUVECs treated as in panel A
were analyzed for NF- B binding with the B site of the IL-2
promoter as a probe.
|
|
VEGF activates NFAT and AP-1-dependent transcription and increases
c-fos and c-jun mRNA levels.
NFAT has been
shown to cooperate with AP-1 transcription factor in transactivation
and DNA binding to mediate the transcriptional activation of a number
of promoter elements (50). In addition, signaling induced by
VEGF results in the activation of MAPK cascades that can integrate
different signals at the AP-1 level (5, 26). Therefore, we
next analyzed whether AP-1 was a target in the activation of VEGF that
could cooperate with NFAT to regulate VEGF-dependent transcription. For
this purpose, we first performed Northern blot experiments to determine
the effect of VEGF on the mRNA levels of c-fos and
c-jun AP-1 components. As shown in Fig. 3A, c-fos mRNA steady-state
levels, undetected in untreated HUVECs, were induced after 30 min of
treatment with VEGF. This induction was transient and markedly declined
after 1 h of activation (data not shown), whereas stimulation with
the phorbol ester PMA plus calcium ionophore yielded a stronger
induction of c-fos that peaked after 1 h of stimulation
and could be still detected after 4 h of treatment. In contrast,
c-jun mRNA levels were already detected in unstimulated
HUVECs, and VEGF induced a small increase over the baseline mRNA levels
by 30 min of activation. Parallel control experiments showed that
c-jun mRNA levels were strongly upregulated by PMA plus
ionophore, displaying similar kinetics to that exhibited by
c-fos. The effect of VEGF on AP-1 DNA
binding activity was examined by EMSAs, and a moderate
increase in the DNA-binding activity to an AP-1 site was reproducibly
found when different nuclear extracts from HUVECs treated with VEGF
were used. The complex generated with the AP-1 probe was supershifted
in the presence of anti-Fos and anti-Jun family antisera, and the DNA binding was higher with extracts from cells stimulated with PMA plus
ionophore and was not inhibited by CsA (Fig. 3B and data not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of VEGF on the mRNA levels of c-fos
and c-jun and on the DNA-binding activity of AP-1. (A)
Northern blot analysis with total RNA from HUVECs untreated or
activated for the indicated times with VEGF or a combination of PMA
plus ionophore (P/I0). After isolation, RNA was separated
by agarose gel electrophoresis, blotted onto a nitrocellulose membrane,
and hybridized with specific probes for c-fos and
c-jun. RNA controls of the corresponding blots are shown. A
sixfold-longer exposure of the autoradiograph is presented for the
control and VEGF points of c-fos. (B) The AP-1 DNA-binding
activity displayed by nuclear extracts from HUVECs activated with VEGF
or PMA plus ionophore (P/I0) for 1 h was tested with a
specific probe encompassing the 284 AP-1 site of the ICAM-1 promoter.
Extracts from CsA-treated cells were obtained after pretreatment of
2 h with 200 ng of CsA per ml and a further 1-h treatment with the
stimuli. VEGF (50 ng/ml), PMA (20 ng/ml), and A23187 calcium ionophore
(1 µM) were used at the same doses in single or combined treatments
in panels A and B.
|
|
To further analyze the effect of VEGF on AP-1 activation, we carried
out transfection experiments in HUVECs with the
73 Col Luc
AP-1-dependent reporter plasmid. These experiments revealed that both
VEGF and PMA (included as a positive control) stimulated the
transcriptional activity of the AP-1 reporter plasmid (Fig. 4A). Similar results were obtained with a
different AP-1-dependent construct driven by the rat prolactin minimal
promoter under the control of four TRE tandem copies (data not shown).
Given that the effects of VEGF on translocation and DNA-binding
activity of NFATp were concomitant with the activation of AP-1, we next determined whether activation by VEGF resulted in the functional activation of the distal NFAT motif of the IL-2 promoter, a site that
has been shown to require the binding of AP-1 and NFAT to be
functionally active (11, 50). Therefore, we transfected HUVECs with a luciferase reporter construct driven by three tandem copies of the NFAT-AP-1 composite site and found that the
transcriptional activity of this construct was significantly induced in
response to VEGF or PMA plus calcium ionophore in a CsA-sensitive
fashion (Fig. 4B).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
VEGF activates AP-1- and NFAT-dependent transcription-
(A) HUVECs were transfected by the calcium phosphate procedure with the
AP-1-responsive ( 73 to +63) region of the collagenase promoter
plasmid for 4.5 h and stimulated or left untreated for an
additional 16 h, and then the luciferase activity was determined.
