Previous Article | Next Article 
Molecular and Cellular Biology, March 1999, p. 2212-2219, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Human Sequence Homologue of Staufen Is an
RNA-Binding Protein That Is Associated with Polysomes and Localizes
to the Rough Endoplasmic Reticulum
Rosa María
Marión,1
Puri
Fortes,1,
Ana
Beloso,1
Carlos
Dotti,2 and
Juan
Ortín1,*
Centro Nacional de Biotecnología
(CSIC), Cantoblanco, 28049 Madrid, Spain,1
and European Molecular Biology Laboratory, 69012 Heidelberg, Germany2
Received 27 May 1998/Returned for modification 7 July 1998/Accepted 11 September 1998
 |
ABSTRACT |
In the course of a two-hybrid screen with the NS1 protein of
influenza virus, a human clone capable of coding for a protein with
high homology to the Staufen protein from Drosophila
melanogaster (dmStaufen) was identified. With these sequences
used as a probe, cDNAs were isolated from a
cDNA library. The
encoded protein (hStaufen-like) contained four double-stranded RNA
(dsRNA)-binding domains with 55% similarity and 38% identity to those
of dmStaufen, including identity at all residues involved in RNA
binding. A recombinant protein containing all dsRNA-binding domains was
expressed in Escherichia coli as a His-tagged polypeptide.
It showed dsRNA binding activity in vitro, with an apparent
Kd of 10
9 M. Using a specific
antibody, we detected in human cells a major form of the hStaufen-like
protein with an apparent molecular mass of 60 to 65 kDa. The
intracellular localization of hStaufen-like protein was investigated by
immunofluorescence using a series of markers for the cell compartments.
Colocalization was observed with the rough endoplasmic reticulum but
not with endosomes, cytoskeleton, or Golgi apparatus. Furthermore,
sedimentation analyses indicated that hStaufen-like protein associates
with polysomes. These results are discussed in relation to the possible
functions of the protein.
 |
INTRODUCTION |
The establishment and maintenance of
asymmetries in certain cells implies the localized expression of many
proteins, a property often enhanced by the localization of the
corresponding mRNAs (for reviews, see references 2
and 47). The relevance of mRNA localization at
precise sites of the cell in the definition of polarity of developing
embryos has been documented in both Drosophila melanogaster
and Xenopus laevis. Thus, the positions of gurken
and oskar mRNAs in the fly oocyte define its dorsoventral axis (36) and the location of the pole plasm at the
posterior pole (15), respectively. Likewise, the
localization of the bicoid and nanos mRNAs at the
anterior and posterior poles of the embryo, respectively, leads to the
generation of two opposing gradients of their protein products and
ultimately to the definition of the head, thorax, and abdomen of the
embryo (50). In the case of X. laevis, several
mRNAs, such as Xcat2, Xcat3, and
Xlsirt, are directed to the germ plasm (34),
while others, such as Vg1 and Xwnt11, accumulate
at the vegetal cortex (30). By analogy to the D. melanogaster genes, these mRNAs are thought to play a role in
defining patterns in the X. laevis embryo. In fact, a region
of the Xcat2 protein shows sequence homology to the zinc finger domain of nanos protein (34).
The specific localization of certain mRNAs to precise sites within the
cell is not an exclusive property of germ cells or developing embryos.
A number of observations indicate that some of the mRNAs of somatic
cells are also localized at different sites within the cell. Thus,
myelin-binding protein is translated in oligodendrocytes from free
ribosomes on localized mRNA (51), and the
microtubule-associated protein MAP2 is translated preferentially in
dendrites of the neurons (23). Likewise, different actin protein isoforms are translated from their mRNAs at distinct sites of
myoblasts (27).
In some cases, the intracellular localization of mRNAs involves
cis-acting signals consisting of distinct secondary
structures of their untranslated regions (UTRs) (reviewed in reference
47). These cis signals are thought to
mediate localization by interaction with RNA-binding proteins, the best
studied of which is the Staufen protein of D. melanogaster
(dmStaufen) (48; reviewed in reference 50). dmStaufen protein is the product of a maternal
mRNA of D. melanogaster that is involved in the accumulation
of bicoid and oskar mRNAs at the anterior pole of
the embryo and the posterior pole of the oocyte, respectively
(48). It contains double-stranded RNA (dsRNA)-binding
domains that associate with bicoid mRNA through a precise
secondary structure in its 3' UTR (18).
Our group has been studying the influenza virus nonstructural protein
NS1, an RNA-binding protein (26, 33, 42) that may be
involved in several regulatory processes during viral infection (reviewed in reference 37). These include the
modulation of pre-mRNA splicing (20, 21, 32), the retention
of poly(A)-containing RNA in the nucleus (20, 42), and the
stimulation of viral mRNA translation (10, 14). These
properties of NS1 protein seem related to particular interactions with
certain cellular or viral RNA molecules and may also involve
interaction with specific cellular factors (26, 40, 42, 43).
In the course of a genetic screen to detect candidate cellular proteins
that may pertain to these biochemical effects, we identified a human
gene with homology to the dmStaufen gene. The encoded protein
(hStaufen-like) was localized by immunofluorescence to the rough
endoplasmic reticulum in cultured cells, was associated with polysomes,
and behaved like an RNA-binding protein.
 |
MATERIALS AND METHODS |
Biological materials.
The COS-1 cell line (25),
kindly provided by Y. Gluzman, and the HeLa cell line, purchased from
the American Type Culture Collection, were cultured as described
previously (39). Saccharomyces cerevisiae HF7c
(MATa his3 GAL1-HIS3 GAL4-lacZ trp1 leu2) was
obtained from Clontech and used for two-hybrid screening. The vaccinia
virus recombinant vTF7-3 (22) was kindly provided by B. Moss. Plasmids pGBT9 and pGAD424, used for interaction tests in the
two-hybrid screen, as well as plasmids pVA3, pTD1, and pCL1, used as
internal controls, were obtained from Clontech. pRSET expression
vectors were obtained from Invitrogen. Plasmid pGEM1-Bcd (4)
containing the bicoid cDNA cloned into pGEM vector was
provided by A. Ephrussi. Plasmid pArII contained the rDNA from
Artemia salina and was provided by J. Renard. The monoclonal antibody specific for the T7 tag present in the pRSET vectors was
purchased from Novagen. The following monoclonal antibodies were used
to detect cytological markers: 18A4 (28), specific for
ribophorin I, kindly provided by F. Becker; antibodies specific for Bip
(kindly provided by S. Fuller) and tubulin (Amersham); anti-lamp2
(Developmental Studies Hybridoma Bank, University of Iowa), specific
for late endosomes, kindly provided by J. Krijnse-Locker; and
anti-mannose II (mannII), specific for the Golgi apparatus, provided by
T. Nilsson. An antibody specific for ribosomal P proteins was kindly
donated by J. P. García-Ballesta.
Protein expression and purification.
The thSTL DNA fragment
of clone C was transferred in frame to pRSET vector to generate plasmid
pRSTL, in which the thSTL protein was fused to a His tag and the T7
antigenic tag. The recombinant pRSTL plasmid was transformed into
Escherichia coli BL21(DE3)(pLysS), the expression of
His-thSTL was induced by
isopropyl-
-D-thiogalactopyranoside, and the recombinant
protein was purified by chromatography on Ni-nitrilotriacetic acid
(NTA)-agarose as described previously (33). In addition, the
hStaufen-like cDNA sequence encoding the dsRNA-binding domains was also
fused in frame to pRSET vector to generate plasmid pRHST. This plasmid
was transformed into E. coli BL21(DE3)(pLysS), and the
His-HST protein was expressed and purified by chromatography on
Ni-NTA-agarose as described above. For immunofluorescence studies, the
thSTL cDNA, fused to the sequence of the tags indicated above, was
transferred to vector pCMV (Clontech) to generate plasmid pCMV-STL.
Two-hybrid screen.
