Previous Article | Next Article 
Molecular and Cellular Biology, March 1999, p. 2098-2108, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Activation-Dependent Transcriptional Regulation of
the Human fas Promoter Requires NF-
B p50-p65
Recruitment
Henry
Chan,
David P.
Bartos, and
Laurie B.
Owen-Schaub*
Department of Immunology, The University of
Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Received 19 June 1998/Returned for modification 14 August
1998/Accepted 10 December 1998
 |
ABSTRACT |
Fas (CD95) and Fas ligand (CD95L) are an interacting
receptor-ligand pair required for immune homeostasis. Lymphocyte
activation results in the upregulation of Fas expression and the
acquisition of sensitivity to FasL-mediated apoptosis. Although Fas
upregulation is central to the preservation of immunologic tolerance,
little is known about the molecular machinery underlying this process. To investigate the events involved in activation-induced Fas
upregulation, we have examined mRNA accumulation, fas
promoter activity, and protein expression in the Jurkat T-cell line
treated with phorbol myristate acetate and ionomycin (P/I),
pharmacological mimics of T-cell receptor activation. Although resting
Jurkat cells express Fas, Fas mRNA was induced approximately 10-fold in
2 h upon P/I stimulation. Using sequential deletion mutants of the
human fas promoter in transient transfection assays, we
identified a 47-bp sequence (positions
306 to
260 relative to the
ATG) required for activation-driven fas upregulation.
Sequence analysis revealed the presence of a previously unrecognized
composite binding site for both the Sp1 and NF-
B transcription
factors at positions
295 to
286. Electrophoretic mobility shift
assay (EMSA) and supershift analyses of this region documented
constitutive binding of Sp1 in unactivated nuclear extracts and
inducible binding of p50-p65 NF-
B heterodimers after P/I activation.
Sp1 and NF-
B transcription factor binding was shown to be mutually
exclusive by EMSA displacement studies with purified recombinant Sp1
and recombinant p50. The functional contribution of the
B-Sp1
composite site in P/I-inducible fas promoter activation was
verified by using
B-Sp1 concatamers (
295 to
286) in a thymidine
kinase promoter-driven reporter construct and native promoter
constructs in Jurkat cells overexpressing I
B-
. Site-directed
mutagenesis of the critical guanine nucleotides in the
B-Sp1 element
documented the essential role of this site in activation-dependent
fas promoter induction.
 |
INTRODUCTION |
Lymphocyte activation results in the
transcription of a number of gene products that mobilize and maintain a
functional immune response. Such gene products regulate cellular
differentiation, effector function, and clonal expansion of the
responding lymphocyte population. One such gene product is Fas (CD95),
a cell surface protein known to induce apoptosis in activated
lymphocytes upon binding to its cognate ligand (FasL). The essential
roles of Fas and FasL in the maintenance of peripheral self-tolerance
underscore their prominence as homeostatic regulators of the immune
system (reviewed in reference 41). Within the T-cell
compartment, Fas is expressed on immature thymocytes, but does not
appear to be involved in thymic deletion (13, 17). Fas
expression on resting peripheral blood lymphocytes is low to absent
(26, 37, 41, 44). Primary T-cell activation results in
upregulation of fas mRNA and protein followed by the gradual
acquisition of sensitivity to Fas-mediated apoptosis (37,
44). Although the regulation of Fas-mediated apoptosis is
complex, involving assembly of the intracellular proteins necessary to
initiate the apoptotic cascade (7, 40) and an absence or low
abundance of inhibitory proteins, such as FAP-1 (53), FLIP
(22), bcl-2, and bcl-xL (6, 23, 25),
Fas receptor cross-linking is fundamentally required (24). Fas expression is maintained on activated lymphocytes for several weeks
(44), and upon secondary exposure to antigen, FasL is upregulated (1, 14, 26). Autocrine or paracrine interactions of Fas and FasL result in the apoptotic elimination of responding CD4+ lymphocytes, a process termed "activation-induced
cell death" (AICD) (1, 14, 26). AICD can also be induced
in CD4+ T-cell lines by T-cell receptor (TCR) engagement or
pharmacological mimics of TCR signaling, such as anti-CD3 antibodies or
phorbol myristate acetate (PMA) plus ionomycin (P/I), respectively. In direct contrast, activated CD8+ T cells do not appear to
undergo apoptosis as a result of Fas ligation, but rather are
stimulated to undergo clonal expansion by reverse signaling through
FasL (59). Thus, while Fas appears to be equivalently
upregulated in both CD4+ and CD8+ T cells upon
activation (37), the signals transduced by both Fas and FasL
have dissimilar biological effects on the two lymphocyte subsets.
The transcriptional machinery controlling Fas expression is largely
unknown. Genomic organization studies showed that human fas
is a single-copy gene containing nine exons and eight introns, spanning
approximately 25 kb (5). Sequences proximal to the Fas
translational start site have a relatively high GC content (61%)
between
590 and
1, a number of CpG dinucleotides (28 CpGs between
590 and
1), and an absence of conventional TATA and CAAT boxes
(5). These are properties characteristic of a class of
polymerase II-dependent promoters that include housekeeping genes
(reviewed in reference 3) and other members of the
tumor necrosis factor (TNF)-nerve growth factor receptor superfamily (28, 51, 52, 54). Although Fas is constitutively expressed on a variety of nonhematopoietic cells and hematopoietic cell lines
(33, 43), multiple reports have documented Fas inducibility in response to such stimuli as UV irradiation, viral infection, wild-type p53, hypoxia, and chemotherapeutic agents (2, 34, 39,
45, 47, 61). To date, however, the molecular events regulating
constitutive and inducible fas expression have not been elucidated.
In the present study, we have investigated the transcriptional
machinery required for activation-dependent induction of Fas expression
in the CD4+ Jurkat T-cell line. Although constitutively
expressed on Jurkat cells, Fas can be markedly upregulated by P/I
activation. Using deletion constructs of the fas promoter in
luciferase reporter assays, we demonstrate the presence of a previously
unrecognized, activation-responsive 47-bp sequence containing a
composite binding site for both Sp1 and NF-
B transcription factors.
Characterization of this noncanonical site (located at positions
295
to
286) by electrophoretic mobility shift assay (EMSA) and supershift analyses revealed that Sp1 was constitutively bound to this site in
untreated Jurkat cells, while p50-p65 NF-
B heterodimers were bound
after P/I activation. Site-directed mutagenesis of the critical guanine
nucleotides in the
B-Sp1 site, as well as inhibition of I
B
degradation or NF-
B translocation, inhibited inducible Fas
transcription. Taken together, our results indicate a critical requirement for NF-
B translocation to the
B-Sp1 site at positions
295 to
286 in activation-driven fas promoter induction.
 |
MATERIALS AND METHODS |
Cell culture and cellular activation.
The T-lymphoma
cell line Jurkat-E6 was obtained from the American Type Culture
Collection (Rockville, Md.) and cultured in complete medium (RPMI 1640 with 10% fetal bovine serum [FBS] and 2 mM L-glutamine)
at 0.4 × 106 to 0.7 × 106 cells/ml.
For activation studies, Jurkat cells were removed from culture and
washed once with RPMI 1640, plated in 10 ml of complete medium, and
rested overnight. The following day, cells were activated with PMA (50 ng/ml) and ionomycin (3 µg/ml) for the times indicated (Sigma, St.
Louis, Mo.).
Flow cytometric analysis.
Indirect antibody staining and
flow cytometric analyses were carried out as described previously
(43). Briefly, 106 cells in 100 µl of
Dulbecco's phosphate-buffered saline (D-PBS) containing 2% FBS and
0.1% sodium azide (fluorescence-activated cell sorter [FACS] buffer)
were incubated with either 150 ng of UB2 (Kaimaya Biomedical Co.,
Tukwila, Wash.) or isotype-matched, control mouse anti-human
immunoglobulin G1 (IgG1) antibodies (Sigma) at 4°C for 30 min.
Samples were washed twice in FACS buffer, and phycoerythrin-conjugated
goat anti-mouse IgG secondary antibodies were added in 100 µl of FACS
buffer for 30 min at 4°C. Samples were washed twice with FACS buffer,
fixed overnight in PBS containing 1% paraformaldehyde, and analyzed
with a FACScan (Becton Dickinson and Co., Mountain View, Calif.). Ten
thousand cells were analyzed for each sample, with the gate set to
exclude dead cells and debris.
RNA isolation and RPAs.
At the indicated time points,
P/I-treated Jurkat cells were pelleted and washed once in D-PBS.
Control Jurkat cells were similarly cultured but were not treated with
P/I. Total RNA from 107 cells per sample was extracted with
the RNeasy kit (Qiagen, Chatsworth, Calif.) according to the
manufacturer's instructions, and RNase protection assays (RPA) were
performed with the HybSpeed RPA kit (Ambion, Austin, Tex.). Samples (25 µg of total RNA) were hybridized to a riboprobe spanning Fas exons 3 to 6 (cDNA sequence 510 to 750) and a control
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) riboprobe. Following
RNAse digestion, protected products were boiled, separated by
electrophoresis on a 5% urea-polyacrylamide gel electrophoresis
(PAGE) gel, and analyzed by autoradiography. Scanning densitometry
(Molecular Dynamics, Sunnyvale, Calif.) was used to quantitate the
fas and GAPDH band intensities of each sample. Relative fold
induction was calculated by dividing each normalized
fas/GAPDH ratio against the zero time point.
Generation of fas promoter constructs and
site-directed mutagenesis.
A human placental genomic phage library
(Clonetech, Palo Alto, Calif.) was screened with a PCR-generated,
[
-32P]dCTP-labeled Fas cDNA probe containing 5'
untranslated exon 1 and 2 sequences: forward, 5'
GGACCCGCTCAGTACGGAGTT; reverse, 5' TTCACCTGGAGGACAGGGCTTATG
(Life Technologies, Grand Island, N.Y.). Plaque hybridizations
were carried out as previously described (52), and filters
were washed sequentially in 6× SSC (0.9 M NaCl, 0.09 M sodium
citrate)-0.1% sodium dodecyl sulfate (SDS) at 42°C for 20 min, 2×
SSC-0.1% SDS at 60°C for 20 min, and 1× SSC-0.1% SDS for 20 min
before autoradiography. Approximately 1.35 × 106
plaques were screened, followed by sequential hybridizations of the
positive clones. Subsequent subcloning of SacI or
HindIII inserts into pGEM11Zf(+) (Promega, Madison,
Wis.) identified a 2.16-kb HindIII fragment containing
1.74 kb proximal to the Fas translational start site (FasH3). Sanger
dideoxy sequencing (U.S. Biochemical Corp., Cleveland, Ohio) confirmed
that FasH3 contained 5' flanking sequences identical to those
previously reported for human fas (5).
Reporter constructs were generated with the 2.16-kb FasH3 fragment and
primers corresponding to sequences
1739 to
1717 (5' AATAATCACTCATCTCACTGGGC) and
43 to
19 (5'
CGAAGTGAAAGAGCTTCCCCAACTC) by PCR to generate a 1.72-kb product.
This PCR product was then subcloned into the pcR2 expression vector
(Invitrogen, San Diego, Calif.) and digested with EcoRI, and
the insert was shuttled into pGEM7+ (Promega) (pFPR7+). A partial
XhoI digest and complete HindIII digest of
pFPR7+ were made to insert the 1.7-kb fragment into the pGL2Basic
luciferase reporter construct (Promega) in either orientation. The
final constructs, FPR1-Luc(+) and FPR1-Luc(
), spanning the region
(1739 to
19) upstream of the fas ATG were sequenced to
verify orientation and identity.
The thymidine kinase promoter reporter construct tk-Luc was generated
by subcloning the
BglII-
HindIII fragment of
the thymidine
kinase promoter from pRL-tk (Promega) into pGEM-11,
followed by
insertion of the
SacI-
HindIII
fragment into pGL2B. The

5/

6-tk-Luc
reporter was constructed by
subcloning the
SacI fragment from
FPR-Luc(+) into tk-Luc,
digesting it with
XhoI-
PstI, treating
it with a
Klenow fragment to fill recessed ends, and performing
blunt end
ligation.
Deletion constructs were generated as follows.