The data is expressed as the mean and standard deviation (error bars)
of determinations performed in triplicate. Results of a representative
experiment are shown. Four different experiments yielded similar
results. (B) HUVECs were transfected with an NFAT-dependent luciferase
reporter plasmid. At 16 h after transfection, the cells were
pretreated or not ( ) with CsA (200 ng/ml) for 2 h, and then left
untreated or further stimulated for an additional 6 h with VEGF or
a combination of PMA and calcium ionophore (P/I0). The
results are expressed as the relative fold induction over the relative
luciferase units (RLU) displayed by the corresponding transfected
unstimulated cells. Results of a representative experiment of five are
shown. VEGF (50 ng/ml), PMA (20 ng/ml), and A23187 calcium ionophore (1 µM) were used at the same doses in single or combined treatments in
panels A and B.
|
|
Identification of an NFAT-binding site within the TF promoter
regulated by VEGF.
To evaluate the functional relevance of the
activation of NFAT in the expression of endothelial genes regulated by
VEGF, we carried out a database search for NFAT motifs within the
promoters of several genes that have been shown to be induced by VEGF.
These analyses revealed the presence of an NFAT consensus site at
positions
186 to
194 within the TF promoter region (Fig.
5A). Therefore, we next determined
whether this site was able to bind NFAT by performing EMSAs with
synthetic oligonucleotides spanning positions
183 to
197 of the TF
promoter that included the NFAT site. These experiments demonstrated
the ability of this site to efficiently bind NFAT from nuclear extracts
of VEGF-treated HUVECs in a CsA-sensitive manner. The specificity of
this binding was further confirmed by addition of an excess of TF
homologous oligonucleotide or an excess of a heterologous
oligonucleotide including the NFAT site of the IL-4 promoter that
abolished the specific binding to the probe but not by the
corresponding TF mut oligonucleotide carrying several nucleotide
substitutions within the NFAT sequence that failed to compete the
binding (Fig. 5). Furthermore, the addition of anti-NFATp or anti-all
NFAT antisera resulted in supershift or inhibition of the NFAT-DNA
complex, respectively (Fig. 5B).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
NFATp binds to the 183 to 197 region within the TF
promoter. (A) The sequences (5' to 3') of the oligonucleotides
including the 183 to 197 region of the TF promoter (TF wt) and that
of the TF mut are shown. Base pair substitutions incorporated in the TF
mut are indicated by asterisks. The partially overlapping nucleotides
corresponding to the B-like and the NFAT sites are indicated. (B)
Nuclear extracts from HUVECs pretreated or not with 200 ng of CsA per
ml and then exposed to VEGF (50 ng/ml) were analyzed by EMSA with a
probe spanning positions 183 to 197 of the TF promoter. A 30-fold
molar excess of unlabeled TF 183 to 197, the corresponding
oligonucleotide mutated at positions 186 to 194 (TF mut), or an
NFAT consensus site of the IL-4 promoter oligonucleotides was added to
the binding-reaction mixtures to detect the specific binding.
Serological identification of the complexes was performed by addition
of 0.5 µl of either preimmune serum (Preim.), anti-NFATp antiserum
(67.1), or anti-NFAT family antiserum (796). Antisera and cold
oligonucleotides were added to the binding-reaction mixture prior to
addition of the probe.
|
|
Since the TF oligonucleotide from
183 to
197 included a previously
identified
B-like site reported to bind NF-
B in response to
TNF-
or LPS (34, 41, 51), we performed gel retardation experiments with this TF probe and nuclear extracts from HUVECs treated
with PMA plus ionophore, a combination of stimuli that triggered the
DNA-binding and transcriptional activity of both NF-
B and NFAT (Fig.
2 and 4 and data not shown). Strikingly, as occurred with the complex
induced by VEGF, the inducible complex generated with nuclear extracts
from HUVECs exposed to PMA plus ionophore was supershifted by the
anti-NFATp antiserum whereas no supershift or inhibition of the binding
was detected with antisera directed against the p65 NF-
B subunit
(Fig. 6). Parallel control experiments
with aliquots of the nuclear extracts of cells activated with PMA plus
ionophore and the prototypic
B probe of the Ig
light-chain
enhancer revealed the presence of an inducible NF-
B complex
supershifted by the anti-p65 antiserum (data not shown). Hence, the
183 to
197 region of the TF promoter, including a previously
identified
B site that overlapped with the NFAT-binding site, bound
exclusively to NFAT from nuclear extracts of HUVECs activated by VEGF.
Similarly, the activation of these cells with PMA plus ionophore, which
triggered both NFAT and NF-
B binding to different consensus probes,
induced predominant NFAT binding to the TF probe.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 6.
