Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 1999, p. 2389-2399, Vol. 19, No. 3
Department of Microbiology and Institute for
Cellular and Molecular Biology, The University of Texas at Austin,
Austin, Texas
Received 8 September 1998/Returned for modification 13 October
1998/Accepted 4 November 1998
A mutation in NMD3 was found to be lethal in the
absence of XRN1, which encodes the major cytoplasmic
exoribonuclease responsible for mRNA turnover. Molecular genetic
analysis of NMD3 revealed that it is an essential gene
required for stable 60S ribosomal subunits. Cells bearing a
temperature-sensitive allele of NMD3 had decreased levels
of 60S subunits at the nonpermissive temperature which resulted in the
formation of half-mer polysomes. Pulse-chase analysis of rRNA
biogenesis indicated that 25S rRNA was made and processed with kinetics
similar to wild-type kinetics. However, the mature RNA was rapidly
degraded, with a half-life of 4 min. Nmd3p fractionated as a
cytoplasmic protein and sedimented in the position of free 60S subunits
in sucrose gradients. These results suggest that Nmd3p is a cytoplasmic
factor required for a late cytoplasmic assembly step of the 60S subunit
but is not a ribosomal protein. Putative orthologs of Nmd3p exist in
Drosophila, in nematodes, and in archaebacteria but not in
eubacteria. The Nmd3 protein sequence does not contain readily
recognizable motifs of known function. However, these proteins all have
an amino-terminal domain containing four repeats of Cx2C,
reminiscent of zinc-binding proteins, implicated in nucleic acid
binding or protein oligomerization.
A screen for mutations that are
lethal in yeast cells lacking the major cytoplasmic exoribonuclease,
Xrn1p, identified mutations in SKI2 and SKI3 and
one additional complementation group (27). ski6
and ski8 mutations are also synthetic lethal with
xrn1 NMD3 (nonsense-mediated decay) was previously identified
from a two-hybrid screen for proteins that interact with the
nonsense-mediated decay factor Upf1p (22). Nonsense-mediated
decay in yeast is a cytoplasmic pathway for the rapid elimination of
aberrant transcripts containing premature stop codons (reviewed in
reference 25). Homologous pathways are found in
nematodes (49) and mammalian cells (5;
reviewed in reference 41). Nonsense-mediated decay involves the recognition of a premature stop codon by a translating ribosome which is then thought to activate a scanning complex that
recognizes downstream sequence elements, leading to rapid decapping of
the transcript (12, 50). In yeast, the pathway depends on
UPF1, UPF2/NMD2, and UPF3 (10,
22, 36-38). Deletion of any of these genes prevents
nonsense-mediated decay, thus stabilizing otherwise unstable mRNA
containing premature nonsense codons. However, such mutants display few
growth defects, indicating that in yeast this pathway is dispensable
for normal growth.
Dominant mutants of NMD3 (also referred to as
SRC5) (30) have also been identified as
suppressors of the growth defect of a temperature-sensitive mutation in
QSR1/GRC5 (31), encoding the large ribosomal
subunit protein identified as L10 in the current ribosomal protein
nomenclature of Mager et al. (40) or as L7 in the
nomenclature of Zinker and Warner (68). L10 is thought to be
an exchangeable ribosomal protein (34) that may be added to
the large subunit in a late cytoplasmic assembly step (13). The genetic interaction between NMD3 and QSR1
suggests a role for NMD3 in ribosome function or synthesis.
Eukaryotic ribosome biogenesis is a complex process occurring largely
in the nucleolus, where rRNA is transcribed, modified, and processed
during assembly with approximately 80 ribosomal proteins into mature
ribosomal subunits. In Saccharomyces cerevisiae, three (25S,
5.8S, and 18S) of the four rRNAs are transcribed by RNA polymerase
I as a single 35S precursor in the nucleolus, whereas the fourth rRNA,
5S rRNA, is transcribed independently by RNA polymerase III
(66). The pre-rRNA then undergoes sequential cleavages and
trimming to generate the mature rRNAs. Most of the ribosomal proteins
assemble into subunits while in the nucleolus, although a few proteins,
including L10, are exchangeable and may be added after transport of
subunits to the cytoplasm.
rRNA processing and assembly of ribosomal proteins onto the rRNAs are
intimately linked processes. Thus, mutations in ribosomal proteins or
in factors required for assembly typically lead to the production of
defective subunits and potentially alter the specificity of
translation. Such defects may lead to the production of unstable
subunits, resulting in an imbalance between 40S and 60S (51,
67), or directly affect ribosome function without resulting in a
subunit imbalance (14). In this paper, we describe the
identification and functional analysis of NMD3, an essential gene from S. cerevisiae. While our initial identification of
a nmd3 mutant from a synthetic lethal screen with a
xrn1 mutant and its previous implication in
nonsense-mediated decay suggested a role in mRNA turnover, our results
suggest that NMD3 is required for a late cytoplasmic
assembly step of 60S ribosomal subunit biogenesis.
Strains, media, and genetic methods.
Strains used in this
study are listed in Table 1. Rich medium
(YPD), 5-fluoroorotic acid (5FOA), synthetic complete (SC) dropout
media, and standard yeast manipulations were as described elsewhere
(28). Yeast transformations were carried out by the lithium
acetate method as previously described (19) except that cells to be transformed were grown as light lawns on plates.
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
NMD3 Encodes an Essential Cytoplasmic
Protein Required for Stable 60S Ribosomal Subunits in
Saccharomyces cerevisiae
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
(1, 9). Although the superkiller
(SKI) genes were initially described as host antiviral genes
that repress expression of killer toxin encoded by an endogenous yeast
RNA virus (58; reviewed in reference 63), they have more recently been shown to play a
general role in the cell (27), to repress translation of
poly(A)
RNA (7, 43, 64), and to be required
for normal mRNA 3'-exonucleolytic degradation (1).
SKI6 encodes an essential 3'
5' exonuclease that is a
component of the exosome (45), and ski6 mutants
have defects in assembly of 60S ribosomal subunits (7). We
have now cloned the wild-type gene of the third complementation group identified in the previous XRN1 synthetic lethal screen
(27) and have shown that it is NMD3.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
TABLE 1.
S. cerevisiae strains used in this study
Cloning of NMD3 and DNA manipulation.
Strain
RDKY2050, identified in a previous screen (27), was
transformed with a centromeric LEU2 library containing 9- to 12-kbp inserts. Leu+ transformants were replica plated to
5FOA plates, and 5FOA-resistant colonies were restruck on 5FOA plates.