5-Luc (

460 to

19)
is the product of a religated
XhoI digest of FPR-Luc(+);

6-Luc (

236 to

19) is the product of a religated complete
SacI
digest of FPR-Luc(+). Constructs within the

5-Luc
region were
generated by PCR with the following oligonucleotides,
digested
with
KpnI (underlined)-
HindIII
(double underlined), and subcloned
directly into pGL2B:

5.4+
(5'
G
GGTACC
429GCCACTGCAGGAACGCCCCGGGACAG);

5.5+
(5'G
GGTACC
366CACCCTGACTTCTCCCCCTCCCTACC);

5.7+
(5'
GGGTACC
305TCCCCAACCCGGGCGTTCCCCAGCG);

5.8+
(5'G
GGTACC
259GACCACCGGGGCTTTTCGTGAGCTCGTCT);
FasR1H

(5'GGGGG

19CGAAGTGAAAGAGCTTCCCCAAC).
The mutagenized reporter constructs

5M5.7-Luc and

5M5.8-Luc
were generated by PCR with the appropriate
primers (

5.7M,
5'CTCCCCAACCCtttCGTTCCCCAGCG [forward] and
5'CCTCGCTGGGGAACGaaaGGGTTGG
[reverse];

5.8M,
5'CCGccyCTTTTCGTGAGCTCGTCT [forward] and
5'AGACGAGCTCACGAAAAGrggCGG
[reverse]; mutated nucleotides are
in lowercase) by using the
QuikChange site-directed mutagenesis kit
(Stratagene, La Jolla,
Calif.) according to the manufacturer's
recommendations. All constructs
were confirmed by dideoxy sequencing
with vector and internal
primers.
Luciferase reporters containing

B-Sp1 concatemers were constructed
with oligonucleotides having two copies of the element
at position

295 to position

286. These oligonucleotides were
synthesized with
either
KpnI (underlined) or
SacI (double
underlined)
3' overhangs (forward,
5'
CGGGCGTTCCCAAAAAGGGCGTTCCC

and reverse,
5'

GGGAACGCCCTTTTTGGGAACGCCCG
GTAC;
forward,
5'

GGGCGTTCCCAAAAAGGGCGTTCCC
GGTAC and reverse,
5'
CGGGAACGCCCTTTTTGGGAACGCCC

).
The corresponding
5'
KpnI-3'
SacI or 5'
SacI-3'
KpnI oligonucleotides were annealed
(10 min at 85°C and then cooled to room temperature), and timed
ligations
were prepared with T4 ligase with various ratios of
the double-stranded
primers. Aliquots of the reaction mixtures
were heated to 75°C for 10 min to inactivate the ligase before
subcloning into the
KpnI-
SacI-digested tk-Luc vector (see above).
Various clones were screened by sequence analysis to determine
the
number of

B-Sp1 elements present. The resultant constructs
containing two, four, and six copies of the

B-Sp1 site were used
for
transient transfection and reporter
assays.
Transient transfections and reporter assays.
A
DEAE-dextran-chloroquine mixture was used for transient transfection of
Jurkat cells. Briefly, 5 × 106 to 7.5 × 106 exponentially growing cells were washed and resuspended
in 1 ml of transfection solution (RPMI plus 250 µg of DEAE-dextran per ml, 0.1 M Tris [pH 7.2], and 0.1 mM chloroquine) together with 10 µg of reporter construct and 10 ng of the pRL-tk Renilla normalizing
luciferase vector (Promega). The cells were incubated for 1.5 h at
37°C, washed, and plated in 10 ml of complete media. After a 20-h
recovery, transfected cells were activated with P/I for 8 h. Cell
extracts and luciferase reagents were prepared with the Promega
Dual-Luciferase Reporter Assay System. Both firefly and Renilla
luciferase activities were monitored with a luminometer (Turner
Industries, Sunnyvale, Calif.). Normalized reporter activity is
expressed as the firefly luciferase value divided by the Renilla luciferase value. Relative fold induction is calculated as the normalized reporter activity of the test sample divided by either the
untreated FPR-Luc or
5-Luc reporter construct, as indicated below.
The Rous sarcoma virus promoter-driven I
B
construct
(RSV-I
B
) and vector control were obtained from Tse-Wa Tan (Baylor
College of Medicine, Houston, Tex.).
Nuclear extract preparation, EMSAs, supershift analyses, and
displacement studies.
Nuclear extracts were prepared by a modified
method of Dignam et al. (15). In brief, 7.5 × 106 Jurkat cells were washed in PBS and pelleted before
resuspension in 200 µl of cold buffer A (10 mM HEPES (pH 7.9), 50 mM
NaCl, 1 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride [PMSF]) and incubated for 20 min on ice prior to the addition of 200 µl of cold buffer B (buffer A with 0.1% Nonidet P-40). Cells were gently pipetted and returned on ice for another 20 min. Nuclei were pelleted (5,000 × g, 2 min), washed in
buffer A, and pelleted again, and nuclear proteins were extracted in 25 µl of buffer D (400 mM NaCl, 20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM
EGTA, 1 mM dithiothreitol 1 mM PMSF). The tubes were iced for at least
30 min, followed by centrifugation at 4°C for 10 min. The supernatant
was recovered, snap-frozen in liquid nitrogen, and stored at
80°C
prior to use.
Probes used for EMSAs were radiolabeled by [

-
32P]ATP
end labeling with T4 polynucleotide kinase. Briefly, 30 µg of the

5-Luc
plasmid was digested with
XhoI, dephosphorylated
with calf intestine
phosphatase, and both enzymes were inactivated at
85°C for 10
min. An aliquot of the digest (7.5 µg) was end labeled
with [

-
32P]ATP for 60 min before the kinase was
inactivated at 75°C for
10 min. The end-labeled plasmid was then
digested overnight with
SacI, and the released probe A
(

460 to

236) was gel purified
as described previously
(
11). The oligonucleotide probe B (

306
to

278;
5'
306CTCCCCAACCCGGGCGTTCCCCAGCGAGG) or its
mutated counterpart was
annealed to the corresponding complementary
sequence before 1
pmol was end labeled with [

-
32P]ATP
for 30 min. The labeled probe was purified from unincorporated
nucleotides by using a Chroma Spin 10 column (Clonetech) following
the
manufacturer's instructions. The specific activities of all
32P-labeled oligoprobes were routinely 5 × 10
6 to 6 × 10
6 cpm per
pmol.
Protein concentration was determined with the Bio-Rad protein assay
reagent (Bio-Rad, Richmond, Calif.). For EMSAs, 6 µg of
nuclear
extract was incubated in a total volume of 19 µl of binding
buffer
[50 mM NaCl, 10 mM Tris (pH 7.9), 0.5 mM EDTA, 1 µg of
poly(dI-dC),
and 5% glycerol] for 15 min at room temperature before
50,000 cpm of
the indicated

-
32P-end-labeled probe was added for
another 15 min. For competition
assays, excess unlabeled
oligonucleotides were preincubated for
15 min prior to the addition of
the radiolabeled probe (50,000
cpm). For antibody-mediated supershift
assays, extracts were preincubated
with 1 µl of either anti-p50,
-p65, -c-Rel (Oncogene Research,
Cambridge, Mass.) -relB, -p52, or -Sp1
(Santa Cruz Biotechnology,
Santa Cruz, Calif.) antibodies at 4°C for
45 min before the addition
of the radiolabeled probe. The reactions
were loaded on a 4.5%
polyacrylamide nondenaturing PAGE gel in 0.5×
Tris-borate-EDTA
electrophoresed for 2.5 h at 100 V before drying
and exposed to
autoradiographic
film.
For displacement studies, 4 footprinting units (fpu) of Sp1 (~30 ng;
Promega) was preincubated in a total volume of 19 µl
of binding
buffer for 5 min prior to addition of 12,500 cpm of
labeled probe B. After 15 min at room temperature, increasing
amounts of recombinant p50
NF-

