INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

The process of sex determination is considered a paradigm for how gene action can influence developmental fate. Mutations that cause sex reversal have proved to be important for identifying genes involved in mammalian sex determination (5, 19, 21). In mammals, both Sry and Sox9 direct or initiate testis determination (15, 25, 50). The Sry gene is expressed within cells of the male genital ridge during a narrow window between ~10.5 and 12.5 days post coitum (dpc). This expression is not dependent on the presence of germ cells and is likely to occur in cells of the supporting lineage, resulting in their differentiation into Sertoli cells rather than follicle cells. Neither Sry nor Sox9 is expressed in the ovary.

Shortly after testis development is triggered, Sertoli cells align into visible cord-like structures (the testis cords) and begin to express Müllerian inhibiting substance (MIS), a transforming growth factor -like hormone which causes the regression of the Müllerian ducts, the anlagen of the female reproductive tract (10). In the absence of MIS, the Müllerian ducts will develop into the oviducts, uterus, and upper vagina. The generation of mice lacking a functional MIS gene has confirmed that the primary role of this hormone is in the regression of the Müllerian ducts and that MIS plays no critical role in testicular determination per se (4).

The orphan nuclear receptor, steroidogenic factor 1 (SF-1), has been directly implicated in regulating MIS gene expression by binding to a conserved upstream regulatory region (46). In addition, SF-1 is postulated to play a role in regulating the steroid hydroxylases and aromatase and in the adult mouse is expressed in all primary steroidogenic tissues, including the adrenal cortex, testicular Leydig cells, ovarian theca and granulosa cells, and corpus luteum (for a review, see reference 35). In the developing mouse embryo, SF-1 is expressed in the urogenital ridges of both sexes beginning at 9.5 dpc and is also present in fetal Sertoli cells (17). Targeted disruption of the Ftz-F1 gene in mice, which encodes SF-1, has demonstrated that SF-1 is essential for development of the hypothalamic-pituitary-gonadal axis and is essential for normal testis differentiation (28).

Targeted disruption of the Wilms' tumor suppressor gene, wt1, also produces mice displaying an arrest of gonadal development (26). During development, the wt1 gene is expressed in the indifferent gonad and then becomes localized to the Sertoli cells of the testis and granulosa and epithelial cells of the ovary (38, 39). In humans, loss-of-function germ line mutations in the wt1 gene are associated with mild effects on sexual differentiation (hypospadias and cryptorchidism) (7, 37), whereas germ line wt1 mutations producing dominant-negative products are associated with severe effects on gonadal development and sexual differentiation (male pseudohermaphroditism) (7, 36). Although the expressivity of the phenotypes associated with germ line wt1 mutations can vary, these data indicate that WT1 plays a critical role in both gonadal development and sexual differentiation. Recent experiments by Nachtigal et al. (33) have suggested that WT1 and SF-1 synergize to promote MIS expression during sexual differentiation.

The wt1 gene encodes a protein having many characteristics of a transcription factor, including a glutamine-proline-rich amino terminus, nuclear localization, and four Cys₂-His₂ zinc finger motifs (42). The three carboxy-terminal-most zinc fingers have 64% identity to the three zinc fingers of the early growth response gene-1 (EGR-1). The mRNA contains two alternative sites of translation and two alternatively spliced exons and undergoes RNA editing, thus potentially encoding 16 different protein isoforms with predicted molecular masses ranging from 52 to 65 kDa (42). The functions of the alternative translation initiation event, the RNA editing, and the first alternative splicing event (exon V) have not been well defined, although exon V can repress transcription when fused to a heterologous DNA binding domain (42). Alternative splicing of exon IX inserts or removes three amino acids (±KTS) between zinc fingers III and IV and changes the DNA binding specificity of WT1 (42). The WT1(KTS) isoforms can bind to two DNA motifs: (i) a GC-rich motif, 5' G(G/Y)GTGGGC(G/C) 3', similar to the EGR-1 binding site (41), and (ii) a (5' TCC 3')_n-containing sequence (52). The DNA binding properties of the WT1(+KTS) isoforms are not well understood, since no high-affinity, specific binding site has been elucidated for these splice variants. A number of genes involved in growth regulation and cellular differentiation contain WT1 binding sites within their promoters, and their expression can be modulated by WT1 in transfection assays (42). The wt1 gene product has the potential to mediate both transcriptional repression and activation (42).