The NS1 cDNA from plasmid pSVa232NS1
(20) was transferred to vector pGBT9, and the resulting
plasmid (pGBT-NS1) was used to screen a human kidney cDNA fusion
library cloned into pGAD vector. With 10 mM 3-aminotriazole, the
recombinant plasmid pGBT-NS1 alone did not induce growth in
histidine-free medium. The procedures for library amplification, yeast
cell transformation, screening for growth in the absence of histidine,
and
-galactosidase activity were those recommended in the Matchmaker
protocol (Clontech). Rescue of positive pGAD plasmids was done by
transformation into E. coli MH4 (Leu
) cells
and selection in M9 plates lacking leucine. cDNA clones corresponding
to the thSTL insert were obtained from a HeLa cDNA library constructed
in
gt10 (Clontech), using standard procedures (45).
Sequencing was carried out in a Perkin-Elmer 373 automatic sequencer,
using specific oligonucleotide primers.
Transfections.
Transfection of HeLa cells with expression
plasmids driven by polymerase II was done with cationic liposomes
(44) as described elsewhere (33). When expression
vectors driven by the T7 promoter were used COS-1 cells were previously
infected with vaccinia virus vTF7-3 and then transfected as indicated above.
Probe labeling and RNA analyses.
Labeling of cDNA was
carried out by random priming using a Stratagene kit. Riboprobe
synthesis and poly(A)+ RNA isolation from cultured cells
were done as described elsewhere (41). Northern
hybridization was performed by using cDNA probes and standard
conditions (45). Dot blot hybridization was carried out as
described elsewhere (33). To generate a 3' UTR probe from
bicoid, plasmid pGEM1-Bcd was digested with SacI,
treated with mung bean nuclease, and further digested with
EcoRV. After religation and digestion with EcoRI,
the resulting DNA was used for transcription with Sp6 RNA polymerase.
To prepare an unrelated probe containing highly structured dsRNA
regions, we used plasmid pNSZ (41), which generates a
240-nucleotide RNA upon transcription with T7 RNA polymerase. As a
nonstructured probe, we transcribed with T7 RNA polymerase the
synthetic oligonucleotide A40CCTATAGTGAGTCGTATTAACC annealed to a T7 promoter-complementary oligonucleotide
(GGTTAATACGACTCACTATAGG), using the conditions described by
Seong and Brownlee (46). To test RNA-protein interaction,
various amounts of His-HST protein were mixed with a fixed quantity of
labeled probe (10,000 cpm; specific activity, 108
cpm/µg), incubated for 20 min at room temperature in a buffer containing 100 mM KCl, 5 mM MgCl2, and 50 mM Tris-HCl (pH
7.5), and filtered through a nitrocellulose filter in a dot blot
apparatus. The proportion of probe retained was determined with a phosphorimager.
Cell fractionations and polysome analysis.
Polysomes were
isolated as described previously (38). In brief, the cell
culture was treated with cycloheximide (100 µg/ml) for 15 min before
cell harvesting. The cytoplasmic fraction was obtained by cell lysis in
isotonic buffer (150 mM NaCl, 1.5 mM MgCl2, 10 mM Tris-HCl
[pH 8.5]) containing 0.5% Nonidet P-40, centrifuged for 10 min at
10,000 × g and 4°C, and finally centrifuged on a 7 to 47% sucrose gradient in isotonic buffer for 2 h at 40,000 rpm
and 2°C in a SW41 rotor. For EDTA treatment, the cytoplasmic fraction
and sucrose gradients were adjusted to 25 mM EDTA. Fractions were
collected and analyzed as indicated below. As a negative control,
polysomes were disrupted by incubation of the cell cultures with
puromycin (100 µg/ml), instead of cycloheximide, for 60 min before
cell harvesting.
Immunological techniques.
Immunological detection of
hStaufen-like protein was carried out with a rabbit antiserum prepared
by immunization with purified His-STL protein. We used as controls both
preimmune serum and the immune serum depleted of specific reactivity by
incubation with purified His-HST protein bound to Ni2+-NTA resin.
For Western blot analysis, cell extracts were subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to
Immobilon filters, and the membranes were saturated with 3% bovine
serum albumin (BSA) for 1 h at room temperature. The filters were
incubated with a 1:400 to 1:2,000 dilutions of the anti-STL or control
serum for 1 h at room temperature. After being washed twice for 30 min with phosphate-buffered saline (PBS) containing 0.25% Tween 20, the filters were incubated with a 1:10,000 dilution goat anti-rabbit
immunoglobulin G conjugated to horseradish peroxidase. Finally, the
filters were washed two times for 30 min as described above and
developed by enhanced chemiluminescence.
Immunofluorescence analysis was performed as follows. HeLa cell
cultures were washed with PBS, fixed for 20 min in 4%
paraformaldehyde, and washed with PBS. After treatment with 50 mM
NH4Cl for 20 min, cells were permeabilized for 10 min with
0.1% Triton X-100 and blocked with 10% BSA in PBS. The cells were
incubated with anti-STL rabbit or control serum (at a 1:200 dilution in
PBS-1% BSA) or the appropriate dilutions of the antibodies specific
for the various intracellular markers (1:100 for monoclonal
anti-ribophorin I, 1:50 for monoclonal anti-lamp2, 1:1,000 for
monoclonal antibodies specific for Bip and tubulin, and 1:400 for
monoclonal anti-T7 tag) for 1 h at room temperature. After washing
with PBS-1% BSA, the bound antibodies were revealed with fluorescein
isothiocyanate-conjugated rabbit anti-mouse antibody (1:200 dilution)
or Texas red-conjugated goat anti-rabbit antibody (1:200 dilution) by
incubation for 1 h at room temperature. Finally, the cells were
washed with PBS and the preparations were mounted with Mowiol. Images
were obtained with a Zeiss Axiophot fluorescence microscope equipped
with a high-resolution charge-coupled device (CCD) camera. For
double-fluorescence experiments, the images were superimposed with
Adobe Photoshop.
 |
RESULTS |
Identification of hStaufen-like by interaction with influenza virus
NS1 protein.
We carried out a two-hybrid screen in yeast with NS1
protein as a bait. Under the conditions used, transformation of
S. cerevisiae with plasmid pGBT-NS1 did not stimulate growth
of the cells in the absence of histidine (data not shown).
Cotransformation with a human kidney cDNA fusion library constructed in
plasmid pGAD led to the growth of about 1,000 independent clones after
screening of 2 million colonies. Only a few of them were positive in
the
-Galactosidase in situ assay, and these were further tested
after isolation of the plasmids and retransformation. One of the clones (clone C) was confirmed as positive and fulfilled all controls in the
two-hybrid interaction protocol (data not shown). Clone C was analyzed
by restriction assay and partial sequence. It contained an insert of
about 1 kb (thSTL) with an open reading frame capable of encoding a
polypeptide with homology to the Staufen protein of D. melanogaster (48) (Fig.
1A). In view of this homology, the thSTL
insert present in clone C was used to screen a standard human cDNA
library. Several
clones were identified, and the cDNA inserts were
sequenced. Although the complete sequence of the gene is not yet
available, about 3.0 kb have been characterized to date. This portion
of the cDNA contains a 471-amino-acid open reading frame and a long 3'
UTR. The predicted protein sequence is highly homologous to the
C-terminal half of the dmStaufen protein, with 38% sequence identity
and 55% sequence similarity (Fig. 1) but shows much less homology to
other members of the Staufen family of dsRNA-binding proteins. It is
remarkable that the Staufen dsRNA-binding domains, including all the
positions relevant for RNA binding, are very conserved (7).
The locations of these RNA-binding domains along hStaufen-like protein
reflect the situation found for the corresponding domains in dmStaufen
protein (Fig. 1A). These results suggest that the gene identified as an
NS1-interacting clone is the human sequence homologue of the dmStaufen
gene.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of the human sequence homologue of the
dmStaufen gene. (A) Structure of hStaufen-like protein, including the
four RNA-binding domains (hatched boxes) and the thSTL protein fragment
encoded in clone C, aligned with the structure of dmStaufen protein.