B (Promega) subunits were added
for an additional 15 min before
the mixture was loaded on a 4.5%
polyacrylamide PAGE gel as described
above.
 |
RESULTS |
Expression of Fas mRNA and protein is upregulated in Jurkat cells
by pharmacological agents that mimic T-cell activation.
While
resting T cells express low to undetectable levels of the Fas protein
(26, 37, 41, 44), it is rapidly upregulated upon exposure to
specific antigens, mitogens, cytokines, TCR antibodies, and various
pharmacological agents such as P/I (6, 37, 44). The Jurkat
T-cell line has an activated T-cell phenotype, in that it
constitutively expresses cell surface Fas (Fig.
1A). Because we were interested in the
transcriptional mechanisms controlling Fas expression, we asked whether
Fas could be upregulated in Jurkat cells upon activation. To this end,
Jurkat cells were stimulated with P/I for various times, and mRNA and
protein expression was determined with RPAs and FACS analyses,
respectively. As shown in Fig. 1A, Jurkat cells transiently upregulated
surface Fas after P/I stimulation. Increased Fas was detectable as
early as 4 h poststimulation, reached maximal levels by 8 h,
and declined to near-baseline levels by 24 h. A 1.5- to 2.0-fold
increase in both the percentage of cells expressing Fas as well as the
mean fluorescence intensity (MFI), representative of antigenic density
on a per-cell basis, was observed. Correspondingly, as shown in Fig.
1B, Fas mRNA levels were upregulated by 10-fold in Jurkat cells
activated for 2 h; mRNA levels declined subsequently over the time
period examined (24 h). These results demonstrate an immediate-early, activation-dependent upregulation of Fas in P/I-stimulated Jurkat cells, suggesting a likely transcriptional control.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Time course induction of Fas upregulation in P/I-treated
Jurkat cells. (A) Cells were harvested at the indicated time, and Fas
expression was analyzed by flow cytometry. Isotype-matched control
antibody staining is represented as a dashed line, and Fas staining is
represented as solid lines. The percentage of specific Fas staining and
the mean fluorescence intensity (MFI) of Jurkat cells at each time
point are shown to the right. (B) Cells were harvested at the indicated
time, total RNA was isolated, and Fas mRNA accumulation was determined
by RNAse protection analysis. Scanning densitometry was used to
normalize Fas mRNA levels and to calculate the relative fold induction
compared to that of the untreated, time zero sample.
|
|
A 220-bp region in the Fas promoter is required for
activation-dependent upregulation.
To test the premise that
activation-dependent Fas upregulation was modulated at the level of
transcription, approximately 1.7 kb of the 5' region flanking the
fas translational start site (nucleotides
1739 to
19)
were isolated from a human placental genomic library and subcloned into
the pGL2-Basic luciferase reporter vector in both orientations relative
to the luciferase gene. The basal activity of the FPR1-Luc(+) construct
was first determined by transient transfections into various T- and
B-cell lines, followed by extract preparations and luciferase activity
measurements. As shown in Fig. 2A, the
FPR1-Luc(+) construct demonstrated basal activity in the Jurkat
(13-fold over empty vector), Molt-4 (32-fold), and HSB (14-fold) T-cell
lines. In B-cell lines, modest basal activity was observed only in Raji
cells (fivefold over empty vector alone), but not in Daudi or Ramos
cells. These results document that the 1.7-kb region upstream of the
fas ATG contains a functional promoter operative in T-cell
lines and certain B-cell lines.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Basal and inducible fas promoter activity and
in vitro EMSA analysis. (A) FPR1-Luc(+) containing the sequence from
1739 to 19 is active in T-cell lines and the B-lymphocyte line
Raji, but inactive in Daudi or Ramos cells. Cells were transfected with
10 µg of either the empty reporter (pGL2B [ ]) or the
fas promoter reporter vector (FPR1-Luc [ ]); 10 ng of
pRL-tk vector was cotransfected for normalization. Extracts were taken
after 40 h, and luciferase activity was determined. Relative fold
activity was calculated as the normalized FPR1-Luc(+) activity divided
by the normalized pGL2B value. (B) fas promoter sequences
460 to 240 are required for inducible fas reporter
activity. FPR1-Luc in both orientations (forward and reverse),
5-Luc, 6-Luc, tk-Luc, and 5/ 6-tk-Luc constructs were
transiently transfected into Jurkat cells with pRL-tk for
normalization, and the cells were then left untreated ( ) or were
activated with P/I ( ) for 8 h before harvesting of the extracts
for measurement of luciferase activity. The values shown are averages
of three independent experiments (± standard deviation) and are
expressed as relative fold induction over normalized luciferase values
from untreated Jurkat cells containing FPR1-Luc(+). For tk-Luc and
5/ 6-tk-Luc, the relative fold induction was calculated separately
as the normalized luciferase value divided by the untreated, normalized
tk-Luc luciferase value. (C) Specific protein complexes bind the
enhancer region between 460 and 236. 32P-labeled probe
A (50,000 cpm) was mixed with nuclear extracts from untreated or
P/I-activated Jurkat cells (left panel, lanes 1 to 3). Specific
complexes (C1 and C2) are indicated. N.S., nonspecific complexes. Cold
competition mixtures with a 25-fold excess of the indicated consensus
elements (right panel, lanes 4 to 7) were mixed with extracts from
Jurkat cells activated with P/I for 1 h prior to addition of
labeled probe A.
|
|
To determine whether FPR1-Luc(+) was responsive to activation,
transiently transfected Jurkat cells were treated with P/I
as described
in Materials and Methods, and the relative luciferase
activities of
untreated and P/I-stimulated cells were compared.
As shown in Fig.
2B,
FPR1-Luc(+) activity increased approximately
17-fold in response to P/I
treatment compared to the basal activity
of unstimulated Jurkat cells.
The
fas promoter is orientation
dependent, since
FPR1-Luc(

) was inactive in both resting and
stimulated cells. To more
precisely map the
fas promoter region(s)
responsive to P/I
activation, two deletion constructs containing
the sequences from

460
to

19 (

5-Luc) and

240 to

19 (

6-Luc)
were prepared as
described in Materials and Methods. As shown
in Fig.
2B, P/I
inducibility of the
fas promoter was maintained
when the
sequences between

1739 and

460 were deleted. However,
when
sequences between

460 and

240 were deleted, P/I-induced
upregulation was virtually absent. As shown, FPR1-Luc(+) and

5-Luc
were upregulated 17- and 15-fold after P/I treatment, respectively,
while the

6-Luc construct was upregulated by less than 4-fold.
Interestingly, no differences were noted in the activity of these
constructs in unstimulated Jurkat cells, suggesting that the
fas promoter sequences between

460 and

240 are
critically important
for activation-dependent, but not basal,
transcription. Sequence
analysis within this region demonstrated the
presence of consensus
elements for several transcription factors,
including AP-2, GAS,
NF-

B, and NF-AT.
To investigate whether the 220-bp region between

460 and

240
contained enhancer elements responsive to P/I activation, this
region
was subcloned proximal to a thymidine kinase promoter in
a luciferase
reporter construct (

5/

6-tk-Luc), and transient
transfection
reporter assays were carried out. As shown in Fig.
2B, the

5/

6-tk-Luc construct was highly inducible by P/I (12-fold
relative to tk-Luc), at levels comparable to that of the native
Fas
promoter. These results suggest that the
fas promoter region
between

460 and

240 contains enhancer element(s) necessary for
activation responsiveness. To analyze whether transcription factors
may
be involved in the activation-dependent upregulation of the
fas promoter within this region, EMSA analyses were carried
out.
Nuclear extracts, prepared from unactivated and P/I-stimulated
Jurkat cells, were incubated with a
32P-labeled probe
spanning the
fas promoter region between

460
and

236
(probe A). A time course analysis revealed the presence
of two
complexes binding to this region. An upper complex, designated
C2, was
constitutively bound in unactivated Jurkat extracts throughout
the
course of activation (Fig.
2C, lanes 1 to 3). A second lower
complex,
designated C1, bound only upon P/I activation (Fig.
2C,
Lane 2). To
determine the nature of the C1 and C2 complexes, cold-target
competition was carried out with 25-fold excesses of the Sp1,
NF-

B,
and AP-1 consensus elements. As shown (Fig.
2C, lane 5),
C2 binding was
inhibited by Sp1-specific oligonucleotides, indicating
the presence of
an Sp1-like transcription factor at this site.
C1 binding was
specifically competed by using

B consensus oligonucleotides
derived
from the human immunodeficiency virus long terminal repeat
(HIV LTR)
(Fig.
2C, lane 6). Other cold-target consensus elements
tested,
including AP-1, AP-2, NF-ATp, and GAS, were incapable
of inhibiting
either C1 or C2 binding (Fig.
2C, lane 7, and data
not shown). Thus, in
the promoter region required for activation-dependent
Fas upregulation,
Sp1 bound constitutively, while NF-

B complex
formation occurred only
in response to
stimulation.
Activation-dependent Fas promoter induction requires nucleotides
306 to
260.
To analyze the region between
460 and
240 in
further detail, sequential deletions of
5-Luc spanning 40- to 60-bp
intervals were generated by PCR. The precise sequences contained in the various constructs are shown in Fig. 3A.
Basal and inducible promoter activities in transiently transfected,
unactivated, and P/I-stimulated Jurkat cells, respectively, are shown
in Fig. 3B. Deletion of nucleotides
460 to
306 and
259 to
240
had little effect on the activation-dependent induction of the
fas promoter (
5 to
5.7,
5.8 to
6), ruling out
the contribution of the consensus NF-
B sites located at
421 to
412 and
252 to
243, the GAS element at
394 to
386, and the
NF-ATp-AP-2 site at positions
358 to
345. When nucleotides
306
to
260 (
5.7 to
5.8) were deleted, however, inducible reporter
activity was reduced to that observed with the
6 construct. The
sequences between
306 and
260 were devoid of any mapped
transcription factor consensus sites, except for a
B-like motif
present at positions
295 to
286. This motif contains the sequence
GGGCGTTCCC and differs from the derived consensus
B
p50-p65 heterodimer motif GGGRNNYYCC (20, 30,
48) at position 4 (change of R to C). Notably, however, the
critical G1-3 nucleotides necessary for p50 binding are
maintained. Comparison of this motif to a consensus Sp1 site,
KRGGCGKRRY (35), also revealed homology at 8 of 10 residues,
indicating a possible interaction with this transcription factor. Taken
together with results from our previous studies showing that complexes
that could be competed with Sp1 and NF-
B oligonucleotides bound to
the fas promoter region at
406 to
236, it seemed likely
that these transcription factors, acting alone or in combination, might
be required for activation-dependent fas promoter induction.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of activation-dependent fas
promoter activity. (A) The fas nucleotide sequence between
460 and 230 is shown with known consensus transcription factor
elements indicated (shaded areas). The location and designation of the
various deletion constructs are indicated by the solid arrow. (B) P/I
inducibility of the fas promoter localizes between
nucleotides 306 and 260. Jurkat cells transiently transfected with
10 µg of the various deletion constructs and 10 ng of pRL-tk as the
normalizing vector were left untreated ( ) or activated with P/I
( ) for 8 h before extracts were prepared for luciferase
activity measurements. The values shown are averages of three
independent experiments ± standard deviation and are expressed as
the relative fold induction of the various deletion constructs over the
untreated, normalized 5-Luc luciferase value.
|
|
Sp1 and NF-
B conjointly bind at the
B-Sp1-like motif (
295
to
286) during activation-driven fas promoter
induction.
To further investigate the transcription factors
involved in fas promoter upregulation in P/I-activated
Jurkat cells, EMSA analyses of nuclear extracts were performed with a
29-bp probe spanning the noncanonical
B-Sp1-like motif (
306 to
278; probe B). In concert with our previous observations with probe
A, spanning nucleotides
460 to
236 (Fig. 2C), we observed
constitutive binding of the C2 complex in both unactivated and
P/I-stimulated extracts and inducible binding of the C1 complex upon
activation (Fig. 4A). C1 was induced de
novo within 15 min of P/I addition (Fig. 4A, lane 2) and persisted for
up to 2 h postactivation (Fig. 4A, lane 5). The specificities of
C1 and C2 binding to probe B were first demonstrated by
cold-competition assays using excess unlabeled probe B (Fig. 4A, lane
9). Jurkat extracts were coincubated with radiolabeled probe B and
25-fold excesses of either unlabeled AP-1- or NF-AT-specific
oligonucleotides or a mutated probe B (GGG to TTT [see below]). Under
these conditions, no displacement was observed in either C1 or C2
binding complexes (Fig. 4A, lanes 7, 8, and 10). To investigate
Sp1-NF-
B binding to probe B, Jurkat extracts were incubated with
labeled probe B and increasing concentrations of unlabeled NF-
B
consensus oligonucleotides. With a 25-fold excess, NF-
B
oligonucleotides effectively competed the inducible C1 complex, but not
the C2 complex. However, at 100-fold excess, both C2 and nonspecific
binding were inhibited (Fig. 4A, lanes 11 to 12). Increasing
concentrations of Sp1 oligonucleotides, on the other hand, specifically
competed the constitutive C2 complex, but not the inducible C1 binding
(Fig. 4A, lanes 13 and 14).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro analysis of a potential B-Sp1 site at 295
to 286. (A) Time course analysis of complex binding to probe B ( 306
to 278). Jurkat cells were activated with P/I for the indicated time,
nuclear extracts were harvested, and EMSA analysis was performed with
32P-labeled probe B (left panel, lanes 1 to 5). Cold competition was performed with 1-h-activated Jurkat
cell nuclear extracts with a 25-fold excess of consensus
oligonucleotides for the transcription factors AP-1, NF-AT, wild-type
probe B (W-T), or mutated probe B (Mut.) added prior to incubation with
32P-labeled probe B (lanes 7 to 10). For NF- B and Sp1
competition, a 25-fold excess (lanes 11 and 13) and 100-fold excess
(lanes 12 and 14) of consensus oligonucleotides were added to
equivalent amounts of P/I-activated nuclear extracts prior to addition
of 32P-labeled probe B. N.S., nonspecific binding. (B)
Supershift analyses of P/I-activated Jurkat cell nuclear extracts.
Nuclear extracts were subjected to EMSA analysis in the absence (lane
1) or presence of the indicated specific antisera (lanes 2 to 8), or
preimmune IgG (lane 9). With two different anti-Sp1 antisera, probe B
binding to the upper C2 complex was shown to be either shifted or
inhibited (lanes 7 and 8). Arrows indicate the identity of the shifted
complexes. (C) Mutual exclusive binding of Sp1 and NF- B p50 to probe
B. Recombinant Sp1 (4 fpu [120 ng]) was preincubated with 12,500 cpm
of radiolabeled probe B in the absence (lane 2) or presence of
increasing amounts (0 to 40 ng) of recombinant NF- B p50 (lanes 3 to
6) prior to EMSA analysis. Brackets indicate the Sp1-probe B and
p50-probe B complexes.
|
|
We next addressed whether extracts from P/I-activated Jurkat cells
bound to probe B could be supershifted by using antibodies
against
various NF-

