Previous Article | Next Article 
Molecular and Cellular Biology, March 1999, p. 2189-2197, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Caenorhabditis elegans Sex
Determination Gene mog-1 Encodes a Member of the DEAH-Box
Protein Family
Alessandro
Puoti1,
and
Judith
Kimble1,2,3,4,*
Departments of
Biochemistry1 and Medical
Genetics,2 Laboratory of Molecular
Biology,3 and Howard Hughes Medical
Institute,4 University of Wisconsin
Madison,
Madison, Wisconsin 53706
Received 31 August 1998/Returned for modification 4 November
1998/Accepted 8 December 1998
 |
ABSTRACT |
In the Caenorhabditis elegans hermaphrodite germ line,
the sex-determining gene fem-3 is repressed
posttranscriptionally to arrest spermatogenesis and permit oogenesis.
This repression requires a cis-acting regulatory element in
the fem-3 3' untranslated region; the FBF protein, which
binds to this element; and at least six mog genes. In this
paper, we report the molecular characterization of mog-1 as
well as additional phenotypic characterization of this gene. The
mog-1 gene encodes a member of the DEAH-box family. Three
mog-1 alleles possess premature stop codons and are likely to be null alleles, and one is a missense mutation and is likely to
retain residual activity. mog-1 mRNA is expressed in both
germ line and somatic tissues and appears to be ubiquitous. The MOG-1 DEAH-box protein is most closely related to proteins essential for
splicing in the yeast Saccharomyces cerevisiae, but
splicing appears to occur normally in a mog-1-null mutant.
In addition to its involvement in the sperm-oocyte switch and control
of fem-3, zygotic mog-1 is required for robust
germ line proliferation and for normal growth during development. We
suggest that mog-1 plays a broader role in RNA regulation
than previously considered.
 |
INTRODUCTION |
Posttranscriptional controls of gene
expression are critical for many aspects of animal development but are
poorly understood at the molecular level (see, e.g., reference
45). In many cases, posttranscriptional controls are
exerted through cis-acting elements in the untranslated
regions (UTRs) of regulated mRNAs. Such regulatory cis-acting elements have been identified in a variety of
organisms ranging from yeasts to vertebrates. Therefore, the mechanisms by which UTR-mediated controls of gene expression are exerted may be
conserved throughout evolution.
Posttranscriptional controls are pivotal for sex determination in the
Caenorhabditis elegans hermaphrodite germ line.
Hermaphrodites make about 300 sperm before switching to oogenesis. The
specification of a germ cell as sperm or oocyte is controlled by
virtually the same sex determination pathway that regulates sexual
fates throughout the organism (for a review, see reference
40). For the purposes of this report, only two
sex-determining genes need to be mentioned. The tra-2 gene
promotes female development and is repressed at the translational level
to permit spermatogenesis in hermaphrodites (11, 17, 21);
the fem-3 gene promotes male development and is repressed
posttranscriptionally for the switch from spermatogenesis to oogenesis
(1, 4, 20). This minicascade of posttranscriptional controls
is essential for the transient generation of sperm.
The posttranscriptional repression of fem-3 relies on a
cis-acting regulatory element in its 3' UTR, dubbed the PME
(for point mutation element) (1, 4, 15). In fem-3
gain-of-function (gf) mutants, single nucleotide changes in
the PME relieve fem-3 repression and abrogate the normal
switch from spermatogenesis to oogenesis. Therefore, in
fem-3(gf) mutants, no oocytes are produced;
instead, sperm are made continuously and to great excess. To identify
trans-acting factors that repress fem-3 via its
3' UTR, both genetic and molecular approaches have been taken. A genetic screen for recessive mutations that cause failure of the sperm-oocyte switch identified six mog (for masculinization
of the germ line) genes (18, 19), while a yeast three-hybrid screen for PME-binding proteins yielded FBF (for fem-3
binding factor), a homolog of Drosophila Pumilio that binds
specifically to the fem-3 PME regulatory element
(46). FBF is encoded by one of two nearly identical genes,
fbf-1 and fbf-2, and therefore is not likely to
have been identified in the genetic screens for mog mutants.
Among the various mog genes, mog-1 is best
characterized genetically (18). Four mog-1
alleles were isolated, and null mutants were identified by genetic
tests. The mog-1 gene is required zygotically for the
sperm-oocyte switch, a rather specific developmental function, and
maternally for embryogenesis (18). Using double-mutant
analysis, mog-1 was placed upstream of fem-3 and,
therefore, in a reasonable genetic position to function as a
fem-3 repressor. However, the genetic position of
mog-1 also lies upstream of fem-1,
fem-2, fog-1, and fog-3, four other
genes required for the specification of germ cells as sperm (12,
18). Therefore, mog-1 might regulate any of these
genes to effect the sperm-oocyte switch. To more carefully examine the
relationship between the mog genes and fem-3 repression, a reporter transgene bearing the fem-3 3' UTR
was constructed (15). In wild-type animals, this reporter is
poorly expressed, whereas it is derepressed in a mog mutant
background. Therefore, the mog genes are required for
fem-3 3' UTR repression, and their further analysis is
likely to provide insight into the mechanism by which the
fem-3 3' UTR repression is exerted.
In this study, we determined that the mog-1 gene encodes a
protein with a DEAH motif typical of RNA helicases and that this protein is most similar to the yeast splicing factors PRP2, PRP16, PRP22, and PRP43 and the human splicing factors hPRP16 and HRH1 (2, 7, 9, 32, 42, 47). However, we found that
mog-1 does not appear to be necessary for general pre-mRNA splicing.
 |
MATERIALS AND METHODS |
Transformation rescue of mog-1.
Cosmids within the
region spanning sqv-3 and stP127 were
microinjected in pools (10 ng of the cosmids to be tested/ml plus 100 ng of pRF4 roller DNA/ml) into young hermaphrodites of genotype mog-1(q223) unc-69(e587)/eT1 (cosmids were kindly provided
by A. Coulson). F1 progeny were scored for rollers as well
as for fertile Uncs. Since the Unc-69 phenotype is very strong, Unc
rollers were difficult to score and had to be backcrossed into wild
type (N2) to verify the presence of the roller array. A pool containing cosmids ZK757, ZK765, F40F12, and K03H1 rescued the Mog phenotype, although rescue was poor (approximately 5% of the Unc rollers were
fertile). Single-cosmid transformations led to the identification of
K03H1 as the rescuing cosmid. Subclones of K03H1 were used to identify
an 8.2-kb fragment with two predicted genes; further subcloning and
deletion analysis identified pJK600, a 6.17-kb genomic fragment that
contains mog-1 rescuing activity. pJK600 is predicted to
encode one transcript of 3.6 kb. Rescue by pJK600 was confirmed by
coinjection of 70 ng of sonication-fragmented Haemophilus
influenzae genomic DNA/ml (13), 30 ng of pRF4/µl, and
8 ng of pJK600/µl. H. influenzae carrier DNA improved
mog-1 rescue of fertile Unc-69 rollers from 5 to 80% in
F1 and led to the development of stable lines.
Isolation of cDNA clones.
A C. elegans cDNA
library (
RB1; provided by R. Barstead) was screened by standard
procedures (39) with a 1,014-nucleotide (nt) genomic
fragment of mog-1 covering the portion corresponding to
amino acids 38 to 341 of the predicted polypeptide (see Fig. 2A). Of
150,000 clones screened, a single positive clone corresponding to a
full-length cDNA was isolated. The 3.6-kb cDNA was cloned into the
pBluescript KS(+) vector (Stratagene) and sequenced by the chain
termination reaction. Not a single difference was found between the
sequence of the actual cDNA clone and that predicted by the C. elegans genome project.
