Previous Article | Next Article 
Molecular and Cellular Biology, April 1999, p. 2485-2494, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
p70S6K Controls Selective mRNA
Translation during Oocyte Maturation and Early Embryogenesis in
Xenopus laevis
Markus S.
Schwab,1
Sang H.
Kim,1
Naohiro
Terada,2
Catarina
Edfjäll,3
Sara C.
Kozma,3
George
Thomas,3 and
James L.
Maller1,*
Howard Hughes Medical Institute and
Department of Pharmacology, University of Colorado School of
Medicine, Denver, Colorado 802621;
Division of Basic Sciences, National Jewish Medical Research
Center, Denver, Colorado 802062; and
Friedrich Meischer Institute, Basel,
Switzerland3
Received 4 September 1998/Returned for modification 22 October
1998/Accepted 28 December 1998
 |
ABSTRACT |
In mammalian cells, p70S6K plays a key role in
translational control of cell proliferation in response to growth
factors. Because of the reliance on translational control in early
vertebrate development, we cloned a Xenopus homolog of
p70S6K and investigated the activity profile of
p70S6K during Xenopus oocyte maturation and
early embryogenesis. p70S6K activity is high in resting
oocytes and decreases to background levels upon stimulation of
maturation with progesterone. During embryonic development, three peaks
of activity were observed: immediately after fertilization, shortly
before the midblastula transition, and during gastrulation. Rapamycin,
an inhibitor of p70S6K activation, caused oocytes to
undergo germinal vesicle breakdown earlier than control oocytes, and
sensitivity to progesterone was increased. Injection of a
rapamycin-insensitive, constitutively active mutant of
p70S6K reversed the effects of rapamycin.
However, increases in S6 phosphorylation were not significantly
affected by rapamycin during maturation. mos
mRNA, which does not contain a 5'-terminal oligopyrimidine tract (5'-TOP), was translated earlier, and a larger amount of Mos
protein was produced in rapamycin-treated oocytes. In
fertilized eggs rapamycin treatment increased the translation
of the Cdc25A phosphatase, which lacks a 5'-TOP. Translation assays
in vivo using both DNA and RNA reporter constructs with the 5'-TOP
from elongation factor 2 showed decreased translational activity with rapamycin, whereas constructs without a 5'-TOP or with an
internal ribosome entry site were translated more efficiently upon
rapamycin treatment. These results suggest that changes in
p70S6K activity during oocyte maturation and early
embryogenesis selectively alter the translational capacity available
for mRNAs lacking a 5'-TOP region.
 |
INTRODUCTION |
In mammalian cells, the p70 and p85
isoforms of the 70-kDa ribosomal protein S6 kinase
(p70S6K) are both rapidly activated upon
stimulation of cells with virtually all mitogenic factors (31, 46,
60). The two isoforms are identical except that p85 has an
amino-terminal 23-amino-acid extension containing a nuclear
localization signal. The two isoforms are derived from the same
transcript by alternative translation initiation start sites
(50a). p70S6K is activated by a complex
pattern of phosphorylation on several sites by various
upstream kinases (48, 60). The first event is
phosphorylation of (Ser/Thr)-Pro sites
Ser411, Ser418, Thr421, and
Ser424 in the carboxy-terminal autoinhibitory domain,
facilitating phosphorylation of Thr389 and
Ser404 in the linker region, which in turn leads to
disruption of the interaction between the carboxy and amino termini of
the protein. Finally, phosphorylation of Thr229 leads to full activation of p70S6K.
The kinase responsible for Thr229
phosphorylation is the constitutively active
3-phosphoinositide-dependent protein kinase 1 (1a, 49a), whereas the kinases involved in the previous
phosphorylation events, also required for activation,
are not clearly identified. However, phosphorylation of
Thr389 in mammalian cells is dependent on the kinase
activity of target of rapamycin (TOR), also termed FRAP, RAFT, or RAPT (9, 48, 60). The macrolide
antibiotic rapamycin is a potent inhibitor of the
p70S6K pathway. It forms a complex with FKBP12, which
specifically blocks activity of mammalian TOR, thereby leading to rapid
deactivation of p70S6K (1, 9, 16, 31, 58).