Serological analysis of the binding to the TF/NFAT site
induced by VEGF and PMA plus ionophore. The DNA binding to the 183 to
197 region of the TF promoter was analyzed by using nuclear extracts
from HUVECs treated with VEGF (50 ng/ml) or with PMA (20 ng/ml) plus
A23187 calcium ionophore (1 µM) for 1 h. Anti-NFATp antiserum
67.1 (0.5 µl) or 1 µl of anti-p65 antisera was added to the
binding-reaction mixture before the addition of the probe.
|
|
VEGF regulates TF gene expression by mechanisms involving NFAT in a
CsA-sensitive fashion.
Because of the presence of the newly
identified NFAT-binding site within the TF promoter, we analyzed
whether NFAT could play a role in the regulation of TF gene expression
induced by VEGF. We initially determined whether the induction
described for TF protein in response to VEGF (9) was also
reflected at the promoter level. For this purpose, we transfected
HUVECs with the pL1 and pL4 plasmids containing the
2106 to +121 and
the
278 to +121 upstream regulatory regions of the TF gene fused to
the luciferase reporter gene, respectively (37). These
experiments showed that VEGF induced the transcriptional activity of
the TF promoter reporter plasmids by three- to fivefold. This
activation was lower than that displayed by PMA plus ionophore, which
appeared to be a very potent stimulus for TF promoter activation, and
was partially inhibited by CsA (Fig. 7A
and data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of CsA and NFAT dominant negative plasmid on the
transcription of the TF promoter by VEGF. (A) The transcriptional
activity of the TF promoter was tested by transfection of HUVECs. The
pL4 and pL1 luciferase reporter plasmids (10 µg) were transfected by
calcium phosphate precipitation for 4.5 h. At 16 h
posttransfection, cells were preincubated or not ( ) with CsA for
2 h, and further stimulated for 6 h with VEGF, PMA plus
ionophore (P/I0), or vehicle. Results of a representative
experiment of three independent experiments performed are shown. (B)
The pL4 promoter construct (5 µg) was cotransfected with 5 µg of
either the NFAT dominant negative pSH102C 418 expression vector or
its parental empty vector (pBJ5). At 16 h after transfection, the
cells were stimulated with VEGF, PMA plus ionophore (P/I0),
or vehicle for 6 h. Results of a representative experiment of
three independent ones are presented. The results are expressed as fold
induction over the expression of pL4 and pL1 plasmids in the absence of
stimuli in both panels. Experiments were performed in triplicate. VEGF
(50 ng/ml), PMA (20 ng/ml), CsA (200 ng/ml), and A23187 calcium
ionophore (1 µM) were used at the same doses in single and combined
treatments.
|
|
The involvement of NFAT in the regulation of TF promoter by VEGF was
analyzed in cotransfection experiments by testing the effect of the
expression of an NFAT dominant negative plasmid (43) on the
transcriptional activity of the pL4 TF promoter reporter construct. As
shown in Fig. 7B, the transfection of the NFAT dominant negative
expression construct resulted in a clear although partial inhibition of
the TF promoter activity induced by VEGF or PMA plus ionophore. Since
the TF mut oligonucleotide carrying a 5-bp substitution in the core
region of the NFAT-binding site failed to compete for the NFAT complex
(Fig. 5B), we evaluated the functional contribution of the identified
NFAT site to the overall transcriptional response of the TF promoter by
performing site-directed mutagenesis to introduce the same 5-bp
substitution into the pL4 TF reporter construct. Consistent with the
results of the cotransfection experiments with the NFAT dominant
negative construct and the TF promoter, the inducibility of the mutated TF promoter was significantly reduced in response to both VEGF and PMA
plus ionophore (Fig. 8A).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
Inhibition of VEGF-induced TF expression by CsA. (A)
HUVECs were transfected by calcium phosphate precipitation with 10 µg
of the parental pL4 luciferase plasmid or with the pL4mut-derived
plasmid mutated in the NFAT site for 4.5 h. At 16 h
posttransfection, the cells were stimulated for 6 h with VEGF (50 ng/ml) or PMA (20 ng/ml) plus ionophore (1 µM). Experiments were
performed in triplicate, and the results are expressed as fold
induction over the baseline levels of transfected unstimulated cells.
Results of a representative experiment of three performed are shown.
(B) Northern blot analysis of HUVECs pretreated or not ( ) with CsA
(200 ng/ml) for 2 h and further stimulated with VEGF (50 ng/ml) or
a combination of PMA (20 ng/ml) plus ionophore (1 µM)
(P/I0) for the time points indicated. Total RNA was
electrophoresed, blotted onto a nitrocellulose membrane, and hybridized
with a TF cDNA probe. Autoradiographs corresponding to exposures for
VEGF and PMA-plus-ionophore treatments of 1 week and 16 h,
respectively, and RNA controls of the blot are presented.
|
|
To analyze whether the effects exerted by VEGF on the activation of TF
at the promoter level correlated with those detected on the TF mRNA
steady-state levels, we performed Northern blot experiments of HUVECs
exposed to VEGF or PMA plus ionophore in the presence or absence of
CsA. These experiments revealed that TF mRNA levels, undetected in
resting HUVECs, were upregulated after treatment with VEGF or PMA plus
ionophore. Exposure of cells to VEGF resulted in maximal expression of
TF mRNA after 1 h of treatment and a progressive decline between 4 and 8 h. Furthermore, the induction of TF mRNA levels induced by
both VEGF and PMA plus ionophore was markedly inhibited by CsA at the
different time points analyzed (Fig. 8B).