RNA extraction, reverse transcription (RT)-PCR, and Northern
analysis.
C. elegans was synchronized and grown at 20°C on
seeded plates until the desired stage was reached, washed with M9
medium, pelleted, frozen in liquid nitrogen, and stored at
70°C.
The different developmental stages were checked by monitoring vulval or
germ line development (23). The frozen pellet was quickly homogenized in a solution containing 20 mM Tris-HCl (pH 7.5), 0.5%
sodium dodecyl sulfate (SDS), 1 mM EDTA, 100 mM NaCl, and 200 µg/ml
of proteinase K (Boehringer Mannheim), using a Polytron homogenizer,
and incubated for 1 h at 37°C. The salt concentration was
adjusted to 500 mM, and 50 to 100 mg of oligo(dT) cellulose (Pharmacia)
was added. After a 2-h incubation at room temperature under conditions
of gentle rotation, the resin was washed in a solution consisting of 20 mM Tris-HCl (pH 7.5), 0.5% SDS, 1 mM EDTA, and 500 mM NaCl and the
poly(A)+ RNA was eluted in a solution containing 20 mM
Tris-HCl (pH 7.5), 0.5% SDS, 1 mM EDTA. Typical yields were 100 µg
of poly(A)+-enriched RNA per 1 ml of worm pellet. The RNA
was precipitated overnight at
20°C in 0.1 volume of 3 M sodium
acetate (pH 5.5) and 2.5 volumes of absolute ethanol.
To extract total RNA, worms were frozen as described above and
homogenized, with a Polytron homogenizer, in a mixture containing 4 M
guanidine thiocyanate, 25 mM EDTA, 1% sodium N-lauroyl
sarcosine, and 50 mM Tris-HCl at pH 7.5. After several extractions with
phenol-chloroform, nucleic acids were precipitated as described above.
The pellet was resuspended in 10 mM EDTA, and total RNA was
precipitated in 2.5 M lithium acetate for 2 h on ice. The RNA
pellet was resuspended in 10 mM EDTA and reprecipitated.
Single-stranded cDNA was synthesized by using 2 µg of
poly(A)+ or total RNA and 2 µg or 100 ng of oligo(dT) or
random primers (Gibco BRL), respectively. The RNA and primers were
heated to 70°C and shifted to 37 to 40°C. A mixture containing 50 mM Tris-HCl (pH 7.0), 75 mM KCl, 3 mM MgCl2, 10 mM
dithiothreitol, 2.5 mM deoxynucleoside triphosphates, and Superscript
II reverse transcriptase (200 to 400 U; Gibco BRL) was added, and the
samples were incubated at 37 to 40°C for 1 h.
PCR was performed on 750 pg of genomic DNA or 2.2 ng of
oligo(dT)-primed single-stranded cDNA from wild-type worms for positive controls (see Figure 6B, lanes 2, 3, 6 and 7). One-twentieth of a
sample corresponding to, initially, 1.5 µg of total RNA from smg-1; mog-1 adults was used as a template for
controls. PCR conditions were 33 cycles of 94°C for 1 min, 57°C for
2 min, 72°C for 2 min. All reaction products were run on a 1.5%
agarose gel in Tris-borate-EDTA. The sequences of the primers used are
as follows: 5' ATGGAGGTGGATCCGGGTT 3' and 5'
TCGTTTCCTGGAGCAATCAG 3' for fem-3 and 5'
AGGGATTGACAGTTATCCG 3' and 5' GCCGTGACTACCGGAAG 3' for
fbf-2.
For Northern analysis, 3 µg of poly(A)+ or 10 µg of
total RNA was denatured, run on a 1.2% denaturing agarose-glyoxal gel
in 10 mM sodium phosphate (pH 7.0), and transferred to a Hybond-N nylon
membrane (Amersham) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate). Blots were UV cross-linked, baked for 2 h at
80°C, and prehybridized overnight at 42°C in a solution containing
50% formamide, 5× SSC, 0.1% SDS, 5× Denhardt's solution, and 150 µg of denatured salmon sperm DNA/ml. Hybridization was performed for
16 h at 42°C in a solution consisting of 20 to 35% formamide,
5× SSC, 1% SDS, 2× Denhardt's solution, and 150 µg of denatured
salmon sperm DNA/ml. Blots were washed in 1× to 2× SSC at 42 to
50°C and exposed at
70°C.
GFP reporter experiments.
An EcoRV site was
engineered in pJK600 by site-directed mutagenesis of the hexanucleotide
GGTCTT located 3 nt upstream of the mog-1 stop
codon. A 1,010-nt genomic fragment of green fluorescent protein (GFP)
was cloned in frame into the EcoRV site. The actual stop
codon of the fusion construct is the GFP stop codon. The 3' UTR and its
flanking sequences were those of mog-1. N2 worms or mog-1 heterozygotes were injected with the gene fusion
construct at a concentration of 10 µg/ml along with 30 µg of
pRF4/ml and 70 µg of fragmented H. influenzae genomic
DNA/ml. Rollers were isolated, and GFP expression was monitored by
epifluorescence and confocal microscopy. This MOG-1::GFP
fusion protein did not rescue mog-1 (data not shown).
Germ cell counts.
To visualize germ line and somatic nuclei,
unmarked adult (24 h after the L4 stage) Mog worms were stained with
diamidinophenylindole (DAPI) (0.5 µg/ml in ethanol) for 10 min and
washed in M9 buffer. Nuclei from immature germ cells and sperm were
counted under a fluorescence microscope. To obtain the total number of
germ cells, the numbers of sperm nuclei were divided by four and added
to the counts of immature germ cell nuclei. n represents the
number of gonadal arms counted.
Growth analyses.
mog-1(x)/balancer
hermaphrodites were allowed to lay embryos for 2 h at the
appropriate temperature. Embryos were placed individually onto petri
dishes and grown at 20 or 25°C for 72 or 48 h, respectively. The
developmental stage was determined by monitoring differentiation of the
vulva. An animal was scored as an L4 if the vulva was invaginated and
as an adult if the vulva had everted. Ten (q370), 24 (q151), 17 (q223), and 11 (q473)
mog-1 homozygous animals were grown at 20°C and scored
70 h after laying embryos. For comparison, 110 mog-1/+
(wild-type) heterozygote siblings were analyzed in parallel. The
development of 18 fem-3(gf)/+ (q96/+)
heterozygotes and 67 wild-type (+/+) siblings was examined 48 h
after embryos were laid. Because q96 is a
temperature-sensitive allele, q96/+ and +/+ embryos were
both grown at 25°C.
Construction and analysis of a smg-1;
mog-1 double mutant.
mog-1(q151)/+
males were crossed into smg-1(r861);
dpy-19(e1259) unc-69(e587)
heterozygotes. Individual cross progeny were placed on petri dishes,
and their self-progeny were scored for Smg, Mog, and Dpy Unc
phenotypes. Smg non-Mog non-Dpy non-Unc animals were picked to make a
stable smg-1(r861);
mog-1(q151)/dpy-19(e1259) unc-69(e587) strain. To test whether
smg-1 might partially suppress mog-1, we examined
smg-1; mog-1 double mutants under Nomarski optics
and counted sperm and immature germ cells. No significant difference
between the mog-1(q151) and
smg-1(r861); mog-1(q151) phenotypes was observed. We also singled out 75 fertile animals and
scored their progeny to show that all were
mog-1(q151)/dpy-19 unc-69
heterozygotes. Therefore, smg-1 does not appear to
either enhance or suppress the Mog-1 phenotype.