The Dax-1 (for DSS [dosage-sensitive sex reversal]-AHC [adrenal hypoplasia congenita] critical region on the X chromosome, gene 1) gene is an orphan nuclear receptor localized to chromosome Xp21 and is thought to be important for the development of the adrenal gland and the reproductive system (3, 54). Mutations in the Dax-1 gene are associated with X-linked adrenal hypoplasia and hypogonadotropic hypogonadism (32), whereas duplication of a 160-kbp genomic region (the DSS critical region), encompassing the Dax-1 gene, is associated with male-to-female sex reversal (3). Since XY individuals with Dax-1 deleted develop as males, it has been proposed that this gene is required for ovarian, but not testicular, development (3). In the mouse, DAX-1 is first expressed in the somatic component of the genital ridge at 10.5 to 11 dpc and peaks at around 12 dpc (48). In males, the levels of DAX-1 decrease dramatically as the testis cords begin to appear, whereas in females, Dax-1 continues to be expressed throughout the gonad after 12.5 dpc (48). DAX-1 binds to DNA hairpin structures and can act as a repressor of StAR (steroidogenic acute regulatory protein) gene expression, an enzyme involved in regulation of steroid production (55). DAX-1 can also inhibit steroidogenesis by a second mechanismby binding to SF-1 and suppressing its activation properties (18). This interaction occurs through a repressor domain within the carboxy terminus of SF-1, and DAX-1 appears to serve as an adaptor molecule capable of recruiting N-CoR (nuclear receptor corepressor) to SF-1 and extending the range of corepressor function (13).

The presence of WT1 binding sites within the Dax-1 promoter (this report), the relative temporal and spatial expression of both genes in the fetal gonad, and the postulated role of both genes in gonadal differentiation raised the possibility that WT1 might regulate Dax-1 expression. In this report, we provide evidence in support of this hypothesis and suggest that WT1 is responsible for the initial activation of Dax-1 expression early in differentiation of the indifferent gonad, thus triggering a regulatory gene hierarchy implicated in sex determination.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Materials and general methods. Restriction endonucleases, calf intestinal alkaline phosphatase, the Klenow fragment of DNA polymerase I, T4 DNA ligase, and T4 DNA polymerase were purchased from New England Biolabs. D-Threo-[dichloroacetyl-1-¹⁴C]chloramphenicol (54.0 Ci/mmol) was purchased from Amersham-Pharmacia. [-³²P]ATP and [-³²P]dCTP (3,000 Ci/mmol) were purchased from New England Nuclear.

Plasmid construction. The murine and human Dax-1 promoters were cloned by PCR amplification from genomic DNA. The amplification primers used for this purpose were: (i) mDAX(s) (5' GGCAAGCTTTAGTTCCAGTGCTGAG 3') (a HindIII restriction site is underlined) and mDAX(as) (5' GAACTGCAGATGGCCTGAGGCTCCT 3') (a PstI site is underlined) for the murine promoter and (ii) hDAX(s) (5' GGCAAGCTTGAGCTCCCACGCTGCTGT 3') (a HindIII site is underlined) and hDAX(as) (5' GAACTGCAGATGGCCCGCGGCGCCC 3') (a PstI site is underlined) for the human promoter. Both promoter fragments were cloned into the HindIII-PstI sites of the promoterless pCAT expression vector (Promega). The sequences of the two promoter fragments used in this study are shown in Fig. 1B.