Rapamycin has been shown to down-regulate the
translation of mRNAs containing a 5'-terminal
oligopyrimidine tract (5'-TOP), which include those for
ribosomal proteins and other proteins of the translational machinery
(4, 28, 29, 41, 59). All known mRNAs for vertebrate
ribosomal proteins and protein synthesis elongation factors
contain a 5'-TOP, and their translation is regulated in
response to mitogens (2-5, 30, 31, 41) via
p70S6K activity (28).
The downstream target of p70S6K is ribosomal
protein S6, which is present in a single copy per 40S subunit. S6
becomes rapidly phosphorylated on five serine residues
in its carboxy-terminal region upon stimulation of cells with growth
factors. Moreover, phosphorylation occurs in an ordered
manner in vivo and in vitro (6, 63). S6
phosphorylation is closely correlated with increased rates of protein synthesis when quiescent cells reenter the cell cycle
(17, 58). Conversely, a decrease in protein synthesis is
paralleled by lower S6 phosphorylation (58).
The concept that the function of p70S6K is linked to
regulation of protein synthesis is also suggested by studies in murine
embryonic stem cells with a disrupted p70S6K gene
(32).
Other studies have suggested that p70S6K is also linked
to pathways controlling cell cycle progression. In particular,
microinjection of neutralizing p70S6K antibodies into
mammalian cells inhibits G1 progression (35). Moreover, mice deficient for p70S6K are significantly
smaller, an effect which is most dramatic during embryogenesis.
Unexpectedly, mouse embryo fibroblasts derived from
p70S6K-deficient mice were as sensitive to
rapamycin as mouse embryo fibroblasts derived from wild-type
animals, and there was no effect on the S6
phosphorylation response (57). These studies
led to the identification of a new highly homologous S6 kinase which is
rapamycin sensitive and whose transcript is up-regulated in all
tissues examined (57). The importance of
p70S6K in both protein synthesis and cell cycle
progression awaits studies in mice deficient for both S6 kinase genes.
Xenopus oocytes are an interesting system for the study of
S6 phosphorylation because of the amplification of
ribosomal genes and ribosomes during oogenesis. It has been estimated
that in oocytes only 1% of the ribosomes are present on polysomes,
with the remainder being gradually utilized after fertilization
(64). During progesterone-induced oocyte maturation in
Xenopus laevis, phosphorylation of S6 in the
total ribosome population changes dramatically. It is low in resting
oocytes, is increased greatly when 50% of the oocytes have undergone
germinal vesicle breakdown (GVBD), and is maximal in unfertilized eggs
(44). In parallel, overall protein synthesis is up-regulated
by a factor of approximately 2 (51). Biochemical and
molecular cloning studies have indicated the protein kinase responsible
for S6 phosphorylation during maturation is
p90Rsk (19-21). Like p70S6K,
Rsk phosphorylates all five sites in S6 in an ordered fashion. Despite
the general increase in protein synthesis and S6
phosphorylation during oocyte maturation, production of
ribosomal proteins ceases (27), suggesting that translation
of ribosomal protein mRNAs (rp-mRNAs) that contain the
5'-TOP is uncoupled from that of non-5'-TOP mRNAs
during oocyte maturation and may be regulated by different mechanisms (2-5). After fertilization, translation of S3,
L17, and L31 begins, and L5 synthesis is evident from stage 7 onward (49). In both oocytes and embryos, total translational
capacity is constant such that new mRNAs compete for translation
with existing mRNAs (37).
The p70S6K has been reported to become rapidly
deactivated after induction of Xenopus oocyte
maturation, suggesting a role in resting oocytes that is terminated in
the initial phase of oocyte maturation (36).
p70S6K function has not previously been
investigated in embryos. Therefore, we cloned a full-length
Xenopus homolog of p70S6K and investigated
the function of this enzyme during oocyte maturation and early
development in X. laevis. p70S6K was
not responsible for the up-regulation of S6
phosphorylation during maturation. Indeed,
administration of rapamycin accelerated oocyte maturation that
was correlated with reduced translation of mRNAs with a 5'-TOP
region and enhanced translation of mos. In embryos,
p70S6K was rapidly activated after fertilization and
may contribute to the enhanced translation of several ribosomal
proteins after fertilization.
 |
MATERIALS AND METHODS |
Cloning of X. laevis p70S6K
cDNA.