Nucleotide sequence accession number.
The mog-1
cDNA sequence data have been submitted to the DDBJ/EMBL/GenBank
databases under accession no. AF120269.
 |
RESULTS |
Cloning the mog-1 gene.
The
mog-1 gene maps genetically to linkage group III between
sqv-3 and stP127 (Fig.
1A) (18, 44). The physical map
of this region has been covered with cosmids by the C. elegans genome consortium (10). To identify
mog-1 by mutant rescue, we microinjected pools of cosmids
into the germ line of mog-1(q223)
unc-69(e587)/eT1 heterozygotes and
scored the F1 progeny for rescued fertile mog-1 unc-69 animals. A cosmid pool containing K03H1 rescued
mog-1, as did the single K03H1 cosmid (Fig. 1B) (see
Materials and Methods). Upon subcloning K03H1, we observed rescue with
an 8.2-kb fragment but not with others (Fig. 1C). The rescuing 8.2-kb
fragment possesses two predicted open reading frames with the
respective transcripts oriented in the same direction from 5' to 3'
(Fig. 1D). To further narrow the mog-1 region, we tested
fragments of the 8.2-kb subclone for mog-1 mutant rescue.
pJK600 deleted the entire smaller transcript, whereas pJK601 deleted
about 2 kb from the larger transcript (Fig. 1D). pJK600 rescued
mog-1, whereas pJK601 failed to rescue mog-1. Therefore, mog-1 is likely to lie within pJK600.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning mog-1. (A) Genetic map.
mog-1 is located between one cloned gene, sqv-3,
and the stP127 Tc1 insertion on chromosome III. (B) Cosmids
spanning the sqv-3-stP127 interval were injected in three
pools: two pools (single cosmids represented by either dashed or thin
lines) failed to rescue mog-1; one pool (single cosmids
represented by thick lines) rescued mog-1. Among the single
cosmids in the rescuing pool, only K03H1 (thickest line) rescued
mog-1 (+); the others failed to rescue mog-1
( ). (C) Subclones of K03H1. Cosmid K03H1 was subcloned, and three
fragments were tested for mog-1 rescue. Only the
BamHI fragment of 8.2 kb (thick line) supported
mog-1 rescue. (D) Transcripts on the rescuing subclone. The
8.2-kb fragment contains two predicted genes (K03H1.2 and K03H1.11
[wavy lines]), which are transcribed in the same direction (arrows)
and might be polycistronic. pJK601 deletes an internal 2,110-nt
SacI fragment from the K03H1.2 region and fails to rescue
mog-1, whereas pJK600 deletes all of K03H1.11 and retains
mog-1 rescuing activity.
|
|
mog-1 encodes a protein with a DEAH box.
The
rescuing genomic fragment, pJK600, bears a single open reading frame
(K03H1.2) that is altered in the four existing mog-1 mutant
alleles (Fig. 2) (see
below). Therefore, this predicted transcript is likely to encode the
MOG-1 protein. To examine the actual mog-1 coding region, a
3,599-nt cDNA (pJK602) was isolated from an oligo(dT)-primed cDNA
library (a gift from R. Barstead). This mog-1 cDNA confirmed
all of the splice junctions predicted by Genefinder and the sequence
obtained by the C. elegans sequencing consortium
(10). It carries 15 nt of the trans-spliced
leader SL1 at its 5' end, the complete predicted coding region, and a poly(A) tail at the 3' end. Therefore, pJK602 is likely to represent a
nearly full-length transcript. The first AUG lies 3 nt downstream of
SL1 and is likely to encode the initiator methionine; it lies in a
region with a reasonable translational initiation sequence: in C. elegans that consensus is A/CA/GAAAUG (6), and the
mog-1 sequence is GUAAAUG. The stretch of amino acids
following this methionine bears similarity to the N-terminal region of
another member of the DEAH-box family (Fig. 2A) (see below). The 3' end of the mog-1 cDNA carries a 130-nt 3' UTR and an acceptable
cleavage and polyadenylation site (CAUAAA [6]),
located 13 nt upstream of the poly(A) tail.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
The MOG-1 protein. (A) Predicted amino acid
sequence of MOG-1 and comparison with that of PRP16. Identical amino
acids are boxed. We chose to compare MOG-1 to PRP16 and not PRP43
because of their similar sizes (PRP43 is only 767 amino acids long). In
the N-terminal part of the protein is the arginine-serine (RS)- and
arginine-aspartic acid (RD)-rich region (white letters on black
background). The conserved region of each member of the broad family
including DEAD- and DEXH-box proteins spans amino acids 474 to 773 and
includes five stretches of conserved amino acids (underlined)
(33). The first of these stretches, GETGSGKTTQ, contains the
A site of the nucleoside triphosphate-binding and ATPase motif; the
ATPase B site corresponds to the DEAH motif. In addition to these
broadly conserved regions, numerous amino acids (gray shading) are
conserved in all 12 DEAH-box proteins examined: human (HRH1 and
hPRP16), S. cerevisiae (PRP2, PRP16, PRP22, and PRP43),
Saccharomyces pombe (Cdc28), C. elegans (MOG-1,
F56D2.6, and EEED8.5), and Arabidopsis thaliana (accession
no. X98130 and Z97341). This region of high-level conservation spans
amino acids 434 to 1051 in MOG-1. The 12 selected sequences for this
comparison correspond to the 12 best scores obtained by the BLASTp
program, using MOG-1 as the query. Black dots indicate the positions of
mutations in mog-1. The three nonsense mutations,
q151, q370, and q223, are at positions
221 (ochre), 330 (opal), and 473 (amber), respectively, and the one
missense mutation, q473, is at position 777 (arginine to
histidine). Putative nuclear localization signals in MOG-1 are
indicated as full lines overlying the sequence. (B) Comparison of MOG-1
to other DEAH-box proteins. The mog-1 amino acid sequence
was compared to GenBank-PDB-SwissProt-PIR database sequences by using
the BLASTp program. Only DEAH-box proteins had a high level of
similarity. We have provided data for the best-understood ones as well
as for one DEIH protein, the Drosophila protein Maleless
(27). Other proteins with a similar degree of sequence
identity but no functional information are not listed; two are from
C. elegans (F56D2.6 and EEED8.5) and two are from A. thaliana (accession no. X98130 and Z97341). EEED8.5, F56D2.6
(C. elegans), HRH1 (human), hPRP16 (human), and Z97341
(A. thaliana) each contains an extensive RS domain located
in the N terminus (data not shown). Like Maleless (a DEIH-box protein),
other DEXX putative helicases are much less similar to MOG-1 than
DEAH-box proteins; Xenopus laevis eIF4A (a DEAD-box protein)
and Drosophila Homeless (a DEVH-box protein) do not align
with MOG-1, indicating a distant relationship. The conserved region
consists of amino acids corresponding to residues 434 to 1051 of
MOG-1.