View larger version (167K): [in this window] [in a new window]   FIG. 1.   Comparison of WT1 and DAX-1 expression in the fetal gonad and EMSA analysis of the Dax-1 promoter. (A) Immunohistochemical analysis demonstrates colocalization of WT1 and DAX-1 signals to pre-Sertoli cells in 11.5-dpc murine testis. (B) Alignment of the murine (mDAX-1) (48) and human (hDAX-1) (54) sequences upstream of the ATG translation initiation codon. The dots represent regions which are not conserved. The characteristic TATAA box and a putative SF-1 binding site are boxed, and two potential WT1 recognition elements are underlined. The nucleotide numbering is relative to the adenosine residue of the ATG initiation codon, which is numbered as +1. (C) EMSA eliciting the DNA binding properties of WTZF(±KTS) isoforms to the Dax-1 promoter. The Dax-1 promoter was divided into two MscI fragments of 77 and 143 bp. Following preparation of radiolabeled probes, EMSAs were performed with recombinant WTZF protein as described in Materials and Methods. The nature of the input probe (5'MSC or 3'MSC), as well as the amount of recombinant protein used for the EMSA, is indicated above the gels. The position of migration of the free probe and protein-DNA complexes is indicated. Protein-DNA complexes were resolved on nondenaturing 4% polyacrylamide (acrylamide/bisacrylamide ratio, 37/1) gels electrophoresed at 4°C in 0.5× TBE (44.5 mM Tris-HCl, 44.5 mM boric acid, 1 mM EDTA). (D) DNase I footprint analysis of putative WT1 binding sites in the mDax-1 promoter. A single end-labeled probe (nucleotides +3 to 141) was incubated with increasing amounts of purified recombinant WTZF(KTS) protein (indicated above the gel). After digestion with DNase I, the samples were separated on a urea-8% polyacrylamide gel. A sequencing ladder was electrophoresed in parallel to determine the sizes of the observed fragments. Shown are the footprints obtained on the WB1 (potential WT1 binding site 1) and WB2 (potential WT1 binding site 2) sites. Although the protected region is larger than the indicated footprint, clearly WB1 and WB2 sites are encompassed.

114

106

114

106

Electrophoretic mobility shift assays (EMSAs). A truncated domain of the WT1 protein consisting of zinc fingers I to IV fused to a His₆ tag was overexpressed and purified from Escherichia coli. Essentially, sequences coding for the WT1 carboxy terminus (codons 297 to 449) were replaced by a synthetic gene fragment generated by overlap extension PCR in order to obtain favorable codon usage for expression in bacteria. Following cloning into pET15B (Novagen) and introduction into E. coli BL21(pLysS), proteins were induced under the recommended conditions (Novagen). The proteins were purified by nickel chelate affinity chromatography (Qiagen, Mississagua, Ontario, Canada) under native conditions as recommended by the manufacturer. Eluted proteins were dialyzed against a buffer containing 20 mM HEPES (pH 7.5), 70 mM KCl, 12% glycerol, 0.05% Nonidet P-40, 100 µM ZnSO₄, and 0.5 mM dithiothreitol. The purity and integrity of the fusion proteins were assessed by Coomassie blue staining of sodium dodecyl sulfate (SDS)-polyacrylamide gels.

Cell culture, transfections, and CAT assays. COS-7 and 293T cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (Gibco-BRL), penicillin, and streptomycin. For transient transfections, cells were plated at a density of 2 × 10⁵ to 5 × 10⁵ cells per 100-mm-diameter dish 24 h prior to transfection. The cells were transfected by the calcium phosphate precipitation method (45). Individual DNA precipitates were adjusted to contain equal amounts of total DNA by the addition of the empty expression vector pcDNA3. To normalize for transfection efficiency, the cells were cotransfected with 2 µg of pRSV/-gal. At 48 h after transfection, the cells were harvested and extracts were prepared and assayed for -galactosidase and chloramphenicol acetyltransferase (CAT) activity (45). Following thin-layer chromatography analysis, regions containing acetylated [¹⁴C]chloramphenicol, as well as unacetylated [¹⁴C]chloramphenicol, were quantitated by direct analysis on a phosphorimager (Fujix BAS 2000). All CAT activity values were normalized against -galactosidase values.

DNase I footprinting. The Dax-1 promoter region was isolated from plasmid pmDAX-1/CAT by digestion with HindIII and SmaI, which released a 253-bp fragment (Fig. 1B). This fragment was isolated with the QIAEX II gel extraction kit (Qiagen). This fragment was gel purified and labeled with [-³²P]dCTP (3,000 Ci/mmol) by the Klenow fill-in reaction. Recombinant WTZF(KTS) protein was preincubated for 15 min at RT with 1 µg of poly[(dI · dC) · (dI · dC)] in 50 µl of binding buffer prior to the addition of ~20,000 cpm of labeled Dax-1 fragment. After an additional 15 min at RT, 0.4 U of DNase I (Boehringer, Mannheim, Germany) was added and the incubations were continued for another 60 s. DNase I digestion was stopped by adding 200 µl of stop buffer (5 µg of tRNA, 0.3 M sodium acetate [pH 5.2]) and 2.5 volumes of ethanol. After 20 min at 70°C, the precipitate was collected by centrifugation at 12,000 × g at 4°C for 20 min. The precipitates were resuspended in 90% formamide and analyzed on a 6% polyacrylamide (acrylamide/bisacrylamide ratio, 18:1)-8 M urea gel.

