Previous Article | Next Article 
Molecular and Cellular Biology, March 1999, p. 2330-2337, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
DEF-1, a Novel Src SH3 Binding Protein That
Promotes Adipogenesis in Fibroblastic Cell Lines
Frederick J.
King,
Erding
Hu,
David F.
Harris,
Pasha
Sarraf,
Bruce M.
Spiegelman, and
Thomas M.
Roberts*
Department of Cancer Biology, The Dana-Farber
Cancer Institute, Boston, Massachusetts 02115
Received 10 September 1998/Returned for modification 22 October
1998/Accepted 19 November 1998
 |
ABSTRACT |
The Src homology 3 (SH3) motif is found in numerous signal
transduction proteins involved in cellular growth and differentiation. We have purified and cloned a novel protein, DEF-1
(differentiation-enhancing factor), from bovine brain by using a Src
SH3 affinity column. Ectopic expression of DEF-1 in fibroblasts
resulted in the differentiation of a significant fraction of the
culture into adipocytes. This phenotype appears to be related to the
induction of the transcription factor peroxisome proliferator-activated
receptor
(PPAR
), since DEF-1 NIH 3T3 cells demonstrated
augmented levels of PPAR
mRNA and, when treated with activating
PPAR
ligands, efficient induction of differentiation. Further
evidence for a role for DEF-1 in adipogenesis was provided by
heightened expression of DEF-1 mRNA in adipose tissue isolated from
obese and diabetes mice compared to that in
tissue isolated from wild-type mice. However, DEF-1 mRNA was detected
in multiple tissues, suggesting that the signal transduction pathway(s)
in which DEF-1 is involved is not limited to adipogenesis. These
results suggest that DEF-1 is an important component of a signal
transduction process that is involved in the differentiation of
fibroblasts and possibly of other types of cells.
 |
INTRODUCTION |
Src homology 3 (SH3) domains are
found in numerous signal transduction proteins, including the Src
family of protein tyrosine kinases. In Src family members, SH3 domains
are believed to function in the control of subcellular localization and
the regulation of kinase activity and as sites of interaction with
other signal transduction proteins (2, 10, 12, 43, 44).
Proteins that are known to interact with an SH3 domain typically have a PXXP consensus sequence (P = proline, X = any amino acid)
that is believed to adopt a polyproline type II helix conformation (68). Residues adjacent to the prolines also form contacts
with the SH3 structure, and these interactions determine the binding specificity between a protein and a particular SH3. For example, the
arginine in RPLPXXP forms a salt bridge with aspartate 99 of
pp60c-src. However, the C-terminal arginine in
the sequence AFAPPLPRR contacts the identical aspartate in
pp60c-src, indicating that proteins may interact
with SH3 domains in either a plus or minus orientation (termed class I
and class II binding, respectively [35, 68]).
SH3 consensus binding sequences have been useful for identifying
proteins that are potential targets for interactions with an
SH3-containing protein. For example, a proline-rich region in mSOS
suggested a mechanism for its association with an SH3 domain of GRB-2
(9). Novel SH3 binding proteins have been isolated by a
number of strategies, including affinity chromatography, expression
library screening, and yeast two-hybrid screening (13, 20, 25, 27,
47, 55). However, the signal transduction pathways in which many
of these SH3 binding proteins are involved have not been delineated.
Signal transduction proteins involved in the differentiation of
fibroblasts into adipocytes have been evaluated by using various tissue
culture cell lines as model systems. For example, members of the C/EBP
and peroxisome proliferator-activated receptor (PPAR) families of
transcription factors have been determined to have the potential to
induce adipogenesis in NIH 3T3 and 3T3-L1 cells under the appropriate
conditions (6, 11, 37, 54). Although numerous studies have
confirmed the importance of these transcription factors for the
promotion of fibroblastic differentiation, the intracellular signaling
involved in the regulation of these factors and others involved in
adipogenesis has not been defined completely.
Several proteins that potentially influence the expression and activity
of transcription factors involved in adipogenesis are members of the
insulin and leptin receptor signal transduction pathways (34,
36). For example, insulin treatment of 3T3-L1 cells results in
the phosphorylation of mitogen-activated protein kinase,
p90rsk, and c-raf (46). In turn,
expression of activated alleles of raf and ras induces adipogenesis in
cultured preadipocytes (3, 46). The genes for leptin and its
receptor are mutated in the mouse models of obesity, obese
(ob), and diabetes (db), respectively (58). The leptin receptor is a member of the class I
cytokine receptor family and, consequently, signals through the
activation of Jak kinases and the STAT family of transcription factors
(4, 22, 42, 51, 56, 59). STAT signaling has been shown to be
defective in db/db mice, and presumably, particular STATs
control the transcription of genes involved in antiobesity (14,
23). Therefore, there are likely numerous proteins that
potentially influence adipogenesis and obesity.
This study describes the purification and characterization of a novel
Src SH3 binding protein, DEF-1 (differentiation-enhancing factor).
Although DEF-1 was partially purified with a domain from a
proto-oncoprotein, its ectopic expression in fibroblasts promotes adipogenesis instead of oncogenic transformation. How DEF-1 promotes this effect is mechanistically unclear, although we have determined that expression of the C terminus of DEF-1 is sufficient for this phenotype. These results, along with the ubiquitous expression pattern
of DEF-1, suggest that DEF-1 is an important signal transduction protein involved in the differentiation of fibroblasts and possibly of
other cell types.
 |
MATERIALS AND METHODS |
GST constructs.
The Src SH3 and Src SH3SH2 affinity columns
were constructed by cloning the avian Src SH3 or Src SH3SH2 domains
(amino acids 88 to 136 and 88 to 240 of chicken c-Src, respectively)
into the plasmid vector pGEX-2T (Pharmacia) by standard PCR techniques. The resulting glutathione S- transferase (GST) Src SH3
domain fusion protein was secured to glutathione-coupled Sepharose
beads. Lck SH3 was constructed in a similar fashion, with a murine
c-lck gene as the initial template. The GST-DEF-1
C1 (amino acids 777 to 926) and C2+3 (amino
acids 928 to 1129) constructs were made by cloning in the appropriate
blunt-ended, BglII fragment of bovine DEF-1 into the
SmaI site of pGEX-2T (Pharmacia). GST-DEF-1 C2
and C3 comprised amino acids 934 to 1036 and 1074 to 1129 of bovine DEF-1, respectively, and were made by standard PCR techniques and cloned into pGEX-2T.
Protein purification.
Calf brain lysates were made by
homogenization in the presence of hypotonic lysis buffer (0.25 M
sucrose, 20 mM Tris [pH 8.0], 1 mM EDTA, 1 mM
-mercaptoethanol, 2 mM phenylmethylsulfonyl fluoride [PMSF]) and passed over the
respective columns. Each column was washed once in Nonidet P-40 (NP-40)
lysis buffer (1% NP-40, Tris [pH 8.0], 137 mM NaCl, 1 mM EDTA, 10%
glycerol, 2 mM PMSF, 0.1 TIU of aprotinin/ml), twice in 0.5 M LiCl-20
mM Tris (pH 8.0), and once with phosphate-buffered saline (PBS).