(B) Comparison of the protein sequences of dmStaufen and the protein
predicted from clones obtained by using the thSTL insert present in
clone C. Boxed residues show the positions conserved among
dsRNA-binding domains present in protein members of the dmStaufen
family (49).
|
|
The hStaufen-like gene is expressed in human cell lines and
organs.
To ascertain whether the cDNA identified in the two-hybrid
screen indeed corresponds to a gene expressed in human cells, we carried out Northern analyses using poly(A)+ RNA from human
cell lines and organs. Cytoplasmic poly(A)+ RNA was
isolated from three human cell lines (293, HeLa, and IM9) and assayed
by Northern blotting. In addition, we tested premade blots generated
with RNA from a variety of human organs (Clontech). The results are
presented in Fig. 2. A single
hybridization band was apparent, both in the three cell lines tested
(Fig. 2A) and in several of the organs assayed (Fig. 2B). The size of
the transcript detected was around 4 to 4.5 kb, and some variation in
mobility was observed among the transcripts derived from various organs. The hStaufen-like mRNA was most abundant in the heart, liver,
muscle, testis, and ovary (Fig. 2B).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Characterization of hStaufen-like mRNA by Northern blot
hybridization. Poly(A)+ RNA from human cell lines (A) or
human organs (B) was separated by denaturing agarose gel
electrophoresis and probed with a thSTL-specific probe or a -actin
probe as described in Materials and Methods. Size of molecular weight
markers are indicated in kilobases to the left.
|
|
Characterization of the hStaufen-like protein.
To characterize
the hStaufen-like protein, we used a monospecific antiserum generated
by immunization of rabbits with the thSTL recombinant protein encoded
in clone C (see Materials and Methods and Fig. 1A). The specificity of
the anti-STL serum was ascertained by Western blot analysis of extracts
obtained from COS-1 cells transfected with plasmids expressing the
recombinant His-HST or His-STL protein. Specific reactive bands of the
expected sizes were clearly detectable in the extracts of
plasmid-transfected but not mock-transfected cells (data not shown).
Using purified His-STL and His-HST proteins, we checked that the
preimmune serum detected no specific reactivity and that the signal was
lost when an anti-STL serum depleted with purified His-HST protein
bound to Ni2+-NTA resin was used (Fig.
3A). The availability of the specific anti-STL serum allowed us to search for the endogenous hStaufen-like protein by Western blotting of total human cell extracts. Two reactive
bands corresponding to molecular masses of 60 to 65 kDa, as well as a
minor band of about 90 kDa, were detected. Depletion of the anti-STL
serum in a column containing purified His-HST protein abrogated
detection of the 60- to 65-kDa bands but not the minor band of 90 kDa,
indicating that the former correspond to hStaufen-like protein. No
reactivity with the preimmune serum was detected (Fig. 3B). In extracts
of rat hippocampal neurons, a protein band of 65 kDa was also
recognized by the anti-STL serum, as well as by two sera raised against
a peptide corresponding to the Staufen cDNA sequence (28a).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Characterization of hStaufen-like protein by Western
blotting. (A) Purified His-STL and His-HST proteins were analyzed by
Western blotting as indicated in Materials and Methods, using anti-STL
serum, preimmune serum, or anti-STL serum depleted with purified
His-HST protein bound to Ni2+-NTA resin. (B) Total extracts
from HeLa or 293 cells were analyzed as indicated above. Sizes of
molecular weight markers are indicated in kilodaltons to the left.
Arrows indicate the relevant protein bands.
|
|
The sequence homology of hStaufen-like and dmStaufen proteins suggested
that the former should behave as an RNA-binding protein. To test this
prediction, we used plasmid pRHST, which contained the cDNA sequence
corresponding to the RNA-binding domains of the hStaufen-like protein
(Fig. 1B) subcloned into pRSET vector. This allowed expression of
His-HST in E. coli and its purification in a
Ni2+-NTA resin. The purified recombinant protein (Fig.
4, inset) was used for in vitro binding
assays with a probe containing the 3' UTR of bicoid mRNA.
High-affinity interaction was detected (Fig. 4), with an apparent
Kd of approximately 10
9 M. Similar
interaction was observed with another highly structured RNA probe
derived from an influenza virus-chloramphenicol acetyltransferase chimeric gene (NSZ probe) (41), but the affinity for binding to a single-stranded probe [polyU)] was less (Fig. 4).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
RNA-binding properties of hStaufen-like protein. Fixed
amounts of labeled RNA probe (10,000 cpm) were incubated with
increasing amounts of purified His-HST protein. The protein-bound probe
was determined by filtration on a nitrocellulose filter. The results
are presented as percentage of maximal retained probe and are averages
and standard deviations of two to four independent experiments. The
insert shows the purified His-HST protein used in the RNA-binding
assays as analyzed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and Coomassie blue staining. Closed circles, His-HST
protein/bicoid probe; open circles, His-HST protein/poly(U) probe;
triangles, BSA/bicoid probe.
|
|
hStaufen-like protein localizes to the endoplasmic reticulum.
We next studied the intracellular localization of hStaufen-like
protein. To this end we used the anti-STL serum; its specificity at the
cytological level was verified first. Cultures of HeLa cells were
transfected with plasmid pCMV-STL, which encodes a His-tagged thSTL
protein. The fixed cells were analyzed by immunofluorescence using an
anti-T7 tag antibody or the anti-STL antiserum. The results are
presented in Fig. 5. The staining
patterns obtained with both reagents were essentially identical (Fig.
5A to C), confirming that the anti-STL serum specifically recognizes
the thSTL protein. We observed a more intense pattern of staining next
to the nucleus but also irradiating toward the cell periphery. The use
of the mild detergent saponin before fixation did not result in a great loss of staining (data not shown), suggesting the interaction of thSTL
to membrane or cytoskelton constitutents. As expected, depletion of the
serum with purified His-HST protein bound to Ni2+-NTA resin
diminished the signal to a large extent (Fig. 5D to F) and the
preimmune serum revealed no specific staining pattern (data not shown).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 5.
Immunofluorescence analysis of hStaufen-like in
transfected HeLa cells. (A and B) Cultures of HeLa cells transfected
with plasmid pCMV-STL, fixed, and processed for immunofluorescence as
indicated in Materials and Methods, using anti-STL serum (A) and
anti-T7 tag monoclonal antibody (B). (C) Overlay of the preceding
images. (D) Anti-STL serum depleted with purified His-HST protein bound
to Ni2+-NTA resin. (E) Anti-T7 tag monoclonal antibody. (F)
Overlay of the preceding images. In these analyses, staining with
anti-STL serum and with anti-STL serum depleted with purified His-HST
protein were carried out under identical conditions, including
dilutions of the sera and exposure times.
|
|
To determine the precise localization of endogenous hStaufen-like
protein, we carried out double-immunofluorescence experiments using a
variety of cellular markers (Fig. 6 and
7). Partial colocalization of
hStaufen-like protein with the endoplasmic reticulum (Fig. 6 to C; Bip
marker) as well as a more precise colocalization with the rough
endoplasmic reticulum (Fig. 6D to F; ribophorin marker) were observed.
In contrast, no colocalization was detected with markers of either the
endocytic pathway (Fig. 7A to C; lamp2 marker) or the cytoskeleton
(Fig. 7D to F; tubulin marker). The partial overlapping of
hStaufen-like staining and the Golgi apparatus (Fig. 7G to I; mannII
marker) does not allow us to exclude its presence in this organelle,
but the hStaufen-like staining pattern did not correspond to a typical
Golgi distribution. Therefore, we conclude from the cytological data
that the hStaufen-like protein is associated with the rough
endoplasmic reticulum.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
Colocalization of hStaufen-like with rough endoplasmic
reticulum. (A and B) Cultures of HeLa cells fixed and processed for
immunofluorescence as indicated in Materials and Methods and the legend
to Fig. 5, using anti-STL serum (A) and anti-Bip monoclonal antibody
(B). (C) Overlay of the preceding images. (D) Anti-STL serum. (E)
Anti-ribophorin I monoclonal antibody. (F) Overlay of the preceding
images.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
Double-immunofluorescence studies with hStaufen-like and
cellular markers. (A and B) cultures of HeLa cells fixed and processed
for immunofluorescence as indicated in Materials and Methods and the
legend to Fig. 5, using anti-STL serum (A) and anti-lamp2 monoclonal
antibody (B). (C) Overlay of the preceding images. (D) Anti-STL serum.