Total RNA isolation, S1 nuclease analysis, and Northern blotting analysis. An HEK293 cell line expressing the WT1(+/) isoform under tetracycline regulation was established based on the expression plasmids of Gossen and Bujard (16). HEK293 cells were first transfected with p15-3/tTA (a cytomegalovirus (CMV)-driven plasmid producing a Repressor/tTA fusion protein) and SV_neo. A neomycin-resistant-colony which demonstrated tight tetracycline regulation of a test reporter plasmid (p10-3/-gal) was then used for a second round of transfection with CMV-Hygro and p10-3/WT1(+/). Twelve colonies resistant to hygromycin were tested for wt1 protein expression, and a colony showing inducibility of WT1 with no leakiness of expression (as assessed by Western blotting [see Fig. 5]) was chosen for the experiments reported here.

Immunohistochemical analysis of WT1 and DAX-1 in the fetal gonads. Mouse embryos (age, 11.5 dpc) were dissected and stored at 70°C without further fixation. Sections (7 to 10 µm thick) from tissues were cut with a cryostat, transferred onto glass slides, and fixed overnight at 20°C in methanol-EGTA. Tissue was preblocked with phosphate-buffered saline (PBS)-methanol-H₂O₂ (59.5%/40%/0.5%) for 20 min at RT. After two washing steps in H₂O and one rinse in PBS, the sections were buffered for 30 min in PBS-normal goat serum (10:1) at RT in a humidified chamber. Then anti-WT1 180 or anti-Dax-1 antibody (Santa Cruz) was applied to different sections in different dilutions ranging from 1:10 to 1:2,000, and the sections were incubated in a humidified chamber overnight at 4°C. The tissue sections were washed three times with PBS and then overlaid with biotinylated anti-rabbit antibody diluted in PBS (1:100) for 30 min. This incubation was again followed by washing the sections in PBS, after which the peroxidase reaction was performed for 20 min with the ABC Immunostain (Santa Cruz) solution and visualized with a diaminobenzidine coloring solution containing 0.01% H₂O₂ for 30 s to 4 min. The staining reaction was stopped by immersing the slides in distilled water, followed by a short counterstain in hematoxylin. The tissue sections were dehydrated by rinsing them in a series of washes with increasing ethanol concentrations (70 to 100%), washing them in xylene, and mounting them in Permount medium.

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

DAX-1 and WT1 are coexpressed in the fetal gonad. The wt1 gene is expressed very early during fetal development in both male and female indifferent gonads. WT1 transcripts can be detected in the urogenital ridge as early as 9 dpc (1), and levels remain high during development of this organ (38). On the other hand, Dax-1 gene expression in the murine gonad begins later, at ~10.5 dpc, and peaks at ~11.5 to 12.5 dpc in both males and females, as assessed by RNase protection experiments (48). In the fetal gonad, WT1 is expressed in pre-Sertoli and Sertoli cells (31, 38, 39). Immunohistochemical analysis of DAX-1 in the fetal gonad indicates that it is expressed in the same cells as WT1 in the 11.5-dpc testis (Fig. 1A). Given the essential roles of both proteins for normal sexual development, their colocalization in cells of the indifferent gonad, and their temporal expression profiles, we wished to test whether WT1 could influence Dax-1 gene expression.

The Dax-1 promoter contains two WT1 responsive elements. The sequences of the human and murine Dax-1 promoters have been previously elucidated (48, 54). The structure of the murine Dax-1 gene has been determined by restriction mapping and sequence comparison of genomic and cDNA clones (48). The immediate 5' flanking regions of the murine and human Dax-1 genes contain a putative TATA box, an SF-1 binding site, and two potential WT1 binding sites (designated WB1 and WB2 [Fig. 1B]). EMSAs have demonstrated that recombinant SF-1 protein is able to bind to the putative SF-1 response element, although it remains to be established whether SF-1 can regulate Dax-1 expression (9).