Samples were eluted with 10 mM glutathione in 120 mM NaCl-100 mM Tris
(pH 8.0) and passed over an ATP-agarose column (Sigma) or eluted with
sodium dodecyl sulfate (SDS) sample buffer and loaded onto an SDS-10% polyacrylamide gel. Samples passed over the ATP-agarose column were
washed twice with PBS, eluted with SDS sample buffer, and electrophoresed on an SDS-5% polyacrylamide gel. The gel was
electroblotted with polyvinylidene difluoride membrane (Bio-Rad) in
CAPS buffer [10 mM 3-(cyclohexylamino)-1-propanesulfonic acid, 10%
methanol], and the band corresponding to DEF-1 was excised. The
starting material for the large-scale purification of DEF-1 was
one-half of a calf brain (approximately 250 g). Following in situ
digestion with trypsin (17), the resulting peptide mixture
was separated by microbe high-pressure liquid chromatography (HPLC)
with a Zorbax C18 1.0- by 150-mm reverse-phase column on a
Hewlett-Packard 1090 HPLC/1040 diode array detector. Optimum fractions
from the chromatogram were chosen based on differential UV absorbance
at 205, 277, and 292 nm, peak symmetry, and resolution. Peaks were
further screened for length and homogeneity by matrix-assisted laser
desorption time-of-flight mass spectrometry on a Finnigan Lasermat 200 (Hemel, England), and selected fractions underwent automated Edman
degradation on a Perkin-Elmer/Applied Biosystems (Foster City, Calif.)
model 494A or 477A. Details of strategies for the selection of peptide fractions and their microsequencing have been previously described (31).
cDNA cloning.
cDNA cloning with degenerate primers by PCR
was performed essentially as described previously (32).
Bovine brain RNA was reverse transcribed with the downstream primer 5'
RTCRTTNGTRTCYTC 3'. The cDNA from this reaction was used in a PCR with
the same downstream primer and 5' CAYGTICARAAYGARGARAA 3' as the
upstream primer. This reaction was used as a template for a subsequent PCR with the nested upstream primer, 5' GARGARAAYTAYGCICARGT 3', and
the downstream primer. The product from this reaction was sequenced and
subsequently determined to encode amino acids 92 to 384 of DEF-1. This
PCR product was used to screen a bovine brain randomly primed cDNA
library in the vector
ZapII (Stratagene) obtained from Akio
Yamakawa. This resulted in six unique clones, five of which contained
DEF-1 coding sequences. The sixth appears to be a related gene (data
not shown). A segment of one clone was used to rescreen the library,
resulting in three novel DEF-1 clones including the remainder of the
coding sequence. The DEF-1 cDNA (comprised of clones S9 and R27), with
the hemagglutinin (HA) tag MVYPYDVPDYAG at the N terminus, was cloned
into the expression vector pLNSL7 and transfected into
2 cells to
obtain infectious retroviral supernatants (38). pLNSL7/DEF-1
was digested with BglII and blunt ended with Klenow enzyme,
and the vector-DEF-1 backbone was religated to make the DEF-1-Bgl construct.
Immunoprecipitations and GST pull-downs.
Lysates made with
NP-40 lysis buffer from NIH 3T3 cells expressing pLNSL7 alone (vector)
or HA-tagged DEF-1 (DEF-1) were passed over the noted columns and
washed as described above. Bound proteins were immunoblotted with the
anti-HA antibody, 12CA5 (Babco). pp60c-src was
detected by using the monoclonal antibody 327, a gift from J. Brugge.
GST preparations were prepared as described above and quantitated by
staining with Coomassie blue. Equal amounts of GST fusion proteins were
used for each pull-down experiment. All immunoprecipitates and GST
pull-downs were washed once with NP-40 lysis buffer, twice with 0.5 M
LiCl-20 mM Tris (pH 8.0), and once with PBS. Anti-DEF-1 antibody
polyclonal serum was prepared by injecting rabbits with amino acids 928 to 1129 of DEF-1 (prepared by proteolysis of a GST fusion protein). The
preimmune serum used was obtained from this rabbit.
Cell treatments.
BALB/c 3T3, NIH 3T3, and 3T3 F442A cells
were infected with the vector or DEF-1 retroviral supernatants and
selected with 400 µg of G418 per ml. Only pools of cells derived from
more than ~1,000 infected cells were assayed. Upon confluence, the
derivative NIH 3T3 cells were cultured in 10% fetal calf serum
(FCS)-Dulbecco modified Eagle medium (DMEM) (Gibco/BRL) and
supplemented with combinations of 1 µM dexamethasone (Sigma), 5 µM
insulin (Sigma), and 10 µM pioglitazone, as indicated previously
(61). 3T3 F442A derivative cell lines were passaged in 10%
calf serum-DMEM and assayed with 10% FCS-DMEM with 10 nM
pioglitazone. For all assays, the medium was changed every other day.
After 9 days, the cells were fixed, stained with Oil-Red-O
(39), and photographed by using a 20× objective or
harvested for RNA.
Northern blot analysis.
Twenty micrograms of total RNA (Fig.
4C) or poly(A)+ RNA purified from 50 µg of total RNA
(Invitrogen; Fig. 5) isolated from the cells treated as described above
was probed with an aP2 or PPAR
cDNA, respectively (61).
Quantities of RNA for Fig. 5 were normalized with a 36B4 probe
(30). The full-length DEF-1 cDNA was used to probe a mouse
multiple-tissue Northern blot (Clontech) and 5 µg of
poly(A)+ mRNA isolated from mouse adipose tissue. A
-actin probe was subsequently used to normalize mRNA loading.
Competitive PCR analyses.
A DNA competitor was constructed
with primers 5' TCGTTTTCGGATGTGACGGCTGAGGTTCATCGCCGAGACCA 3'
and 5' ATTGTGGCTCAGACCCTGGA 3' and murine DEF-1
(21) as a template. This PCR product represented the 5' end
of murine DEF-1 with an internal 88-nucleotide deletion. Five
micrograms of RNA from each tissue sample was reverse transcribed by
using reverse transcriptase and the primer 5'
AACAAGGAATCCAAGGTGAAGA 3' according to the protocol of the
manufacturer (Promega). Equivalent quantities of RNA were confirmed by
Northern blot analysis of 5 µg of RNA from each sample by using 36B4
as a probe (data not shown), and quantitation of the signal was
performed on a PhosphorImager (Molecular Dynamics). PCRs were performed
with equal amounts of template and 5' TCGTTTTCGGATGTGACGGCTGAG 3'
(containing 5' noncoding sequence of murine DEF-1) and 5'
ATTGTGGCTCAGACCCTGGA 3' as primers, with decreasing amounts of
competitor (starting at 0.1 attomole). Equal amounts of the PCR
mixtures were loaded on an agarose gel, and band intensities were
determined by using an AlphaImager 2000 version 3.3 analysis system
(Alpha Innotech Corporation). The log ([DEF-1]/[competitor]) versus
log [competitor added] was plotted, and the value of [DEF-1] = [competitor] was calculated (Clontech). The fold induction versus
that of the wild type was then determined and plotted. All values
represent the average of three experiments. Adipose and brain tissue
samples were run at separate times and thus cannot be directly compared.
Nucleotide sequence accession number.
The sequence of bovine
DEF-1 has been assigned GenBank accession no. AF112886.
 |
RESULTS |
Purification and cloning of DEF-1.
To identify novel Src SH3
binding proteins, we undertook an analysis of proteins isolated from
bovine brain extracts that bound to a GST Src SH3 (Src SH3) affinity
column. Resolution of the associated proteins by SDS-polyacrylamide gel
electrophoresis showed several species that bound to the Src SH3 column
but not the GST beads alone (Fig. 1A).