(E) Antitubulin monoclonal antibody. (F) Overlay of the preceding
images. (G) Anti-STL serum. (H) Anti-mannII monoclonal antibody. (I)
Overlay of the preceding images.
|
|
The hStaufen-like protein is associated with polysomes.
In
view of the presence of hStaufen-like in the rough endoplasmic
reticulum fraction, we examined whether it is associated with
polysomes. Cultures of HeLa cells were fractionated by lysis with
Nonidet P-40, and the polysomes were isolated from the cytoplasmic fraction by sedimentation on sucrose gradients as indicated in Materials and Methods. Each fraction was tested for the presence of
hStaufen-like protein, using anti-STL serum, and for the presence of
ribosomes, using an rDNA probe or an anti-P-protein serum (data not
shown). The results are presented in Fig.
8. hStaufen-like protein was not present
as a soluble protein; rather, it cosedimented with the ribosomes and
the polysomes (Fig. 8A). To verify that the fast-sedimenting forms in
the gradient corresponded to polysomes, the cytoplasmic fraction was
treated with EDTA before centrifugation. Under these conditions, the
ribosomal subunits should dissociate from the mRNAs and sediment more
slowly; indeed, we observed the accumulation of rRNA marker in
slow-sedimenting forms (Fig. 8C). This mobility shift was also apparent
for hStaufen-like protein, which under these conditions was not present
in the bottom fractions of the gradient and accumulated with the
ribosomal marker (Fig. 8C). Alternatively, the cell cultures were
incubated with puromycin before preparation of cytoplasmic extracts
(Fig. 8B). As with EDTA treatment, the dissociation of polysomes, shown
by the disappearance of fast-sedimenting ribosomes, correlated with a
parallel loss of hStaufen-like from the bottom fractions of the
gradient (Fig. 8B). These results indicate that the hStaufen-like
protein is present in the cell in association with the polysome
complexes.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
Association of hStaufen-like protein with polysomes.
Soluble extracts of HeLa cells were centrifuged in a sucrose gradient
as described in Materials and Methods. (A) Untreated extracts. The
fractions were analyzed by Western blotting using anti-STL serum. In
addition, aliquots of each fraction were used to isolate RNA to carry
out dot blot hybridization with an rDNA probe as indicated in Materials
and Methods. (B) Extracts from cultures treated with puromycin. The
cultures were treated with puromycin (100 µg/ml) for 60 min prior to
preparation of cytoplasmic extracts. (C) Extracts treated with EDTA.
The extracts prepared as described above were treated with 25 mM EDTA
and separated as indicated except that the sucrose gradient was
adjusted to 25 mM EDTA. The fractions were analyzed as described for
panel A. Sizes of molecular weight markers are indicated in kilodaltons
to the right.
|
|
 |
DISCUSSION |
In the course of a two-hybrid screen with influenza virus NS1
protein as a bait, we identified a human cDNA (thSTL) with high sequence homology to dmStaufen protein. The encoded protein was shown
to colocalize in vivo and to interact in vitro with NS1 protein by
coimmunoprecipitation (19a). The possible significance of
this interaction for influenza virus infection is under investigation.
Characterization of hStaufen-like protein.
In view of the high
homology between the RNA-binding regions of the protein encoded in the
thSTL clone and those of dmStaufen protein, longer cDNA clones were
identified and sequenced. The predicted protein showed strong
conservation of four of the dsRNA-binding domains present in dmStaufen
protein (Fig. 1B), although no such a conservation was observed in
comparison to other members of the dsRNA-binding protein family
(49). We therefore concluded that the cDNA obtained probably
corresponds to a human homologue of dmStaufen.
Previous reports in the literature did not provide much information
about possible human homologues of the dmStaufen protein. The use of a
cDNA probe for in situ hybridization on mitotic spreads indicated a
single-copy gene located at band 20q13.1 (11). We took
advantage of the isolation of cDNAs corresponding to the thSTL clone to
investigate the pattern of expression of hStaufen-like mRNAs and to
study the RNA-binding properties and the intracellular localization of
hStaufen-like protein.
The Northern analysis clearly indicated differences in the expression
level of the gene in several human organs. Consistent with the function
assigned for dmStaufen protein in D. melanogaster early
development, we found abundant expression of hStaufen-like gene in both
human testis and ovary (Fig. 2B). In addition, several organs in which
muscular tissue is present proved positive for hStaufen-like
expression. In contrast, we could detect only low-level hStaufen-like
gene expression in the brain.
The characterization of hStaufen-like protein in cultured human cells
included the evaluation of its apparent molecular weight by Western
blotting. We observed prominent bands, with mobilities corresponding to
about 60 to 65 kDa, in HeLa and 293 cells (Fig. 3B), as well as in IM9
lymphocytes or human neuroblastoma cells (data not shown).
hStaufen-like protein might have been present in more than one isoform;
indeed, small differences were observed in the mobilities of the mRNAs
detected in various organs (Fig. 2B). The specificity of this signal
was corroborated by its absence in Western blotting experiments using a
hStaufen-like serum that had been depleted with a Ni2+-NTA
resin containing purified His-HST protein (Fig. 3B). The detection of a
65-kDa protein band with identical mobility using sera raised against a
Staufen peptide (28a) indicates that the 60- to 65-kDa
protein bands detected are indeed the products of hStaufen-like gene
and not cross-reacting proteins. The significance of additional signals
observed with mobilities corresponding to about 90 kDa is not clear at present.
Next, the RNA-binding properties of the hStaufen-like protein were
studied by means of purified His-HST protein, the portion of the
polypeptide that contains four dsRNA-binding domains homologous to
dmStaufen. High-affinity binding to the 3' UTR bicoid probe could be observed and an apparent Kd of about
10
9 M was determined, but its affinity of binding to
poly(U) was smaller (Fig. 4), indicating that hStaufen-like is a
dsRNA-binding protein, as inferred from its amino acid sequence. The
high-affinity binding of hStaufen-like to the bicoid probe
cannot be interpreted as demonstrating that an mRNA of this sequence is
the physiological target of hStaufen-like in human cells, since other
dsRNA probes showed similar affinities of binding (data not shown). The
identification of the relevant RNAs that interact with hStaufen-like in
vivo represents a fundamental research objective for the future.
The characterization of hStaufen-like protein also included the study
of its intracellular localization. Indirect immunofluorescence with
anti-STL serum showed a granular cytoplasmic staining, more intense
around the nucleus (Fig. 6). Double-immunofluorescence experiments
demonstrated that it associates mainly with the rough endoplasmic
reticulum (Fig. 6). Within the limits of detection of this technique,
the endogenous hStaufen-like protein did not colocalize with a variety
of markers representative of other cell compartments such as endosomes,
cytoskeleton, or Golgi apparatus and could not be detected in the
nucleus (Fig. 7), although some nucleolar staining was apparent when
the thSTL protein fragment was expressed by transfection (Fig. 5).
Analyses of extracts from HeLa cells indicated that hStaufen-like
protein cosedimented with ribosomes and polysomes, and its association
with the latter was confirmed by the change in sedimentation properties
observed upon in vivo disruption of polysomes by puromycin treatment
(Fig. 8B) or their in vitro dissociation by EDTA treatment (Fig. 8C).
Such a protein distribution is reminiscent of the localization of the protein kinase PKR, a fraction of which is associated to ribosomes and
polysomes (53).