|
|
The MOG-1 protein is a member of a superfamily of RNA helicases that
includes DEAD- and DEAH-box proteins. The defining elements of the
DEAH-box protein family are found in a region spanning residues 464 to
770 of MOG-1 (Fig. 2A) (33). Within the DEAH-box family,
MOG-1 is most similar to DEAH-box proteins; in the region spanning
amino acids 434 to 1051 of MOG-1, many residues are conserved among the
12 DEAH-box family members with the highest BLAST scores to MOG-1 (Fig.
2A). MOG-1 is most similar to four Saccharomyces cerevisiae
DEAH proteins, PRP2, PRP16, PRP22, and PRP43, that are required for
pre-mRNA splicing (2, 7, 9, 41, 42) and to HRH1
(32) and hPRP16 (31, 47), predicted human
homologs of PRP22 and PRP16, respectively (Fig. 2B). The identities
among these proteins vary from 30.9 to 53.6% for the whole peptide and from 40 to 74.7% for the conserved region only (amino acids 434 to
1051 in MOG-1), with the strongest homolog being hPRP16. In addition,
MOG-1 shares an RS domain with HRH1, hPRP16, and DEAH proteins from
other multicellular organisms (Fig. 2A). Such arginine-serine (RS) or
arginine-aspartic acid (RD) dipeptides are typical of many pre-mRNA
processing factors, including HRH1 and hPRP16 (for a review, see
reference 14), but they are not present in yeast PRP2, PRP16, PRP22, and PRP43 proteins. Finally, we note that a search
of the virtually complete C. elegans genome does not reveal
any other DEAH proteins, suggesting that MOG-1 may be the true PRP16 ortholog.
Molecular basis of mog-1 mutations.
To begin to
link the mog-1 molecular characterization with phenotypic
effects of various mog-1 mutants, we sequenced the existing four mog-1 alleles. Three of them, q151,
q223, and q370, contain nonsense mutations in the
first one-third of the predicted cDNA sequence (Fig. 2A). The 5'-most
nonsense mutation, mog-1(q151), places a stop
codon at residue 221, and all three are predicted to produce truncated
fragments of the MOG-1 protein that do not contain the conserved region
typical of members of the DEAH family. In C. elegans, mRNAs
containing premature stop codons are normally degraded by
nonsense-mediated decay (36). Therefore, mog-1
nonsense mutants are predicted not only to lack most of the MOG-1
protein but also to possess only a small fraction of the normal amount of mog-1 mRNA. A truncated nonsense fragment containing
partial MOG-1 activity might not be detected phenotypically because of mRNA degradation. To test this possibility, we examined a
smg-1; mog-1(q151) double mutant,
since in a smg-1 mutant background, mRNAs containing
premature stop codons are stabilized (36). We found the
mog-1; smg-1 double mutant to be phenotypically
indistinguishable from the mog-1 single mutant. Furthermore,
since we were able to build a healthy smg-1;
mog-1(q151)/dpy-19 unc-69 strain, the truncated fragment does not have a strong dominant-negative effect. We
suggest that the three nonsense alleles are molecular nulls. The fourth
mog-1 allele (q473) contains a missense mutation
predicted to change an arginine to a histidine (amino acid 777) (Fig.
2A). This particular arginine is likely to be of critical importance to
MOG-1 function since it is conserved among DEAH-box family members
(Fig. 2B).
We next asked whether a phenotypic difference between the null and
missense mog-1 mutants could be observed. Previous work focused on the role of mog-1 in the specification of germ
line sexual fates (18). Upon further examination of
mog-1 germ lines, we found that
mog-1(q473) missense mutants have a significantly larger number of mature sperm than do mog-1(q151)
null mutants: mog-1(q473) mutants produce
1,073 ± 341 mature sperm per gonadal arm (n = 18), while the mog-1(q151) mutants make only
309 ± 115 mature sperm per gonadal arm (n = 16).
The difference between the mog-1 null and missense mutant
phenotypes suggests that missense mutants retain partial
mog-1 activity. This idea is consistent with the fact that
mog-1 null alleles are fully penetrant while mog-1(q473) mutants can occasionally make oocytes
(18). During this study, we further noted that
mog-1 mutant germ lines are smaller than those of the wild
type. Whereas a wild-type or mog-1(q151)/+ adult
gonadal arm contains about 1,200 total germ line cells (reference 24 and unpublished data), a
mog-1(q151) arm has only about 400 total germ
cells (395 ± 179 per gonadal arm; n = 16) and a
mog-1(q473) arm contains only about 650 germ
cells (638 ± 224 per gonadal arm; n = 6).
Therefore, mog mutants produce significantly fewer germ line
cells than the wild type. We conclude that the mog-1 gene is
required not only for the sperm-oocyte switch but also for robust germ
line proliferation.
mog-1 is expressed in germ line and somatic
tissues.
To determine when mog-1 mRNA is expressed
during development, we extracted poly(A)+ RNAs from
synchronized animals and analyzed them by Northern blotting. C. elegans embryos hatch, develop through four larval stages (L1 to
L4), and then molt to adulthood. On a Northern blot probed with the
mog-1 cDNA, pJK602, one band of 3.65 kb was observed throughout development (Fig. 3, lanes 1 to 7). The steady-state level of mog-1 mRNA varied during
development in a manner predictable by its functions. It peaks in L4
just before the germ line switches from spermatogenesis to oogenesis at
the molt from L4 to adult, and it continues in the adult and embryo, as
predicted by the maternal-effect lethality of mog-1
homozygotes (18).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
Northern analysis of mog-1 RNA. Three
micrograms of poly(A)+-enriched RNA was loaded per lane.
Lanes 1 to 7 contain RNA from staged worms (E, embryos; L1 to L4, four
larval stages; A, adults; eL2 and IL2, early and late L2,
respectively). Lane 8 was loaded with RNA from adult
glp-1(q224) mutants, which contain virtually no
germ line. Molecular sizes were determined by comparison to RNA markers
(Promega). The same blot was probed with C. elegans act-1 (a
gift from M. Krause) as a loading control.
|
|
The germ line roles of mog-1 (sperm-oocyte switch,
proliferation, and maternal contribution to the embryo) suggest that
mog-1 might be expressed specifically in germ line tissue.
To investigate this possibility, we compared poly(A)+ RNAs
from wild-type adults, which possess over 2,000 germ cells, and
glp-1(q224) mutant adults, which contain only 16 to 32 mature sperm (3). Whereas the mog-1
transcript is abundant in wild-type adults (Fig. 3, lane 7), its
quantity is dramatically reduced in glp-1 mutants (Fig. 3,
lane 8). The ratio of the steady-state level of mog-1 RNA in
the wild type to that in glp-1 mutants is 6 to 1 (normalized
to actin); the same ratio was found reproducibly in several independent
experiments as well as in a comparison of wild-type and
glp-4(bn2) RNAs (data not shown). Therefore, most
mog-1 RNA appears to be in the germ line, but a fraction of
mog-1 RNA is present in somatic tissues.
In C. elegans, expression of transgenes is easily obtained
in somatic tissues but not in the germ line. The apparent somatic expression of mog-1 prompted the investigation of the
expression pattern of a mog-1::GFP fusion
construct (Fig. 4A) in transgenic worms.
The MOG-1::GFP fusion protein was detected in all somatic tissues, including the intestine, suggesting that the MOG-1 protein is
ubiquitous (Fig. 4B). Furthermore, MOG-1::GFP was found to be
localized to the nucleus (Fig. 4B), a site within the cell that was
predicted by at least three putative nuclear localization signals in
the MOG-1 amino acid sequence (Fig. 2A). The lack of MOG-1::GFP fusion protein in germ line tissues was most
likely due to its poor expression in the C. elegans germ
line.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of mog-1::GFP fusion.