To identify and eliminate wild-type XRN1 clones,
5FOA-resistant clones were analyzed by PCR using primers to distinguish
wild-type XRN1 from the genomic xrn1 deletion
(xrn1
). Plasmid DNA from one complementing clone that was
not XRN1 was subcloned as a Sau3AI partial digest
into YEp351 as described previously (27). The insert in
pAJ78, containing the smallest complementing subclone, was sequenced
(Sequenase dideoxy sequencing kit; Amersham) and found to contain one
single complete open reading frame encoding NMD3.
nmd3::TRP1 disruption. The TRP1-containing BstUI fragment from pRS424 was ligated into pAJ78 that had been digested with MscI and BglII and blunt ended with T4 DNA polymerase. This gave a TRP1 disruption of NMD3 from nucleotides (nt) 248 to 1146 to create pAJ81. The L-A double-stranded RNA virus-deficient diploid, AJY362, was made by mating RDKY1997 and RDKY2037. The nmd3::TRP1-containing NheI-to-SpeI fragment of pAJ81 was transformed into AJY362. Trp+ transformants were analyzed by PCR for heterozygotes containing the correct integration of the nmd3::TRP1 allele at the NMD3 locus to give AJY384.
Genomic NMD3-LEU2.
An NMD3-containing
SmaI-to-NheI fragment from pAJ78 was ligated into
the LEU2-containing yeast integrating plasmid pRS305 digested with SmaI and XbaI. The resulting
plasmid (pAJ92) was digested with BamHI, which cuts within
NMD3 coding sequence, and integrated into the genomic
NMD3 locus of RDKY1979 (xrn1
) by transformation to give strain AJY404. The resulting NMD3
duplication with an intervening LEU2 gene was confirmed by
Southern blotting.
Plasmids.
Table 2 describes
the plasmids used in this study. All nucleotide numbering is relative
to the translation start, defined as +1 of the respective gene. pAJ123
was constructed by ligating the NMD3-containing
SmaI-to-SalI fragment from pAJ78 into the respective sites in pRS315. pAJ112, expressing His6-tagged
NMD3, was constructed as follows. Oligonucleotide primers
AJO108
(5'-CTAGTCTAGACTCGAGAAAATGCATCATCATCATCATCATTCCATGGAATTCACACCTATAGATCC), encoding the His6 tag and containing an
XhoI site, and AJO109 (5'-GCGCAAGCTTGAGTATATACTACTCTCC), containing a
HindIII site, were used to PCR amplify NMD3.
The XhoI- and HindIII-digested PCR product
was then ligated into XhoI- and
HindIII-digested pVT102U to give pAJ112.
|
Epitope-tagged NMD3. pAJ234, containing a galactose-inducible c-Myc-tagged NMD3, was created as follows. The PCR-amplified NMD3 coding sequence of pAJ112 was replaced with the NMD3-containing EcoRI-to-HindIII fragment from pAJ78 to give pAJ113. The NMD3-containing NcoI-to-HindIII fragment from pAJ113 was ligated into the corresponding sites in pRDK306 (47) to give pAJ118. Finally, oligonucleotide AJO148 (5'-CATGGAACAAAAGCTTATTTCTGAAGAAGACTTGAA), encoding the c-Myc epitope, and its complementary oligonucleotide were ligated into the NcoI site at the start codon of NMD3 in pAJ118 to give pAJ234. pAJ153, encoding c-Myc-tagged NMD3 expressed from its own promoter, was constructed as follows. The wild-type NMD3 promoter and 5' sequences were amplified from pAJ78 by using an M13 reverse sequencing primer and oligonucleotide AJO168 (5'-GGTAACGGTACCATGGTTTTGTCAAATTCCTCAACG). The resulting PCR product was digested with NcoI and SmaI and ligated to the c-Myc-NMD3-containing NcoI-to-BglII fragment from pAJ234 and the BglII-to-SmaI vector pAJ123. The resulting construct complemented the temperature sensitivity of an nmd3-4 mutant.
nmd3 mutants. The genomic nmd3-1 mutation was rescued to plasmid pAJ123 by in vivo recombination by transforming strain AJY543 with pAJ123 digested with SnaBI and HindIII, and the resulting plasmid was sequenced. nmd3-1 sequence was confirmed by directly sequencing the genomic locus amplified by PCR.
PCR mutagenesis was used to create random temperature-sensitive mutations in NMD3. Oligonucleotide primers AJO108 and AJO109 (see above) were used for PCR amplification of NMD3. The PCR product was digested with NcoI and was cotransformed into AJY529 with pAJ123 digested by MscI and BglII to remove NMD3 coding sequence from nt 245 to 1143. Leu+ transformants were then replica plated to 5FOA plates at 37 and 26°C. From approximately 2,000 transformants, three temperature-sensitive mutations, nmd3-2, nmd3-3, and nmd3-4, were obtained. All three nmd3 temperature-sensitive mutants behaved similarly, and nmd3-4 was used for most temperature shift experiments. pAJ124 (bearing nmd3-2) and pAJ129 (bearing nmd3-4) were transformed into AJY529, replacing pAJ112 to give strains AJY590 and AJY596 respectively. pAJ150, containing nmd3-4 on a URA3 integrating plasmid, was created by ligating the nmd3-4-containing NcoI-to-SalI fragment from pAJ129 into the respective sites of pRS406. pAJ150 was digested with BglII and transformed into the wild-type strain CH1305 to integrate pAJ150 into the NMD3 genomic locus. Ura+ transformants were then patched onto 5FOA plates to select for the loss of the intervening URA3 sequence and one copy of the NMD3 gene. 5FOA-resistant clones were then scored for temperature sensitivity, and loss of the integrated plasmid was confirmed by PCR of the genomic NMD3 locus. Since all temperature-sensitive isolates were petite, this strain (AJY717) bearing nmd3-4 was crossed to a wild-type grande (AJY483). The resulting heterozygous diploid was sporulated, and the resulting tetrads were dissected. All spore clones from the cross were grandes. AJY734 (nmd3-4) and AJY735 (wild type) from the same tetrad were used for further study.Northern blot analysis.
For CYH2 steady-state
mRNA analysis, 10-ml cultures were grown in SC dropout medium to a
density of approximately 107 cells/ml at 26°C and then
shifted to 37°C for 2 h. Cells were harvested and RNA was
prepared and analyzed by Northern blotting as previously described
(26). For time course experiments with thiolutin, 40-ml
cultures were grown in YPD at 26°C and then shifted to 37°C. After
1.75 h at 37°C, cells were collected by centrifugation and
resuspended in 10 ml of YPD at 37°C. After another 30 min at 37°C,
thiolutin was added to 3 µg/ml (final concentration). Immediately
after addition of thiolutin (time zero) and at various times afterward,
1.5-ml aliquots were removed, cells were collected by centrifugation,
and cell pellets were placed on dry ice. RNA was prepared and analyzed
by Northern blotting. For MFA2 Northern analysis, 25-ml
cultures were grown at 26°C in SC Ura
medium containing
2% raffinose to a density of approximately 107 cells/ml
and then shifted to 37°C for 2 h. Transcription was induced by
adding galactose to 2%. After 10 min, glucose was added to 2% to
repress transcription. At various times, cells were collected by
centrifugation and cell pellets were placed on dry ice. RNA was
prepared and analyzed by Northern blotting using oligonucleotide AJO101
(5'-GATCAGGAATTCCCCCCCCCCCCCCCCCCAAATTCCTA), specific to a
poly(G) insertion in MFA2 mRNA.