Taken together, these results suggest that VEGF regulates TF gene
expression in endothelial cells by transcriptional mechanisms involving
the activation of NFAT, and they identify a functional NFAT site
required for full inducibility of the TF promoter that is likely to
account for the partial inhibition of TF gene expression displayed by CsA.
 |
DISCUSSION |
VEGF is a multifunctional cytokine that plays a pivotal role in
the regulation of angiogenesis and is required for the development and
differentiation of the vascular system (6, 18). Despite extensive research focused on the biological functions of VEGF and its
role in the physiological and pathological angiogenic processes, the
molecular mechanisms of signal transduction and the transcription
factors that couple such signals to the gene expression programs
induced by VEGF are still largely unknown. In this study, we show that
VEGF triggers the activation of NFAT and AP-1, two transcription
factors that are rapidly mobilized in cell activation processes to
regulate gene transcription in response to a large number of stimuli
(26, 51). To our knowledge, this is the first report
demonstrating the activation of NFAT by a physiological stimulus in
endothelial cells. In addition, we have found that the VEGF-induced
expression of TF involves the activation of NFAT and identified a
functional NFAT-binding site within the TF promoter that overlaps with
a previously identified
B-like element.
Exposure of HUVECs to VEGF increases the intracellular calcium
concentration (12, 45). In T lymphocytes and fibroblasts, elevations of intracellular calcium levels result in calcineurin activation and subsequent activation and nuclear localization of NFAT
proteins (32, 54, 59, 60). Similarly, we have demonstrated
that the dephosphorylation and translocation of NFATp triggered by both
VEGF and calcium ionophore were blocked by the calcineurin inhibitor
CsA in endothelial cells. Once in the nucleus, the imported NFAT was
detected displaying forms with the mobility of phosphorylated NFATp at
times when the transcription factor was progressively found in the
cytoplasm of activated cells, and this process was independent of RNA
synthesis. These data suggest that the activation of the
calcium-calcineurin pathway in HUVECs by VEGF leads to the
translocation of NFATp to the nucleus, where it is phosphorylated and
then exported to the cytoplasm. Therefore, NFATp activation appears to
be regulated in HUVECs by mechanisms similar to those operating in T
cells or fibroblasts.
The major role that endothelial cells play in angiogenesis as well as
in inflammatory and immune reactions is mediated largely by its ability
to produce and respond to cytokines (38). In a previous
report, NFATp has been shown to be activated in endothelial cells
treated with PMA plus calcium ionophore and bind to an NFAT site of the
GM-CSF enhancer. Furthermore, in these activated cells, the induction
of both the transcriptional activity of a GM-CSF enhancer-promoter
reporter construct and protein synthesis of GM-CSF were partially
inhibited by CsA (10). Although NFAT proteins are the major
targets of the calcineurin inhibitors CsA and FK506, these drugs have
been shown to affect the activation of other transcription factors that
can also be regulated by calcineurin (23, 25, 61, 66). Since
the expression of other cytokines produced by endothelial cells
including IL-1, IL-6, and IL-8 is inhibited by CsA in different cell
types (51), the possible involvement of NFAT in the
transcriptional regulation of these cytokine genes in endothelial cells
will be an important issue for future studies.
We have detected by serological analysis of the NFAT-binding complex
generated with nuclear extracts from HUVECs activated with VEGF the
presence of only the NFAT1 (NFATp) protein. Likewise, NFATp was the
only member detected in the DNA-binding complexes formed with the
GM-CSF probe in endothelial cells activated with PMA plus ionophore
(10). Hence, of the four NFAT family members identified,
only NFATp protein has so far been found to be expressed by endothelial
cells in the adult. However, using specific oligonucleotides of the
different members, as well as degenerate oligonucleotides of sequences
within the DNA-binding domain of NFAT members, we have amplified by
reverse transcription-PCR the cDNAs of NFAT1 (NFATp), NFAT2 (NFATc),
NFAT3, and NFATx from mRNA of HUVECs (data not shown). Although the
presence of mRNAs of the different forms does not imply the presence or
the functional involvement of these proteins, if other NFAT proteins
are actually expressed in these endothelial cells, they could be
potentially involved in the regulation of TF or GM-CSF gene expression
by other stimuli or in the control of other, so far unidentified,
NFAT-regulated endothelial genes. In this regard, it is important to
note the recent identification of NFATc in endocardial cells during
embryonic heart development, where it has been found to be required for
the formation of the aortic and pulmonary valves (13, 49).