Included was a prominent band of approximately 100 kDa, which was
subsequently identified as dynamin (data not shown;
24). Because dynamin also has affinity for ATP
agarose (50), we determined the ability of the Src
SH3-associated proteins to bind to an ATP affinity matrix. This led to
the identification of a small number of proteins that bound to both
affinity columns, including a protein of approximately 140 kDa (DEF-1;
see below) which showed high abundance and good separation relative to
the other proteins (Fig. 1B). Therefore, our efforts focused on
purifying DEF-1 in a quantity sufficient for amino acid sequencing.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
Purification of DEF-1 protein. (A) Calf brain lysates
were passed over the GST, Src SH3, or Src SH3SH2 affinity column, and
associated proteins were electrophoresed on a 10% polyacrylamide gel
and visualized by silver stain. Molecular size markers in kilodaltons
are indicated on the left. (B) Bound proteins from panel A were eluted
with free glutathione and passed over an ATP-agarose column. The
associated proteins were electrophoresed on a 5% polyacrylamide gel
and visualized by silver staining.
|
|
A large-scale protein purification of DEF-1 was performed, resulting in
approximately 20 µg of the purified protein. Degenerate
oligonucleotides were designed based on the resultant amino acid
sequence of six tryptic peptides and were used as primers in a
series
of nested PCRs, with bovine brain mRNA as the initial template.
One
positive PCR product was used to screen a randomly primed,
bovine brain
cDNA library. Positive clones were used to isolate
eight overlapping
clones that resulted in approximately 5,300
bp of contiguous sequence.
The composite sequence contained an
open reading frame encoding a
protein of 1,129 amino acids (Fig.
2A).
All six peptides sequenced were found in the predicted translation
product. Comparison of the amino acid sequence with those in the
database indicated several motifs, including a zinc finger closely
related to the zinc finger found in ARF1 GTPase-activating protein
(
62), three ankyrin repeats (
41), a pleckstrin
homology domain
(
15), a putative lipid binding motif named
C2 (
19,
57),
and an SH3 domain (
16). In addition,
several proline-rich motifs,
including multiple Src SH3 consensus
binding sequences, were noted
(
1,
48,
52,
63). No previously
described motifs that
would account for DEF-1's affinity for ATP
agarose were apparent.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence of DEF-1. (A) Eight unique, overlapping clones
were used to obtain the DEF-1 composite sequence. One clone (R19)
lacked the sequence SRR at amino acids 304 to 306. The sequence from
other clones and an apparent human DEF-1 partial sequence in the EST
database suggested that the SRR sequence is an alternative exon (data
not shown). The number of the last amino acid in a line is noted on the
right. Key: overline, peptide sequenced; underline, putative
alternative exon; aqua, pleckstrin homology domain (amino acids 326 to
419); purple, zinc finger (amino acids 457 to 480); red, C2 domain
(amino acids 498 to 557); yellow, ankyrin-related motifs (amino acids
604 to 623, 640 to 659, 673 to 692); green, SH3 consensus binding
sequences (amino acids 791 to 800, 803 to 809, 828 to 835, 895 to 901, 993 to 999); brown, proline-rich repeat (amino acids 934 to 1001);
blue, SH3 domain (amino acids 1074 to 1123). (B) Putative structure of
proline-rich motif in DEF-1. The sequence of amino acids 976 to 1001 is
drawn in a left-handed poly-proline type II helix. Standard amino acid
abbreviations are used.
|
|
In addition to the readily identifiable motifs described above, an
unusual proline-rich stretch located between the SH3 domain
and the
predicted SH3 binding sites in DEF-1 was noted (amino
acids 934 to
1001). This region can be subdivided into six tandem
repeats centered
on the consensus sequence GDLPPKP. Although this
motif has the PXXP
consensus found in SH3 binding proteins, it
would not be predicted to
form a high affinity interaction with
Src SH3, since it lacks a basic
amino acid residue at the proper
position (with the exception of the
last repeat [
48]). However,
the preponderance of
prolines in this repeat suggests that this
region forms a polyproline
type II helix (
64). On the basis
of this assumption, the
four C-terminal repeats form a trigonal
prism with an acidic edge, a
basic edge, and an uncharged edge
(with the exception noted above; Fig.
2B). The two longer repeats
(amino acids 934 to 965) have a similar
pattern, yet the relative
charge rotates between the repeats (data not
shown).
DEF-1 is a Src SH3 binding protein.
To confirm that the DEF-1
cDNA encoded a Src SH3 binding protein, the full-length DEF-1 coding
sequence, fused with an HA tag at the amino terminus, was expressed in
NIH 3T3 cells. Lysates from the subsequent drug selected,
DEF-1-expressing cells were passed over a Src SH3 column and probed
with an anti-HA antibody. The protein produced by the DEF-1 cDNA
associated with the Src SH3 beads (Fig.
3A), strongly suggesting that it encodes
the protein detected in Fig. 1A. DEF-1 also associated with the SH3
domain of the Src-related protein, lck, indicating that DEF-1 does not exclusively bind Src SH3.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
DEF-1 is an SH3 binding protein. (A) Lysates made with
NP-40 lysis buffer from NIH 3T3 cells expressing pLNSL7 alone (pLN)
(38) or pLNSL7/HA-tagged DEF-1 (pLN/DEF-1 HA) were passed
over the noted columns. Bound proteins were immunoblotted with an
anti-HA antibody. (B) Bovine brain (brain extract) or Sf9 cells
infected with a pp60c-src baculovirus (Bv Src)
was lysed with NP-40 lysis buffer and passed over a column consisting
of GST alone, GST-DEF-1-C1 (amino acids 777 to 926; SH3
binding sites), or GST-DEF-1-C2+3 (amino acids 928 to 1129;
proline-rich repeat plus SH3 domain). Bound proteins were immunoblotted
with an anti-pp60c-src antibody. (C) Bovine
brain extracts were passed over a GST-DEF-1-C1,
C2 (amino acids 934 to 1036; proline-rich repeat) or
C3 column (amino acids 1074 to 1129; SH3 domain), and bound
proteins were blotted for DEF-1 by using an anti-DEF-1 rabbit
polyclonal serum. The brain lysate was immunoprecipitated with
preimmune (pre-imm.) or anti-DEF-1 serum ( DEF-1) or passed over a
column of GST alone (GST) as a control.
|
|
DEF-1 copurified with dynamin, a protein known to associate with
numerous SH3 domains and ATP agarose (
24,
50). Therefore,
the interaction between DEF-1 and Src SH3 may have been dependent
upon
an intermediary such as dynamin. To provide evidence that
DEF-1
associated with Src SH3 directly, two GST fusion proteins
spanning
regions of DEF-1 that had SH3 consensus binding sequences
were
constructed and named C
1 (amino acids 777 to 926 of DEF-1)
and C
2+3 (amino acids 928 to 1129 of DEF-1). Lysates made
from bovine brain or insect cells infected with a baculovirus
expressing pp60
c-src were passed over the
respective columns, and after being washed,
proteins eluted from the
beads were immunoblotted with an anti-pp60
c-src
antibody. pp60
c-src from either lysate
associated efficiently with the C
1 column
(Fig.
3B).
Although proteins found in both lysates may have acted
as intermediates
between pp60
c-src and the column, the results in
Fig.
3A and B are most easily
explained by a direct interaction between
amino acids 777 and
926 of DEF-1 and the SH3 domain in
pp60
c-src. Even though the C
2+3
column contains a consensus Src SH3
binding site (amino acids 993 to
999), no interaction with pp60
c-src was
detected. However, it is not clear if an intramolecular or
intermolecular interaction between the SH3 binding motif and the
DEF-1
SH3 domain in this construct might interfere with Src SH3
binding.
To determine if the SH3 domain of DEF-1 could associate with
full-length DEF-1, brain lysates were passed over a column comprised
of
GST fused with the DEF-1 SH3 domain (C
3, amino acids 1074 to
1129), C
1, or C
2 (the proline-rich repeats;
amino acids 934 to
1036). The C
3 column bound DEF-1 as
determined by immunoblotting
with an anti-DEF-1 antibody. Presumably,
this interaction occurs
at one of the SH3 consensus binding sites
denoted in Fig.
2A.