B-Rel family members, including p50, p52,
p65, c-Rel,
and RelB. As shown in Fig.
4B, the inducible C1 complex
was
supershifted with antibodies against p50, p65, and to a lesser
extent,
c-Rel, indicating the presence of these heterodimers in
the shifted
complex (Fig.
4B, lanes 2 to 4). No such shifted complexes
were
observed in extracts from unactivated Jurkat cells lacking
the
inducible C1 complex (data not shown). Antibodies against
Sp1, on the
other hand, shifted the constitutive C2 complex in
both activated (Fig.
4B, lanes 7 and 8) and unactivated Jurkat
extracts (data not shown).
These results imply that Sp1 is bound
to the

B-Sp1 site at

295 to

286 during normal basal transcription,
whereas NF-

B p50-p65
heterodimers occupy the

B-Sp1 site during
activation-driven
fas promoter
induction.
Mutually exclusive binding of Sp1 versus NF-
B at nucleotides
295 to
286.
To assess whether binding of Sp1 and NF-
B to
the
295 to
286 site in the fas promoter occurs
concurrently or as a mutually exclusive event, EMSA analyses were
performed with probe B with recombinant Sp1 and increasing amounts of
recombinant p50. Consistent with our observations using extracts from
unactivated Jurkat cells, a single complex is observed when probe B is
mixed with Sp1 alone (Fig. 4C, lane 2). As increasing amounts of
recombinant p50 are added, however, the intensity of the Sp1 complex is
decreased, with a concomitant increase in the lower p50 binding complex
(Fig. 4C, lanes 3 to 6). These results indicate that the fas
promoter region at
295 to
286 contains a single
B-Sp1 binding
motif to which either Sp1 or NF-
B is exclusively bound. Upon
cellular activation, constitutively bound Sp1 is likely displaced by
NF-
B to drive fas promoter upregulation.
NF-
B recruitment regulates activation-dependent Fas promoter
induction.
Although the above in vitro analyses document that
NF-
B heterodimers are rapidly recruited to the fas
promoter region controlling activation-dependent induction, these
studies do not address the functional consequences of the effects of
NF-
B recruitment on fas promoter activity. To investigate
the role of NF-
B recruitment in activation-driven fas
upregulation, the effects of various inhibitors of NF-
B function
were examined. Jurkat cells transiently transfected with the
5-Luc
reporter were pretreated with two pharmacological inhibitors of NF-
B
and then activated with P/I, and luciferase activity was determined. As
shown in Fig. 5A, cyclosporin A
pretreatment of Jurkat cells completely prevented P/I-dependent upregulation of the fas promoter. Because this calcineurin
inhibitor can inhibit NF-AT translocation and disrupt Ca2+
signals leading to NF-
B induction (36), the fungal
metabolite gliotoxin, a specific inhibitor of I
B-
degradation and
NF-
B translocation, was also used (46). Gliotoxin, but
not the inactive gliotoxin derivative
bis-dethio-bis(methylthio)gliotoxin, completely abolished P/I
inducibility of the
5-Luc reporter, consistent with the notion that
NF-
B recruitment was functionally required for activation-dependent
fas promoter induction. The critical requirement for NF-
B
recruitment was additionally verified in Jurkat cells overexpressing
wild-type I
B-
. The overexpression of I
B-
, a natural
inhibitor of NF-
B translocation, has been shown to effectively block
B-dependent transactivation (31, 32). As shown in Fig.
5B, P/I-activated Jurkat cells transiently transfected
with the
5-Luc reporter and RsV-I
B-
expression plasmid showed a dose-dependent decrease in fas
promoter activity with increasing I
B-
concentration. Taken
together, these results strongly support the premise that NF-
B
translocation is essential for activation-dependent fas
promoter induction.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of activation-dependent fas
promoter upregulation. (A) Pharmacological inhibition of 5-Luc
induction by P/I. Jurkat cells transiently transfected with 10 µg of
5-Luc and 10 ng of pRL-tk were preincubated in the absence (None) or
presence of cyclosporin A (CsA [1 µg/ml]), gliotoxin (GT [1
µg/ml]), or bis-dethio-bis(methylthio)gliotoxin (DGT [3 µg/ml])
for 30 min prior to P/I stimulation for 8 h. Following incubation,
cells were harvested for extract preparation, and luciferase activity
was determined. The values shown are representative of two independent
experiments ± standard deviation and are expressed as the
relative fold induction over normalized untreated 5-Luc activity.
(B) Dose-dependent inhibition of P/I-inducible 5-Luc reporter
activity by I B . Increasing amounts of wild-type RsV-I B
( ) or vector control ( ) expression plasmid were cotransfected
into Jurkat cells with 10 µg of 5-Luc and 10 ng of pRL-tk 40 h prior to P/I activation. Cells were harvested for extract preparation
after 8 h of P/I exposure, and luciferase activity was measured.
The values shown are averages from two independent experiments ± standard deviation and are expressed as percent inhibition of
P/I-induced, normalized 5-Luc reporter activity.
|
|
The
B-like motif at
295 to
286 controls activation-dependent
fas promoter responses.
While previous experiments
indicated that NF-
B translocation was essential for fas
promoter induction, the functional significance of the
B element at
positions
295 to
286 remained to be tested. To determine the
specific contribution of this
B-Sp1 element, oligonucleotides were
synthesized with the composite site altered (as underlined)
(GGGCGTTCCC to TTTCGTTCCC) and with a
mutagenized
5 fas reporter construct generated by PCR.
This construct was designated
5M5.7-Luc. As a control, a second
5
reporter construct containing the
B site at
262 to
253 was also
mutagenized (
5M5.8; GGGGCTTTTC to
GCCYCTTTTC) and used in reporter assays. Jurkat cells transiently transfected with the wild-type
5-Luc construct,
5M5.7-Luc, or the
5M5.8-Luc control were activated with P/I, and
reporter activity was measured. Similar to previous experiments with
the
5 deletion constructs (Fig. 3B), both wild-type
5-Luc and
5M5.8-Luc showed an approximate 15-fold induction following activation (Fig. 6). In contrast,
5M5.7-Luc reporter activity increased only threefold after P/I
treatment. These results document the functional contribution of the
B-Sp1 site at positions
295 to
286, but not the consensus
NF-
B site at
262 to
243, in activation-dependent fas
promoter induction. Interestingly, while
5M5.7-Luc induction was
significantly suppressed compared to that of the wild-type
5-Luc
construct (79.6% ± 10.61%, respectively) P/I inducibility was not
entirely abolished. Such findings suggest that an additional site or
sites, perhaps in the region from
19 to
240 (compare Fig. 3B to
Fig. 6), may be required for maximal fas promoter induction
during T-cell activation.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
The B-Sp1 enhancer element is required for
P/I-inducible 5-Luc reporter activity. (A) Nucleotide mutagenesis of
5-Luc at either the B-Sp1 element (GGG CCC; 295 to 293
[ 5M5.7-Luc]) or the downstream NF- B element (GGG CCY; 252
to 249 [ 5M5.8-Luc]) was introduced by PCR. Wild-type or
mutagenized constructs were cotransfected into Jurkat cells with 10 ng
of pRL-tk, and the cells were activated with P/I for 8 h prior to
being harvested for extract preparation and luciferase activity
measurements. The values shown are averages of three independent
experiments ± standard deviations and are expressed as the
relative fold increase over untreated, normalized 5-Luc luciferase
activity. (B) Concatemer constructs containing either none (tk-Luc),
two ( /S2tk-Luc), four ( /S4tk-Luc), or six ( /S6tk-Luc) copies
of the B-Sp1 element ( 295 to 286) were juxtaposed upstream of a
thymidine kinase-driven luciferase reporter and cotransfected into
Jurkat cells as mentioned above before activation with P/I and
luciferase measurements. Inhibition of NF- B activity were analyzed
by preincubation of transfected cells with either gliotoxin (GT [1
µg/ml]) or bis-dethio-bis(methylthio)gliotoxin (DGT [1 µg/ml])
as described in the legend to Fig. 5 prior to activation with P/I.
Relative fold induction is calculated against the untreated, normalized
tk-Luc reporter luciferase activity. (C) Specific inhibition of
NF- B-dependent upregulation of the B-Sp1 motif concatemers by
coexpression of RsV-I B . Multimerized constructs were
cotransfected with 5 µg of either RsV-I B or vector-only
expression plasmids before activation with P/I as described above.
Extracts were taken for luciferase measurements, and relative
inhibition is calculated as the percentage of P/I-induced luciferase
activity of the corresponding reporter constructs.
|
|
To further verify the transcriptional contribution of the

295 to

286

B-Sp1 composite site, concatemer constructs containing
multiple copies of this element upstream of a thymidine kinase
promoter-driven luciferase reporter were generated (Fig.
2B).
Constructs containing none, two, four, or six copies of the

B-Sp1
element were transiently transfected into Jurkat cells, and the
reporter activity was measured after P/I activation (Fig.
6B).
As
expected, the inducibility of the concatemer-reporter constructs
increased with the number of the

B-Sp1 elements multimerized,
with
six copies showing a >35-fold specific induction over that
of the
thymidine kinase promoter alone. As observed previously
with the

5-Luc construct (Fig.
5), P/I inducibility of the

B-Sp1
concatemers was specifically eliminated by inhibitors of NF-

B
translocation. Figures
6B and C show the effects of gliotoxin
and
I

B-

overexpression on P/I inducibility of the

B-Sp1-containing
constructs. Furthermore, in cells transfected with six copies
of the

B-Sp1 element (

/S6tk-Luc), basal reporter activity was
fourfold
higher in unstimulated Jurkat cells than that of the
tk-Luc reporter
alone, suggesting a possible enhancement of constitutive
fas
promoter regulation by multiple Sp1 sites. Taken together,
these
experiments confirm the functional significance of the