Endocardial cells are specialized endothelial cells of the heart that
give rise to the cardiac valves and septum. It is noteworthy that the
translocation of NFATc to the nucleus of these cells can be inhibited
by CsA or FK506 in cultured whole embryos (13, 49),
suggesting the involvement of the calcium-calcineurin signaling pathway
in the morphogenesis of cardiac valves and septum. Since the ligand(s) that triggers the translocation of NFATc in endocardial cells during
development has not so far been identified, it will be important to
determine whether VEGF could play a role in this important process.
The effects of VEGF activating pathways that involve the MAPKs ERKs
(12, 53, 56), JNKs/SAPKs (30), and p38/HOG
(53) in endothelial cells are consistent with the activation
of AP-1 by VEGF that we show here. These MAPKs are components of the
signal transduction cascades that regulate the AP-1 family members at the transcriptional and posttranscriptional levels (20, 26). Although we observed a clear induction of the human collagenase AP-1-dependent reporter construct and the mRNA levels of
c-fos, both the AP-1 DNA-binding activity and the
c-jun mRNA levels were only weakly induced in response to
VEGF. The lack of correlation between AP-1 DNA-binding and
transcriptional activation has been previously noted in other cell
systems, and the reason for this disagreement appears to be related to
the changes in the composition of the AP-1 complexes during the
activation processes. Thus, various members of the Fos family can
associate with Jun proteins to form heterodimers displaying similar
DNA-binding activities but different transactivating capabilities. In
addition, the phosphorylation of Fos and Jun proteins has been reported
to stimulate their transactivating efficacy without altering the
DNA-binding activities (14, 26). The effect of VEGF on the
activation of AP-1 is evidenced not only by the stimulation of
transcriptional activity of the AP-1 dependent reporter construct
73
Col Luc but also by the activation exerted on the reporter construct
directed by the NFAT-AP-1 composite site of the IL-2 promoter, whose
transcriptional induction requires the activation of both NFAT and AP-1
transcription factors (47). Furthermore, we have confirmed
the involvement of the AP-1 transcription factor in the VEGF-mediated
endothelial activation by using the TAM-67 c-jun dominant
negative plasmid, whose expression basically blocked the
transcriptional activity of the TF promoter in response to VEGF (data
not shown). Whether this blocking effect of TAM-67 reflects the
relevance of the AP-1-binding sites of the promoter in response to VEGF
or the importance of cooperative interactions of AP-1 with other
transcription factors (or both) remains to be determined.
TF deficiency results in embryonic death due to defective yolk sac
vessel and abnormal vitelloembryonic circulation (7). Since
the abnormal yolk sac vasculature resembles in part the phenotype found
in VEGF-deficient embryos (6, 18), the possibility that the
functions of VEGF and TF are interrelated has been suggested (8). In fact, the induction of TF by VEGF leads to the
generation of fibrin and the sequential activation of tPA and plasmin,
which stimulates the degradation of matrix proteins, a critical step for the migration and sprouting of endothelial cells during
angiogenesis (57). Experiments aimed to establish a
functional link between VEGF-induced gene expression and the activation
of NFAT and AP-1 transcription factors led us to analyze the TF gene
promoter. TF expression in monocytes and endothelial cells is induced
by a variety of proinflammatory agents, including LPS, IL-1
, and TNF-
, through transcriptional and posttranscriptional mechanisms (34). Previous reports have identified Sp1-Egr-1 sites
required for basal expression of the gene and NF
B and AP-1 sites
involved in the inducible response to LPS and cytokines, and a
concerted action of the transcription factors that bind to these sites
has been proposed to regulate TF promoter in monocytes and endothelial cells (34, 36, 41, 44). We have shown that VEGF induced the
expression of TF mRNA levels and the transcriptional activation of the
TF gene promoter involving the activation of NFAT. This role of NFAT
was evidenced by the expression of the NFAT dominant negative construct
that resulted in significant inhibition of the TF promoter
transcription by VEGF, and it correlated with the defective
inducibility displayed by the TF promoter construct carrying the NFAT
mutated site. In both cases, the inhibitory effect observed was
partial, as occurred with that displayed by CsA on both the TF promoter
activation and mRNA expression triggered by VEGF. Since we have also
demonstrated that the effects of CsA precluding the translocation and
transcriptional activation of NFAT are also operative in VEGF-activated
endothelial cells, these data suggest that the inhibition of TF gene
expression by CsA is exerted through the inhibition of NFAT activation.