(A) The MOG-1::GFP fusion construct encodes the GFP protein
fused to the C terminus of MOG-1. The 5' and 3' flanking regions are
those of pJK600, the smallest genomic fragment that was able to rescue
mog-1. (B) MOG-1::GFP is found in the nuclei of
all somatic tissues. Transgenic worms were examined by epifluorescence
and confocal microscopy. Intestinal nuclei can be distinguished by
their elongated shape and large size.
|
|
mog-1 mutants develop more slowly than the wild
type.
Given the ubiquitous expression of the MOG-1 protein, we
wondered about additional phenotypic consequences that might not have
been previously detected. Graham and Kimble (18) reported that no sexual transformation occurred in somatic tissues, and they did
not find any other specific somatic defect, but they noticed the slower
growth of mog-1 unc-69 homozygotes. To verify and extend
this initial observation, we compared the growth of unmarked
mog-1 mutants to their phenotypically wild-type siblings. To
this end, animals were synchronized at hatching and allowed to grow at
either 20°C [mog-1(q151, q223,
q370, q473) and
mog-1(x)/+] or 25°C
[fem-3(q96)/+ and wild type]. After 72 h
at 20°C or 48 h at 25°C, the developmental stage was assessed
by monitoring vulvar differentiation. fem-3(gf)
mutants were examined as a control because, like mog-1
mutants, they fail in the sperm-oocyte switch (4). Whereas
most mog-1/+ animals had reached adulthood after 72 h
at 20°C, most mog-1 homozygotes had only reached the L4
stage after the same period of time (Fig.
5A). By contrast,
fem-3(gf)/+ animals were similar to the wild type
(Fig. 5B). Since mog-1 mutants develop slowly, we asked
whether their life span is different from that of mog-1/+
heterozygotes. At 20°C, heterozygotes survived 13.4 days
(standard deviation, 6.7 days; n = 19) and
mog-1(0) homozygotes survived 13.2 (standard deviation, 5.7 days; n = 8). Therefore, in
spite of their slow growth, mog-1 homozygotes do not live
longer than mog-1/+ heterozygotes.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
mog-1 mutants grow more slowly than the wild
type. Black bars represent L4 larvae, and white bars indicate adults.
L4 larvae were distinguished from adults (A) by standard features of
vulval development (43). The y axis represents
the percentage of animals that have reached adulthood or the fourth
larval stage. For the numbers of animals tested, refer to Materials and
Methods. (A) Four different mog-1 mutants and the wild type
(wt) were examined for the developmental stage reached after 72 h
at 20°C. Whereas most wild-type animals had reached adulthood, most
mog-1 mutants had only reached the fourth larval stage. (B)
As a control, fem-3(gf) mutants (which have a Mog
phenotype) and fertile wild-type animals were compared after 48 h
at 25°C. No significant difference was observed, suggesting that the
slow-growth phenotype is associated with mog-1 rather than
with the production of sperm instead of oocytes.
|
|
General splicing appears to be normal in a mog-1-null
mutant.
Since the MOG-1 protein is similar to general splicing
factors in S. cerevisiae (PRP2, PRP16, PRP22, and PRP43), we
asked whether mog-1 is required for pre-mRNA splicing in
C. elegans. To test this hypothesis, total RNA was extracted
from 5,000 to 10,000 hand-picked mog-1 homozygotes and
analyzed by Northern blotting. To ensure that all RNAs would be
represented, we deliberately did not select for poly(A)+
RNA but instead used total RNA. Furthermore, to maximize the chances
that incompletely or incorrectly spliced products would be observed, we
isolated RNA from a smg-1; mog-1(q151)
double mutant, in which mRNAs with premature nonsense codons are
stabilized (36).
The RNAs examined included act-1, fem-3,
lag-1, and fbf. act-1 encodes body wall actin
(26), fem-3 is a sex-determining gene (see the
introduction) (38); lag-1 encodes a ubiquitous transcription factor (8, 25), and fbf encodes a
trans-acting repressor of fem-3 (46).
For actin, lag-1, and fbf, we saw in both
wild-type and mog-1 mutants the expected bands corresponding to completely spliced mRNAs, with no additional products in either mog-1 or smg-1; mog-1 mutant extracts
(Fig. 6A and data not shown). The light
bands above and below the fbf transcript correspond to RNA
trapped by 28S and 18S ribosomal RNAs. Although minor differences in
transcript size might have escaped Northern analysis, totally unspliced
fbf, actin, and lag-1 mRNAs would migrate to
positions corresponding to 2.8 kb (with 7 introns), 1.5 kb (with 2 introns), and 15.2 kb (with 11 introns), respectively, and would be
distinguishable from the spliced mRNAs in our analysis.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of splicing in mog-1(0)
background. (A) Northern blotting. Ten-microgram quantities of total
RNA derived from mog-1 or wild-type worms were run on a
denaturing agarose gel. Lanes: 1, smg-1;
mog-1(q151) double-mutant adults; 2, dpy-19
mog-1(q223) adults; 3, wild-type adults; 4, wild type
at mixed stages (st.). The blot was probed for fbf-1,
fbf-2, and act-1. Blots were also overexposed to
ensure that no secondary products were present. The expected
transcripts for smg-1; mog-1(+) adults could also
be seen in a Northern blot (data not shown). (B) RT-PCR. Wild-type (wt)
C. elegans genomic DNA (D) (lanes 1 and 5) or cDNA prepared
from poly(A)+ RNA (A+) (lanes 2 and 6) were
used as positive controls for PCR amplification with oligonucleotides
that are specific for either fem-3 (lanes 1 to 4) or
fbf-2 (lanes 5 to 8). Total RNA (T) from smg-1;
mog-1(q151) hermaphrodites (mog-1) was
used as a template for PCR without ( ) (lanes 3 and 7) or with (+)
(lanes 4 and 8) reverse transcriptase. The 1.17- and 1.83-kb bands
correspond to totally spliced fem-3 and fbf-2
mRNAs, respectively.
|
|
For fem-3, we reproducibly were unable to detect any signal
by Northern blot analysis, probably because the fem-3
transcript is relatively rare and is primarily expressed in the germ
line, which is small in mog-1 (0)
mutants. Therefore, we looked for fem-3 mRNA by RT-PCR. The
primers used for PCR span the entire coding region of fem-3
and cover five splice junctions. PCR generated a product of the
expected size (1.17 kb) from single-stranded cDNA obtained by using RNA
prepared from either wild-type or smg-1; mog-1
worms (Fig. 6B, lanes 2 and 4). The introns removed from this region
range from 80 to 380 nt and should have been detected if present. In
addition to the 1.17-kb product, a 2.15-kb product was also observed;
this larger band corresponded to genomic fem-3 DNA, since it
was also obtained without the use of reverse transcriptase or if
genomic DNA was used as a template (lanes 1 and 3) but was absent if
the cDNA was generated from poly(A)+ RNA (lane 2). The
1.17-kb product was absent if no reverse transcriptase was used,
indicating that this band corresponds to reverse-transcribed RNA.
To substantiate the results of the Northern blot analysis (Fig. 6A),
RT-PCR was also used for fbf-2 (Fig. 6B, lanes 5 to 8). The
expected sizes of the genomic and cDNA products were 2.1 and 1.83 kb,
respectively. The 1.83-kb product was detected if RT-PCR was performed
on RNA from either wild-type or smg-1; mog-1
worms (lanes 6 and 8). The additional 2.1-kb product corresponded to genomic fbf-2 DNA (lanes 5, 7, and 8) and was not present if
the cDNA was made from poly(A)-enriched RNA (lane 6).