Specificity of binding of WT1 to the Dax-1 promoter. To demonstrate the specificity of the interaction between WTZF(KTS) and the putative WT1 binding sites, WB1 and WB2, a series of gel shift experiments were performed with synthetic oligonucleotides containing the WB1 or WB2 sequence. A single protein-DNA complex was obtained with oligonucleotides harboring the wild-type WB1 or WB2 sequence (Fig. 2A and C). This interaction was abrogated when either (i) a cytosine residue (underlined) in WB1 (5' GTCCCCCTC 3'), known to be necessary for WT1 binding (36), was changed to an adenosine residue (underlined) in WB1(m) (5' GTCACCCTC 3') (compare Fig. 2A and B) or (ii) a deletion was introduced into the overlapping WT1 sites in WB2 (compare Fig. 2C and D).

View larger version (95K): [in this window] [in a new window]   FIG. 2.   Specificity of WT1-Dax-1 complexes. (A to D) WTZF(KTS) recombinant protein was used in EMSAs with oligonucleotides containing the sequences corresponding to regions designated WB1 (A), WB1(m), a mutant of WB1 (B), WB2 (C), and WB2(m), a deletion mutant (D). The nucleotide sequences of the oligonucleotides are presented in Materials and Methods. The amount of recombinant WTZF protein used in the EMSAs was titrated and is indicated (in nanograms) above each lane. (E to H) Competition experiments were performed in the presence of increasing amounts (the molar excess is indicated above each lane) of an unlabeled oligonucleotide harboring either the WTE recognition site (E and G) or a mutant version of WTE (F and H). Specific complexes were preformed between WTZF(KTS) protein and an oligonucleotide containing the WB1 site (E and F) or between WTZF(KTS) protein and an oligonucleotide containing the WB2 site (G and H). Protein-DNA complexes were resolved on nondenaturing 4% polyacrylamide (acrylamide/bisacrylamide ratio, 37/1) gels electrophoresed at 4°C in 0.5× TBE. To detect the complexes, the gel was dried and exposed to X-Omat film (Kodak) at 70°C for 12 h. The positions of migration of free probe and protein-DNA complexes are indicated.

Transcriptional activation of the Dax-1 promoter by WT1. To investigate whether the WT1 binding sites within the murine and human Dax-1 promoters could mediate a transcriptional response to WT1, both promoter regions were cloned upstream of the CAT reporter gene (Fig. 3A). CMV-based expression vectors driving the production of all four alternatively spliced WT1 isoforms and two isoforms of the commonest Denys-Drash syndrome (DDS) allele (harboring a missense mutation in zinc finger III, converting ³⁹⁴Arg to ³⁹⁴Trp) were also generated. Reporter and expression vectors were then introduced into COS-7 cells and assayed for induction of CAT activity. No detectable amount of CAT activity was present in extracts prepared from untransfected COS-7 cells (Fig. 3B, "Mock" lane). Cotransfection of pmDAX-1/CAT or phDAX-1/CAT with the empty expression vector pcDNA3, resulted in a low-level production of CAT enzyme (Fig. 3B, "vector alone" lane). This basal level of CAT activity was arbitrarity set as 1. Cotransfection of 5 or 10 µg of CMV/WT1(/) expression vector produced a dose-dependent increase in CAT activity from both human and murine Dax-1 promoters (three- to sevenfold [Fig. 3B]). Similar results were obtained in human embryonic kidney 293T and simian CV-1 cells, indicating that the observed response is not cell line dependent (23) (Fig. 4A). The observed transcriptional response was dependent on the unique DNA binding specificities of the WT1(KTS) isoforms, since only those isoforms could elicit a response from the DAX-1/CAT reporter (Fig. 3C). In this experiment, isoforms containing the +KTS amino acids between zinc fingers III and IV [WT1(+/+) and WT1(/+)], or representing the commonest DDS allele [WT1(+/+, RW) and WT1(/, RW)] could not activate CAT expression above basal levels (Fig. 3C). Activation by WT1(/) and WT1(+/) was dependent on the presence of the Dax-1 promoter, since no response was observed from the parental pCAT reporter vector lacking the Dax-1 promoter (23). These results demonstrate that activation of Dax-1 gene expression by WT1 is restricted to the KTS isoforms. Since the majority of WT1 downstream targets identified to date are repressed by the wt1 tumor suppressor gene product, these results identify the Dax-1 promoter as one of the few promoters known to be activated by WT1 (42).