As a whole, the results presented in this report support the notion
that the human homologue of dmStaufen protein is a dsRNA-binding protein and that it may be related to the localization and/or the
translation of cellular mRNA.
Possible functions of hStaufen-like in mRNA localization.
The
characterization of hStaufen-like reported here provides only
circumstantial evidence about its function in human cells. The role of
dmStaufen protein in the early stages of D. melanogaster development is well established. It binds specifically, but not necessarily directly to, some mRNAs, such as oskar mRNA or
bicoid mRNA, and allows their localization at opposite poles
in the oocyte and early embryo, respectively (48). This
precise localization is required to express the oskar and
bicoid gene products only at those sites. The expression of
oskar induces the formation of the pole plasm, which will
determine the posterior pole of the embryo. The importance of its
localization is stressed by the phenotype of mutants in which its
expression is produced ectopically (16). On the other hand,
the localized translation of bicoid mRNA allows the
formation of an anterior-posterior gradient of bicoid
protein, opposite that formed by nanos protein, that
determines the formation of the head and thorax (50). The
transport and retention of bicoid mRNA at the anterior pole
is mediated by the formation of large ribonucleoprotein complexes that
include dmStaufen protein and require the presence of specific
sequences located at the 3' UTR of the mRNA (18). These
large complexes involve not only RNA-protein interactions but also
intermolecular RNA-RNA interactions (19). In this context,
it should be mentioned that despite the high-affinity interaction
observed between hStaufen-like protein and the bicoid 3' UTR
probe in solution (Fig. 4), we detected no retention of the same probe
by His-HST protein immobilized on a Ni2+-NTA resin (data
not shown). The large dmStaufen-bicoid mRNA particles seem
to move along microtubule bundles to the anterior pole (18), although localization of oskar mRNA also requires
tropomyosin (17). In the case of hStaufen-like, the
expression of the gene in ovaries and testis is compatible with a role
in development, but so far we have no direct evidence to support such a possibility.
Recent evidence indicates that dmStaufen also plays a role in somatic
cells. Thus, dmStaufen protein interacts with prospero mRNA
by binding to its 3' UTR and mediates, in cooperation with inscuteable, its accumulation its accumulation in the basal
area of neuroblasts (5, 6, 31; reviewed in reference
8), leading to an asymmetrical distribution of this
mRNA in the progeny cells. Such specific localization of mRNAs is
reminiscent of similar phenomena described for specialized
mammalian cells. Thus, specific intracellular localization of the
mRNAs encoding different isoforms of actin, myelin-binding
protein, and creatine kinase has been described (27, 51,
52). Furthermore, this specific localization can operate on
microinjected myelin-binding protein mRNA (1). Recently, a
protein factor present in certain stages of X. laevis has
been implicated in the localization of Vg1 mRNA (12, 35). It
is noteworthy that this so called Vera protein accumulates in the rough
endoplasmic reticulum (12) as we describe for hStaufen-like protein. It is tempting to speculate that the hStaufen-like protein characterized in this report might also play a role in these
localization processes in somatic cells. Thus, a similar rat
Staufen-like homologue accumulates in dendrites but not in the axons of
neurons in culture (28a).
Is hStaufen-like involved in regulation of mRNA translation?
The dmStaufen protein belongs to a family of proteins that share a
number of dsRNA-binding domains and include, among others, PKR, TAR
RNA-binding protein (TRBP), and its homologue in X. laevis, Xlrbpa (13, 24, 49). PKR is a protein kinase that can be activated by interaction with dsRNA and specifically phosphorylates the
subunit of protein synthesis initiation factor eIF2. This modification abolishes its recycling and therefore inhibits protein synthesis. On the other hand, TRBP is essential for human
immunodeficiency virus replication, although its function in the
uninfected cell may be related to efficient gene expression. Thus, it
has been shown that TRBP interacts with PKR in a manner that may be RNA independent (3, 9) and inhibits its activity. It is
conceivable that TRBP blocks PKR activation by binding to dsRNA regions
in the mRNAs, therefore avoiding their interaction to the dsRNA-binding domain of PKR, but it is also possible that the observed inhibition is
exerted by directly blocking PKR through protein-protein interaction. Since both PKR and TRBP, as well as Xlrbpa, are found associated to the
ribosome (13, 53), TRBP could be involved in establishing an
appropriate milieu for mRNA translation by local inhibition of the PKR
protein bound to the ribosome. In this regard, it should be mentioned
that these proteins do not show sequence specificity for RNA binding
and therefore could act as general cellular factors. In contrast,
dmStaufen has been shown to colocalize specifically with certain mRNA
targets (8, 47). We presume that hStaufen-like would show
preferential binding to specific mRNAs in human cells. Since it is
associated with polysomes, it is conceivable that it plays a dual role:
(i) positioning specific mRNAs at given sites in the cell and (ii)
stimulating their translation at the site. These roles are consistent
with the activity of dmStaufen in mRNA localization (47),
with the localization of the rat homologue of hStaufen-like in
dendrites of hippocampal neurons (28a), and with the
diminished translation of oskar mRNA in D. melanogaster Staufen mutants lacking bruno activity
(29).
 |
ACKNOWLEDGMENTS |
We are indebted to A. Nieto, M. Kiebler, I. Mattaj, J. A. Melero, and T. Zürcher for critical comments on the manuscript. We thank F. Becker, A. Ephrussi, J. P. García-Ballesta, J. Krijnse-Locker, B. Moss, and J. Renard for providing biological
materials. The technical assistance of J. Fernández is gratefully acknowledged.
P.F. and R.M.M. were fellows from Programa Nacional de Formación
de Personal Investigador. This work was supported by Programa Sectorial
de Promoción General del Conocimiento (grant PB94-1542).
The first two authors contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centro Nacional
de Biotecnología (CSIC), Cantoblanco, 28049 Madrid, Spain.
Phone: 3491 585 4557. Fax: 3491 585 4506. E-mail
jortin{at}cnb.uam.es.
Present address: European Molecular Biology Laboratory, 69012 Heidelberg, Germany.
 |
REFERENCES |
| 1.
|
Ainger, K.,
D. Avossa,
F. Morgan,
S. J. Hill,
C. Barry,
E. Barbarese, and J. H. Carson.
1993.
Transport and localization of exogenous myelin basic protein mRNA microinjected into oligodendrocytes.
J. Cell Biol.
123:431-441[Abstract/Free Full Text].
|
| 2.
|
Bassell, G., and R. H. Singer.
1997.
mRNA and cytoskeletal filaments.
Curr. Opin. Cell Biol.
9:109-115[Medline].
|
| 3.
|
Benkirane, M.,
C. Neuveut,
R. F. Chun,
S. M. Smith,
C. E. Samuel,
A. Gatignol, and K. T. Jeang.
1997.
Oncogenic potential of TAR RNA binding protein TRBP and its regulatory interaction with RNA-dependent protein kinase PKR.
EMBO J.
16:611-624[Medline].
|
| 4.
|
Berleth, T.,
M. Burri,
G. Thoma,
D. Bopp,
S. Richstein,
G. Frigerio,
M. Noll, and C. Nüsslein-Volhard.
1988.
The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo.
Cell
7:1749-1756.
|
| 5.
|
Broadus, J., and C. Q. Doe.
1997.
Extrinsic cues, intrinsic cues and microfilaments regulate asymmetric protein localization in Drosophila neuroblasts.
Curr. Biol.
7:827-835[Medline].
|
| 6.
|
Broadus, J.,
S. Fuerstenberg, and C. Q. Doe.
1998.
Staufen-dependent localization of prospero mRNA contributes to neuroblast daughter-cell fate.
Nature
391:792-795[Medline].
|
| 7.
|
Bycroft, M.,
S. Grunert,
A. G. Murzin,
M. Proctor, and D. St Johnston.
1995.
NMR solution structure of a dsRNA binding domain from Drosophila staufen protein reveals homology to the N-terminal domain of ribosomal protein S5.