Our results suggest that general splicing can occur normally, although
we cannot exclude small defects (e.g., skipping of a small exon or
retention of a small intron) that occur at low frequencies. Given that
the splicing of at least four different mRNAs appears to be normal in a
mog-1-null mutant, we suggest that mog-1 is not
essential for general splicing. Possible caveats to this conclusion are
discussed below.
 |
DISCUSSION |
We report the cloning and initial molecular characterization of
mog-1, the first of six mog genes involved in the
sperm-oocyte switch in the C. elegans hermaphrodite. The
mog-1 gene encodes a member of the DEAH-box family of RNA
helicases, which includes the yeast splicing factors PRP2, PRP16,
PRP22, and PRP43 and their human homologs hPRP16 and HRH1. Three
mog-1 alleles bear nonsense codons and are likely to be null
mutations; one is a missense mutation and appears to have residual
mog-1 activity. The mog-1 gene is expressed not
only in the germ line but also in somatic tissues. Consistent with its
presence in the soma, we found a slow-development defect in
mog-1 mutants; we also report a reduced germ line
proliferation in mog-1 mutants. These findings suggest that
MOG-1 may be a ubiquitous protein with more general functions than
the sperm-oocyte switch. Given its similarity to well-characterized splicing factors, we tested mog-1 for a general role in
splicing but were unable to obtain data supporting that idea. We
discuss the implications of these results for both mog-1
biology and biochemistry below.
Biological functions of the mog-1 gene.
Our
understanding of the biological functions of mog-1 derives
from genetic, phenotypic, and molecular analyses (reference 18 and this work). Early studies showed that
mog-1 mutants fail in the germ line switch from
spermatogenesis to oogenesis and that mog-1;
fem-3 mothers, which make oocytes instead of sperm due to
the lack of fem-3, produce dead embryos (18). In
addition to the phenotypes identified by Graham and Kimble
(18), we found two additional defects. First,
mog-1 is required for robust germ line proliferation. The
adult germ line of mog-1 mutants contains only about half of
the number of germ cells present in the wild type; this smaller germ
line is organized like the wild type, with mitotic stem cells at one
end and differentiating gametes at the other. The germ line defect
therefore does not mimic known glp phenotypes:
glp-1 mutants lack mitotic stem cells (3), glp-2 mutants have very few germ cells, which fail to
differentiate (35), glp-3 mutants fail to
progress through meiosis (22), and glp-4 mutants
are blocked in mitotic prophase (5). Instead, the
mog-1(0) mutation's effect on germ line
proliferation is more similar to that observed after laser ablation of
the sheath-spermathecal precursor cells (30). A speculative
idea arising from that similarity is that mog-1 may regulate
some RNAs in the sheath-spermathecal precursor cell to promote germ
line proliferation, in addition to its role in fem-3
regulation. Alternatively, mog-1 may be required for some
more general function within the germ line which results in slower cell
division. Second, mog-1 is required for growth; mog-1 null mutants grow more slowly than the wild type.
However, many mutations retard larval growth, and the significance of
this latter phenotype remains unknown. In sum, maternal
mog-1 is required for embryogenesis, and zygotic
mog-1 is required for the sperm-oocyte switch, normal germ
line proliferation, and normal larval growth (reference
18 and this work). This spectrum of phenotypes
suggests that mog-1 is broadly required during development.
Possible molecular functions of MOG-1 protein.
What is the
molecular function of the MOG-1 protein? Although we cannot yet answer
this question in detail, the present work and a complementary study
(15) provide important insights. Here we show that MOG-1 is
a member of the DEAH family of RNA helicases, that it is expressed in
both somatic and germ line tissues, and that it may be nuclear.
Gallegos et al. (15) used a reporter transgene that is
regulated by the fem-3 3' UTR to demonstrate that
mog-1 activity is required in somatic tissues for the
posttranscriptional repression of fem-3. Taking the data
together, we can conclude that MOG-1 is involved in RNA regulation and
that it is crucial for control mediated via the fem-3 3' UTR.
The identification of MOG-1 as a DEAH-box protein links it to RNA
regulation. Among the yeast DEAH-box proteins, PRP2, PRP16, PRP22, and
PRP43 are most similar to MOG-1, with PRP16 showing the highest degree
of similarity (Fig. 2). However, none of the yeast proteins contains an
RS domain. The presence of an RS domain in MOG-1, HRH1, hPRP16, and at
least two other DEAH-box proteins, from C. elegans and
Arabidopsis thaliana (see the legend to Fig. 2B), suggests
that these proteins might have additional roles in metazoans.
DEAD-box and other DEXH-box proteins, such as
Drosophila Homeless and Maleless, are only distantly related
to MOG-1 (16, 27). PRP2, PRP16, PRP22, and PRP43 have all
been implicated in pre-mRNA splicing (2, 7, 9, 41, 42); all
four are essential genes in S. cerevisiae, since null
mutations in any one are lethal. By contrast with its yeast homologs,
mog-1 null mutants are viable and do not appear to be
required generally for splicing.
The significance of MOG-1's similarity to yeast and human splicing
factors remains to be determined. Many possibilities exist. If
mog-1 is indeed used for general splicing, perhaps some
other gene supplies that function or maternal mog-1 is
sufficient in mog-1 mutants. Alternatively, the function of
mog-1 may have become specialized for splicing selected
genes, or this gene may have diverged sufficiently from its closest
homologs and not be critical for splicing at all. Finally, the
requirement of mog-1 for fem-3 3' UTR regulation
(15) may indicate that the four PRP genes are involved in
other aspects of RNA regulation in addition to their roles in splicing.
MOG-1, fem-3 3' UTR regulation, and the sperm-oocyte
switch.
How does mog-1 effect repression by the
fem-3 3' UTR and control the sperm-oocyte switch? Two models
are presented in Fig. 7. In both models,
fem-3 mRNA bears the cis-acting PME regulatory element which is bound by the FBF repressor. The first model (Fig. 7A)
shows an indirect role for MOG-1. MOG-1 may regulate the production of
some component of the posttranscriptional regulatory machinery that in
turn controls fem-3, here represented by an X (Fig. 7A). A
simple example is that MOG-1 might control the splicing of a component
needed for fem-3 3' UTR regulation. With FBF being localized to the cytoplasm, as evidenced by antibody staining (46), a nuclear location for MOG-1 might indicate such an indirect mechanism. However, we have no functional evidence for MOG-1 activity in the
nucleus or for FBF activity in the cytoplasm, and therefore this
apparent paradox cannot be given too much weight. The second model
(Fig. 7B) shows a more direct role for the MOG-1 protein in
fem-3 3' UTR regulation. MOG-1 may either bind FBF directly or be part of a complex that regulates 3' UTR regulation via the PME.