A
gt10 cDNA library generated by oligo(dT) priming of RNA
from defolliculated X. laevis oocytes was obtained from
D. Melton (50). Screening of 4× 105 PFU by
hybridization with probes corresponding to the 231 bp of the 5' coding
sequence of rat p70S6K cDNA and to 665 bp of a partial
X. laevis cDNA clone (36), respectively,
revealed 20 clones containing identical 1.7-kb inserts. Two phage
inserts were subcloned in pBluescript and analyzed by dideoxy
sequencing of both strands, using a Sequenase 2.0 sequencing kit (U.S.
Biotechnology, Lake Placid, N.Y.) with oligonucleotide priming from the
T3 and T7 sequences in the vector polylinker.
Oocytes, eggs, and embryos.
Female X. laevis
frogs were injected with 75 IU of pregnant mare's serum gonadotropin
(PMSG) 2 to 7 days prior to dissection of the ovary and manual
isolation of oocytes. Isolated oocytes were incubated in 1× modified
Barth's solution [88 mM NaCl, 1 mM KCl, 0.41 mM CaCl2,
0.33 mM Ca(NO3)2, 0.82 mM MgSO4,
2.4 mM NaHCO3, 10 mM HEPES (pH 7.4)], and maturation was
induced by addition of progesterone as indicated in the figure legends.
Rapamycin (Sigma, St. Louis, Mo.), dissolved in dimethyl sulfoxide, was added at a final concentration of 2 µg/ml 1 to 2 h prior to
induction of maturation. Controls were exposed to dimethyl sulfoxide
alone. When eggs or embryos were needed, frogs were injected with 550 IU of human chorionic gonadotropin to induce egg laying 12 to 14 h
later. To obtain activated eggs, freshly laid eggs were dejellied with
2% cysteine (Sigma), pH 8.0, in 1× Maller's modified Ringer (MMR;
100 mM NaCl, 2 mM KCl, 1 mM CaCl2, 1 mM MgCl2,
5 mM HEPES [pH 7.4]), treated with the calcium ionophore A23187
(Calbiochem, La Jolla, Calif.) at a final concentration of 5 µg/ml in
1× MMR for 1.5 to 2 min, and rinsed 8 to 10 times with 0.2× MMR.
Preincubation with rapamycin (2 µg/ml in 1× MMR) was
performed for 15 to 30 min before addition of the calcium ionophore.
Embryos were obtained by in vitro fertilization of freshly laid eggs,
dejellied, and cultivated in 0.1× MMR as described previously
(26). Embryos were staged as specified by Nieuwkoop and
Faber (45). Oocytes, eggs, and embryos were frozen in dry
ice at the desired time or stage.
Injection of mRNA and DNA.
Constructs encoding
Myc-tagged active and inactive mutants of rat p70S6K
were produced by PCR amplification of plasmids
pRK5-myc-p70S6KD3E-E389 and
pRK5-myc-p70S6KQ100 (42, 48),
using the primers 5'CTTGAATTCGGCAGGAGTGTTTGACATAG3' and
5'GCGCTCTAGATCATAGATTCATACGCAGGT3'. PCR products were cloned into pGEM T-easy vector (Promega, Madison, Wis.); the resulting plasmids were digested with EcoRI, and the fragment was
ligated into EcoRI-digested pCS2+MT (53, 62).
Capped mRNA was produced in vitro by using a mMessage mMachine kit
(Ambion, Austin, Tex.) after linearization of the plasmid with
NotI. Oocytes were injected with 20 ng of mRNA and
incubated for 2 h prior to induction of maturation by
progesterone. The 5'-flanking region of the hamster elongation
factor 2 (EF2) gene (with [
272 to +47] or without [
272 to +1]
[+1, transcription initiation site] a 5'-TOP) was inserted
upstream of luciferase cDNA in the pGL2-Enhancer vector (Promega) to
obtain the EF2+TOP or EF2
TOP luciferase reporter. The hamster EF2
gene has a typical 5'-TOP sequence from its transcription initiation site (+1
CCTCTTCCGCCGCAGCCGCCGCCATCGTCGGCGCCCCTCGCTCTTCT +47)
(43). Initiation of transcription of the chimeric
mRNAs at the native EF2 transcription site was confirmed by S1
mapping in a mammalian cell system. Plasmid DNA (1.5 ng) encoding
luciferase reporters with or without a 5'-TOP, driven by the
genomic promoter of hamster EF2, was injected into the oocyte germinal
vesicle. After incubation at room temperature for 10 h, oocytes
were frozen in dry ice.