EMBO J.
14:3563-3571[Medline].
|
| 8.
|
Campos-Ortega, J. A.
1997.
Dynastic intrincacies of neuroblast division.
Curr. Biol.
7:R726-R728[Medline].
|
| 9.
|
Cosentino, G. P.,
S. Venkatesan,
F. C. Serluca,
S. R. Green,
M. B. Mathews, and N. Sonenberg.
1995.
Double-stranded-RNA-dependent protein kinase and TAR RNA-binding protein form homo- and heterodimers in vivo.
Proc. Natl. Acad. Sci. USA
92:9445-9449[Abstract/Free Full Text].
|
| 10.
|
de la Luna, S.,
P. Fortes,
A. Beloso, and J. Ortín.
1995.
Influenza virus NS1 protein enhances the rate of translation initiation of viral mRNAs.
J. Virol.
69:2427-2433[Abstract].
|
| 11.
|
DesGroseillers, L., and N. Lemieux.
1996.
Localization of a human double-stranded RNA-binding protein gene (STAU) to band 20q13.1 by fluorescence in situ hybridization.
Genomics
36:527-529[Medline].
|
| 12.
|
Deshler, J. O.,
M. I. Highett, and B. J. Schnapp.
1997.
Localization of Xenopus Vg1 mRNA by Vera protein and the endoplasmic reticulum.
Science
276:1128-1131[Abstract/Free Full Text].
|
| 13.
|
Eckmann, C. R., and M. F. Jantsch.
1997.
Xlrbpa, a double-stranded RNA-binding protein associated with ribosomes and heterogeneous nuclear RNPs.
J. Cell Biol.
138:239-253[Abstract/Free Full Text].
|
| 14.
|
Enami, K.,
T. A. Sato,
S. Nakada, and M. Enami.
1994.
Influenza virus NS1 protein stimulates translation of the M1 protein.
J. Virol.
68:1432-1437[Abstract/Free Full Text].
|
| 15.
|
Ephrussi, A.,
L. K. Dickinson, and R. Lehmann.
1991.
Oskar organizes the germ plasm and directs localization of the posterior determinant nanos.
Cell
66:37-50[Medline].
|
| 16.
|
Ephrussi, A., and R. Lehmann.
1992.
Induction of germ cell formation by oskar.
Nature
358:387-392[Medline].
|
| 17.
|
Erdelyi, M.,
A. M. Michon,
A. Guichet,
J. B. Glotzer, and A. Ephrussi.
1995.
Requirement for Drosophila cytoplasmic tropomyosin in oskar mRNA localization.
Nature
377:524-527[Medline].
|
| 18.
|
Ferrandon, D.,
L. Elphick,
C. Nusslein Volhard, and D. St Johnston.
1994.
Staufen protein associates with the 3'UTR of bicoid mRNA to form particles that move in a microtubule-dependent manner.
Cell
79:1221-1232[Medline].
|
| 19.
|
Ferrandon, D.,
I. Koch,
E. Westhof, and V. C. Nusslein.
1997.
RNA-RNA interaction is required for the formation of specific bicoid mRNA 3' UTR-Staufen ribonucleoprotein particles.
EMBO J.
16:1751-1758[Medline].
|
| 19a.
| Fortes, P. Unpublished data.
|
| 20.
|
Fortes, P.,
A. Beloso, and J. Ortín.
1994.
Influenza virus NS1 protein inhibits pre-mRNA splicing and blocks RNA nucleocytoplasmic transport.
EMBO J.
13:704-712[Medline].
|
| 21.
|
Fortes, P.,
A. I. Lamond, and J. Ortín.
1995.
Influenza virus NS1 protein alters the subnuclear localization of cellular splicing components.
J. Gen. Virol.
76:1001-1007[Abstract/Free Full Text].
|
| 22.
|
Fuerst, T. R.,
P. L. Earl, and B. Moss.
1987.
Use of a hybrid vaccinia virus-T7 RNA polymerase system for expression of target genes.
Mol. Cell. Biol.
7:2538-2544[Abstract/Free Full Text].
|
| 23.
|
Garner, C. C.,
R. P. Tucker, and A. Matus.
1988.
Selective localization of messenger RNA for cytoskeletal protein MAP2 in dendrites.
Nature
336:674-677[Medline].
|
| 24.
|
Gatignol, A.,
C. Buckler, and K. T. Jeang.
1993.
Relatedness of an RNA-binding motif in human immunodeficiency virus type 1 TAR RNA-binding protein TRBP to human P1/dsI kinase and Drosophila Staufen.
Mol. Cell. Biol.
13:2193-2202[Abstract/Free Full Text].
|
| 25.
|
Gluzman, Y.
1981.
SV40 transformed simian cells support the replication or early SV40 mutants.
Cell
23:175-182[Medline].
|
| 26.
|
Hatada, E.,
S. Saito,
N. Okishio, and R. Fukuda.
1997.
Binding of the influenza virus NS1 protein to model genome RNAs.
J. Gen. Virol.
78:1059-1063[Abstract].
|
| 27.
|
Hill, M. A., and P. Gunning.
1993.
Beta and gamma actin mRNAs are differentially located within myoblasts.
J. Cell Biol.
122:825-832[Abstract/Free Full Text].
|
| 28.
|
Hortsch, M.,
D. Avossa, and D. I. Meyer.
1986.
Characterization of secretory protein translocation: ribosome-membrane interaction in endoplasmic reticulum.
J. Cell Biol.
103:241-253[Abstract/Free Full Text].
|
| 28a.
| Kiebler, M. A., I. Hemraj, P. Verkade, M. Köhrmann, P. Fortes, R. M. Marión, J. Ortín, and C. Dotti. The mammalian Staufen protein
localizes to the somatodendritic domain of cultured hippocampal
neurons: implications for its involvement in mRNA transport. J. Neurosci., in press.
|
| 29.
|
Kim-Ha, J.,
K. Kerr, and P. M. MacDonald.
1995.
Translational regulation of oskar mRNA by Bruno, an ovarian RNA-binding protein, is essential.
Cell
81:403-412[Medline].
|
| 30.
|
Ku, M., and D. A. Melton.
1993.
Xwnt-11: a maternally expressed Xenopus wnt gene.
Developments
119:1161-1173.
|
| 31.
|
Li, P.,
X. Yang,
M. Wasser,
Y. Cai, and W. Chia.
1997.
Inscuteable and Staufen mediate asymmetric localization and segregation of prospero RNA during Drosophila neuroblast cell divisions.
Cell
90:437-447[Medline].
|
| 32.
|
Lu, Y.,
X. Y. Qian, and R. M. Krug.
1994.
The influenza virus NS1 protein: a novel inhibitor of pre-mRNA splicing.
Genes Dev.
8:1817-1828[Abstract/Free Full Text].
|
| 33.
|
Marión, R. M.,
T. Aragón,
A. Beloso,
A. Nieto, and J. Ortín.
1997.
The N-terminal half of the influenza virus NS1 protein is sufficient for nuclear retention of mRNA and enhancement of viral mRNA translation.
Nucleic Acids Res.
25:4271-4277[Abstract/Free Full Text].
|
| 34.
|
Mosquera, L.,
C. Forristall,
Y. Zhou, and M. L. King.
1993.
A mRNA localized to the vegetal cortex of Xenopus oocytes encodes a protein with a nanos-like zinc finger domain.
Development
117:377-386[Abstract].
|
| 35.
|
Mowry, K. L.
1996.
Complex formation between stage-specific oocyte factors and a Xenopus mRNA element.
Proc. Natl. Acad. Sci. USA
93:14608-14613[Abstract/Free Full Text].
|
| 36.
|
Neuman, S. F., and T. Schupbach.
1994.
Dorsoventral axis formation in Drosophila depends on the correct dosage of the gene gurken.
Development
120:2457-2463[Abstract/Free Full Text].
|
| 37.
|
Ortín, J.
1998.