Pulse-chase analysis of pre-rRNA processing.
Labeling with
[methyl-3H]methionine was carried out as
described previously (67). Briefly, 5-ml cultures were grown
in SC Met
medium to a density of approximately 0.6 × 107 cells/ml at room temperature. Cells were harvested
by centrifugation, resuspended in 1.5 ml of SC Met
medium
prewarmed to 37°C, and grown at 37°C for 2 h. Cells were then
labeled by the addition of 150 µCi of
[methyl-3H]methionine. After labeling for 2 min, 150 µg of unlabeled methionine was added as a chase. At various
times, samples were taken and quickly frozen in dry ice.
medium. Cells were
shifted to 37°C for 2 h in 3 ml of SC Ura
medium,
pulse-labeled with 150 µCi of [3H]uracil for 3 min, and
chased with 900 µg of unlabeled uracil. RNAs were prepared and
analyzed by electrophoresis through formaldehyde-agarose gels (6%
formaldehyde, 1.2% agarose) as described elsewhere (28) and
by electrophoresis in urea-polyacrylamide gels (6% polyacrylamide, 8.2 M urea). To detect labeled RNAs, the gels were soaked in Enlightning (New England Nuclear), dried, and subjected to autoradiography.
Drug sensitivity tests. Fresh single colonies from plates were resuspended in sterile distilled water and plated on YPD plates. After the cell suspension had soaked into the plate, 0.25-in. sterile filters (Schleicher & Schuell catalog no. 740-E) were placed onto the plates, and the indicated amount of antibiotic was spotted onto the filter. Plates were incubated at room temperature or at 33°C.
Sucrose density gradients. For polysome preparation, yeast cultures were grown to a density of 0.6 × 107 cells/ml in 500 ml of YPD at 26°C. One half of the culture was removed and shifted to 37°C for 2 h. Just before the cells were harvested, cycloheximide was added to a final concentration of 100 µg/ml. The cells were harvested, washed once with 25 ml of ice-cold buffer C (10 mM Tris-HCl [pH 7.4], 100 mM NaCl, 30 mM MgCl2, cycloheximide [50 µg/ml], heparin [200 µg/ml]), and resuspended in 1 ml of ice-cold buffer C; 300 µl of cold glass beads (400-µm diameter; Sigma Chemical Co.) was added, and the suspension was vortexed six times, each consisting of 30 s of vortexing followed by 1 min of cooling on ice. Extracts were clarified by centrifugation, and 30 A260 units of cell lysate was loaded onto each 12-ml linear 7 to 47% sucrose gradient and centrifuged for 2.5 h at 40,000 rpm in a Beckman SW40 rotor at 4°C as described elsewhere (2).
Analysis of dissociated ribosomal subunits was as described above except that extracts were prepared in buffer C containing 30 mM EDTA and lacking MgCl2 and cycloheximide. In addition, gradients were prepared with 30 mM EDTA and no MgCl2, and centrifugation was for 5 h. Sucrose gradients were analyzed by continuous monitoring at A254 with a Pharmacia Uvicord monitor.Yeast cell fractionation and Western blotting. Yeast cells were fractionated into nuclear and cytoplasmic fractions as described previously (65). Proteins from cytoplasmic and nuclear fractions and from sucrose density gradients were analyzed by Western blotting as described previously (26), using anti-c-Myc monoclonal antibody at 1:5,000 as the primary antibody to detect c-Myc-tagged Nmd3p. Rabbit anti-topoisomerase II (Topo II) and rabbit anti-glucose-6-phosphate dehydrogenase (G6PDH) polyclonal antibodies were diluted 1:7,500 and used to detect nuclear and cytoplasmic protein markers, respectively. Rabbit polyclonal anti-Topo II antibody was a gift from J. Lindsley and J. Wang, anti-G6PDH antibody was obtained from Sigma, and mouse monoclonal anti-c-Myc was derived from 9E10.2 cells (American Type Culture Collection, Rockville, Md.).
| |
RESULTS |
|---|
|
|
|---|
Identification of nmd3-1 as synthetically lethal with
xrn1 deletion.
A previous screen for mutations
synthetically lethal with xrn1
identified recessive
mutations in three complementation groups. The wild-type genes for two
of these were cloned and identified as SKI2 and
SKI3 (27). The wild-type gene for the third
complementation group was cloned from a centromeric LEU2
plasmid library by complementation and shown to be NMD3.
NMD3 was previously found in a two-hybrid screen for proteins that
interact with Upf1p (22). Mutants in the UPF1
gene, originally isolated on the basis of their ability to enhance the
suppression of a frameshift mutation that led to premature
translational termination (11), selectively stabilize mRNAs
containing early nonsense mutations.
and putatively nmd3-1) containing
pRDK297 (XRN1 URA3) was mated with AJY404 (xrn1
NMD3::LEU2::NMD3), diploids were sporulated, and the
resulting tetrads were dissected. All tetrads containing four viable
spores (17 tetrads) showed 2:2 segregation of synthetic lethality,
scored as 5FOA sensitive (data not shown). No 5FOA-sensitive colonies
were Leu+, indicating no recombination between the putative
nmd3-1 allele and the LEU2-marked NMD3
locus, confirming that the original mutation was in NMD3.
NMD3 is an essential gene.
A heterozygous diploid
containing one nmd3::TRP1 allele was constructed
in a genetic background lacking the double-stranded RNA virus, L-A.
Upon sporulation and tetrad dissection, no Trp+ spore
clones were obtained from 37 tetrads and each ascus contained at least
two dead spores (data not shown), indicating that NMD3 is
essential. To further confirm the essentiality of NMD3, a
LEU2 NMD3 plasmid was transformed into the NMD3
heterozygous diploid before sporulation. This plasmid rescued the
inviability of Trp+ spore clones and allowed the recovery
of tetrads containing four viable spores (data not shown). All
Trp+ spore clones were also Leu+. Because
NMD3 is essential, the original recessive allele,
nmd3-1, identified as synthetically lethal with
xrn1
, must be a hypomorphic, or partially functional, allele.
Sequence analysis of wild-type and mutant NMD3. NMD3 encodes a 59.1-kDa protein that is homologous to hypothetical proteins from Caenorhabditis elegans and Drosophila melanogaster (Fig. 1) and from Schizosaccharomyces pombe (data not shown), suggesting conservation of NMD3 function throughout eukaryotes. In addition, apparent homologs, corresponding to the amino-terminal half of Nmd3p, are predicted from genome sequencing of the archaebacteria Methanococcus jannaschii and Methanobacterium thermoautotrophicum. Although this protein family does not contain readily identifiable protein motifs related to proteins of known function, it does contain a highly conserved cysteine repeat motif indicated in Fig. 1. These cysteine repeats are reminiscent of zinc-binding motifs of RING fingers, LIM domains (39), and type IV fingers (57). Determination of whether this motif is a novel zinc-binding motif will require further biochemical analysis.
|
, the nmd3-1 and
temperature-sensitive mutants behaved similarly in that all gave rise
to reduced levels of 60S subunits resulting in half-mers, sensitivity
to translation elongation inhibitors, and no obvious defects in mRNA
turnover (see below; also data not shown).
nmd3 mutants do not display significant defects in mRNA
turnover.