However, even though the C
1 column was
capable of associating
with pp60
c-src
(presumably through the SH3 domain of pp60
c-src;
Fig.
3B), no full-length DEF-1 protein bound to this column.
This
result suggests that the SH3 domain of full-length DEF-1
may be tightly
associated with a protein with an SH3 binding site
that may be DEF-1
itself.
DEF-1 induces adipogenesis in fibroblastic cell lines.
Numerous SH3 binding proteins have been cloned, yet their respective
cellular functions have not been determined. Since DEF-1 was isolated
by using a domain from the proto-oncoprotein
pp60c-src, we introduced DEF-1 into BALB/c 3T3
cells by retroviral infection to ascertain if DEF-1 was capable of
inducing cellular transformation. DEF-1-expressing cells initially had
the same morphology as cells infected with the expression vector alone
(data not shown). However, after approximately 2 weeks at confluence, a
small number of DEF-1 BALB/c 3T3 cells formed shiny vacuoles that were
suggestive of lipid droplets (Fig. 4A).
This unexpected result implied that DEF-1 enhanced the potential of
fibroblasts to differentiate into adipocytes.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 4.
DEF-1 induces fibroblastic differentiation. (A) Stably
infected DEF-1 BALB/c 3T3 cells were grown to confluence and
photographed with a 20× objective after noticeable lipid accumulation.
(B) NIH 3T3 cells stably infected with DEF-1 or the expression vector
alone were grown to confluence with 10% FCS-DMEM and supplemented with
combinations of dexamethasone (Dex), insulin, and pioglitazone (Pio) as
indicated. After notable lipid accumulation (9 days), the cells were
fixed and lipid droplets were identified by staining with Oil-Red-O.
(C) Twenty micrograms of total RNA isolated from the cells treated as
shown in panel B was probed with an aP2 cDNA (D, dexamethasone; P,
pioglitazone; I, insulin; 0, no treatment) (61). (D) 3T3
F442A cells ectopically expressing DEF-1 or the expression vector alone
were grown to confluence and supplemented with 10 nM pioglitazone.
After 9 days, the cells were stained with Oil-Red-O and photographed.
|
|
The formation of lipid droplets in the DEF-1 BALB/c 3T3 cells
encouraged us to study the role of DEF-1 in adipogenesis, using
NIH 3T3
cells as a model system (
11). A selected pool of NIH
3T3
cells infected with the DEF-1 retrovirus (DEF-1 NIH 3T3) kept
at
confluence in 10% FCS-DMEM demonstrated no visible signs of
adipogenesis (data not shown). However, parallel cultures supplemented
with factors that have been previously shown to enhance differentiation
in preadipocytic cell lines, particularly dexamethasone, insulin,
and
the thiazolidinedione pioglitazone, demonstrated considerable
levels of
lipid accumulation compared to the level accumulated
with the vector
alone (Fig.
4B) (
7,
18,
28). Northern blot
analysis
with the adipocyte-specific marker aP2 confirmed that
the cultures of
treated DEF-1 NIH 3T3 cells that presented lipid
droplets underwent
adipogenesis (Fig.
4C) (
53,
60).
In addition to NIH 3T3 and BALB/c-3T3 cells, other cell lines have been
used as model systems to study adipogenesis in culture
(reviewed in
reference
11). We have used the DEF-1 retroviral
supernatants to ectopically express DEF-1 in several of these
lines in
an attempt to find DEF-1-associated phenotypes which
would advance our
understanding of how DEF-1 promotes adipogenesis
in the assay described
above. 3T3 F442A cells have been used extensively
to study adipogenic
differentiation because well-defined protocols
that induce robust and
exclusive differentiation into adipocytes
have been developed. For
example, 3T3 F442A cells have been shown
to undergo adipocytic
differentiation when they are treated with
high levels of insulin or
pioglitazone (
49). 3T3 F442A cells
stably expressing DEF-1
(DEF-1 F442A) showed no evidence of adipogenesis
when they were kept at
confluence in 10% FCS-DMEM. Supplementation
of DEF-1 F442A cultures
with pioglitazone demonstrated more extensive
differentiation than that
observed with the cells expressing the
vector alone. The difference
between DEF-1 F442A and control cells
was most noticeable when the
amount of pioglitazone was lowered
to a limiting concentration of 10 nM
(Fig.
4D and data not
shown).
DEF-1 NIH 3T3 cells express augmented levels of PPAR
.
The
adipogenic activity seen in the DEF-1 NIH 3T3 and DEF-1 F442A cells was
dependent upon the presence of pioglitazone, which is a potent and
specific stimulator of the nuclear receptor PPAR
(33).
NIH 3T3 cells normally demonstrate no discernible phenotypic changes
during pioglitazone treatment, presumably due to low levels of PPAR
expression (61). However, ectopic expression of PPAR
in
NIH 3T3 cells followed by treatment with PPAR
-activating ligands has
been shown to be sufficient to promote conspicuous adipogenesis (18, 29).
While assaying for the expression of adipocytic markers in DEF-1 NIH
3T3 cells, we noted elevated levels of PPAR

mRNA in
cells that had
been treated with the complete differentiation
cocktail (Fig.
5). Since PPAR

levels increase during
adipogenesis,
this result could imply that DEF-1 promotes PPAR

expression or
that augmented PPAR

levels are the result of
DEF-1-induced fibroblastic
differentiation (
60). Notably,
the culture of DEF-1 NIH 3T3
cells supplemented only with dexamethasone
and insulin demonstrated
increased levels of PPAR

mRNA compared to
those in control cells
(Fig.
5). This suggests that heightened
expression of DEF-1 in
NIH 3T3 cells synergizes with the effects of
dexamethasone and
insulin treatment to increase PPAR

levels. The
further supplementation
of pioglitazone activates the augmented levels
of PPAR

, resulting
in the adipogenic phenotype observed in Fig.
4B
and C. Similarly,
the observed increase in the sensitivity of DEF-1
F442A cells
to pioglitazone is consistent with the notion that DEF-1
expression
is modulating PPAR

levels in these cells (Fig.
4D).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of PPAR in DEF-1 cells. RNA isolated from
NIH 3T3 cells expressing the vector alone (vector) or DEF-1 (DEF-1)
treated as in Fig. 4B was probed with a PPAR cDNA (60).
Quantities of RNA were standardized with a 36B4 probe
(30).
|
|
Expression of DEF-1 in tissues from wild-type mice and mouse models
of adipogenesis and obesity.
How DEF-1 operates as a signal
transduction protein to promote adipogenesis is unclear at present.
Although we have found that DEF-1 induces fibroblastic differentiation
under certain conditions, DEF-1 is also expressed in every tissue and
cell line that has been tested to date (Fig.
6A and data not shown). Therefore, we
postulate that DEF-1 signal transduction activity is not limited to
adipogenesis.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
DEF-1 expression in various tissues and adipose tissue
from mouse models of obesity. (A) The full-length DEF-1 cDNA was used
to probe a mouse multiple-tissue Northern blot (Clontech), and 5 µg
of poly(A)+ mRNA was isolated from mouse adipose tissue.
The lower band appears to be smaller than the DEF-1 composite cDNA
isolated and, therefore, is believed to be a DEF-1-related mRNA (data
not shown). A -actin probe was subsequently used to normalize mRNA
loading. (B) Lysates from 3T3 F442A cells before (Undiff.) and after
(Diff.) differentiation with 1 µM pioglitazone were
immunoprecipitated with preimmune (PI) or anti-DEF-1 antiserum
( DEF-1). The immunoprecipitates were immunoblotted with the
anti-DEF-1 antibody. (C) An example of the data obtained from a
competitive PCR analysis used to evaluate the levels of DEF-1 mRNA in
adipose and brain tissues isolated from wild-type, ob/ob,
and db/db mice. The amount of competitor added that resulted
in equivalent DEF-1 and competitor signal intensities was determined.