Multiple levels of post-transcriptional regulation of Influenza virus gene expression.
Semin. Virol.
3:335-342.
|
| 38.
|
Ortín, J., and W. Doerfler.
1975.
Transcription of the genome of adenovirus type 12: I. Viral mRNA in abortively infected and transformed cells.
J. Virol.
15:27-35[Abstract/Free Full Text].
|
| 39.
|
Ortín, J.,
R. Nájera,
C. López,
M. Dávila, and E. Domingo.
1980.
Genetic variability of Hong Kong (H3N2) influenza viruses: spontaneous mutations and their location in the viral genome.
Gene
11:319-331[Medline].
|
| 40.
|
Park, Y. W., and M. G. Katze.
1995.
Translational control by influenza virus. Identification of cis-acting sequences and trans-acting factors which may regulate selective viral mRNA translation.
J. Biol. Chem.
270:28433-28439[Abstract/Free Full Text].
|
| 41.
|
Perales, B., and J. Ortín.
1997.
The influenza A virus PB2 polymerase subunit is required for the replication of viral RNA.
J. Virol.
71:1381-1385[Abstract].
|
| 42.
|
Qiu, Y., and R. M. Krug.
1994.
The influenza virus NS1 protein is a poly(A)-binding protein that inhibits nuclear export of mRNAs containing poly(A).
J. Virol.
68:2425-2432[Abstract/Free Full Text].
|
| 43.
|
Qiu, Y.,
M. Nemeroff, and R. M. Krug.
1995.
The influenza virus NS1 protein binds to a specific region in human U6 snRNA and inhibits U6-U2 and U6-U4 snRNA interactions during splicing.
RNA
1:304-316[Abstract].
|
| 44.
|
Rose, J. K.,
L. Buonocore, and M. A. Whitt.
1991.
A new cationic liposome reagent mediating nearly quantitative transfection of animal cells.
BioTechniques
10:520-525[Medline].
|
| 45.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Seong, B. L., and G. G. Brownlee.
1992.
A new method for reconstituting influenza polymerase and RNA in vitro: a study of the promoter elements for cRNA and vRNA synthesis in vitro and viral rescue in vivo.
Virology
186:247-260[Medline].
|
| 47.
|
St Johnston, D.
1995.
The intracellular localization of messenger RNAs.
Cell
81:161-170[Medline].
|
| 48.
|
St Johnston, D.,
D. Beuchle, and C. Nusslein-Volhard.
1991.
Staufen, a gene required to localize maternal RNAs in the Drosophila egg.
Cell
66:51-63[Medline].
|
| 49.
|
St Johnston, D.,
N. H. Brown,
J. G. Gall, and M. Jantsch.
1992.
A conserved double-stranded RNA-binding domain.
Proc. Natl. Acad. Sci. USA
89:10979-10983[Abstract/Free Full Text].
|
| 50.
|
St Johnston, D., and C. Nusslein-Volhard.
1992.
The origin of pattern and polarity in the Drosophila embryo.
Cell
68:201-19[Medline].
|
| 51.
|
Trapp, B. D.,
T. Moench,
M. Pulley,
E. Barbosa,
G. Tennekoon, and J. Griffin.
1987.
Spatial segregation of mRNA encoding myelin-specific proteins.
Proc. Natl. Acad. Sci. USA
84:7773-7777[Abstract/Free Full Text].
|
| 52.
|
Wilson, I. A.,
K. M. Brindle, and A. M. Fulton.
1995.
Differential localization of the mRNA of the M and B isoforms of creatine kinase in myoblasts.
Biochem. J.
308:599-605.
|
| 53.
|
Zhu, S.,
P. R. Romano, and R. C. Wek.
1997.
Ribosome targeting of PKR is mediated by two double-stranded RNA-binding domains and facilitates in vivo phosphorylation of eukaryotic initiation factor-2.
J. Biol. Chem.
272:14434-14441[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 1999, p. 2212-2219, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Maroto, M., Fernandez, Y., Ortin, J., Pelaez, F., Cabello, M. A.
(2008). Development of an HTS Assay for the Search of Anti-influenza Agents Targeting the Interaction of Viral RNA with the NS1 Protein. J Biomol Screen
13: 581-590
[Abstract]
-
Yamaguchi, Y., Oohinata, R., Naiki, T., Irie, K.
(2008). Stau1 negatively regulates myogenic differentiation in C2C12 cells.. GENES CELLS
13: 583-592
[Abstract]
[Full Text]
-
Lebeau, G., Maher-Laporte, M., Topolnik, L., Laurent, C. E., Sossin, W., DesGroseillers, L., Lacaille, J.-C.
(2008). Staufen1 Regulation of Protein Synthesis-Dependent Long-Term Potentiation and Synaptic Function in Hippocampal Pyramidal Cells. Mol. Cell. Biol.
28: 2896-2907
[Abstract]
[Full Text]
-
Katahira, J., Miki, T., Takano, K., Maruhashi, M., Uchikawa, M., Tachibana, T., Yoneda, Y.
(2008). Nuclear RNA export factor 7 is localized in processing bodies and neuronal RNA granules through interactions with shuttling hnRNPs. Nucleic Acids Res
36: 616-628
[Abstract]
[Full Text]
-
Garaigorta, U., Ortin, J.
(2007). Mutation analysis of a recombinant NS replicon shows that influenza virus NS1 protein blocks the splicing and nucleo-cytoplasmic transport of its own viral mRNA. Nucleic Acids Res
35: 4573-4582
[Abstract]
[Full Text]
-
Chatel-Chaix, L., Abrahamyan, L., Frechina, C., Mouland, A. J., DesGroseillers, L.
(2007). The Host Protein Staufen1 Participates in Human Immunodeficiency Virus Type 1 Assembly in Live Cells by Influencing pr55Gag Multimerization. J. Virol.
81: 6216-6230
[Abstract]
[Full Text]
-
Burry, R. W., Smith, C. L.
(2006). HuD Distribution Changes in Response to Heat Shock but Not Neurotrophic Stimulation. J. Histochem. Cytochem.
54: 1129-1138
[Abstract]
[Full Text]
-
Liu, J., Hu, J.-Y., Wu, F., Schwartz, J. H., Schacher, S.
(2006). Two mRNA-Binding Proteins Regulate the Distribution of Syntaxin mRNA in Aplysia Sensory Neurons.. J. Neurosci.
26: 5204-5214
[Abstract]
[Full Text]
-
Baez, M. V., Boccaccio, G. L.
(2005). Mammalian Smaug Is a Translational Repressor That Forms Cytoplasmic Foci Similar to Stress Granules. J. Biol. Chem.
280: 43131-43140
[Abstract]
[Full Text]
-
Garaigorta, U., Falcon, A. M., Ortin, J.
(2005). Genetic Analysis of Influenza Virus NS1 Gene: a Temperature-Sensitive Mutant Shows Defective Formation of Virus Particles. J. Virol.
79: 15246-15257
[Abstract]
[Full Text]
-
Nakamura, Y., Makabe, K. W., Nishida, H.
(2005). POPK-1/Sad-1 kinase is required for the proper translocation of maternal mRNAs and putative germ plasm at the posterior pole of the ascidian embryo. Development
132: 4731-4742
[Abstract]
[Full Text]
-
Tretyakova, I., Zolotukhin, A. S., Tan, W., Bear, J., Propst, F., Ruthel, G., Felber, B. K.
(2005). Nuclear Export Factor Family Protein Participates in Cytoplasmic mRNA Trafficking. J. Biol. Chem.
280: 31981-31990
[Abstract]
[Full Text]
-
Dugre-Brisson, S., Elvira, G., Boulay, K., Chatel-Chaix, L., Mouland, A. J., DesGroseillers, L.
(2005). Interaction of Staufen1 with the 5' end of mRNA facilitates translation of these RNAs. Nucleic Acids Res
33: 4797-4812
[Abstract]
[Full Text]
-
Shiina, N., Shinkura, K., Tokunaga, M.