B-Sp1
site at

295 to

286 in the control of activation-driven
fas
promoter
induction.
 |
DISCUSSION |
In recent years, much attention has been focused on how the immune
response is downregulated. Because self-reactive T cells are
ineffectively deleted by negative selection in the thymus, the
preservation of immune homeostasis requires self-regulatory mechanisms
for the maintenance of tolerance and the control of excessive T-cell
proliferation to foreign antigens in the periphery. Apoptosis is
responsible for maintaining T-cell homeostasis by at least two
mechanisms-AICD that occurs after TCR ligation by antigen and passive
cell death that occurs in the absence of antigen or cytokine
stimulation (1, 14, 26, 63). The Fas-FasL-mediated pathway
of apoptosis appears to be central in the regulation of peripheral
tolerance, because mutations in either the receptor or the ligand can
induce lymphadenopathy and autoimmune disease in mice and humans caused
by defects in AICD and peripheral T- and B-cell deletion (18, 60,
65). Fas is constitutively expressed on most cultured T cells,
whereas freshly isolated, naïve (CD45RO+)
peripheral blood T cells have little to no surface Fas. Early after
T-cell activation, Fas is rapidly upregulated, but these Fas-positive
cells remain resistant to Fas-induced apoptosis (26, 37, 41,
44). With the progression of an immune response, Fas-positive T
cells acquire sensitivity to Fas-induced killing (37, 44).
Although Fas upregulation is known to be a prerequisite for the
elicitation of Fas-FasL-mediated AICD (1, 14, 26), the
molecular mechanisms underlying this process have not been well
investigated. In this report, we have identified the immediate transcriptional events and cis-acting elements required for
activation-induced fas expression in the human Jurkat cell
line. Using transient transfection reporter assays, we have localized a
47-bp sequence (
306 to
260) upstream of the translational start
site that confers P/I inducibility of the fas promoter (Fig.
3B). Within this region, a critical 10-bp enhancer (
295 to
286) was
shown to bind Sp1 during basal transcription expression and NF-
B
p50-p65 heterodimers after P/I activation (Fig. 4). When binding of
NF-
B was inhibited by the blockade of
B translocation or
mutagenesis of the
B-Sp1 site, activation-dependent Fas upregulation
was lost. Our findings provide the first molecular evidence for
differential control of constitutive and inducible Fas expression and
suggest an intervention strategy for inducible Fas upregulation.
Sp1 is a zinc-finger transcription factor constitutively expressed in a
variety of cell types that binds the GC-rich consensus sequences
(KGGGCGGRRY or KRGGCGKRRY) present in many cellular and viral
promoters. The N terminus of Sp1 contains glutamine- and
serine/threonine-rich domains required for transactivation, while the C
terminus is involved in synergistic activation and interaction with
other transcription factors (12). Although Sp1 has been
shown to independently initiate transcription in TATA-less promoters
(reviewed in reference 3), it can also form homo- or
heteromultimeric complexes to transactivate a number of disparate
promoters, including interleukin 2, VCAM-1, and the HIV LTR (42,
50, 56). Several lines of circumstantial evidence suggest that
Sp1 may be involved in basal fas transcription. First, sequences proximal to the fas translational start site have
a relatively high GC content (61% between positions
590 and
1) and
an absence of conventional TATA and CAAT boxes (5), typical of a subclass of polymerase II-dependent promoters controlled by the
interactions of the glutamine-rich activation domains of Sp1 with TFIID
components (9). Second, the TATA-less, GC-rich area of the
fas promoter (
590 to
1) has been shown to be functional in analyses of transcriptional start sites (5). Third, the TATA-less
5 fas promoter construct was sufficient in
driving basal transcription. Fourth, Sp1 bound to the
B-Sp1 site at
positions
295 to
286 in resting, but not activated, Jurkat cell
extracts (data not shown). Finally, multimers of the
B-Sp1 element
at positions
295 to
286 showed increase basal transcription in Jurkat cells (Fig. 6B). Although Sp1 may be involved in the control of
fas transcription in resting Jurkat cells, it is likely that multiple Sp1 binding elements are required for optimal basal levels of
Fas expression. In this regard, site-directed mutagenesis of the
B-Sp1 site at
295 to
286 alone inhibited basal fas
transcription by ~20%, while disruption of a second consensus Sp1
site at
140 to
131 repressed basal fas transcription by
greater than 50% (data not shown).
Nuclear translocation of the NF-
B-Rel transcription factor family
occurs in T lymphocytes in response to TCR engagement (reviewed in
reference 20). The prototypic form of NF-
B is a
heterodimer complex containing NF-
B1-p50 or NF-
B2-p52 in
combination with a transactivating subunit such as c-Rel or RelA (p65)
(reviewed in reference 64). Each NF-
B-Rel family
member contains a conserved N-terminal region responsible for decameric
DNA binding, dimerization, and I
B interaction; NF-
B-responsive
genes are transactivated by the C-terminal domain of dimeric
NF-
B-Rel family members. In resting T lymphocytes, various NF-
B
subunits are sequestered in the cytoplasm by virtue of their
association with by the I
B family of inhibitors (I
B
, I
B
,
I
B
, I
B
, and bcl-3), which masks their nuclear localization
signal (reviewed in reference 64). During T-cell
activation, intracellular signaling triggers multiple kinase pathways
that converge in the activation of the I
B kinase complex (IKK); IKK
then phosphorylates I
B
or I
B
at conserved serines,
resulting in the targeting of the
B inhibitor for
ubiquitin-proteasome-dependent destruction and permitting the nuclear
translocation of NF-
B (10). Binding sites for NF-
B have been found in numerous genes involved in effector T-cell function,
including those regulating cytokine production, cell adhesion
molecules, and apoptosis. In this report, we have demonstrated that
NF-
B p50-p65 mediates inducible fas promoter activation in T lymphocytes at
460 to
240 and confers the majority of P/I responsiveness at a single, noncanonical
B-Sp1-like motif
(GGGCGTTCCC) located at
295 to
286. Interestingly,
although two consensus NF-
B sites as well as GAS, NF-ATp, AP-2, and
Egr-1 sites are also present within this region, the contribution of
these elements to either basal or inducible fas promoter
induction in Jurkat cells was insignificant (Fig. 3). Notably, however,
such motifs may be functional in other cell types, because Egr-1
binding at
371 to
338 has been reported to repress fas
transcription during B-cell activation (16).
The mutually exclusive binding of either Sp1 or NF-
B to the novel
composite
B-Sp1 site at
295 to
286 in the fas
promoter differs from the previously described cross-coupling of
NF-
B with the transcription factor AP-1 or HMG I(Y) (58,
62). Our observations are not unexpected, however, in light of
reports documenting the functional interference of Sp1 and NF-
B at
selected NF-
B binding sites (21) and crystallographic
data showing that Sp1 and p50 homodimers both interact with DNA at the
major groove (19, 38, 49). In this report, we provide
multiple lines of evidence that NF-
B p50-p65 heterodimers displace
Sp1 at the composite
B-Sp1 site to drive activation-dependent
interaction of the fas promoter. First, P/I-dependent
promoter induction requires the sequences between
306 and
260
containing the
B-Sp1 site (Fig. 3B). Second, NF-
B p50-65
heterodimers bound to this region of the fas promoter only
during activation (Fig. 4A and B). Third, recombinant NF-
B p50
displaced Sp1 binding to the
B-Sp1 site in a dose-dependent manner
(Fig. 4C). Fourth, recruitment of NF-
B to the fas
promoter region at
295 to
286 was required for activation-dependent fas promoter induction, but not for basal activity (Fig. 5).
Fifth, specific mutagenesis of the NF-
B site at
295 to
286
significantly diminished P/I-dependent fas promoter
induction (Fig. 6A). Finally, multimers of the
B-Sp1 site
juxtaposed to a minimal thymidine kinase promoter were functionally
responsive to P/I stimulation in a dose-dependent manner (Fig. 6B). In
further support of our observations that NF-
B is critically required
for activation-induced fas upregulation, several inducers of
NF-
B, including UV irradiation, hypoxia, cytokines, and TNF, have
been reported to rapidly upregulate Fas (24, 44, 61). It is
interesting to speculate that Sp1, bound to the
B-Sp1 site during
basal transcription, may facilitate rapid activation-induced
fas promoter responsiveness mediated by NF-
B
translocation as a consequence of its role in DNA bending (57).
If Fas is similarly regulated in Jurkat and fresh T cells, our findings
may be relevant to HIV pathogenesis, in which increased Fas expression
and sensitivity to FasL-induced apoptosis have been reported during
infection and disease progression (2, 4, 27). Interestingly,
both HIV-1 binding and gp120-mediated CD4 cross-linking can induce
NF-
B (8). Because NF-
B can drive both HIV-1 expression
(50) and fas upregulation, inhibition of NF-
B