(D) The average fold increase of DEF-1 mRNA levels in adipose tissue
isolated from two ob/ob mice and one db/db mouse
relative to that of a wild-type standard was determined as described in
panel C. A similar analysis was performed with RNA from brain tissue.
All values represent the average from three separate trials, and the
error bars refer to average deviations.
|
|
The expression of numerous genes is altered during adipocytic
development (
11). These genes include PPAR

, which as
noted
above, is induced to high levels of expression during late stages
of adipocyte differentiation (
61). To determine if the
levels
of DEF-1 are modified during adipogenesis, we analyzed the
amount
of DEF-1 protein in 3T3 F442A cells before and after
differentiation
with pioglitazone. There was no apparent alteration in
the levels
of DEF-1 after differentiation of these cells (Fig.
6B).
In contrast to the pattern of DEF-1 expression in 3T3 F442A
differentiation, two mouse models of obesity have provided additional
evidence that DEF-1 expression levels correlate with enhanced
adipogenesis in vivo. Adipose tissue from
ob/ob and
db/db mice
show heightened levels of DEF-1 mRNA compared to
those in wild-type
mice (Fig.
6C and D). This relative increase was not
seen in RNA
isolated from brain tissue from the same mice. The
augmentation
of DEF-1 expression in
ob/ob and
db/db adipose tissue over that
in wild type was
approximately equal to the increase in NIH 3T3
cells due to ectopic
expression of DEF-1 (data not
shown).
The C terminus of DEF-1 is sufficient to induce adipogenesis.
We have undertaken a deletion analysis of DEF-1 to delineate the
domains involved in the adipogenic differentiation described above. A
construct involving a BglII digest resulted in the fusion of
the first three amino acids of DEF-1 to the C-terminal 204 (DEF-1/Bgl).
When assayed for the ability to induce adipogenesis in NIH 3T3 cells in
a manner identical to that described above, the truncated DEF-1 mutant
was shown to be sufficient to promote adipogenesis to levels equal to
or greater than those achieved with the full-length construct (Fig.
7). Since this region of DEF-1 contains
the proline-rich repeat and the SH3 domain (Fig. 2A), this result
strongly suggests that proteins that interact with the SH3 domain of
DEF-1 are involved in the adipogenic phenotype described above.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 7.
The C terminus of DEF-1 promotes adipogenesis. NIH 3T3
cells stably expressing DEF-1-Bgl were assayed as described in the
legend for Fig. 4B in the presence of dexamethasone, insulin, and
pioglitazone.
|
|
 |
DISCUSSION |
We have described a novel signal transduction molecule, DEF-1,
whose overexpression in fibroblasts participates in augmentation of
PPAR
levels and induction of cellular differentiation. Heightened DEF-1 expression was also found in the adipose tissue from particular mouse models of obesity, which seems to correlate with the phenotype observed by DEF-1 ectopic expression in fibroblasts. The adipogenic effect mapped to the C terminus of DEF-1, implying that key molecules involved in this response interact with this region of DEF-1.
DEF-1 has several motifs, suggesting that it interacts with other
proteins to achieve its biological effects and, therefore, may act as a
scaffolding protein (Fig. 2A) (45). These proteins may include a GTPase, since DEF-1 has been demonstrated to have GTPase-activating properties (5). The purification of DEF-1 described above involved a Src SH3 affinity column, which implies that
DEF-1 is potentially involved in pp60c-src
signal transduction. Although we have mapped a
pp60c-src binding site to a region of DEF-1
containing Src SH3 consensus binding sequences (Fig. 3B), we have not
been able to demonstrate an interaction between full-length DEF-1 and
pp60c-src in vivo at physiological levels of
expression of the two proteins by any of several different experimental
approaches. For example, immunoprecipitates of DEF-1 from brain lysate
(where both pp60c-src and DEF-1 are abundant) or
cultured cells stably expressing an activated Src allele show no
pp60c-src by immunoblotting, and these
immunoprecipitates of DEF-1 do not have a kinase activity that
comigrates with pp60c-src (data not shown). At
least one potential impediment to an in vivo interaction between DEF-1
and pp60c-src may derive from their divergent
subcellular locations. Whereas pp60c-src is
localized to the plasma membrane, results from experiments involving
immunofluorescence, localization of a fusion of DEF-1 and green
fluorescent protein, and the purification of DEF-1 with a hypotonic
lysis buffer all indicate that most, if not all, DEF-1 is present in
the cytosol (Fig. 1) (5, 40). This is in spite of the fact
that DEF-1 has multiple motifs that have been found in proteins that
associate at least transiently with membranes or lipids (Fig. 2A)
(15, 19, 41, 57). These domains within DEF-1 suggest that a
hypothetical stimulus could result in the migration of DEF-1 to the
plasma membrane, but to date we have not been able to identify
conditions under which this occurs. A potential interaction with
pp60c-src could be regulated by such a stimulus.
In keeping with this idea, Brown et al. have observed an interaction
between DEF-1 and an activated pp60c-src allele
but not pp60c-src upon transient coexpression
(5). Alternatively, DEF-1 may be a target for a different
SH3-containing protein in vivo. Therefore, our data presently do not
support a role for pp60c-src in adipogenesis.
The potential association between DEF-1 and SH3 domain-containing
proteins or SH3 binding proteins may be regulated at steps other than
subcellular localization. A GST fusion protein containing several SH3
binding consensus sequences found in DEF-1 demonstrated affinity to
pp60c-src but not to DEF-1 (Fig. 3C). This may
indicate an intramolecular interaction between the SH3 domain of DEF-1
with one of the potential SH3 binding sites or dimerization of two
DEF-1 molecules. Thus, efforts to define the mechanism by which the
DEF-1-Bgl construct enhances adipogenesis may be complicated by a
potential interaction with the endogenous DEF-1 that would serve to
alter the activity of the full-length molecule.
The effect of DEF-1 on PPAR
expression in NIH 3T3 cells was apparent
only after the cultures were supplemented with dexamethasone and
insulin (Fig. 5). How might the cellular effects brought upon by these
chemicals interplay with ectopic expression of DEF-1 to induce
adipogenesis? Dexamethasone and insulin have been shown to induce or
maintain the expression of particular members of the PPAR and C/EBP
families of transcription factors which have fundamental roles in
adipogenesis (37, 54). For example, dexamethasone has been
shown to induce the expression of C/EBP
(65, 67). However, currently undefined factors that enhance adipogenesis and are
affected by dexamethasone treatment have been suggested previously
(65). The changes imparted by dexamethasone and insulin in
DEF-1 NIH 3T3 cells that contribute to PPAR
expression may already
be present in 3T3 F442A cells, since DEF-1 F442A cells showed
heightened sensitivity to pioglitazone in the absence of this treatment.
Increased expression of DEF-1 promoted adipogenesis in cultured
fibroblast cell lines and was also detected in adipose tissue of
ob/ob and db/db mice. How these two observations
might be mechanistically linked is unclear at present. The obese
phenotype seen in ob/ob and db/db mice is due (at
least partially) to a defect in leptin signaling in the hypothalmus,
resulting in the loss of appetite suppression (26, 58).
Therefore, leptin may affect DEF-1 expression levels in these mouse
models of obesity by a mechanism that does not directly target fat tissue.