NMD3 was identified from two genetic screens for
mRNA turnover factors: synthetic lethality with xrn1
and
a two-hybrid screen with UPF1. Thus, it seemed likely that
nmd3 mutants would display defects in mRNA turnover,
especially for RNAs in the nonsense-mediated decay pathway. The
transcript from the CYH2 gene is inefficiently spliced in
yeast, and the pre-mRNA is rapidly degraded in the cytoplasm by
nonsense-mediated decay. The effects of temperature-sensitive nmd3-2 and nmd3-4 mutants on pre-CYH2
degradation were assessed. Cultures were shifted to the nonpermissive
temperature for 2 h, at which time thiolutin was added to inhibit
RNA polymerase II transcription. In this experiment, the
nmd3 mutant strains showed two- to fourfold-higher levels of
pre-CYH2 at the time of thiolutin addition, suggesting that
the steady-state levels of pre-CYH2 were slightly elevated
(Fig. 2A). A similar elevation in the
ratio of pre-CYH2 to mature CYH2 was also seen in
steady-state experiments (data not shown). However, there was no
significant difference in the rates of decay of pre-CYH2 or
mature CYH2. The half-lives of pre-CYH2 in
wild-type and mutant cells were about 4 and 5 min, respectively, and
those of mature CYH2 cells were 9.5 and 10.5 min,
respectively. In control experiments, an xrn1 null mutant showed significant stabilization of pre-CYH2 (data not
shown). The degradation of MFA2 mRNA in a transcription
pulse-chase experiment was also examined (Fig. 2B). After growth for
2 h at 37°C, transcription of a galactose-inducible
MFA2 construct was transiently induced with galactose
followed by inhibition of transcription by glucose. In this experiment,
there was no discernible difference between mutant and wild type.
Similar results were obtained for a galactose-inducible wild-type or
nonsense codon-containing MAT
1 transcript in the partially functional mutant nmd3-1 (data not shown). Thus,
NMD3 does not appear to have a general role in mRNA
degradation.
|
Effects of translation inhibitory drugs on nmd3
mutants.
Since nmd3 mutants did not show significant
defects in mRNA degradation, we examined their effects on translation,
first by assaying for sensitivity to various antibiotics that inhibit
translation. Figure 3 shows a disk
diffusion assay for drug sensitivity on plates. In this assay, strains
carrying both nmd3-1 and the temperature-sensitive allele
nmd3-4 displayed sensitivity to paromomycin (Fig. 3A) and hypersensitivity to hygromycin B (Fig. 3B) relative to wild-type strains. The light halo seen for the wild type in the presence of
paromomycin is a zone of slow growth distinct from the zone of total
growth inhibition seen in the nmd3-4 strain. Interestingly, an xrn1
mutant showed hypersensitivity to hygromycin B
but was not sensitive to paromomycin at the concentrations used (Fig. 3A and B). Paromomycin and hygromycin B increase the translational error rate during elongation in yeast cells, and mutations that affect
translational fidelity often confer increased sensitivity to these
drugs (21, 44, 53, 54). Cycloheximide also inhibits translation by direct interaction with the large ribosomal subunit, leading to the inhibition of translational elongation and the peptidyl
transfer reaction (29). As shown in Fig. 3C, the
nmd3-1 mutant displayed resistance to cycloheximide compared
to that of wild-type cells, whereas xrn1 mutants were
similar to wild-type cells in this assay (data not shown). The
sensitivity of nmd3 mutants to paromomycin and hygromycin B
and resistance to cycloheximide suggest a role for NMD3 in
translation and ribosome function.
|
nmd3 mutants display decreased levels of 60S ribosomal subunits and half-mer polysomes. The role of NMD3 in translation was analyzed more directly by examining the effects of an nmd3 mutation on polysome profiles. Polysomes were prepared from wild-type and temperature-sensitive nmd3-4 mutant cells grown at 26 or 37°C and analyzed by ultracentrifugation on sucrose density gradients. At the permissive temperature, profiles for the nmd3-4 mutant (Fig. 4C) and the wild type (Fig. 4A) were similar, but after 2 h at 37°C, the mutant showed a deficit of free 60S relative to free 40S ribosomal subunits, an overall decrease in the average number of ribosomes in polysomes, and the appearance of half-mers (Fig. 4D). Similar results were obtained with the hypomorphic allele nmd3-1 grown at 30°C (data not shown). The presence of half-mers, which contain 43S initiation complexes stalled at the initiator AUG, is indicative of a defect in a late step of the translation initiation pathway (18).
|
|
, it
was possible that any mutation that resulted in reduction of 60S
subunits would be synthetically lethal with xrn1
. This
was tested genetically by crossing an spb2 mutant (YAS398)
to an xrn1
mutant (RDKY1978) to determine if the double
mutant was viable. SPB2 encodes ribosomal protein L46, and
mutations in SPB2 lead to reduced levels of 60S subunits
(51). The xrn1
spb2
double mutants were
viable and did not grow appreciably more slowly than xrn1
single mutants (data not shown). Thus, nmd3-1 synthetic
lethality with xrn1
may not be due simply to reduced 60S levels.
Nmd3p is required for stable 25S rRNA. Defects in ribosomal subunit levels due to mutations in nonribosomal proteins typically suggest problems with rRNA processing and/or ribosomal subunit assembly. In yeast cells, the major portion of the rDNA repeat is transcribed by polymerase I and consists of a single transcription unit leading to the synthesis of a 35S rRNA precursor that is processed to form the 18S rRNA found in the 40S ribosomal subunit and the 25S and 5.8S rRNAs found in the 60S subunit. 5S rRNA, transcribed by polymerase III, also is found in 60S subunit (62, 66).