may be one major strategy to suppress both viral replication (31) and premature execution of the AICD pathway resulting
in T-cell depletion. Indeed, inhibitors of NF-
B may also effectively repress Fas-driven apoptosis in response to metabolic stress, genotoxic
insults, and viral infections.
Although our studies clearly demonstrate a critical role for NF-
B in
fas upregulation, other transcriptional or
posttranscriptional processes may also be operative, depending upon the
cell type and cellular microenvironment. For example, the proline-,
glutamine-, and histidine-rich protein TDAG51 has been reported to be
critical for Fas mRNA induction after TCR engagement (47).
Our laboratory has demonstrated that wild-type p53 can upregulate
fas expression in both hematopoietic and nonhematopoietic
cells (45). Taken with our current observations, it is
plausible that p53 may act with NF-
B to increase fas
transcription, particularly under conditions of metabolic and genotoxic
stress. mRNA stability may also regulate fas expression. In
this regard, the 3' untranslated region of fas contains
several AU-rich elements reported to induce selective mRNA degradation
(29, 55). Given the potent biological function of the Fas
protein, multiple levels of gene regulation involving both
cis-acting transcription and mRNA stability would not be unexpected.
In summary, our studies have identified a novel
B-Sp1 enhancer motif
in the fas promoter in which NF-
B p50-p65 dimers bind to
drive activation-dependent Fas upregulation in T cells. The critical
involvement of NF-
B further underscores the importance of this
transcription factor in immunohomeostasis and prompts consideration for
strategies aimed toward its manipulation in various pathophysiological
states involving inappropriate Fas and FasL interactions, including
malignant disease, autoimmunity, and AIDS.
 |
ACKNOWLEDGMENTS |
This work was supported in part by NIH Cancer Center Support Core
grant CA16672, NIH predoctoral fellowship (H.C.), and American Cancer
Society grant CIM 88929 (L.B.O.-S.).
We thank Karen Ramirez for providing technical expertise with flow
cytometric analyses and Kathleen McAveney and David McConkey for
critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The University
of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Box
178, Houston, TX 77030. Phone: (713) 792-8735. Fax: (713) 745-1633. E-mail: lowensch{at}mdanderson.org.
 |
REFERENCES |
| 1.
|
Alderson, M. R.,
T. W. Tough,
T. Davis-Smith,
S. Braddy,
B. Falk,
K. A. Schooley,
R. G. Goodwin,
C. A. Smith,
F. Ramsdell, and D. H. Lynch.
1995.
Fas ligand mediates activation-induced cell death in human T lymphocytes.
J. Exp. Med.
181:71-77[Abstract/Free Full Text].
|
| 2.
|
Aries, S.,
B. Scgaaf,
C. Muller,
R. Dennin, and K. Dalhoff.
1995.
Fas (CD95) expression of CD4+ T cells from HIV-infected patients increases with disease progression.
J. Mol. Med.
73:591-593[Medline].
|
| 3.
|
Azizkhan, J. C.,
D. E. Jensen,
A. J. Pierce, and M. Wade.
1993.
Transcription from TATA-less promoters: dihydrofolate reductase as a model.
Crit. Rev. Eukaryot. Gene Expr.
3:229-254[Medline].
|
| 4.
|
Banda, N. K.,
J. Bernier,
D. K. Kurahara,
R. Kurrle,
N. Haligwood,
R. P. Sekaly, and T. H. Finkel.
1992.
Crosslinking CD4 by human immunodeficiency virus gp120 primes T cells for activation-induced apoptosis.
J. Exp. Med.
176:1099-1106[Abstract/Free Full Text].
|
| 5.
|
Behrmann, I.,
H. Walczak, and P. H. Krammer.
1994.
Structure of the human APO-1 gene.
Eur. J. Immunol.
24:3057-3062[Medline].
|
| 6.
|
Boise, L. H.,
A. J. Minn,
P. J. Noel,
C. H. June,
M. A. Accavitti,
T. Lindsten, and C. B. Thompson.
1995.
CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-xL.
Immunity
3:87-98[Medline].
|
| 7.
|
Boldin, M. P.,
T. M. G. Goncharou,
Y. V. Goltsev, and D. Wallach.
1996.
Involvement of MACH1, a novel MORT1/FADD interacting protease, in Fas/APO-1 and TNF receptor-induced cell death.
Cell
85:803-815[Medline].
|
| 8.
|
Briant, L.,
N. Coudronniere,
V. Hebmann-Robert,
M. Benkirane, and C. Devaux.
1996.
Binding of HIV-1 virions or gp120-anti-gp120 immune complexes to HIV-1-infected quiescent peripheral blood mononuclear cells reveals latent infection.
J. Immunol.
156:3994-4004[Abstract].
|
| 9.
|
Chen, J. L.,
L. D. Attardi,
C. P. Verrijzer,
K. Yokomori, and R. Tjian.
1994.
Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators.
Cell
79:93-105[Medline].
|
| 10.
|
Chen, Z.,
J. P. Hagler,
V. F. Melandri,
B. D. Scherer, and T. Maniatis.
1995.
Signal-induced site-specific phosphorylation targets I B to the ubiquitin-proteasome pathway.
Genes Dev.
9:1586-1597[Abstract/Free Full Text].
|
| 11.
|
Chodish, L. A.
1989.
DNA-protein interactions, p. 12.2.1-12.2.10.
In
F. M. Ausubel, et al. (ed.), Current protocols in molecular biology, vol. 2. Greene Publishing Associates and Wiley-Interscience, New York, N.Y.
|
| 12.
|
Courey, A. J.,
D. A. Holtzman,
S. P. Jackson, and R. Tjian.
1989.
Synergistic activation by the glutamine-rich domains of human transcription factor Sp1.
Cell
59:827-836[Medline].
|
| 13.
|
Debatin, K.-M.,
D. Süss, and P. H. Krammer.
1994.
Differential expression of APO-1 on human thymocytes: implications for negative selection?
Eur. J. Immunol.
24:753-758[Medline].
|
| 14.
|
Dhein, J.,
H. Walczak,
C. Bäumler,
K. M. Debatin, and P. H. Krammer.
1995.
Autocrine T-cell suicide mediated by APO-1/(Fas/CD95).
Nature
373:438-441[Medline].
|
| 15.
|
Dignam, J.,
R. Lebovitz, and R. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 16.
|
Dinkel, A.,
W. K. Aicher,
C. Haas,
P. F. Zipfel,
H.-H. Peter, and H. Eibel.
1997.
Transcription factor Egr-1 activity down-regulates Fas and CD23 expression in B cells.
J. Immunol.
159:2678-2684[Abstract].
|
| 17.
|
Drappa, J.,
N. Brot, and K. B. Elkon.
1993.
The Fas protein is expressed at high levels on CD4+CD8+ thymocytes and activated mature lymphocytes in normal mice but not in the lupus-prone strain, MRL lpr/lpr.
Proc. Natl. Acad. Sci. USA
90:10340-10344[Abstract/Free Full Text].
|
| 18.
|
Fisher, G. H.,
F. J. Rosenberg,
S. E. Straus,
J. K. Dale,
L. A. Middleton,
A. Y. Lin,
W. Strober,
M. J. Lenardo, and J. M. Puck.
1995.
Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome.
Cell
81:935-946[Medline].
|
| 19.
|
Ghosh, G.,
G. V. Duyne,
S. Ghosh, and P. B. Sigler.
1995.
Structure of NF- B p50 homodimer bound to a B site.
Nature
373:303-310[Medline].
|
| 20.
|
Ghosh, S.,
M. J. May, and E. B. Kopp.
1998.
NF- B and Rel proteins: evolutionarily conserved mediators of immune responses.
Annu. Rev. Immunol.
16:225-260[Medline].
|
| 21.
|
Hirano, F.,
H. Tanaka,
Y. Hirano,
M. Hiramoto,
H. Handa,
I. Makino, and C. Scheidereit.
1998.
Functional interference of Sp1 and NF- B through the same DNA binding site.
Mol. Cell. Biol.
18:1266-1274[Abstract/Free Full Text].
|
| 22.
|
Irmler, M.,
M. Thome,
M. Hahne,
P. Schneider,
K. Hofmann,
V. Steiner,
J.-L. Bodmer,
M. Schröter,
K. Burns,
C. Mattmann,
D. Rimoldi,
L. E. French, and J. Tschopp.
1997.
Inhibition of death receptor signals by cellular FLIP.
Nature
388:190-195[Medline].
|
| 23.
|
Itoh, N.,
Y. Tsujimoto, and S. Nagata.
1993.
Effect of bcl-2 on Fas antigen-mediated cell death.
J. Immunol.
151:621-627[Abstract].
|
| 24.
|
Itoh, N.,
S. Yonehara,
A. Ishii,
M. Yonehara,
S. Mizushima,
M. Sameshima,
A. Hase,
Y. Seto, and S. Nagata.
1991.
The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis.
Cell
66:233-243[Medline].
|
| 25.
|
Jäättelä, M.,
M. Benedict,
M. Tewari,
J. A. Shayman, and V. M. Dixit.
1995.
Bcl-x and bcl-2 inhibit TNF and Fas-induced apoptosis and activation of phospholipase A2 in breast carcinoma cells.
Oncogene
10:2297-2305[Medline].
|
| 26.
|
Ju, S. T.,
D. J. Panka,
H. Cul,
R. Ettinger,
M. El-Khatib,
D. H. Sherr,
B. Z. Stanger, and A. Marshak-Rothstein.
1995.
Fas (CD95)/FasL interactions required for programmed cell death after T-cell activation.
Nature
373:444-448[Medline].
|
| 27.
|
Katsikis, P. D.,
E. S. Wunderlich,
C. A. Smith,
L. A. Herzenberg, and L. A. Herzenberg.
1995.
Fas antigen stimulation induces marked apoptosis of T lymphocytes in human immunodeficiency virus-infected individuals.
J. Exp. Med.
181:2029-2036[Abstract/Free Full Text].
|
| 28.
|
Kemper, O., and D. Wallach.
1993.
Cloning and partial characterization of the promoter for the human p55 tumor necrosis factor (TNF) receptor.
Gene
134:209-216[Medline].
|
| 29.
|
Kruys, V.,
O. Marinx,
G. Shaw,
J. Deschamps, and G. Huez.
1989.
Translational blockade imposed by cytokine-derived UA-rich sequences.
Science
245:852-855[Abstract/Free Full Text].
|
| 30.
|
Kunsch, C.,
S. M. Ruben, and C. A. Rosen.
1992.
Selection of optimal B/Rel DNA-binding motifs: interaction of both subunits of NF- B with DNA is required for transcriptional activation.
Mol. Cell. Biol.
12:4412-4421[Abstract/Free Full Text].
|
| 31.
|
Kwon, H.,
N. Pelletier,
C. DeLuca,
P. Genin,
S. Cisternas,
R. Lin,
M. A. Wainberg, and J. Hiscott.
1998.
Inducible expression of I B repressor mutants interferes with NF- B activity and HIV-1 replication in Jurkat T cells.
J. Biol. Chem.
273:7431-7440[Abstract/Free Full Text].
|
| 32.
|
Lai, J.-H.,
G. Horvath,
J. Subleski,
J. Bruder,
P. Ghosh, and T.-H. Tan.
1995.
RelA is a potent transcriptional activator of the CD28 response element within the interleukin 2 promoter.
Mol. Cell. Biol.
15:4260-4271[Abstract].
|
| 33.
|
Leithäuser, F.,