Given the role that AP-1 appears to play in the activation of TF
promoter, it is likely that AP-1 could account for the promoter
activity that was refractory to the inhibition by CsA or to the
expression of the NFAT dominant negative construct.
The presence of an NFAT site overlapping with a previously identified
B-like functional site within the TF promoter is noteworthy. Since
previous studies have demonstrated the ability of this site to bind
NF-
B proteins in response to LPS or TNF-
(34, 41, 44),
our data indicate that the NFAT-NF-
B motif
(CGGAGTTTCCT) may represent one example of the
B-like sites such as those of the CD28RE of the IL-2 and GM-CSF
promoters, which also include the TTCC sequence, thought to
be critical for the binding of either NFAT or NF-
B proteins but not
both simultaneously (51). However, stimulation of HUVECs
with PMA plus ionophore, which resulted in the activation of
NF-
B-binding activity to the IL-2 or Ig
light-chain
B probes,
strongly stimulated NFAT binding to the TF probe but failed to induce
detectable
B binding activity to this probe. Therefore, NFAT binding
to this NFAT-NF-
B motif appears to be predominant (or exclusive)
when cells are activated by a stimulus that triggers the simultaneous
activation of NFAT and NF-
B. The comparative analysis of the murine,
porcine, and human sequences of the TF promoter (41)
revealed that the NFAT sequence (GAGTTTCCT) is completely
conserved in all three species whereas the partially overlapping
NF-
B sequence ([C/T]GGAGTTTCC) displays a 9-of-10-base
match among the species. The high degree of conservation of this region
is consistent with the critical role reported in the regulation of the
TF gene by proinflammatory stimuli through NF-
B (34) and
also with its functional role in the response to VEGF or other stimuli
that could induce the TF gene by triggering the activation of NFAT.
The inhibition of TF gene expression by CsA that we have detected
suggests a putative role of this drug interfering with the procoagulant
activity of VEGF described in monocytes and endothelial cells
(9). CsA has also been reported to reduce the activation of
TF transcription and NF-
B-binding activity to the TF-
B site in
LPS-activated monocytes as well as in monocytes from cardiac transplant
recipients (23, 24). TF is thought to be involved in fibrin
deposition and thrombogenic processes associated with a number of
disorders, including atherosclerosis, septic shock, and cancer
(34, 52). Therefore, it is conceivable that part of the
beneficial effects described for CsA in some of these clinical disorders, such as those reported for experimental transplant atherosclerosis (2), are related not only to the reported
ability of the drug to interfere with the activation of TF expression by stimuli that trigger NF
B activation but also to those that induce
NFAT activation in nonlymphoid cells such as VEGF. On the other hand,
given the major role of VEGF in physiological and pathological
angiogenesis, the identification of NFAT and AP-1 as transcription
factors that couple VEGF signaling to the transcriptional gene response
may help to localize therapeutic targets to antagonize or modulate the
angiogenic process and to further delineate the upstream signaling
pathways and the specific gene expression program triggered by VEGF in
endothelial cells.
 |
ACKNOWLEDGMENTS |
We are very grateful to G. Crabtree, A. García-Martín, M. Karin, N. Mackman, A. Rao, N. Rice,
M. Rincón, and C. Zacharchuk for providing plasmids and
antibodies, which made this work possible. We thank H. Riese, G. Márquez, I. Prieto, and Pharmacia Upjohn, Madrid, Spain, for the
gift of recombinant VEGF 165. We also thank M. López Cabrera and
S. Lamas for critical reading of the manuscript, R. Tejedor for helping
us with the immunofluorescence experiments, L. Horrillo and Charo
Martin for excellent secretarial assistance, and the members of the
Servicio de Inmunología of the Hospital de la Princesa (Madrid)
for their continual help and support.
This work was supported by a grant from the Ministerio de
Educación y Cultura (MEC) of Spain (PM96-0076) and grants from the Comunidad Autónoma de Madrid (CAM) 07/046/96 and 8.3/011/97 to J.M.R. A.L.A. was supported by grants from the Comunidad
Autónoma de Madrid. The Centro de Biología Molecular S.O.
is supported by a grant from the Fundación Ramón Areces.
P.G.A. was supported by an FPI fellowship from the CAM. E.L.A. and
S.M.M. were supported by FPI fellowships from the MEC.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centro de
Biología Molecular Severo Ochoa, Consejo Superior de
Investigaciones Científicas (CSIC)-Universidad Autónoma
de Madrid. Facultad de Ciencias, Cantoblanco, Madrid 28049, Spain.
Phone: 34-91-397-4252. Fax: 34-91-397-4799. E-mail:
jmredondo{at}cbm.uam.es.
 |
REFERENCES |
| 1.
|
Abedi, H., and I. Zachary.