The ubiquitous expression pattern of DEF-1 implies that DEF-1 function
is not restricted to adipogenesis (Fig. 6A). Moreover, amino acid
sequences of cDNAs corresponding to DEF-1 homologues reveal that DEF-1
has been extremely well conserved between zebrafish, mice, rats, cows,
and humans, which argues that DEF-1 may be a signal transduction
component in all vertebrates (5, 8, 66). Whereas the
phenotype of DEF-1 ectopic expression has been fibroblastic
differentiation, this may be due to the ability of high levels of DEF-1
(or DEF-1 mutants) to bind a subset of signal transduction proteins,
resulting in the formation of an inactive signaling complex. Therefore,
ectopic expression of DEF-1 may be acting by a dominant negative
mechanism. Determination of the proteins that interact with DEF-1
should elucidate the signal transduction pathways where DEF-1
participates and may provide new insights into cellular signal transduction.
 |
ACKNOWLEDGMENTS |
We are indebted to A. Gashler, J. Chan, I. Aksoy, C. Furman,
W. Haser, and A. Yamakawa for advice, helpful discussions, and contributions of unpublished data. We are grateful to W. S. Lane, R. Robinson, V. Bailey, J. Neveu, T. Addona, and E. Spooner of the
Harvard Microchemistry Facility for their expertise in the HPLC, mass
spectrometry, and peptide sequencing. We also thank the members of the
Dana-Farber core facility for performing all the DNA sequencing described.
This work was supported by an NIH postdoctoral fellowship to F.J.K.
(CA09134) and NIH grants to B.M.S. (R37DK31405) and T.M.R. (CA43803).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cancer Biology, SM970, The Dana-Farber Cancer Institute, One Jimmy Fund Way, Boston, MA 02115. Phone: (617) 632-3049. Fax: (617) 632-4770. E-mail: thomas_roberts{at}dfci.harvard.edu.
Present address: SmithKline Beecham Pharmaceuticals, King of
Prussia, PA 19406.
 |
REFERENCES |
| 1.
|
Alexandropoulos, K.,
G. Cheng, and D. Baltimore.
1995.
Proline-rich sequences that bind to Src homology 3 domains with individual specificities.
Proc. Natl. Acad. Sci. USA
92:3110-3114[Abstract/Free Full Text].
|
| 2.
|
Bar-Sagi, D.,
D. Rotin,
A. Batzer,
V. Mandiyan, and J. Schlessinger.
1993.
SH3 domains direct cellular localization of signaling molecules.
Cell
74:83-91[Medline].
|
| 3.
|
Benito, M.,
A. Porras,
A. R. Nebreda, and E. Santos.
1991.
Differentiation of 3T3-L1 fibroblasts to adipocytes induced by transfection of ras oncogenes.
Science
253:565-568[Abstract/Free Full Text].
|
| 4.
|
Bjorbaek, C.,
S. Uotan,
B. da Silva, and J. S. Flier.
1997.
Divergent signaling capacities of the long and short isoforms of the leptin receptor.
J. Biol. Chem.
272:32686-32695[Abstract/Free Full Text].
|
| 5.
|
Brown, M. T.,
J. Andrade,
H. Radhakrishna,
J. G. Donaldson,
J. A. Cooper, and P. A. Randazzo.
1998.
ASAP1, a phospholipid-dependent Arf GTPase-activating protein that associates with and is phosphorylated by Src.
Mol. Cell. Biol.
18:7038-7051[Abstract/Free Full Text].
|
| 6.
|
Brun, R. P.,
P. Tontonoz,
B. M. Forman,
R. Ellis,
J. Chen,
R. M. Evans, and B. M. Spiegelman.
1996.
Differential activation of adipogenesis by multiple PPAR isoforms.
Genes Dev.
10:974-984[Abstract/Free Full Text].
|
| 7.
|
Cao, Z.,
R. M. Umek, and S. L. McKnight.
1991.
Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5:1538-1552[Abstract/Free Full Text].
|
| 8.
| Chan, J., I. Aksov, and C. Furman. Personal
communication.
|
| 9.
|
Chardin, P.,
J. H. Camonis,
N. W. Gale,
L. van Aelst,
J. Schlessinger,
M. H. Wigler, and D. Bar-Sagi.
1993.
Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.
Science
260:1338-1343[Abstract/Free Full Text].
|
| 10.
|
Cohen, G. B.,
R. Ren, and D. Baltimore.
1995.
Modular binding domains in signal transduction proteins.
Cell
80:237-248[Medline].
|
| 11.
|
Cornelius, P.,
O. A. MacDougald, and M. D. Lane.
1994.
Regulation of adipocyte development.
Annu. Rev. Nutr.
14:99-129[Medline].
|
| 12.
|
Courtneidge, S. A.
1994.
Protein tyrosine kinases, with emphasis on the Src family.
Semin. Cancer Biol.
5:239-246[Medline].
|
| 13.
|
Dai, Z., and A. M. Pendergast.
1995.
Abi-2, a novel SH3-containing protein interacts with the c-Abl tyrosine kinase and modulates c-Abl transforming activity.
Genes Dev.
9:2569-2582[Abstract/Free Full Text].
|
| 14.
|
Darnell, J. E., Jr.
1996.
Reflections on STAT3, STAT5, and STAT6 as fat STATs.
Proc. Natl. Acad. Sci. USA
93:6221-6224[Abstract/Free Full Text].
|
| 15.
|
Downing, A. K.,
P. C. Driscoll,
I. Gout,
K. Salim,
M. J. Zvelebil, and M. D. Waterfield.
1994.
Three-dimensional solution structure of the pleckstrin homology domain from dynamin.
Curr. Biol.
4:884-891[Medline].
|
| 16.
|
Feng, S.,
C. Kasahara,
R. J. Rickles, and S. L. Schreiber.
1995.
Specific interactions outside the proline-rich core of two classes of Src homology 3 ligand.
Proc. Natl. Acad. Sci. USA
92:12408-12415[Abstract/Free Full Text].
|
| 17.
|
Fernandez, J.,
L. Andrews, and S. M. Mische.
1994.
An improved procedure for enzymatic digestion of polyvinylidene difluoride-bound proteins for internal sequence analysis.
Anal. Biochem.
218:112-117[Medline].
|
| 18.
|
Forman, B. M.,
P. Tontonoz,
J. Chen,
R. P. Brun,
B. M. Spiegelman, and R. M. Evans.
1995.
15-Deoxy- 12,14-prostaglandin J2 is a ligand for the adiptocyte determination factor PPAR .
Cell
83:803-812[Medline].
|
| 19.
|
Fukuda, M.,
J. Aruga,
M. Niinobe,
S. Aimoto, and K. Mikoshiba.
1994.
Inositol-1,3,4,5-tetrakisphosphate binding to C2B domain of IP4BP/synaptotagmin II.
J. Biol. Chem.
269:29206-29211[Abstract/Free Full Text].
|
| 20.
|
Fumagalli, S.,
N. F. Totty,
J. J. Hsuan, and S. A. Courtneidge.
1994.
A target for Src in mitosis.
Nature
368:871-874[Medline].
|
| 21.
| Furman, C. Unpublished data.
|
| 22.
|
Ghilardi, N., and R. C. Skoda.
1997.
The leptin receptor activates janus kinase 2 and signals for proliferation in a factor-dependent cell line.
Mol. Endocrinol.
11:393-399[Abstract/Free Full Text].
|
| 23.
|
Ghilardi, N.,
S. Ziegler,
A. Wiestner,
R. Stoffel,
M. H. Heim, and R. C. Skoda.
1996.
Defective STAT signaling by the leptin receptor in diabetic mice.
Proc. Natl. Acad. Sci. USA
39:6231-6235.
|
| 24.
|
Gout, I.,
R. Dhand,
I. D. Hiles,
M. J. Fry,
G. Panayotou,
P. Das,
O. Truong,
N. F. Totty,
J. Hsuan,
G. W. Booker, et al.
1993.
The GTPase dynamin binds to and is activated by a subset of SH3 domains.