J. Dhein,
G. Mechtersheimer,
K. Koretz,
S. Brüderlein,
C. Henne,
A. Schmidt,
K.-M. Debatin,
P. H. Krammer, and P. Möller.
1993.
Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells.
Lab. Investig.
69:415-429[Medline].
|
| 34.
|
Leverkus, M.,
M. Yaar, and B. A. Gilchrest.
1997.
Fas/Fas ligand interaction contributes to UV-induced apoptosis in human keratinocytes.
Exp. Cell Res.
232:255-262[Medline].
|
| 35.
|
Locker, J.
1996.
Transcription factors essential data.
John Wiley & Sons, Chichester, West Sussex, United Kingdom.
|
| 36.
|
Marienfeld, R.,
M. Neumann,
S. Chuvpilo,
C. Escher,
B. Kneitz,
A. Avots,
A. Schimpl, and E. Serfling.
1997.
Cyclosporin A interferes with the inducible degradation of NF- B inhibitors, but not with the processing of p105/NF B1 in T cells.
Eur. J. Immunol.
27:1601-1609[Medline].
|
| 37.
|
Miyawaki, T.,
T. Uehara,
R. Nibu,
T. Tsuji,
A. Yachie,
S. Yonehara, and N. Taniguchi.
1992.
Differential expression of apoptosis-related Fas antigen on lymphocyte subpopulations in human peripheral blood.
J. Immunol.
149:3753-3758[Abstract].
|
| 38.
|
Müller, C. W.,
F. A. Rey,
M. Sodeoka,
G. L. Verdine, and S. C. Harrison.
1995.
Structure of the NF- B p50 homodimer bound to DNA.
Nature
373:311-317[Medline].
|
| 39.
|
Müller, M.,
S. Strand,
H. Hug,
E.-M. Heinemann,
H. Walczak,
W. J. Hoffmann,
W. Stremmel,
P. H. Krammer, and P. R. Galle.
1997.
Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild-type p53.
J. Clin. Investig.
99:403-413[Medline].
|
| 40.
|
Muzio, M.,
A. M. Chinnaiyan,
F. C. Kischkel,
K. O'Rourke,
A. Shevchenko,
J. Ni,
C. Scaffidi,
J. D. Bretz,
M. Zhang,
R. Gentz,
M. Mann,
P. H. Krammer,
M. E. Peter, and V. M. Dixit.
1996.
FLICE, a novel FADD-homologous ICE/Ced-3-like protease, is recruited to the CD95 (Fas/APO-1) death inducing signaling complex.
Cell
85:817-827[Medline].
|
| 41.
|
Nagata, S.
1997.
Apoptosis by death factor.
Cell
88:355-365[Medline].
|
| 42.
|
Neish, A. S.,
L. M. Khachigian,
A. Park,
V. R. Baichwal, and T. Collins.
1995.
Sp1 is a component of the cytokine-inducible enhancer in the promoter of vascular cell adhesion molecule-1.
J. Biol. Chem.
270:28903-28909[Abstract/Free Full Text].
|
| 43.
|
Owen-Schaub, L. B.,
R. Radinsky,
E. Kruzel,
K. Berry, and S. Yonehara.
1994.
Anti-Fas on nonhematopoietic tumors: levels of Fas/APO-1 and bcl-2 are not predictive of biological responsiveness.
Cancer Res.
54:1580-1586[Abstract/Free Full Text].
|
| 44.
|
Owen-Schaub, L. B.,
S. Yonehara,
W. L. Crump, and E. A. Grimm.
1992.
DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement.
Cell. Immunol.
140:197-205[Medline].
|
| 45.
|
Owen-Schaub, L. B.,
W. Zhang,
J. C. Cusack,
L. S. Angelo,
S. M. Santee,
T. Fujiwara,
J. A. Roth,
A. B. Deisseroth,
W.-W. Zhang,
E. Kruzel, and R. Radinsky.
1995.
Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression.
Mol. Cell. Biol.
15:3032-3040[Abstract].
|
| 46.
|
Pahl, H. L.,
B. Kraub,
K. Schulze-Osthoff,
T. Decker,
E. B.-M. Traenckner,
M. Vogt,
C. Myers,
T. Parks,
P. Warring,
A. Mühlbacher,
A. P. Czernilofsky, and P. A. Baeuerle.
1996.
The immunosuppressive fungal metabolite gliotoxin specifically inhibits transcription factor NF- B.
J. Exp. Med.
183:1829-1840[Abstract/Free Full Text].
|
| 47.
|
Park, C. G.,
S. Y. Lee,
G. Kandala,
S. Y. Lee, and Y. Choi.
1996.
A novel gene product that couples TCR signaling to Fas(CD95) expression in activation-induced cell death.
Immunity
4:583-591[Medline].
|
| 48.
|
Parry, G. C., and N. Mackman.
1994.
A set of inducible genes expressed by activated human monocytic and endothelial cells contain B-like sites that specifically bind c-Rel-p65 heterodimers.
J. Biol. Chem.
269:20823-20825[Abstract/Free Full Text].
|
| 49.
|
Pavletich, N. P., and C. O. Pabo.
1991.
Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 Å.
Science
252:809-817[Abstract/Free Full Text].
|
| 50.
|
Perkins, N. D.,
N. L. Edwards,
C. S. Duckett,
A. B. Agranoff,
R. M. Schmid, and G. J. Nabel.
1993.
A cooperative interaction between NF- B and Sp1 is required for HIV-1 enhancer activation.
EMBO J.
12:3551-3558[Medline].
|
| 51.
|
Rothe, J.,
H. Bluethmann,
R. Gentz,
W. Lesslauer, and M. Steinmetz.
1993.
Genomic organization and promoter function of the murine tumor necrosis factor receptor gene.
Mol. Immunol.
30:165-175[Medline].
|
| 52.
|
Santee, S. M., and L. B. Owen-Schaub.
1996.
Human tumor necrosis factor receptor p75/80 (CD120b) gene structure and promoter characterization.
J. Biol. Chem.
271:21151-21159[Abstract/Free Full Text].
|
| 53.
|
Sato, T.,
S. Irie,
S. Kitada, and J. C. Reed.
1995.
FAP-1: A protein tyrosine phosphatase that associates with Fas.
Science
268:411-415[Abstract/Free Full Text].
|
| 54.
|
Sehgal, A.,
N. Patil, and M. Chao.
1988.
A constitutive promoter directs expression of the nerve growth factor receptor gene.
Mol. Cell. Biol.
8:3160-3167[Abstract/Free Full Text].
|
| 55.
|
Shaw, G., and R. Kamen.
1986.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:659-667[Medline].
|
| 56.
|
Sherka, C.,
E. L. Decker, and P. F. Zipfel.
1995.
A regulatory element in the human interleukin 2 gene promoter is a binding site for the zinc finger proteins Sp1 and EGR-1.
J. Biol. Chem.
270:22500-22506[Abstract/Free Full Text].
|
| 57.
|
Sjottem, E.,
C. Andersen, and T. Johansen.
1997.
Structural and functional analyses of DNA bending induced by Sp1 family transcription factors.
J. Mol. Biol.
267:490-504[Medline].
|
| 58.
|
Stein, B.,
A. S. Baldwin, Jr.,
D. W. Ballard,
W. C. Greene,
P. Angel, and P. Herrlich.
1993.
Cross-coupling of the NF- B p65 and Fos/Jun transcription factors produces potentiated biological function.
EMBO J.
12:3879-3891[Medline].
|
| 59.
|
Suzuki, I., and P. J. Fink.
1998.
Maximal proliferation of cytotoxic T lymphocytes requires reverse signaling through Fas ligand.
J. Exp. Med.
187:123-128[Abstract/Free Full Text].
|
| 60.
|
Takahashi, T.,
M. Tanaka,
C. I. Brannan,
N. A. Jenkins,
N. G. Copeland,
T. Suda, and S. Nagata.
1994.
Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand.
Cell
76:969-976[Medline].
|
| 61.
|
Tanaka, M.,
H. Ito,
S. Adachi,
H. Akimoto,
T. Nishikawa,
T. Kasajima,
F. Marumo, and M. Hiroe.
1994.
Hypoxia induces apoptosis with enhanced expression of Fas antigen messenger RNA in cultured neonatal rat cardiomyocytes.
Circ. Res.
75:426-433[Abstract/Free Full Text].
|
| 62.
|
Thanos, D., and T. Maniatis.
1992.
The high mobility group protein HMG I(Y) is required for NF- B-dependent virus induction of the human IFN- gene.
Cell
71:777-789[Medline].
|
| 63.
|
van Parijs, L.,
A. Ibraghimov, and A. K. Abbas.
1996.
The roles of costimulation and Fas in T-cell apoptosis and peripheral tolerance.
Immunity
4:321-326[Medline].
|
| 64.
|
Verma, I. M.,
J. K. Stevenson,
E. M. Schwartz,
D. Van Antwerp, and S. Miyamoto.
1995.
Rel/NF- B/I B family: intimate tales of association and dissociation.
Genes Dev.
9:2723-2735[Free Full Text].
|
| 65.
|
Watanabe-Fukunaga, R.,
C. I. Brannan,
N. G. Copeland,
N. A. Jenkins, and S. Nagata.
1992.
Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis.
Nature
356:314-317[Medline].
|
Molecular and Cellular Biology, March 1999, p. 2098-2108, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Le Clorennec, C., Ouk, T.-S., Youlyouz-Marfak, I., Panteix, S., Martin, C.-C., Rastelli, J., Adriaenssens, E., Zimber-Strobl, U., Coll, J., Feuillard, J., Jayat-Vignoles, C.
(2008). Molecular Basis of Cytotoxicity of Epstein-Barr Virus (EBV) Latent Membrane Protein 1 (LMP1) in EBV Latency III B Cells: LMP1 Induces Type II Ligand-Independent Autoactivation of CD95/Fas with Caspase 8-Mediated Apoptosis. J. Virol.
82: 6721-6733
[Abstract]
[Full Text]
-
Huang, Z., Wang, R., Xie, H., Shang, W., Manicassamy, S., Sun, Z.
(2008). Stabilized {beta}-Catenin Potentiates Fas-Mediated T Cell Apoptosis. J. Immunol.
180: 6586-6592
[Abstract]
[Full Text]
-
Park, J.-W., Kim, H. P., Lee, S.-J., Wang, X., Wang, Y., Ifedigbo, E., Watkins, S. C., Ohba, M., Ryter, S. W., Vyas, Y. M., Choi, A. M. K.
(2008). Protein Kinase C{alpha} and {zeta} Differentially Regulate Death-Inducing Signaling Complex Formation in Cigarette Smoke Extract-Induced Apoptosis. J. Immunol.
180: 4668-4678
[Abstract]
[Full Text]
-
Rujkijyanont, P., Watanabe, K.-i., Ambekar, C., Wang, H., Schimmer, A., Beyene, J., Dror, Y.
(2008). SBDS-deficient cells undergo accelerated apoptosis through the Fas-pathway. haematol
93: 363-371
[Abstract]
[Full Text]
-
Juan, S.-H., Chen, C.-H., Hsu, Y.-H., Hou, C.-C., Chen, T.-H., Lin, H., Chu, Y.-L., Sue, Y.-M.
(2007). Tetramethylpyrazine protects rat renal tubular cell apoptosis induced by gentamicin. Nephrol Dial Transplant
22: 732-739
[Abstract]
[Full Text]
-
Mentaverri, R., Yano, S., Chattopadhyay, N., Petit, L., Kifor, O., Kamel, S., Terwilliger, E. F., Brazier, M., Brown, E. M.
(2006). The calcium sensing receptor is directly involved in both osteoclast differentiation and apoptosis. FASEB J.
20: 2562-2564
[Abstract]
[Full Text]
-
Mao, X., Moerman-Herzog, A. M., Wang, W., Barger, S. W.
(2006). Differential Transcriptional Control of the Superoxide Dismutase-2 {kappa}B Element in Neurons and Astrocytes. J. Biol. Chem.
281: 35863-35872
[Abstract]
[Full Text]
-
Lu, B., Wang, L., Stehlik, C., Medan, D., Huang, C., Hu, S., Chen, F., Shi, X., Rojanasakul, Y.