View larger version (24K): [in this window] [in a new window]   FIG. 3.   Transactivation of the human and murine Dax-1 promoters by WT1(KTS) isoforms. (A) Schematic representation of reporter plasmids and expression vectors. The pmDax-1/CAT and phDAX-1/CAT reporter plasmids contain genomic DNA sequences from nucleotides 218 to +3 (for mouse) and 234 to +3 (for human), respectively (Fig. 1B). The murine promoter is indicated by solid boxes, the human Dax-1 gene promoter is indicated by shaded boxes, and the CAT gene is indicated by open boxes. Expression vectors driving the production of murine WT1 isoforms are also represented. The first alternative splice site (exon V) consists of 17 amino acids (VAAGSSSSVKWTEGDSN), and the second alternative splice site consists of three amino acids (KTS). The exon boundaries of wt1 are denoted above WT1(+/+), and the positions of the first and last amino acids are indicated below each construct. (B) Transcriptional activation of the murine and human Dax-1 promoters by WT1(/). Cotransfections of COS-7 cells were performed with 1 µg of reporter plasmid and 0, 5, or 10 µg of CMV/WT1(/) expression plasmid. Individual DNA precipitates were adjusted to contain equal amounts of total DNA by the addition of the empty expression vector, pcDNA3. To normalize for transfection efficiency, the cells were cotransfected with 2 µg of pRSV/-gal. At 48 h after transfection, the cells were harvested and assayed for -galactosidase and CAT activity. The average fold activation and standard error for CAT determinations are indicated below the chromatogram and represent the value obtained from three independent experiments. (C) Effect of WT1 isoforms on the transcriptional regulation of the murine Dax-1 promoter. The average relative transactivation (normalized CAT activity) and standard error is presented, with the relative transactivation values obtained with pcDNA3 and CMV/WT1(/) taken as 0 and 100%, respectively. The values shown are taken from three independent experiments. A representative autoradiogram is shown on the right. RW indicates a missense mutation in WT1 zinc finger III converting an Arg residue to a Trp. This is the commonest DDS allele.

View larger version (14K): [in this window] [in a new window]   FIG. 4.   Mutational analysis of the Dax-1 promoter and inhibition of WT1-mediated transactivation by DDS alleles of wt1 and par-4 genes. (A) Mutational analysis of WT1 binding sites within the Dax-1 promoter. Mutations were introduced by PCR primer-directed mutagenesis to alter site WB1 (5' GTCCCCCTC 3') to WB1(m) (5' GTCACCCTC 3') and site WB2 (5' AGGAGGAGGCGG 3') to WB2(m) (5' A---GG 3') (changes are indicated in boldface, and a dash represents a deletion). Open box, wild-type WT1 binding site; filled box, mutated WT1 binding site. Transfections were performed with 1 µg of reporter plasmid, 10 µg of CMV/WT1(/) expression vector, and 2 µg of CMV/-gal. CAT and -galactosidase assays were performed with whole-cell extracts from transiently transfected COS-7 and 293T cells. The values represent the average fold activations of at least two experiments performed in duplicate. (B) DDS alleles inhibit WT1-mediated transactivation. One microgram of the pmDAX-1/CAT reporter plasmid was cotransfected into COS-7 cells with 5 µg of CMV/WT1(/) and the indicated amounts of WT1(/, RW). The total transfected DNA concentration was kept constant by the addition of empty expression vector, pcDNA3, to make up differences in amounts of expression vector between tubes. CAT activity was determined from whole-cell extracts prepared 48 h after transfection. The standard deviation for each experiment is shown by an error bar. (C) Par-4 inhibits transcriptional activation of Dax-1 by WT1(/) in a dose-dependent fashion. For these experiments, 5 µg of WT1(/) expression vector was cotransfected with 1 µg of pmDAX-1/CAT and the indicated amounts of Par-4 expression vector. The total transfected DNA concentration was kept constant by the addition of empty expression vector, pcDNA3, to make up differences in amounts between tubes. CAT activity was determined from whole-cell extracts prepared 48 h after transfection. The standard deviation for each experiment is shown by an error bar.