Cell
75:25-36[Medline].
|
| 25.
|
Hasegawa, H.,
E. Kiyokawa,
S. Tanaka,
K. Nagashima,
N. Gotoh,
M. Shibuya,
T. Kurata, and M. Matsuda.
1996.
DOCK180, a major CRK-binding protein, alters cell morphology upon translocation to the cell membrane.
Mol. Cell. Biol.
16:1770-1776[Abstract].
|
| 26.
|
Hwang, C. S.,
T. M. Loftus,
S. Mandrup, and M. D. Lane.
1997.
Adipocyte differentiation and leptin expression.
Annu. Rev. Cell Dev. Biol.
13:231-259[Medline].
|
| 27.
|
Kitamura, T.,
Y. Kitamura,
K. Yonezawa,
N. F. Totty,
I. Gout,
K. Hara,
M. D. Waterfield,
M. Sakaue,
W. Ogawa, and M. Kasuga.
1996.
Molecular cloning of p125Nap1, a protein that associates with an SH3 domain of Nck.
Biochem. Biophys. Res. Commun.
219:509-514[Medline].
|
| 28.
|
Kletzien, R. F.,
S. D. Clarke, and R. G. Ulrich.
1992.
Enhancement of adipocyte differentiation by an insulin-sensitizing agent.
Mol. Pharmacol.
41:393-398[Abstract].
|
| 29.
|
Kliewer, S. A.,
B. M. Forman,
B. Blumberg,
E. S. Ong,
U. Borgmeyer,
D. J. Mangelsdorf,
K. Umesono, and R. M. Evans.
1994.
Differential expression and activation of a family of murine peroxisome proliferator-activated receptors.
Proc. Natl. Acad. Sci. USA
91:7355-7359[Abstract/Free Full Text].
|
| 30.
|
Laborda, J.
1991.
36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO.
Nucleic Acids Res.
19:3998[Free Full Text].
|
| 31.
|
Lane, W. S.,
A. Galat,
M. W. Harding, and S. L. Schreiber.
1991.
Complete amino acid sequence of the FK506 and rapamycin binding protein, FKBP, isolated from calf thymus.
J. Protein Chem.
10:151-160[Medline].
|
| 32.
|
Lee, C. C., and C. T. Caskey.
1990.
cDNA cloning using degenerate primers, p. 46-53.
In
M. A. Innis, D. H. Gelfad, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
|
| 33.
|
Lehmann, J. M.,
L. B. Moore,
T. A. Smith-Oliver,
W. O. Wilkison,
T. M. Willson, and S. A. Kliewer.
1995.
An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma).
J. Biol. Chem.
270:12953-12956[Abstract/Free Full Text].
|
| 34.
|
Leibel, R. L.,
W. K. Chung, and S. C. Chua, Jr.
1997.
The molecular genetics of rodent single gene obesities.
J. Biol. Chem.
272:31937-31940[Free Full Text].
|
| 35.
|
Lim, W. A.,
F. M. Richards, and R. O. Fox.
1994.
Structural determinants of peptide-binding orientation and of sequence specificity in SH3 domains.
Nature
372:375-379[Medline].
|
| 36.
|
MacDougald, O. A., and M. D. Lane.
1995.
Transcriptional regulation of gene expression during adipocyte differentiation.
Annu. Rev. Biochem.
64:345-373[Medline].
|
| 37.
| Mandrup, S., and M. D. Lane. Regulating
adipogenesis. J. Biol. Chem. 272:5367-5370.
|
| 38.
|
Marth, J. D.,
D. B. Lewis,
M. P. Cooke,
E. D. Mellins,
M. E. Gearn,
L. E. Samelson,
C. B. Wilson,
A. D. Miller, and R. M. Perlmutter.
1989.
Lymphocyte activation provokes modification of a lymphocyte-specific protein tyrosine kinase (p56lck).
J. Immunol.
142:2430-2437[Abstract].
|
| 39.
|
McKinney, B., and M. Riley.
1967.
An orecin-oil red O stain for concomitant demonstration of elastic tissue and lipid.
Stain Technol.
42:245-258[Medline].
|
| 40.
| McNamee, H., and I. Aksoy. Personal communication.
|
| 41.
|
Michaely, P., and V. Bennett.
1993.
The membrane-binding domain of ankyrin contains four independently folded subdomains, each comprised of six ankyrin repeats.
J. Biol. Chem.
268:22703-22709[Abstract/Free Full Text].
|
| 42.
|
Miller, R. J., and G. I. Bell.
1996.
JAK/STAT eats the fat.
Trends Neurosci.
19:159-161[Medline].
|
| 43.
| Pawson, T. 1988. Non-catalytic domains of
cytoplasmic protein-tyrosine kinases: regulatory elements in signal
transduction. Oncogene 491-495.
|
| 44.
|
Pawson, T.
1995.
Protein modules and signalling networks.
Nature
373:573-580[Medline].
|
| 45.
|
Pawson, T., and J. D. Scott.
1997.
Signaling through scaffold, anchoring, and adaptor proteins.
Science
278:2075-2080[Abstract/Free Full Text].
|
| 46.
|
Porras, A.,
K. Muszynski,
U. R. Rapp, and E. Santos.
1994.
Dissociation between activation of Raf-1 kinase and the 42-kDa mitogen-activated protein kinase/90-kDa S6 kinase (MAPK/RSK) cascade in the insulin/Ras pathway of adipocytic differentiation of 3T3 L1 cells.
J. Biol. Chem.
269:12741-12748[Abstract/Free Full Text].
|
| 47.
|
Richard, S.,
D. Yu,
K. J. Blumer,
D. Hausladen,
M. W. Olszowy,
P. A. Connelly, and A. S. Shaw.
1995.
Association of p62, a multifunctional SH2- and SH3-domain-binding protein, with src family tyrosine kinases, Grb2, and phospholipase C -1.
Mol. Cell. Biol.
15:186-197[Abstract].
|
| 48.
|
Rickles, R. J.,
M. C. Botfield,
X. M. Zhou,
P. A. Henry,
J. S. Brugge, and M. J. Zoller.
1995.
Phage display selection of ligand residues important for Src homology 3 domain binding specificity.
Proc. Natl. Acad. Sci. USA
92:10909-10913[Abstract/Free Full Text].
|
| 49.
|
Sandouk, T.,
D. Reda, and C. Hofmann.
1993.
Antidiabetic agent pioglitazone enhances adipocyte differentiation of 3T3-F442A cells.
Am. J. Physiol.
264:C1600-C1608[Abstract/Free Full Text].
|
| 50.
|
Scaife, R., and R. L. Margolis.
1990.
Biochemical and immunochemical analysis of rat brain dynamin interaction with microtubules and organelles in vivo and in vitro.
J. Cell Biol.
111:3023-3033[Abstract/Free Full Text].
|
| 51.
|
Schindler, C., and J. E. Darnell, Jr.
1995.
Transcriptional responses to polypeptide ligands: the JAK-STAT pathway.
Annu. Rev. Biochem.
64:621-651[Medline].
|
| 52.
|
Sparks, A. B.,
N. B. Adey,
L. A. Quilliam,
J. M. Thorn, and B. K. Kay.
1995.
Screening phage-displayed random peptide libraries for SH3 ligands.
Methods Enzymol.
255:498-509[Medline].
|
| 53.
|
Spiegelman, B. M.,
L. Choy,
G. S. Hotamisligil,
R. A. Graves, and P. Tontonoz.
1993.
Regulation of adipocyte gene expression in differentiation and syndromes of obesity/diabetes.
J. Biol. Chem.
268:6823-6826[Free Full Text].
|
| 54.
|
Spiegelman, B. M., and J. S. Flier.