(2006). Phosphatidylinositol 3-Kinase/Akt Positively Regulates Fas (CD95)-Mediated Apoptosis in Epidermal Cl41 Cells.. J. Immunol.
176: 6785-6793
[Abstract]
[Full Text]
-
Huang, C., Bi, E., Hu, Y., Deng, W., Tian, Z., Dong, C., Hu, Y., Sun, B.
(2006). A Novel NF-{kappa}B Binding Site Controls Human Granzyme B Gene Transcription. J. Immunol.
176: 4173-4181
[Abstract]
[Full Text]
-
Ivanov, V. N., Ronai, Z., Hei, T. K.
(2006). Opposite Roles of FAP-1 and Dynamin in the Regulation of Fas (CD95) Translocation to the Cell Surface and Susceptibility to Fas Ligand-mediated Apoptosis. J. Biol. Chem.
281: 1840-1852
[Abstract]
[Full Text]
-
Ross, M. J., Martinka, S., D'Agati, V. D., Bruggeman, L. A.
(2005). NF-{kappa}B Regulates Fas-Mediated Apoptosis in HIV-Associated Nephropathy. J. Am. Soc. Nephrol.
16: 2403-2411
[Abstract]
[Full Text]
-
Guicciardi, M E, Gores, G J
(2005). Apoptosis: a mechanism of acute and chronic liver injury. Gut
54: 1024-1033
[Full Text]
-
Gopalan, B., Litvak, A., Sharma, S., Mhashilkar, A. M., Chada, S., Ramesh, R.
(2005). Activation of the Fas-FasL Signaling Pathway by MDA-7/IL-24 Kills Human Ovarian Cancer Cells. Cancer Res.
65: 3017-3024
[Abstract]
[Full Text]
-
Chang, L.-C., Madsen, S. A, Toelboell, T., Weber, P. S D, Burton, J. L
(2004). Effects of glucocorticoids on Fas gene expression in bovine blood neutrophils. J Endocrinol
183: 569-583
[Abstract]
[Full Text]
-
Wurzer, W. J., Ehrhardt, C., Pleschka, S., Berberich-Siebelt, F., Wolff, T., Walczak, H., Planz, O., Ludwig, S.
(2004). NF-{kappa}B-dependent Induction of Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) and Fas/FasL Is Crucial for Efficient Influenza Virus Propagation. J. Biol. Chem.
279: 30931-30937
[Abstract]
[Full Text]
-
Ivanov, V. N., Hei, T. K.
(2004). Arsenite Sensitizes Human Melanomas to Apoptosis via Tumor Necrosis Factor {alpha}-mediated Pathway. J. Biol. Chem.
279: 22747-22758
[Abstract]
[Full Text]
-
Chandrasekar, B., Vemula, K., Surabhi, R. M., Li-Weber, M., Owen-Schaub, L. B., Jensen, L. E., Mummidi, S.
(2004). Activation of Intrinsic and Extrinsic Proapoptotic Signaling Pathways in Interleukin-18-mediated Human Cardiac Endothelial Cell Death. J. Biol. Chem.
279: 20221-20233
[Abstract]
[Full Text]
-
Xiao, S., Zhang, X., Mann, K. K., Jodo, S., Li, L., Jarjour, W. N., Marshak-Rothstein, A., Sherr, D. H., Ju, S.-T.
(2004). Changes in sensitivity of peripheral lymphocytes of autoimmune gld mice to FasL-mediated apoptosis reveal a mechanism for the preferential deletion of CD4-CD8-B220+ T cells. Int Immunol
16: 759-766
[Abstract]
[Full Text]
-
Huang, Y., Fang, Y., Wu, J., Dziadyk, J. M., Zhu, X., Sui, M., Fan, W.
(2004). Regulation of Vinca alkaloid-induced apoptosis by NF-{kappa}B/I{kappa}B pathway in human tumor cells. Molecular Cancer Therapeutics
3: 271-277
[Abstract]
[Full Text]
-
Hilgendorf, A., Lindberg, J., Ruzsics, Z., Honing, S., Elsing, A., Lofqvist, M., Engelmann, H., Burgert, H.-G.
(2003). Two Distinct Transport Motifs in the Adenovirus E3/10.4-14.5 Proteins Act in Concert to Down-modulate Apoptosis Receptors and the Epidermal Growth Factor Receptor. J. Biol. Chem.
278: 51872-51884
[Abstract]
[Full Text]
-
Sheard, M. A., Uldrijan, S., Vojtesek, B.
(2003). Role of p53 in Regulating Constitutive and X-Radiation-Inducible CD95 Expression and Function in Carcinoma Cells. Cancer Res.
63: 7176-7184
[Abstract]
[Full Text]
-
Park, S.-M., Park, H.-Y., Lee, T. H.
(2003). Functional Effects of TNF-{alpha} on a Human Follicular Dendritic Cell Line: Persistent NF-{kappa}B Activation and Sensitization for Fas-Mediated Apoptosis. J. Immunol.
171: 3955-3962
[Abstract]
[Full Text]
-
Tabruyn, S. P., Sorlet, C. M., Rentier-Delrue, F., Bours, V., Weiner, R. I., Martial, J. A., Struman, I.
(2003). The Antiangiogenic Factor 16K Human Prolactin Induces Caspase-Dependent Apoptosis by a Mechanism that Requires Activation of Nuclear Factor-{kappa}B. Mol. Endocrinol.
17: 1815-1823
[Abstract]
[Full Text]
-
Fukui, M., Imamura, R., Umemura, M., Kawabe, T., Suda, T.
(2003). Pathogen-Associated Molecular Patterns Sensitize Macrophages to Fas Ligand-Induced Apoptosis and IL-1{beta} Release. J. Immunol.
171: 1868-1874
[Abstract]
[Full Text]
-
Herr, I., Ucur, E., Herzer, K., Okouoyo, S., Ridder, R., Krammer, P. H., von Knebel Doeberitz, M., Debatin, K.-M.
(2003). Glucocorticoid Cotreatment Induces Apoptosis Resistance toward Cancer Therapy in Carcinomas. Cancer Res.
63: 3112-3120
[Abstract]
[Full Text]
-
Rajakangas, J., Basu, S., Salminen, I., Mutanen, M.
(2003). Adenoma Growth Stimulation by the trans-10, cis-12 Isomer of Conjugated Linoleic Acid (CLA) Is Associated with Changes in Mucosal NF-{kappa}B and Cyclin D1 Protein Levels in the Min Mouse. J. Nutr.
133: 1943-1948
[Abstract]
[Full Text]
-
Mahr, J. A., Boss, J. M., Gooding, L. R.
(2002). The Adenovirus E3 Promoter Is Sensitive to Activation Signals in Human T Cells. J. Virol.
77: 1112-1119
[Abstract]
[Full Text]
-
Lorenzo, E., Ruiz-Ruiz, C., Quesada, A. J., Hernandez, G., Rodriguez, A., Lopez-Rivas, A., Redondo, J. M.
(2002). Doxorubicin Induces Apoptosis and CD95 Gene Expression in Human Primary Endothelial Cells through a p53-dependent Mechanism. J. Biol. Chem.
277: 10883-10892
[Abstract]
[Full Text]
-
Ivanov, V. N., Krasilnikov, M., Ronai, Z.'e.
(2002). Regulation of Fas Expression by STAT3 and c-Jun Is Mediated by Phosphatidylinositol 3-Kinase-AKT Signaling. J. Biol. Chem.
277: 4932-4944
[Abstract]
[Full Text]
-
Zhang, B., Prendergast, G. C., Fenton, R. G.
(2002). Farnesyltransferase Inhibitors Reverse Ras-mediated Inhibition of Fas Gene Expression. Cancer Res.
62: 450-458
[Abstract]
[Full Text]
-
Herr, I., Debatin, K.-M.
(2001). Cellular stress response and apoptosis in cancer therapy. Blood
98: 2603-2614
[Abstract]
[Full Text]
-
TEGEDER, I., PFEILSCHIFTER, J., GEISSLINGER, G.
(2001). Cyclooxygenase-independent actions of cyclooxygenase inhibitors. FASEB J.
15: 2057-2072
[Abstract]
[Full Text]
-
Kreuz, S., Siegmund, D., Scheurich, P., Wajant, H.
(2001). NF-{kappa}B Inducers Upregulate cFLIP, a Cycloheximide-Sensitive Inhibitor of Death Receptor Signaling. Mol. Cell. Biol.
21: 3964-3973
[Abstract]
[Full Text]
-
Zheng, Y., Ouaaz, F., Bruzzo, P., Singh, V., Gerondakis, S., Beg, A. A.
(2001). NF-{{kappa}}B RelA (p65) Is Essential for TNF-{{alpha}}-Induced Fas Expression but Dispensable for Both TCR-Induced Expression and Activation-Induced Cell Death. J. Immunol.
166: 4949-4957
[Abstract]
[Full Text]
-
Inan, M. S., Tolmacheva, V., Wang, Q.-S., Rosenberg, D. W., Giardina, C.
(2000). Transcription factor NF-kappa B participates in regulation of epithelial cell turnover in the colon. Am. J. Physiol. Gastrointest. Liver Physiol.
279: G1282-G1291
[Abstract]
[Full Text]
-
Ouhtit, A., Gorny, A., Muller, H. K., Hill, L. L., Owen-Schaub, L., Ananthaswamy, H. N.
(2000). Loss of Fas-Ligand Expression in Mouse Keratinocytes during UV Carcinogenesis. Am. J. Pathol.
157: 1975-1981
[Abstract]
[Full Text]
-
Eichhorst, S. T., Müller, M., Li-Weber, M., Schulze-Bergkamen, H., Angel, P., Krammer, P. H.
(2000). A Novel AP-1 Element in the CD95 Ligand Promoter Is Required for Induction of Apoptosis in Hepatocellular Carcinoma Cells upon Treatment with Anticancer Drugs. Mol. Cell. Biol.
20: 7826-7837
[Abstract]
[Full Text]
-
Houghton, J., Macera-Bloch, L. S., Harrison, L., Kim, K. H., Korah, R. M.
(2000). Tumor Necrosis Factor Alpha and Interleukin 1beta Up-Regulate Gastric Mucosal Fas Antigen Expression in Helicobacter pylori Infection. Infect. Immun.
68: 1189-1195
[Abstract]
[Full Text]
-
Kuhnel, F., Zender, L., Paul, Y., Tietze, M. K., Trautwein, C., Manns, M., Kubicka, S.
(2000). NFkappa B Mediates Apoptosis through Transcriptional Activation of Fas (CD95) in Adenoviral Hepatitis. J. Biol. Chem.
275: 6421-6427
[Abstract]
[Full Text]
-
Chen, F., Demers, L. M., Vallyathan, V., Lu, Y., Castranova, V., Shi, X.
(1999). Involvement of 5'-Flanking kappa B-like Sites within bcl-x Gene in Silica-induced Bcl-x Expression. J. Biol. Chem.
274: 35591-35595
[Abstract]
[Full Text]
-
Li, X. R., Chong, A. S.-F., Wu, J., Roebuck, K. A., Kumar, A., Parrillo, J. E., Rapp, U. R., Kimberly, R. P., Williams, J. W., Xu, X.
(1999). Transcriptional Regulation of Fas Gene Expression by GA-binding Protein and AP-1 in T Cell Antigen Receptor{middle dot}CD3 Complex-stimulated T Cells. J. Biol. Chem.
274: 35203-35210
[Abstract]
[Full Text]
-
Roux, P. P., Colicos, M. A., Barker, P. A., Kennedy, T. E.
(1999). p75 Neurotrophin Receptor Expression Is Induced in Apoptotic Neurons After Seizure. J. Neurosci.
19: 6887-6896
[Abstract]
[Full Text]
-
Hill, L. L., Ouhtit, A., Loughlin, S. M., Kripke, M. L., Ananthaswamy, H. N., Owen-Schaub, L. B.
(1999). Fas Ligand: A Sensor for DNA Damage Critical in Skin Cancer Etiology. Science
285: 898-900
[Abstract]
[Full Text]
-
Giannoukakis, N., Rudert, W. A., Trucco, M., Robbins, P. D.
(2000). Protection of Human Islets from the Effects of Interleukin-1beta by Adenoviral Gene Transfer of an Ikappa B Repressor. J. Biol. Chem.
275: 36509-36513
[Abstract]
[Full Text]
-
Laniel, M.-A., Poirier, G. G., Guerin, S. L.
(2001). Nuclear Factor 1 Interferes with Sp1 Binding through a Composite Element on the Rat Poly(ADP-ribose) Polymerase Promoter to Modulate Its Activity in Vitro. J. Biol. Chem.
276: 20766-20773
[Abstract]
[Full Text]