Since 25S and 18S rRNAs are highly methylated during processing, pre-rRNA processing is easily followed by metabolic labeling with [methyl-3H]methionine (61). RNA was pulse-chase labeled for 2 min at 37°C with [methyl-3H]methionine and then chased with unlabeled methionine. At the indicated times after the addition of unlabeled chase, total RNA was prepared and analyzed by formaldehyde-agarose gel electrophoresis. As shown in Fig. 6A, the nmd3-4 mutant showed a dramatic destabilization of 25S rRNA at 37°C. The half-life of 25S rRNA in the mutants was approximately 4 min, whereas in wild-type cells the label in 25S rRNA continued to accumulate throughout the chase (Fig. 6A). Although 25S rRNA failed to accumulate, the kinetics of processing of 18S and 25S rRNAs were normal in the nmd3-4 mutant at both room temperature and 37°C (Fig. 6A). This was seen by the transient appearance of mature 18S and 25S rRNAs at a 1:1 molar ratio at 2 min and the similar kinetics of disappearance of 27S and 20S precursor rRNAs, respectively. Similar results were obtained in separate experiments using different nmd3 mutant strains (data not shown). The slight increase in 35S precursor at time zero in the mutant was observed in separate experiments, whereas subsequent processing steps appeared to follow wild-type kinetics. It is not clear why the initial cleavage of 35S rRNA is slightly altered in the mutant; however, the localization of Nmd3p to the cytoplasm (see below) suggests that this is an indirect consequence of an nmd3 mutation.
|
Nmd3p cosediments with free 60S ribosomal subunits. Destabilization of ribosomal subunits can result from mutations in ribosomal protein genes, factors required for rRNA processing and factors required for assembly. Since nmd3-4 mutants did not show defects in rRNA processing, we investigated the possible association of Nmd3p with ribosomes. The Nmd3 protein was epitope tagged with one copy of the c-Myc epitope at its amino terminus. This construct, expressed from a single-copy centromeric plasmid, complemented the temperature sensitivity of an nmd3 mutant. Extracts were prepared from cells expressing the c-Myc-Nmd3p and fractionated on sucrose density gradients. The A254 profile of the gradient was determined, and fractions were collected (Fig. 7A). The protein compositions of gradient fractions were analyzed by immunoblotting. Western blot analysis showed that the majority of Nmd3p migrated at the position of free 60S subunits on sucrose gradients and was not observed in the fractions containing polysomes or at the top of the gradient (Fig. 7B). The large ribosomal protein L3 was used as a marker for the sedimentation of 60S ribosomal proteins. L3 was found within the regions of the gradient containing 60S subunits, 80S monosomes, and polysomal ribosomes but was absent from fractions containing free 40S subunits (Fig. 7B). These results suggest that Nmd3p is associated with 60S subunits, but its absence from 80S ribosomes and polysomes indicates that Nmd3p is not an integral ribosomal protein.
|
Cell fractionation. Since most ribosome assembly events occur in the nucleus, the apparent association of Nmd3p with free 60S subunits could have been explained by the cosedimentation of Nmd3p with nuclear pre-60S complexes. To address this possibility, cells expressing a functional c-Myc-tagged Nmd3p from a single-copy vector and expressed from its own promoter were fractionated into nuclear and cytoplasmic fractions. The proteins in arbitrary amounts of each fraction were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting. Topo II and G6PDH were used as nuclear and cytoplasmic markers, respectively. As seen in Fig. 8, Nmd3p fractionated similarly to G6PDH, the cytoplasmic marker protein. Topo II was highly enriched in the nuclear fraction lane, whereas Nmd3p and G6PDH were depleted. Quantitation of the band intensities in Fig. 8 revealed a 12-fold increased signal of Topo II in the nuclear fraction lane compared to total extract lane, whereas Nmd3p and G6PDH were depleted to 0.7- and 0.6-fold of their levels in the total extract lane. Thus, Nmd3p and G6PDH were present in the nuclear fraction at approximately 5% of the level expected if they were nuclear proteins. Although it is possible that a small amount of Nmd3p is present in the nucleus, the majority of the protein is cytoplasmic, supporting the notion that the apparent association with free 60S subunits reflects an association in the cytoplasm. The c-Myc cross-reactive protein was Nmd3p since no signal was observed from cells lacking c-Myc-tagged Nmd3p (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
We identified an allele of NMD3 from a screen for mutations synthetically lethal with a deletion of XRN1, which encodes the major cytoplasmic exoribonuclease responsible for mRNA degradation in yeast (27, 35, 55). NMD3 had previously been identified from a two-hybrid screen with UPF1 (22), a gene required for nonsense-mediated mRNA decay. In eukaryotes, premature stop codons within an mRNA stimulate rapid deadenylation-independent degradation of the mRNA, or nonsense-mediated decay (3, 25, 42, 48). In yeast, this pathway is not essential and depends on UPF1, UPF2/NMD2, and UPF3. Deletion of any one or all of these three genes prevents nonsense-mediated decay but confers few other apparent defects to the cell. NMD3, on the other hand, is an essential gene.
Dominant alleles of NMD3 (also referred to as SRC5) (30) have been identified from a screen for suppressors of a temperature-sensitive grc5 mutant (31). GRC5, also referred to as QSR1 (30), is an essential gene whose protein product, the large ribosomal subunit protein L10, is required for ribosomal subunit joining (13, 16). The loading of L10 to the 60S ribosomal subunit may be a late cytoplasmic event facilitated by the SQT1 gene product (15).
The essential nature of NMD3 along with the putative physical interaction of Nmd3p with Upf1p and the genetic interaction with xrn1 suggested to us that NMD3 may have a critical role in mRNA degradation. On the other hand, its genetic interaction with QSR1 implied a ribosomal function. Although these two functions are not mutually exclusive, our data support a primary role in ribosome biogenesis.
Examination of mRNA stability in nmd3 mutants indicated little defect in mRNA degradation. nmd3 mutants displayed a modest (two- to fourfold) increase in the abundance of pre-CYH2 mRNA, which is subject to nonsense-mediated decay. However, the increased levels of pre-CYH2 were not apparently due to impaired mRNA degradation since the half-life of pre-CYH2 was not significantly increased in the mutants. These modest mRNA stability phenotypes are in contrast to those observed for upf1 or xrn1 mutants, in which pre-CYH2 is highly stabilized. It is not clear why nmd3 mutants display elevated levels of pre-CYH2, but this could be due to a defect in export of pre-CYH2. Dominant alleles of nmd3 suppress grc5 mutations and restore the cytoskeletal defects of grc5 (31). Thus, it is conceivable that a defect in the cytoskeleton, caused by nmd3 mutation, affects mRNA export. Although we have observed no defects in mRNA turnover of deadenylation-dependent or of nonsense-mediated deadenylation-independent turnover in the nmd3-1 hypomorphic allele or in temperature-sensitive alleles, overexpression of a truncated form of Nmd3p, lacking the C-terminal 100 amino acids, leads to a dominant effect of general mRNA stabilization (6). Such stabilization appears to be a gain-of-function phenotype since it was not observed in our recessive alleles.
60S ribosomal subunits are unstable in a temperature-sensitive nmd3 mutant. Several classes of mutations that affect ribosomal subunit stability in yeast have been identified. These include defects in integral ribosomal proteins (46, 51), defects in rRNA processing (4, 8, 17, 20, 24, 52, 56, 59, 67), and defects in ribosome assembly (15, 33). Our data suggest that nmd3 mutants fall into the latter class. The partially functional allele nmd3-1 and nmd3 temperature-sensitive mutations result in reduced levels of 60S subunits and half-mer polysomes. The half-mer polysomes appear to be a consequence of reduced 60S subunit levels and not specifically to a subunit joining defect since their appearance follows a time course similar to that of depletion of 60S subunits (unpublished observation). Pulse-chase analysis of rRNA processing indicated that 25S and 18S RNAs were made with normal kinetics in the temperature-sensitive mutant at nonpermissive temperature. However, the 25S rRNA had a half-life of only 4 min. Such destabilization of 25S rRNA has been observed previously in cells depleted of the 60S subunit protein L16 (46). Since rRNA processing and ribosome assembly are intimately linked processes, the apparently normal processing of 25S rRNA in nmd3 mutants suggest that the nmd3 defect is late in the assembly pathway.