1997.
Vascular endothelial growth factor stimulates tyrosine phosphorylation and recruitment to new focal adhesions of focal adhesion kinase and paxillin in endothelial cells.
J. Biol. Chem.
272:15442-15451[Abstract/Free Full Text].
|
| 2.
|
Andersen, H. O.,
G. Madsen,
B. G. Nordestgaard,
B. F. Hansen,
K. Kjeldsen, and S. Stender.
1994.
Cyclosporin suppresses transplant arteriosclerosis in the aorta-allografted, cholesterol-clamped rabbit. Suppression preceded by decrease in arterial lipoprotein permeability.
Arterioscler. Thromb.
14:944-950[Abstract/Free Full Text].
|
| 3.
|
Brock, T. A.,
H. F. Dvorak, and D. R. Senger.
1991.
Tumor-secreted vascular permeability factor increases cytosolic Ca2+ and von Willebrand factor release in human endothelial cells.
Am. J. Pathol.
138:213-221[Abstract].
|
| 4.
|
Brown, L. F.,
M. Detmar,
K. Claffey,
J. A. Nagy,
D. Feng,
A. M. Dvorak, and H. F. Dvorak.
1997.
Vascular permeabilty factor/vascular endothelial growth factor: A multifunctional angiogenic cytokine, p. 233-269.
In
G. A. Rosen (ed.), Regulation of angiogenesis. Birkhauser Verlag, Basel, Switzerland.
|
| 5.
|
Cahill, M. A.,
R. Janknecht, and A. Nordheim.
1996.
Signalling pathways: jack of all cascades.
Curr. Biol.
6:16-19[Medline].
|
| 6.
|
Carmeliet, P.,
V. Ferreira,
G. Breier,
S. Pollefeyt,
L. Kieckens,
M. Gertsenstein,
M. Fahrig,
A. Vandenhoeck,
K. Harpal,
C. Eberhardt,
C. Declercq,
J. Pawling,
L. Moons,
D. Collen,
W. Risau, and A. Nagy.
1996.
Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele.
Nature
380:435-439[Medline].
|
| 7.
|
Carmeliet, P.,
N. Mackman,
L. Moons,
T. Luther,
P. Gressens,
V. I. Van,
H. Demunck,
M. Kasper,
G. Breier,
P. Evrard,
M. Muller,
W. Risau,
T. Edgington, and D. Collen.
1996.
Role of tissue factor in embryonic blood vessel development.
Nature
383:73-75[Medline].
|
| 8.
|
Carmeliet, P.,
L. Moons,
M. Dewerchin,
N. Mackman,
T. Luther,
G. Breier,
V. Ploplis,
M. Muller,
A. Nagy,
E. Plow,
R. Gerard,
T. Edgington,
W. Risau, and D. Collen.
1997.
Insights in vessel development and vascular disorders using targeted inactivation and transfer of vascular endothelial growth factor, the tissue factor receptor, and the plasminogen system.
Ann. N. Y. Acad. Sci.
811:191-206[Abstract/Free Full Text].
|
| 9.
|
Clauss, M.,
M. Gerlach,
H. Gerlach,
J. Brett,
F. Wang,
P. C. Familletti,
Y. C. Pan,
J. V. Olander,
D. T. Connolly, and D. Stern.
1990.
Vascular permeability factor: a tumor-derived polypeptide that induces endothelial cell and monocyte procoagulant activity, and promotes monocyte migration.
J. Exp. Med.
172:1535-1545[Abstract/Free Full Text].
|
| 10.
|
Cockerill, G. W.,
A. G. Bert,
G. R. Ryan,
J. R. Gamble,
M. A. Vadas, and P. N. Cockerill.
1995.
Regulation of granulocyte-macrophage colony-stimulating factor and E-selectin expression in endothelial cells by cyclosporin A and the T-cell transcription factor NFAT.
Blood
86:2689-2698[Abstract/Free Full Text].
|
| 11.
|
Crabtree, G. R., and N. A. Clipstone.
1994.
Signal transmission between the plasma membrane and nucleus of T lymphocytes.
Annu. Rev. Biochem.
63:1045-1083[Medline].
|
| 12.
|
D'Angelo, G.,
I. Struman,
J. Martial, and R. I. Weiner.
1995.
Activation of mitogen-activated protein kinases by vascular endothelial growth factor and basic fibroblast growth factor in capillary endothelial cells is inhibited by the antiangiogenic factor 16-kDa N-terminal fragment of prolactin.
Proc. Natl. Acad. Sci. USA
92:6374-6378[Abstract/Free Full Text].
|
| 13.
|
de la Pompa, J. L.,
L. A. Timmerman,
H. Takimoto,
H. Yoshida,
A. J. Elia,
E. Samper,
J. Potter,
A. Wakeham,
L. Marengere,
B. L. Langille,
G. R. Crabtree, and T. W. Mak.
1998.