At the present time, we consider both models viable. The identification
of MOG-1 in a complex at the fem-3 3' UTR or the identification of mRNAs that are abnormally spliced in mog-1
mutants could distinguish the two models.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Models for the role of mog-1 in
fem-3 3' UTR control. These working models take into account
the findings that MOG-1 appears be a nuclear protein and that the
splicing of the fem-3 and fbf mRNAs appears to be
unaffected by the loss of mog-1. (A) This model suggests
that MOG-1 regulates the generation of a specific transcript (mRNA X)
that encodes a factor (X) which is required for the fem-3 3'
UTR control. In this diagram, we suggest that MOG-1 may regulate the
splicing of a specific pre-mRNA, but it may instead affect translation,
stability, or localization of that RNA. (B) This model suggests that
MOG-1 may interact directly or indirectly with a PME-binding complex to
influence the fem-3 3' UTR control. Two-headed arrows
represent protein-protein or protein-RNA interactions. The PME is shown
as a black full circle.
|
|
Another possibility is that MOG-1 influences RNA translation,
stability, transport, and/or localization. These mechanisms have been
implicated for other proteins with DEAD or DEXH motifs. For instance,
the Escherichia coli degradosome is a multienzymatic complex
containing at least one DEAD-box protein, named RhIB (37). RNA transport from the nucleus to the cytoplasm is dependent on Mtr4p,
a nuclear protein with a DEAD-box motif (29). Finally, in
D. melanogaster, Vasa, a DEAD-box protein (28),
is required for proper localization of nanos mRNA during
oogenesis. Similarly, the Drosophila homeless gene is
required for transport of specific messages during early development
and encodes a protein with a DEVH motif (16). At present we
cannot rule out any of these possibilities for mog-1 function.
How does the apparently ubiquitous MOG-1 protein control the
sperm/oocyte switch in the C. elegans hermaphrodite germ
line? We favor the idea that MOG-1 is part of a regulatory machinery that is present in both somatic and germ line tissues and that influences multiple transcripts, including fem-3. Examples
of general regulators that also regulate specific genes are emerging. For example, the SWI-SNF complex appears to be a general
transcriptional regulator that plays a role in the induction of
specific genes (see, e.g., reference 34). Perhaps
MOG-1 and a MOG complex function as a general regulator at the
posttranscriptional level and fem-3 is targeted for MOG
control by FBF.
 |
ACKNOWLEDGMENTS |
We gratefully acknowledge Beth Westlund and Tim Schedl for
sharing unpublished mapping data on mog-1. We thank Maria
Gallegos for sharing unpublished data and comments on the manuscript.
Thanks go to Marv Wickens for fruitful discussions, Niki Gray for
helpful comments on the manuscript, and Timothy James for sequencing
the mog-1 cDNA. We are grateful to Alan Coulson and his team
for providing C. elegans cosmids and for sequencing of the
worm genome, as well as to Bob Barstead for cDNA libraries.
A.P. was supported by fellowships from the European Molecular Biology
Organization and the Fonds national suisse de la recherche scientifique. J.K. is an investigator of the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, University of Wisconsin
Madison, 433 Babcock Dr.,
Madison, WI 53706-1544. Phone: (608) 262-6188. Fax: (608) 265-5820. E-mail: jekimble{at}facstaff.wisc.edu.
Present address: Institut de Zoologie, Université de
Fribourg, Pérolles, CH-1700 Fribourg, Switzerland.
 |
REFERENCES |
| 1.
|
Ahringer, J., and J. Kimble.
1991.
Control of the sperm-oocyte switch in Caenorhabditis elegans hermaphrodites by the fem-3 3' untranslated region.
Nature
349:346-348[Medline].
|
| 2.
|
Arenas, J. E., and J. N. Abelson.
1997.
An RNA helicase-like factor involved in spliceosome disassembly.
Proc. Natl. Acad. Sci. USA
94:11798-11802[Abstract/Free Full Text].
|
| 3.
|
Austin, J., and J. Kimble.
1987.
glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans.
Cell
51:589-599[Medline].
|
| 4.
|
Barton, M. K.,
T. B. Schedl, and J. Kimble.
1987.
Gain-of-function mutations of fem-3, a sex-determination gene in Caenorhabditis elegans.
Genetics
115:107-119[Abstract/Free Full Text].
|
| 5.
|
Beanan, M. J., and S. Strome.
1992.
Characterization of a germ-line proliferation mutation in C. elegans.
Development
116:755-766[Abstract].
|
| 6.
|
Blumenthal, T., and K. Steward.
1997.
RNA processing and gene structure, p. 117-145.
In
D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess (ed.), C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 7.
|
Chen, J.-H., and R.-J. Lin.
1990.
The yeast PRP2 protein, a putative RNA-dependent ATPase, shares extensive sequence homology with two other pre-mRNA splicing factors.
Nucleic Acids Res.
18:6447[Free Full Text].
|
| 8.
|
Christensen, S.,
V. Kodoyianni,
M. Bosenberg,
L. Friedman, and J. Kimble.
1996.
lag-1, a gene required for lin-12 and glp-1 signaling in Caenorhabditis elegans, is homologous to human CBF1 and Drosophila Su(H).
Development
122:1373-1383[Abstract].
|
| 9.
|
Company, M.,
J. Arenas, and J. Abelson.
1991.
Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes.
Nature
349:487-493[Medline].
|
| 10.
|
Coulson, A.,
C. Huynh,
Y. Kozono, and R. Shownkeen.
1995.
The physical map of the Caenorhabditis elegans genome.
Methods Cell Biol.
48:534-550.
|
| 11.
|
Doniach, T.
1986.
Activity of the sex-determining gene tra-2 is modulated to allow spermatogenesis in the C. elegans hermaphrodite.
Genetics
114:53-76[Abstract/Free Full Text].
|
| 12.
|
Ellis, R. E., and J. Kimble.
1995.
The fog-3 gene and regulation of cell fate in the germ line of Caenorhabditis elegans.
Genetics
139:561-577[Abstract].
|
| 13.
| Fire, A. Personal communication.
|
| 14.
|
Fu, X.-d.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 15.
|
Gallegos, M.,
J. Ahringer,
S. Crittenden, and J. Kimble.
1998.
Repression by the 3' UTR of fem-3, a sex-determining gene, relies on a ubiquitous mog-dependent control in Caenorhabditis elegans.
EMBO J.
17:6337-6347[Medline].
|
| 16.
|
Gillespie, D. E., and C. A. Berg.
1995.
homeless is required for RNA localization in Drosophila oogenesis and encodes a new member of the DE-H family of RNA-dependent ATPases.
Genes Dev.
9:2495-2508[Abstract/Free Full Text].
|
| 17.
|
Goodwin, E. B.,
P. G. Okkema,
T. C. Evans, and J. Kimble.
1993.
Translational regulation of tra-2 by its 3' untranslated region controls sexual identity in C. elegans.
Cell
75:329-339[Medline].
|
| 18.
|
Graham, P. L., and J. Kimble.
1993.
The mog-1 gene is required for the switch from spermatogenesis to oogenesis in Caenorhabditis elegans.
Genetics
133:919-931[Abstract].
|
| 19.
|
Graham, P. L.,
T. Schedl, and J. Kimble.
1993.
More mog genes that influence the switch from spermatogenesis to oogenesis in the hermaphrodite germ line of Caenorhabditis elegans.
Dev. Genet.
14:471-484[Medline].
|
| 20.
|
Hodgkin, J.
1986.
Sex determination in the nematode C. elegans: analysis of tra-3 suppressors and characterization of fem genes.
Genetics
114:15-52[Abstract/Free Full Text].
|
| 21.
|
Hodgkin, J., and S. Brenner.
1977.
Mutations causing transformation of sexual phenotype in the nematode Caenorhabditis elegans.
Genetics
86:275-287[Abstract/Free Full Text].
|
| 22.
|
Kadyk, L. C.,
E. J. Lambie, and J. Kimble.
1997.
glp-3 is required for mitosis and meiosis in the Caenorhabditis elegans germ line.
Genetics
145:111-121[Abstract].
|
| 23.
|
Kimble, J., and D. Hirsh.
1979.
The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans.
Dev. Biol.