1996.
Adipogenesis and obesity: rounding out the big picture.
Cell
87:377-389[Medline].
|
| 55.
|
Sudol, M.
1994.
Yes-associated protein (YAP65) is a proline-rich phosphoprotein that binds to the SH3 domain of the yes proto-oncogene product.
Oncogene
9:2145-2152[Medline].
|
| 56.
|
Tanabe, K.,
S. Okuya,
Y. Tanizawa,
A. Matsutani, and Y. Oka.
1997.
Leptin induces proliferation of pancreatic beta cell line MIN6 through activation of mitogen-activated protein kinase.
Biochem. Biophys. Res. Commun.
241:765-768[Medline].
|
| 57.
|
Tanaka, K.,
S. Imajoh-Ohmi,
T. Sawada,
R. Shirai,
Y. Hashimoto,
S. Iwasaki,
K. Kaibuchi,
Y. Kanaho,
T. Shirai,
Y. Terada,
K. Kimura,
S. Nagata, and Y. Fukui.
1997.
A target of phosphatidylinositol 3,4,5-triphosphate with a zinc finger motif similar to that of the ADP-ribosylation-factor GTPase-activating protein and two pleckstrin homology domains.
Eur. J. Biochem.
245:512-519[Medline].
|
| 58.
|
Tartaglia, L. A.
1997.
The leptin receptor.
J. Biol. Chem.
272:32686-32695.
|
| 59.
|
Tartaglia, L. A.,
M. Dembski,
X. Weng,
N. Deng,
J. Culpepper,
R. Devos,
G. J. Richards,
L. A. Campfield,
F. T. Clark,
J. Deeds, et al.
1995.
Identification and expression cloning of a leptin receptor, OB-R.
Cell
83:1263-1271[Medline].
|
| 60.
|
Tontonoz, P.,
E. Hu,
R. A. Graves,
A. I. Budavari, and B. M. Spiegelman.
1994.
mPPAR 2: tissue-specific regulator of an adipocyte enhancer.
Genes Dev.
8:1224-1234[Abstract/Free Full Text].
|
| 61.
|
Tontonoz, P.,
E. Hu, and B. M. Spiegelman.
1994.
Stimulation of adipogenesis in fibroblasts by PPAR 2, a lipid-activated transcription factor.
Cell
79:1147-1156[Medline].
|
| 62.
|
Trainor, C. D.,
T. Evans,
G. Felsenfeld, and M. S. Boguski.
1990.
Structure and evolution of a human erythroid transcription factor.
Nature
343:92-96[Medline].
|
| 63.
|
Weng, Z.,
R. J. Rickles,
S. Feng,
S. Richard,
A. S. Shaw,
S. L. Schreiber, and J. S. Brugge.
1995.
Structure-function analysis of SH3 domains: SH3 binding specificity altered by single amino acid substitutions.
Mol. Cell. Biol.
15:5627-5634[Abstract].
|
| 64.
|
Williamson, M. P.
1994.
The structure and function of proline-rich regions in proteins.
Biochem. J.
297:249-260.
|
| 65.
|
Wu, Z.,
N. L. R. Bucher, and S. R. Farmer.
1996.
Induction of peroxisome proliferator-activated receptor during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBP , C/EBP , and glucocorticoids.
Mol. Cell. Biol.
16:4128-4136[Abstract].
|
| 66.
|
Yamabhai, M., and B. K. Kay.
1997.
Examining the specificity of Src homology 3 domain ligand interactions with alkaline phosphatase fusion proteins.
Anal. Biochem.
247:143-151[Medline].
|
| 67.
|
Yeh, W. C.,
Z. Cao,
M. Classon, and S. L. McKnight.
1995.
Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins.
Genes Dev.
9:168-181[Abstract/Free Full Text].
|
| 68.
|
Yu, H.,
J. K. Chen,
S. Feng,
D. C. Dalgarno,
A. W. Brauer, and S. L. Schreiber.
1994.
Structural basis for the binding of proline-rich peptides to SH3 domains.
Cell
76:933-945[Medline].
|
Molecular and Cellular Biology, March 1999, p. 2330-2337, Vol. 19, No. 3
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bharti, S., Inoue, H., Bharti, K., Hirsch, D. S., Nie, Z., Yoon, H.-Y., Artym, V., Yamada, K. M., Mueller, S. C., Barr, V. A., Randazzo, P. A.
(2007). Src-Dependent Phosphorylation of ASAP1 Regulates Podosomes. Mol. Cell. Biol.
27: 8271-8283
[Abstract]
[Full Text]
-
Ehlers, J. P., Worley, L., Onken, M. D., Harbour, J. W.
(2005). DDEF1 Is Located in an Amplified Region of Chromosome 8q and Is Overexpressed in Uveal Melanoma. Clin. Cancer Res.
11: 3609-3613
[Abstract]
[Full Text]
-
Stacey, T. T. I, Nie, Z., Stewart, A., Najdovska, M., Hall, N. E., He, H., Randazzo, P. A., Lock, P.
(2004). ARAP3 is transiently tyrosine phosphorylated in cells attaching to fibronectin and inhibits cell spreading in a RhoGAP-dependent manner. J. Cell Sci.
117: 6071-6084
[Abstract]
[Full Text]
-
Oda, A., Wada, I., Miura, K., Okawa, K., Kadoya, T., Kato, T., Nishihara, H., Maeda, M., Tanaka, S., Nagashima, K., Nishitani, C., Matsuno, K., Ishino, M., Machesky, L. M., Fujita, H., Randazzo, P.
(2003). CrkL Directs ASAP1 to Peripheral Focal Adhesions. J. Biol. Chem.
278: 6456-6460
[Abstract]
[Full Text]
-
Scott, M. P., Zappacosta, F., Kim, E. Y., Annan, R. S., Miller, W. T.
(2002). Identification of Novel SH3 Domain Ligands for the Src Family Kinase Hck. WISKOTT-ALDRICH SYNDROME PROTEIN (WASP), WASP-INTERACTING PROTEIN (WIP), AND ELMO1. J. Biol. Chem.
277: 28238-28246
[Abstract]
[Full Text]
-
Furman, C., Short, S. M., Subramanian, R. R., Zetter, B. R., Roberts, T. M.
(2002). DEF-1/ASAP1 Is a GTPase-activating Protein (GAP) for ARF1 That Enhances Cell Motility through a GAP-dependent Mechanism. J. Biol. Chem.
277: 7962-7969
[Abstract]
[Full Text]
-
Takai, Y., Sasaki, T., Matozaki, T.
(2001). Small GTP-Binding Proteins. Physiol. Rev.
81: 153-208
[Abstract]
[Full Text]
-
Jackson, T., Brown, F., Nie, , Miura, , Foroni, , Sun, , Hsu, V., Donaldson, J., Randazzo, P.
(2000). ACAPs Are Arf6 GTPase-activating Proteins That Function in the Cell Periphery. JCB
151: 627-638
[Abstract]
[Full Text]
-
Premont, R. T., Claing, A., Vitale, N., Perry, S. J., Lefkowitz, R. J.
(2000). The GIT Family of ADP-ribosylation Factor GTPase-activating Proteins. FUNCTIONAL DIVERSITY OF GIT2 THROUGH ALTERNATIVE SPLICING. J. Biol. Chem.
275: 22373-22380
[Abstract]
[Full Text]
-
Vitale, N., Patton, W. A., Moss, J., Vaughan, M., Lefkowitz, R. J., Premont, R. T.
(2000). GIT Proteins, A Novel Family of Phosphatidylinositol 3,4,5-Trisphosphate-stimulated GTPase-activating Proteins for ARF6. J. Biol. Chem.
275: 13901-13906
[Abstract]
[Full Text]