(2005). A Novel RNA-Binding Protein in Neuronal RNA Granules: Regulatory Machinery for Local Translation. J. Neurosci.
25: 4420-4434
[Abstract]
[Full Text]
-
Thomas, M. G., Tosar, L. J. M., Loschi, M., Pasquini, J. M., Correale, J., Kindler, S., Boccaccio, G. L.
(2005). Staufen Recruitment into Stress Granules Does Not Affect Early mRNA Transport in Oligodendrocytes. Mol. Biol. Cell
16: 405-420
[Abstract]
[Full Text]
-
ALLISON, R., CZAPLINSKI, K., GIT, A., ADEGBENRO, E., STENNARD, F., HOULISTON, E., STANDART, N.
(2004). Two distinct Staufen isoforms in Xenopus are vegetally localized during oogenesis. RNA
10: 1751-1763
[Abstract]
[Full Text]
-
Yoon, Y. J., Mowry, K. L.
(2004). Xenopus Staufen is a component of a ribonucleoprotein complex containing Vg1 RNA and kinesin. Development
131: 3035-3045
[Abstract]
[Full Text]
-
Villace, P., Marion, R. M., Ortin, J.
(2004). The composition of Staufen-containing RNA granules from human cells indicates their role in the regulated transport and translation of messenger RNAs. Nucleic Acids Res
32: 2411-2420
[Abstract]
[Full Text]
-
Falcon, A. M., Marion, R. M., Zurcher, T., Gomez, P., Portela, A., Nieto, A., Ortin, J.
(2004). Defective RNA Replication and Late Gene Expression in Temperature-Sensitive Influenza Viruses Expressing Deleted Forms of the NS1 Protein. J. Virol.
78: 3880-3888
[Abstract]
[Full Text]
-
Burgui, I., Aragon, T., Ortin, J., Nieto, A.
(2003). PABP1 and eIF4GI associate with influenza virus NS1 protein in viral mRNA translation initiation complexes. J. Gen. Virol.
84: 3263-3274
[Abstract]
[Full Text]
-
SAUNDERS, L. R., BARBER, G. N.
(2003). The dsRNA binding protein family: critical roles, diverse cellular functions. FASEB J.
17: 961-983
[Abstract]
[Full Text]
-
Mallardo, M., Deitinghoff, A., Muller, J., Goetze, B., Macchi, P., Peters, C., Kiebler, M. A.
(2003). From the Cover: Isolation and characterization of Staufen-containing ribonucleoprotein particles from rat brain. Proc. Natl. Acad. Sci. USA
100: 2100-2105
[Abstract]
[Full Text]
-
Roegiers, F.
(2003). Insights into mRNA transport in neurons. Proc. Natl. Acad. Sci. USA
100: 1465-1466
[Full Text]
-
Wang, W., Wyckoff, J. B., Frohlich, V. C., Oleynikov, Y., Huttelmaier, S., Zavadil, J., Cermak, L., Bottinger, E. P., Singer, R. H., White, J. G., Segall, J. E., Condeelis, J. S.
(2002). Single Cell Behavior in Metastatic Primary Mammary Tumors Correlated with Gene Expression Patterns Revealed by Molecular Profiling. Cancer Res.
62: 6278-6288
[Abstract]
[Full Text]
-
Ohashi, S., Koike, K., Omori, A., Ichinose, S., Ohara, S., Kobayashi, S., Sato, T.-A., Anzai, K.
(2002). Identification of mRNA/Protein (mRNP) Complexes Containing Puralpha , mStaufen, Fragile X Protein, and Myosin Va and their Association with Rough Endoplasmic Reticulum Equipped with a Kinesin Motor. J. Biol. Chem.
277: 37804-37810
[Abstract]
[Full Text]
-
Duchaine, T. F., Hemraj, I., Furic, L., Deitinghoff, A., Kiebler, M. A., DesGroseillers, L.
(2002). Staufen2 isoforms localize to the somatodendritic domain of neurons and interact with different organelles. J. Cell Sci.
115: 3285-3295
[Abstract]
[Full Text]
-
Palacios, I. M., Johnston, D. S.
(2002). Kinesin light chain-independent function of the Kinesin heavy chain in cytoplasmic streaming and posterior localisation in the Drosophila oocyte. Development
129: 5473-5485
[Abstract]
[Full Text]
-
Huarte, M., Sanz-Ezquerro, J. J., Roncal, F., Ortin, J., Nieto, A.
(2001). PA Subunit from Influenza Virus Polymerase Complex Interacts with a Cellular Protein with Homology to a Family of Transcriptional Activators. J. Virol.
75: 8597-8604
[Abstract]
[Full Text]
-
Saunders, P.T.K., Pathirana, S., Maguire, S.M., Doyle, M., Wood, T., Bownes, M.
(2000). Mouse staufen genes are expressed in germ cells during oogenesis and spermatogenesis. Mol Hum Reprod
6: 983-991
[Abstract]
[Full Text]
-
Zürcher, T., Marión, R. M., Ortín, J.
(2000). Protein Synthesis Shut-Off Induced by Influenza Virus Infection Is Independent of PKR Activity. J. Virol.
74: 8781-8784
[Abstract]
[Full Text]
-
Aragón, T., de la Luna, S., Novoa, I., Carrasco, L., Ortín, J., Nieto, A.
(2000). Eukaryotic Translation Initiation Factor 4GI Is a Cellular Target for NS1 Protein, a Translational Activator of Influenza Virus. Mol. Cell. Biol.
20: 6259-6268
[Abstract]
[Full Text]
-
Duchaîne, T., Wang, H.-J., Luo, M., Steinberg, S. V., Nabi, I. R., DesGroseillers, L.
(2000). A Novel Murine Staufen Isoform Modulates the RNA Content of Staufen Complexes. Mol. Cell. Biol.
20: 5592-5601
[Abstract]
[Full Text]
-
Mouland, A. J., Mercier, J., Luo, M., Bernier, L., DesGroseillers, L., Cohen, E. A.
(2000). The Double-Stranded RNA-Binding Protein Staufen Is Incorporated in Human Immunodeficiency Virus Type 1: Evidence for a Role in Genomic RNA Encapsidation. J. Virol.
74: 5441-5451
[Abstract]
[Full Text]
-
Le, S., Sternglanz, R., Greider, C. W.
(2000). Identification of Two RNA-binding Proteins Associated with Human Telomerase RNA. Mol. Biol. Cell
11: 999-1010
[Abstract]
[Full Text]
-
Köhrmann, M., Luo, M., Kaether, C., DesGroseillers, L., Dotti, C. G., Kiebler, M. A.
(1999). Microtubule-dependent Recruitment of Staufen-Green Fluorescent Protein into Large RNA-containing Granules and Subsequent Dendritic Transport in Living Hippocampal Neurons. Mol. Biol. Cell
10: 2945-2953
[Abstract]
[Full Text]
-
Runge, S., Nielsen, F. C., Nielsen, J., Lykke-Andersen, J., Wewer, U. M., Christiansen, J.
(2000). H19 RNA Binds Four Molecules of Insulin-like Growth Factor II mRNA-binding Protein. J. Biol. Chem.
275: 29562-29569
[Abstract]
[Full Text]
-
Smith, E. J., Marie, I., Prakash, A., Garcia-Sastre, A., Levy, D. E.
(2001). IRF3 and IRF7 Phosphorylation in Virus-infected Cells Does Not Require Double-stranded RNA-dependent Protein Kinase R or Ikappa B Kinase but Is Blocked by Vaccinia Virus E3L Protein. J. Biol. Chem.
276: 8951-8957
[Abstract]
[Full Text]
-
Frey, S., Pool, M., Seedorf, M.
(2001). Scp160p, an RNA-binding, Polysome-associated Protein, Localizes to the Endoplasmic Reticulum of Saccharomyces cerevisiae in a Microtubule-dependent Manner. J. Biol. Chem.
276: 15905-15912
[Abstract]
[Full Text]