Western blot analysis of a functional epitope-tagged Nmd3p suggested that Nmd3p was associated with free 60S subunits but not with polysomes. However, the finding that Nmd3p fractionated as a cytoplasmic protein supports the idea that the association is with free cytoplasmic 60S subunits. Although most 60S subunit proteins are loaded onto the particle in the nucleolus, at least four proteins are believed to be exchangeable, raising the possibility that they are added in the cytoplasm. One of these is the L10, encoded by QSR1 (13). As noted above, NMD3 shows a genetic interaction with QSR1. A second gene, SQT1, was identified as a high-copy-number suppressor of a dominant negative phenotype conferred by overexpressing a truncated L10 (15). Sqt1p is thought to function in the cytoplasm in loading L10 onto the 60S subunit. Interestingly, depletion of L10 does not result in destabilization of 60S subunits, whereas depletion of Sqt1p does. Thus, in addition to loading L10 protein, Sqt1p must have an additional function that is required for subunit integrity. It has been suggested that Sqt1p may contribute to a novel mechanism of translational control by modulating ribosome function through exchanging protein L10 (13). That both SQT1 and NMD3 appear to be required for a late cytoplasmic assembly step and both have genetic interaction with QSR1 suggests that Sqt1p and Nmd3p may act together. However, in preliminary experiments we have not observed physical or genetic interaction between SQT1 and NMD3 (23). Additionally, whereas Sqt1p has been suggested to exchange L10 protein onto and off ribosomes, the depletion of 60S subunits in nmd3-4 mutants is observed only after several hours at the nonpermissive temperature (data not shown). This finding suggests that nmd3 mutations do not affect ribosomes already formed. Thus, NMD3 is most likely required for a maturation step and not for exchanging proteins on existing ribosomes. Such a maturation step could be protein loading, rRNA modification, or rearrangement of existing components. It is also possible that transport of the 60S subunit is affected. Comparison of Nmd3p sequence with GenBank sequences indicated that the protein is conserved throughout eukaryotes. In addition, archaebacteria but not bacteria contain proteins of related sequence. Sequence analysis of Nmd3p revealed no readily recognizable protein motifs. Intriguingly, these proteins all contain Cx2Cx10-12Cx2Cx18-21Cx2Cx75-89Cx2C. This sequence is reminiscent of various cysteine-rich zinc-binding motifs including RING fingers, type IV zinc fingers, and LIM domains (39, 57), although the spacing of the Cx2C repeats and additional residues defining these motifs are not conserved in Nmd3p. Because Nmd3p is required for a ribosome assembly step, it is possible that this motif in Nmd3p is involved in either RNA binding or protein-protein interaction to facilitate the loading or rearrangement of a 60S ribosomal protein.NMD3 and nonsense-mediated mRNA decay. The identification of NMD3 from a two-hybrid screen with UPF1 suggests a role for NMD3 in nonsense-mediated decay. However, we were unable to observe a defect in nonsense mRNA decay in nmd3 mutants. Thus, NMD3 does not appear to be required for the nonsense-mediated decay pathway. It is intriguing that the nmd3-1 mutation results in truncation of the protein within the region identified as interacting with Upf1p. However, UPF1 is not an essential gene whereas NMD3 is, and nmd3-1 upf1 double mutants are viable (23). Thus, UPF1 is not required for NMD3 function. The finding that overexpression of a truncated Nmd3p gives rise to a dominant stabilization of mRNA suggests that Nmd3p may interact with mRNA turnover factors (6), although our work suggests that it is not required for normal mRNA turnover.
The basis for synthetic lethality between nmd3-1 and
xrn1
.
At present we do not know why the nmd3-1
mutation is synthetic lethal with an xrn1 null mutation.
nmd3 temperature-sensitive mutants are unable to assemble
stable 60S subunits, manifest in a reduced pool of free and total 60S
subunits. This in turn leads to a translation initiation defect. The
partial function allele, nmd3-1, identified as synthetically
lethal with xrn1, also displayed reduced 60S levels,
suggesting that in an xrn1 mutant, normal levels of 60S
subunits are essential. This idea suggests that other mutations leading
to reduced 60S levels would also be synthetically lethal with an
xrn1 deletion. However, an spb2 mutation, which leads to reduced 60S levels, is not synthetically lethal with xrn1. Thus, synthetic lethality is not due simply to reduced
60S levels, suggesting that there is a specific defect conferred by nmd3-1 on the 60S subunit. The identification of
nmd3 suppressors should shed light on the specific function
of NMD3 and the reason for its genetic interaction with
XRN1.
| |
ACKNOWLEDGMENTS |
|---|
We thank Alan Sachs for providing strain YAS398, Janet
Lindsley and Jim Wang for providing anti-Topo II antibodies, Jonathan Warner for anti-L3 antibodies, and Roy Parker for plasmid pRP485. We
are grateful to Xianmei Yang for the spb2
cross with
xrn1
and Justin Brown for c-Myc-NMD3 construct
pAJ153. We are especially appreciative of John Woolford for critical
reading of the manuscript and of Allan Jacobson for sharing results
before publication. DNA sequence analysis was done by the Core Facility
at the Institute for Cellular and Molecular Biology, University of
Texas at Austin.
This work was supported by NIH grant GM056355 to A. W. Johnson.
| |
ADDENDUM IN PROOF |
|---|
Because we found that the c-Myc signal of epitope-tagged Nmd3p was weak, even when expressed from a galactose-inducible promoter, we have since tagged the genomic NMD3 with 13 tandem copies of c-Myc to verify the cytoplasmic localization. The multiply tagged protein was functional and by indirect immunofluorescence techniques it was found in the cytoplasm and excluded from the nucleus.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, The University of Texas at Austin, Austin, TX 78712-1095. Phone: (512) 475-6350. Fax: (512) 471-7088. E-mail: arlen{at}mail.utexas.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Anderson, J. S. J., and R. Parker. 1998. The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17:1497-1506[Medline]. |
| 2. |
Baim, S. B.,
D. F. Pietras,
D. C. Eustice, and F. Sherman.
1985.
A mutation allowing an mRNA secondary structure diminishes translation of Saccharomyces cerevisiae iso-1-cytochrome c.
Mol. Cell. Biol.
5:1839-1846 |
| 3. |
Barker, G. F., and K. Beemon.
1991.
Nonsense codons within the Rous sarcoma virus gag gene decrease the stability of unspliced viral RNA.
Mol. Cell. Biol.