Activation of the endogenous Dax-1 promoter by WT1. To investigate whether ectopic expression of WT1 could modulate expression of the endogenous Dax-1 gene, a tetracycline-repressible 293 cell line was generated in which the murine WT1(+/) cDNA had been placed under control of the reverse tetracycline transactivator (16). In this system, the tetracycline analogue, doxycycline, is used to keep expression of WT1 off. Removal of doxycycline from the growth medium of this cell line results in the production of WT1(+/) protein, as determined by Western blotting of total cell extracts (Fig. 5A and D, upper panel). Although 293 cells have been reported to express WT1 protein (40), our Western blot conditions did not detect the very low amounts of endogenous WT1 protein (Fig. 5A, compare lanes 1 to 4 and 5 to 8). To examine the effects of activating WT1 expression on endogenous Dax-1 gene expression, S1 nuclease analyses were performed with complementary synthetic oligonucleotides targeting the Dax-1 mRNA. To distinguish between undigested probe and protected probe, a 50-mer oligonucleotide containing 10 noncomplementary nucleotides (adenosine residues at the 3' end were synthesized). Protection with this probe was observed only when it was hybridized to total RNA isolated from 293-WT1(+/) cells but not with total RNA from 293 cells or with control tRNA (Fig. 5B). Sense and antisense probes against GAPDH were used as controls in these experiments. To verify that both 293 and 293-WT(+/) RNA preparations contained equivalent amounts of RNA, both samples were probed for the presence of GAPDH (Fig. 5C). The observed GAPDH signal was not due to DNA contamination of the RNA preparation, since no signal was obtained with a sense GAPDH oligonucleotide (Fig. 5C).

View larger version (23K): [in this window] [in a new window]   FIG. 5.   Activation of the endogenous Dax-1 promoter by WT1. (A) Western blot analysis of WT1 expression in 293 cells and in 293 cells harboring the WT1 gene under control of the inducible tetracycline promoter. Total cell extracts were prepared with 293/Control or 293/WT1(+/) cells by sonication. Extracts were resolved by SDS-10% polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane, and immunoblotted with anti-WT1 antibody (C-19). The blot was preblocked in TBST (10 mM Tris-Cl [pH 8.0], 150 mM NaCl, 0.5% Tween-20) containing 5% skim milk for 1 h at 4°C and probed with anti-mouse antibodies (Santa Cruz) (1:1,500). Following extensive washing with TBST, the blot was incubated with a horseradish peroxidase conjugated anti-mouse antibody (1:1,500) (Santa Cruz). The immune complexes were visualized with an ECL kit from Amersham. The positions of migration of the prestained molecular mass markers (New England Biolabs) are indicated to the left. Either 90 (lanes 1 and 5), 180 (lanes 2 and 6), 360 (lanes 3 and 7), or 540 (lanes 4 and 8) µg of total cell lysate was analyzed. (B) Quantitation of Dax-1 mRNA levels in RNA preparations from 293/Control or 293/WT1(+/) cells. S1 analysis was performed with a single-stranded radioactive synthetic oligonucleotide probe directed against nucleotides +1 to +40 (relative to the translation start site) of the human Dax-1 gene mRNA as described in Materials and Methods. The products of the protection were visualized by autoradiography by exposing the dried gel to X-Omat film at 70°C overnight with an intensifying screen. (C) Quantitation of GAPDH mRNA levels in RNA preparations from 293/Control or 293/WT1(+/) cells. The products of the protection assay were analyzed on a 6% polyacrylamide-8 M urea gel, and size determinations were made by comparing the positions of migration of the products with a set of sequencing reactions which had been electrophoresed in parallel. The free probe lane is indicated as S1. The RNA sources incubated with the S1 probes are denoted at the top as tRNA, 293/Control, or 293/WT1(+/). The products of the protection were visualized by autoradiography by exposing the dried gel to X-Omat film at 70°C overnight with an intensifying screen. (D) Quality assessment of WT1-induced Dax-1 mRNA. (Upper gel) Following incubation of 293/Control or 293/WT1(+/) cells for 36 h in media lacking or containing 1 µg of doxycycline/ml (+/ Dox), cells were harvested for preparation of total protein and RNA extracts. Recombinant WT1 protein was visualized by immunoblotting, as described for panel A. (Middle gel) Total RNA was fractionated on a 6% formaldehyde-1.2% agarose gel, transferred to a nylon membrane, and probed with human Dax-1 cDNA as described in Materials and Methods. (Lower gel) The ethidium bromide (EtBr) staining of the agarose gel used for Northern blotting is shown to demonstrate that equal amounts of total RNA were loaded in each lane.