70:396-417[Medline].
|
| 24.
|
Kimble, J. E., and J. G. White.
1981.
On the control of germ cell development in Caenorhabditis elegans.
Dev. Biol.
81:208-219[Medline].
|
| 25.
| Kodoyianni, V., S. Crittenden, and J. Kimble.
Unpublished data.
|
| 26.
|
Krause, M.,
M. Wild,
B. Rosenzweig, and D. Hirsh.
1989.
Wild-type and mutant actin genes in Caenorhabditis elegans.
J. Mol. Biol.
208:381-392[Medline].
|
| 27.
|
Kuroda, M. I.,
M. J. Kernan,
R. Kreber,
B. Ganetzky, and B. S. Baker.
1991.
The maleless protein associates with the X chromosome to regulate dosage compensation in Drosophila.
Cell
66:935-947[Medline].
|
| 28.
|
Lasko, P. F., and M. Ashburner.
1988.
The product of the Drosophila gene vasa is very similar to eukaryotic initiation factor-4A.
Nature
335:611-617[Medline].
|
| 29.
|
Liang, S.,
M. Hitomi,
Y.-H. Hu,
Y. Liu, and A. M. Tartakoff.
1996.
A DEAD-box-family protein is required for nucleocytoplasmic transport of yeast mRNA.
Mol. Cell. Biol.
16:5139-5146[Abstract].
|
| 30.
|
McCarter, J.,
B. Bartlett,
T. Dang, and T. Schedl.
1997.
Soma-germ cell interactions in Caenorhabditis elegans: multiple events of hermaphrodite germline development require the somatic sheath and spermathecal lineages.
Dev. Biol.
181:121-143[Medline].
|
| 31.
|
Nagase, T.,
N. Seki,
K. Ishikawa,
M. Ohira,
Y. Kawarabayasi,
O. Ohara,
A. Tanaka,
H. Kotani,
N. Miyajima, and N. Nomura.
1996.
Prediction of the coding sequences of unidentified human genes. VI. The coding sequences of 80 new genes (KIAA0201-KIAA0280) deduced by analysis of cDNA clones from cell line KG-1 and brain.
DNA Res.
3:321-329[Abstract].
|
| 32.
|
Ohno, M., and Y. Shimura.
1996.
A human RNA helicase-like protein, HRH1, facilitates nuclear export of spliced mRNA by releasing the RNA from the spliceosome.
Genes Dev.
10:997-1007[Abstract/Free Full Text].
|
| 33.
|
Pause, A., and N. Sonenberg.
1992.
Mutational analysis of a DEAD box RNA helicase: the mammalian translation initiation factor eIF-4A.
EMBO J.
11:2643-2654[Medline].
|
| 34.
|
Pazin, M. J., and J. T. Kadonaga.
1997.
SWI1/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions?
Cell
88:737-740[Medline].
|
| 35.
| Petcherski, A., E. Lambie, and J. Kimble.
Unpublished data.
|
| 36.
|
Pulak, R., and R. P. Anderson.
1993.
mRNA surveillance by the Caenorhabditis elegans smg genes.
Genes Dev.
7:1885-1897[Abstract/Free Full Text].
|
| 37.
|
Py, B.,
C. F. Higgins,
H. M. Krisch, and A. J. Carpousis.
1996.
A DEAD-box RNA helicase in the Escherichia coli RNA degradosome.
Nature
381:169-172[Medline].
|
| 38.
|
Rosenquist, T. A., and J. Kimble.
1988.
Molecular cloning and transcript analysis of fem-3, a sex-determination gene in Caenorhabditis elegans.
Genes Dev.
2:606-616[Abstract/Free Full Text].
|
| 39.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 40.
|
Schedl, T.
1997.
Developmental genetics of the germ line, p. 241-269.
In
D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess (ed.), C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Schwer, B., and C. H. Gross.
1998.
prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing.
EMBO J.
17:2086-2094[Medline].
|
| 42.
|
Schwer, B., and C. Guthrie.
1991.
PRP16 is an RNA-dependent ATPase that interacts transiently with the spliceosome.
Nature
349:494-499[Medline].
|
| 43.
|
Sulston, J. E., and H. R. Horvitz.
1977.
Post-embryonic cell lineages of the nematode Caenorhabditis elegans.
Dev. Biol.
56:110-156[Medline].
|
| 44.
| Westlund, E., and T. Schedl. Personal
communication.
|
| 45.
|
Wickens, M.,
J. Kimble, and S. Strickland.
1996.
Translational control of developmental decisions, p. 411-450.
In
J. Hershey, M. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Zhang, B.,
M. Gallegos,
A. Puoti,
E. Durkin,
S. Fields,
J. Kimble, and M. P. Wickens.
1997.
A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line.
Nature
390:477-484[Medline].
|
| 47.
|
Zhou, Z., and R. Reed.
1998.
Human homologs of yeast Prp16 and Prp17 reveal conservation of the mechanism for catalytic step II of pre-mRNA splicing.
EMBO J.
17:2095-2106[Medline].
|
Molecular and Cellular Biology, March 1999, p. 2189-2197, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Belfiore, M., Pugnale, P., Saudan, Z., Puoti, A.
(2004). Roles of the C. elegans cyclophilin-like protein MOG-6 in MEP-1 binding and germline fates. Development
131: 2935-2945
[Abstract]
[Full Text]
-
Western, T. L., Cheng, Y., Liu, J., Chen, X.
(2002). HUA ENHANCER2, a putative DExH-box RNA helicase, maintains homeotic B and C gene expression in Arabidopsis. Development
129: 1569-1581
[Abstract]
[Full Text]
-
Jin, S.-W., Arno, N., Cohen, A., Shah, A., Xu, Q., Chen, N., Ellis, R. E.
(2001). In Caenorhabditis elegans, the RNA-Binding Domains of the Cytoplasmic Polyadenylation Element Binding Protein FOG-1 Are Needed to Regulate Germ Cell Fates. Genetics
159: 1617-1630
[Abstract]
[Full Text]
-
Chin, G. M., Villeneuve, A. M.
(2001). C. elegans mre-11 is required for meiotic recombination and DNA repair but is dispensable for the meiotic G2 DNA damage checkpoint. Genes Dev.
15: 522-534
[Abstract]
[Full Text]
-
Sanjuán, R., Marín, I.
(2001). Tracing the Origin of the Compensasome: Evolutionary History of DEAH Helicase and MYST Acetyltransferase Gene Families. Mol Biol Evol
18: 330-343
[Abstract]
[Full Text]
-
Rudel, D., Kimble, J.
(2001). Conservation of glp-1 Regulation and Function in Nematodes. Genetics
157: 639-654
[Abstract]
[Full Text]
-
Wu-Scharf, D., Jeong, B.-r., Zhang, C., Cerutti, H.
(2000). Transgene and Transposon Silencing in Chlamydomonas reinhardtii by a DEAH-Box RNA Helicase. Science
290: 1159-1162
[Abstract]
[Full Text]
-
Haag, E. S., Kimble, J.
(2000). Regulatory Elements Required for Development of Caenorhabditis elegans Hermaphrodites Are Conserved in the tra-2 Homologue of C. remanei, a Male/Female Sister Species. Genetics
155: 105-116
[Abstract]
[Full Text]
-
Puoti, A., Kimble, J.
(2000). The hermaphrodite sperm/oocyte switch requires the Caenorhabditis elegans homologs of PRP2 and PRP22. Proc. Natl. Acad. Sci. USA
97: 3276-3281
[Abstract]
[Full Text]