11:2760-2768 |
| 4. |
Baudin-Baillien, A.,
D. Tollervey,
C. Cullin, and F. Lacroute.
1997.
Functional analysis of Rrp7p, an essential yeast protein involved in pre-rRNA processing and ribosome assembly.
Mol. Cell. Biol.
17:5023-5032 |
| 5. |
Belgrader, P.,
J. Cheng,
X. Zhou,
L. S. Stephenson, and L. E. Maquat.
1994.
Mammalian nonsense codons can be cis effectors of nuclear mRNA half-life.
Mol. Cell. Biol.
14:8219-8228 |
| 6. | Belk, J., F. He, and A. Jacobson. 1998. Personal communication. |
| 7. |
Benard, L.,
K. Carroll,
R. C. P. Valle, and R. B. Wickner.
1998.
Ski6p is a homolog of RNA-processing enzymes that affects translation of non-poly(A) mRNAs and 60S ribosomal subunit biogenesis.
Mol. Cell. Biol.
18:2688-2696 |
| 8. |
Briggs, M. W.,
K. T. Burkard, and J. S. Butler.
1998.
Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8S rRNA 3' end formation.
J. Biol. Chem.
273:13255-13263 |
| 9. | Brown, J. T., and A. W. Johnson. 1998. Unpublished data. |
| 10. |
Cui, Y.,
K. W. Hagan,
S. Zhang, and S. W. Peltz.
1995.
Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination codon.
Genes Dev.
9:423-436 |
| 11. |
Culbertson, M. R.,
K. M. Underbrink, and G. R. Fink.
1980.
Frameshift suppression in Saccharomyces cerevisiae. II. Genetic properties of group II suppressors.
Genetics
95:833-853 |
| 12. |
Czaplinski, K.,
M. J. Ruiz-Echevarria,
S. V. Paushkin,
X. Han,
Y. Weng,
H. A. Perlick,
H. C. Dietz,
M. D. Ter-Avanesyan, and S. W. Peltz.
1998.
The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs.
Genes Dev.
12:1665-1677 |
| 13. | Dick, F. A., D. P. Eisinger, and B. L. Trumpower. 1997. Exchangeability of Qsr1p, a large ribosomal subunit protein required for subunit joining, suggests a novel translational regulatory mechanism. FEBS Lett. 419:1-3[Medline]. |
| 14. | Dinman, J. D., and R. B. Wickner. 1995. 5S rRNA is involved in fidelity of translational reading frame. Genetics 141:95-105[Abstract]. |
| 15. |
Eisinger, D. P.,
F. A. Dick,
E. Denke, and B. L. Trumpower.
1997.
SQT1, which encodes an essential WD domain protein of Saccharomyces cerevisiae, suppresses dominant-negative mutations of the ribosomal protein gene QSR1.
Mol. Cell. Biol.
17:5146-5155 |
| 16. |
Eisinger, D. P.,
F. A. Dick, and B. L. Trumpower.
1997.
Qsr1p, a 60S ribosomal subunit protein, is required for joining of 40S and 60S subunits.
Mol. Cell. Biol.
17:5136-5145 |
| 17. |
Fabian, G. R., and A. K. Hopper.
1987.
RRP1, a Saccharomyces cerevisiae gene affecting rRNA processing and production of mature ribosomal subunits.
J. Bacteriol.
169:1571-1578 |
| 18. |
Foiani, M.,
A. M. Cigan,
C. J. Paddon,
S. Harashima, and A. G. Hinnebusch.
1991.
GCD2, a translational repressor of the GCN4 gene, has a general function in the initiation of protein synthesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:3203-3216 |
| 19. |
Gietz, D.,
A. St. John,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425 |
| 20. | Ginisty, H., F. Amalric, and P. Bouvet. 1998. Nucleolin functions in the first step of ribosomal RNA processing. EMBO J. 17:1476-1486[Medline]. |
| 21. | Gonzalez, A., A. Jimenez, D. Vazquez, J. E. Davies, and D. Schindler. 1978. Studies on the mode of action of hygromycin B, an inhibitor of translocation in eukaryotes. Biochim. Biophys. Acta 521:459-469[Medline]. |
| 22. |
He, F., and A. Jacobson.
1995.
Identification of a novel component of the nonsense-mediated mRNA decay pathway by use of an interacting protein screen.
Genes Dev.
9:437-454 |
| 23. | Ho, J. H.-N., and A. W. Johnson. Unpublished data. |
| 24. |
Hong, B.,
J. S. Brockenbrough,
P. Wu, and J. P. Aris.
1997.
Nop2p is required for pre-rRNA processing and 60S ribosome subunit synthesis in yeast.
Mol. Cell. Biol.
17:378-388 |
| 25. | Jacobson, A., and S. W. Peltz. 1996. Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem. 65:693-739[Medline]. |
| 26. |
Johnson, A. W.
1997.
Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.
Mol. Cell. Biol.
17:6122-6130 |
| 27. |
Johnson, A. W., and R. D. Kolodner.
1995.
Synthetic lethality between SEP1/XRN1 and the antiviral genes SKI2 and SKI3 is independent of virus and suggests a general role in translation control.
Mol. Cell. Biol.
15:2719-2727 |
| 28. | Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 29. |
Kaufer, N. F.,
H. M. Fried,
W. F. Schwindinger,
M. Jasin, and J. R. Warner.
1983.
Cycloheximide resistance in yeast: the gene and its protein.
Nucleic Acids Res.
11:3123-3135 |
| 30. | Koller, L. Personal communication. |
| 31. | Koller, L., T. Karl, T. Klade, R. Kodzius, A. Thur, R. Andrejic, and M. Breitenbach. 1995. Personal communication. |
| 32. |
Kranz, J. E., and C. Holm.
1990.
Cloning by function: an alternative approach for identifying yeast homologs of genes from other organisms.
Proc. Natl. Acad. Sci. USA
87:6629-6633 |
| 33. |
Kressler, D.,
J. de la Cruz,
M. Rojo, and P. Linder.
1998.
Dbp6p is an essential putative ATP-dependent RNA helicase required for 60S-ribosomal-subunit assembly in Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:1855-1865 |
| 34. | Kruiswijk, T., R. J. Planta, and J. M. Krop. 1978. The course of assembly of ribosomal subunits in yeast. Biochim. Biophys. Acta 517:378-389[Medline]. |
| 35. |
Larimer, F. W.,
C. L. Hsu,
M. K. Maupin, and A. Stevens.
1992.
Characterization of the XRN1 gene encoding a 5' 3' exoribonuclease: sequence data and analysis of disparate protein and mRNA levels of gene-disrupted yeast cells.
Gene
120:51-57[Medline].
|
| 36. |
Lee, B. S., and M. R. Culbertson.
1995.
Identification of an additional gene required for eukaryotic nonsense mRNA turnover.
Proc. Natl. Acad. Sci. USA
92:10354-10358 |
| 37. |
Leeds, P.,
S. W. Peltz,
A. Jacobson, and M. R. Culbertson.
1991.