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

Dax-1 is an immediate downstream target of WT1. Our results imply a direct regulatory link between the wt1 tumor suppressor gene product and Dax-1, an unusual member of the nuclear hormone receptor superfamily (Fig. 6). There are three criteria which WT1 fulfills as an upstream regulator of Dax-1. (i) WT1 expression precedes that of DAX-1 in the urogenital ridge. In fact, very high levels of wt1 transcripts are present in the urogenital ridge of 9-dpc mouse embryos, a time when there is no detectable Dax-1 expression (1). Dax-1 transcripts are first detected in the developing indifferent murine gonads of both XX and XY embryos at 10 to 10.5 dpc; transcript levels peak at 11.5 to 12 dpc and remain fairly constant in females throughout the remainder of development, whereas in males the levels rapidly decline (48). (ii) Both DAX-1 and WT1 proteins show an overlapping spatial expression profile in the developing fetal gonad (Fig. 1A). (iii) WT1(KTS) isoforms are capable of directly transactivating Dax-1 gene expression (Fig. 3 and 5). We propose that the initial rise in Dax-1 expression in the developing male and female gonad is mediated by WT1 (Fig. 6). It is not yet clear what subsequent events uncouple expression of these genes in the male gonad. One possible effector of Dax-1 expression may be par-4, a regulator of WT1 transcriptional activity, since we have shown that Par-4 can interfere with WT1-mediated transactivation of Dax-1 in vitro (Fig. 4C). Additionally, once testicular differentiation has commenced, sequestration of Dax-1 expression to Leydig cells and wt1 expression to Sertoli cells would also clearly abrogate the WT1-DAX-1 axis in males. Alternatively, other cell-specific repressors or coactivators may contribute to this effect.

View larger version (21K): [in this window] [in a new window]   FIG. 6.   (A) Schematic representation illustrating the relative expression of gene products involved in sexual differentiation of the gonad. (B) Model depicting our results and the predicted effects on gene expression in the developing male gonad. The separate nuclear localization of WT1 isoforms is highlighted. The male-specific gene Sry is antagonized by the Dax-1 gene product (47), whereas MIS is activated via a synergistic effect of SF-1-WT1(KTS) complexes, causing regression of the female anlagen (33). As a result of WT1-mediated activation, levels of DAX-1 are increased during normal early gonadal development. Once DAX-1 has accumulated to a certain threshold level, Sry activity is antagonized.

wt1 mutations and gonadal differentiation. Genetic evidence has indicated that although DAX-1 is not required for normal testis differentiation (32, 54), XY individuals with duplications of Dax-1 show male-to-female sex reversal, implying a link between DAX-1 and the gonadal differentiation pathway (3). Consistent with this interpretation, DAX-1 has been shown to antagonize Sry function in some transgenic mice containing a weakened Sry allelic background made to overexpress DAX-1 (47). In this experimental setting, altering the window of Dax-1 expression has severe consequencesif DAX-1 levels peak too early, then Sry activity is inhibited before the male differentiation program has been activated, providing a rationale for the sex reversal associated with increased dosage of Dax-1 in individuals with duplications of Xp21. The outcome of delayed Dax-1 expression is more difficult to predict, but should not impair the testis differentiation process, since this program is activated by Sry.

Activation of transcription by WT1. The mechanism by which WT1 activates or represses genes is still a poorly understood process, although a large number of genes have been shown to be WT1-responsive. In the majority of cases analyzed, WT1 behaves as a repressor of transcription. The repressor domain maps to amino acids 84 to 179 (29, 52). In the case of the syndecan-1 and p21 genes, WT1 has been shown to activate transcription, although the two genes appear to require distinct activation domains (12, 14). The Dax-1 promoter is the only one characterized to date which contains two WT1-responsive sites, both of which can individually mediate transactivation by WT1 (Fig. 4A). In our hands, internal deletions of WT1 which either (i) remove the transactivation domain (a deletion of amino acids 160 to 262) or (ii) abolish the self-association domain (a deletion of amino acids 2 to 126) could no longer activate Dax-1 gene expression in transient transfection assays, suggesting that both of these domains are essential for the observed transcriptional effects (23).