Role of the NF-ATc transcription factor in morphogenesis of cardiac valves and septum.
Nature
392:182-186[Medline].
|
| 14.
|
Deng, T., and M. Karin.
1994.
c-Fos transcriptional activity stimulated by H-Ras-activated protein kinase distinct from JNK and ERK.
Nature
371:171-175[Medline].
|
| 15.
|
Deng, T., and M. Karin.
1993.
JunB differs from c-Jun in its DNA-binding and dimerization domains, and represses c-Jun by formation of inactive heterodimers.
Genes Dev.
7:479-490[Abstract/Free Full Text].
|
| 16.
|
de Vries, C.,
J. A. Escobedo,
H. Ueno,
K. Houck,
N. Ferrara, and L. T. Williams.
1992.
The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor.
Science
255:989-991[Abstract/Free Full Text].
|
| 17.
|
Durand, D. B.,
J. P. Shaw,
M. R. Bush,
R. E. Replogle,
R. Belagaje, and G. R. Crabtree.
1988.
Characterization of antigen receptor response elements within the interleukin-2 enhancer.
Mol. Cell. Biol.
8:1715-1724[Abstract/Free Full Text].
|
| 18.
|
Ferrara, N.,
M. K. Carver,
H. Chen,
M. Dowd,
L. Lu,
K. S. O'Shea,
B. L. Powell,
K. J. Hillan, and M. W. Moore.
1996.
Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene.
Nature
380:439-442[Medline].
|
| 19.
|
Ferrara, N., and S. T. Davis.
1997.
The biology of vascular endothelial growth factor.
Endocr. Rev.
18:4-25[Abstract/Free Full Text].
|
| 20.
|
Gómez del Arco, P.,
S. Martínez-Martínez,
V. Calvo,
A. L. Armesilla, and J. M. Redondo.
1997.
Antioxidants and AP-1 activation: a brief overview.
Immunobiology
198:273-278[Medline].
|
| 21.
|
Guo, D.,
Q. Jia,
H. Song,
R. S. Warren, and D. B. Donner.
1995.
Vascular endothelial growth factor promotes tyrosine phosphorylation of mediators of signal transduction that contain SH2 domains.
J. Biol. Chem.
12:6729-6733.
|
| 22.
|
Ho, A. M.,
J. Jain,
A. Rao, and P. G. Hogan.
1994.
Expression of the transcription factor NFATp in a neuronal cell line and in the murine nervous system.
J. Biol. Chem.
269:28181-28186[Abstract/Free Full Text].
|
| 23.
|
Holschermann, H.,
F. Durfeld,
U. Maus,
A. Bierhaus,
K. Heidinger,
J. Lohmeyer,
P. P. Nawroth,
H. Tillmanns, and W. Haberbosch.
1996.
Cyclosporin A inhibits tissue factor expression in monocytes/macrophages.
Blood
88:3837-3845[Abstract/Free Full Text].
|
| 24.
|
Holschermann, H.,
O. Kohl,
U. Maus,
F. Durfeld,
A. Bierhaus,
P. P. Nawroth,
J. Lohmeyer,
H. Tillmanns, and W. Haberbosch.
1997.
Cyclosporin A inhibits monocyte tissue factor activation in cardiac transplant recipients.
Circulation
96:4232-4238[Abstract/Free Full Text].
|
| 25.
|
Jain, J.,
E. Burgeon,
T. M. Badalian,
P. G. Hogan, and A. Rao.
1995.
A similar DNA-binding motif in NFAT family proteins and the Rel homology region.
J. Biol. Chem.
270:4138-4145[Abstract/Free Full Text].
|
| 26.
|
Karin, M.
1995.
The regulation of AP-1 activity by mitogen-activated protein kinases.
J. Biol. Chem.
270:16483-16486[Free Full Text].
|
| 27.
|
Kim, K. J.,
B. Li,
J. Winer,
M. Armanini,
N. Gillett,
H. S. Phillips, and N. Ferrara.
1993.
Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo.
Nature
362:841-844[Medline].
|
| 28.
|
Kroll, J., and J. Waltenberger.
1997.
The vascular endothelial growth factor receptor KDR activates multiple signal transduction pathways in porcine aortic endothelial cells.
J. Biol. Chem.
272:32521-32527[Abstract/Free Full Text].
|
| 29.
|
Liu, J.
1993.
FK506 and cyclosporin A, molecular probes for studying intracellular signal transduction.
Immunol. Today
14:290-295[Medline].
|
| 30.
|
Liu, Z. Y.,
R. K. Ganju,
J. F. Wang,
K. Schweitzer,
B. Weksler,
S. Av |