The product of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a premature translational termination codon.
Genes Dev.
5:2303-2314 |
| 38. |
Leeds, P.,
J. M. Wood,
B.-S. Lee, and M. R. Culbertson.
1992.
Gene products that promote mRNA turnover in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:2165-2177 |
| 39. | Mackay, J. P., and M. Crossley. 1998. Zinc fingers are sticking together. Trends Biochem. Sci. 23:1-4[Medline]. |
| 40. |
Mager, W. H.,
R. J. Planta,
J. Ballesta,
J. C. Lee,
K. Mizuta,
K. Suzuki,
J. R. Warner, and J. Woolford.
1997.
A new nomenclature for the cytoplasmic ribosomal proteins Saccharomyces cerevisiae.
Nucleic Acids Res.
25:4872-4875 |
| 41. | Maquat, L. E. 1995. When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells. RNA 1:453-465[Abstract]. |
| 42. |
Maquat, L. E.,
A. J. Kinneburgh,
E. A. Rachmilewitz, and J. Ross.
1981.
Unstable -globin mRNA in mRNA deficient beta o thalassemia.
Cell
27:543-553[Medline].
|
| 43. |
Masison, D. C.,
A. Blanc,
J. C. Ribas,
K. Carroll,
N. Sonenberg, and R. B. Wickner.
1995.
Decoying the cap mRNA degradation system by a double-stranded RNA virus and poly(A) mRNA surveillance by a yeast antiviral system.
Mol. Cell. Biol.
15:2763-2771 |
| 44. | Masurekar, M., E. Palmer, B. I. Ono, J. M. Wilhelm, and F. Sherman. 1981. Misreading of the ribosomal suppressor SUF46 due to an altered 40S subunit in yeast. J. Mol. Biol. 147:381-390[Medline]. |
| 45. |
Mitchell, P.,
E. Petfalski,
A. Shevchenko,
M. Mann, and D. Tollervey.
1997.
The exosome: a conserved eukaryotic RNA processing complex containing multiple 3' 5' exoribonucleases.
Cell
91:457-466[Medline].
|
| 46. |
Moritz, M.,
B. A. Pulaski, and J. L. Woolford, Jr.
1991.
Assembly of 60S ribosomal subunits is perturbed in temperature-sensitive yeast mutants defective in ribosomal protein L16.
Mol. Cell. Biol.
11:5681-5692 |
| 47. |
Page, A. M.,
K. Davis,
C. Molineux,
R. D. Kolodner, and A. W. Johnson.
1998.
Mutational analysis of exoribonuclease I in Saccharomyces cerevisiae.
Nucleic Acids Res.
26:3707-3716 |
| 48. | Peltz, S. W., F. He, E. Welch, and A. Jacobson. 1994. Nonsense-mediated mRNA decay in yeast. Prog. Nucleic Acid Res. Mol. Biol. 47:271-297[Medline]. |
| 49. |
Pulak, R., and P. Anderson.
1993.
mRNA surveillance by the Caenorhabditis elegans smg genes.
Genes Dev.
7:1885-1897 |
| 50. | Ruiz-Echevarria, M. J., C. I. Gonzalez, and S. W. Peltz. 1998. Identifying the right stop: determining how the surveillance complex recognizes and degrades an aberrant mRNA. EMBO J. 17:575-589[Medline]. |
| 51. | Sachs, A. B., and R. W. Davis. 1989. The poly(A) binding protein is required for poly(A) shortening and 60S ribosomal subunit-dependent translation initiation. Cell 58:857-867[Medline]. |
| 52. |
Sachs, A. B., and R. W. Davis.
1990.
Translation initiation and ribosome biogenesis: involvement of a putative rRNA helicase and RPL46.
Science
247:1077-1079 |
| 53. |
Sandbaken, M. G., and M. R. Culbertson.
1988.
Mutations in elongation factor EF1-a affect the frequency of frameshifting and amino acid misincorporation in Saccharomyces cerevisiae.
Genetics
120:923-934 |
| 54. | Singh, A., D. Ursic, and J. Davies. 1990. Phenotypic suppression and misreading in Saccharomyces cerevisiae. Nature (London) 277:146-148. |
| 55. |
Stevens, A.
1980.
Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5'-mononucleotides by a 5' 3' mode of hydrolysis.
J. Biol. Chem.
255:3080-3085 |
| 56. | Sun, C., and J. L. Woolford, Jr. 1994. The yeast NOP4 gene product is an essential nucleolar protein required for pre-rRNA processing and accumulation of 60S ribosomal subunits. EMBO J. 13:3127-3135[Medline]. |
| 57. | Teakle, G. R., and P. M. Gilmartin. 1998. Two forms of type IV zinc-finger motif and their kingdom-specific distribution between the flora, fauna and fungi. Trends Biochem. Sci. 23:100-102[Medline]. |
| 58. |
Toh-e, A.,
P. Guerry, and R. B. Wickner.
1978.
Chromosomal superkiller mutants of Saccharomyces cerevisiae.
J. Bacteriol.
136:1002-1007 |
| 59. | Venema, J., and D. Tollervey. 1996. RRP5 is required for formation of both 18S and 5.8S rRNA in yeast. EMBO J. 15:5701-5714[Medline]. |
| 60. | Vernet, T., D. Dignard, and D. Y. Thomas. 1987. A family of yeast expression vectors containing the phage f1 intergenic region. Gene 52:225-233[Medline]. |
| 61. | Warner, J. R. 1991. Labeling of RNA and phosphoproteins in Saccharomyces cerevisiae. Methods Enzymol. 194:423-427[Medline]. |
| 62. |
Warner, J. R.
1989.
Synthesis of ribosomes in Saccharomyces cerevisiae.
Microbiol. Rev.
53:256-271 |
| 63. |
Wickner, R. B.
1996.
Double-stranded viruses of Saccharomyces cerevisiae.
Microbiol. Rev.
60:250-265 |
| 64. |
Widner, W. R., and R. B. Wickner.
1993.
Evidence that the SKI antiviral system of Saccharomyces cerevisiae acts by blocking expression of viral mRNA.
Mol. Cell. Biol.
13:4331-4341 |
| 65. | Wise, J. A. 1991. Preparation and analysis of low molecular weight RNAs and small ribonucleoproteins. Methods Enzymol. 194:405-415[Medline]. |
| 66. | Woolford, J. L., Jr., and J. R. Warner (ed.). 1991. The ribosome and its synthesis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 67. |
Zanchin, N. I. T.,
P. Roberts,
A. Desilva,
F. Sherman, and D. S. Goldfarb.
1997.
Saccharomyces cerevisiae Nip7p is required for efficient 60S ribosome subunit biogenesis.
Mol. Cell. Biol.
17:5001-5015 |
| 68. |
Zinker, S., and J. R. Warner.
1976.
The ribosomal proteins of Saccharomyces cerevisiae. Phosphorylated and exchangeable proteins.
J. Biol. Chem.
251:1799-1807 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»