The SP6-EF2+TOP reporter construct, which was used for production of
RNA, was made by PCR amplification of EF2+TOP by using the primers
GATTTAGGTGACACTATAGCTCTTCCGCCCCAGC and
CATCGCTGAATACAGTTAC and blunt-end cloning of the product
into pT7Blue-3 vector (Novagen, Madison, Wis.). A
PstI/BglII fragment from pOTV corresponding to
the 3' untranslated region (3' UTR) of Xenopus
-globin mRNA was inserted into
BamHI/PstI sites of pT7Blue-3. The integrity of the constructs was confirmed by sequencing. RNA was produced in
vitro with a mMessage mMachine kit (Ambion) from the SP6 promoter, whose sequence was integrated in the upstream primer by using a
PstI-linearized template. The
-galactosidase reporter
construct containing the internal ribosome entry site (IRES) of
encephalomyocarditis virus was produced by ligation-independent cloning
of the
-galactosidase open reading frame (Novagen) into pCITE-5 LIC
vector (Novagen).
Gel electrophoresis and Western blotting.
Oocytes, eggs, or
embryos were homogenized in extraction buffer (50 mM Tris [pH
7.4], 80 mM
-glycerophosphate, 20 mM EDTA, 20 mM NaF, 0.1 mM sodium
vanadate, 1 mM dithiothreitol [DTT], 0.3 µM microcystin, 0.3 mM phenylmethylsulfonyl fluoride, leupeptin [10
µg/ml], pepstatin [10 µg/ml], chymostatin [10 µg/ml])
and centrifuged for 5 min at 4°C. The cytosolic phase equivalent
to one oocyte, egg, or embryo was loaded onto Laemmli sodium dodecyl sulfate (SDS)-10% polyacrylamide gels for immunoblotting with rabbit
anti-Mos (Santa Cruz Biotechnology, Santa Cruz, Calif.) or rabbit
anti-Cdc25A antibodies or onto 12.5% Anderson gels for immunoblotting
with rabbit anti-p70S6K antibody (Santa Cruz
Biotechnology). Proteins were transferred to nitrocellulose membranes
by using a semidry blotting technique (Pharmacia-LKB, Piscataway,
N.J.). Membranes were blocked with 10% nonfat dry milk in
phosphate-buffered saline-0.05% Tween 20 and probed with
antibodies in phosphate-buffered saline-10% milk-0.05% Tween
(anti-Mos and anti-p70S6K) or with
Tris-buffered saline-0.05% Tween (anti-Cdc25A). Bands were visualized
by the enhanced chemiluminescence procedure (Amersham, Arlington
Heights, Ill.). Isolation of ribosomes and two-dimensional gel analysis
of ribosomal proteins were carried out as described previously
(44, 47).
Immunoprecipitation and p70S6K assay.
Extracts, prepared as described above and corresponding to one oocyte
or embryo, were incubated with 400 ng of anti-p70S6K
antibody for 2 h on ice. Antibody-antigen complexes were collected onto 10 µl of protein A-Sepharose beads (Pierce Chemical, Rockford, Ill.). Beads were then washed twice in low-salt buffer (50 mM Tris [pH
7.4], 80 mM
-glycerophosphate, 20 mM EDTA, 20 mM NaF, 0.1 mM
sodium vanadate, 1 mM DTT, 100 mM NaCl, 0.2 mg of bovine serum
albumin per ml, 1% Nonidet P-40 or IGEPAL CA-630), twice in high-salt
buffer (500 mM NaCl instead of 100 mM), and then twice with kinase
buffer (50 mM morpholinepropanesulfonic acid [pH 7.4], 10 mM
MgCl2, 0.2 mg of bovine serum albumin per ml, 1 mM DTT).
The immunoprecipitates were incubated in kinase buffer containing
50 µM ATP, 5 µCi of [
-32P]ATP, and 22 µg of
ribosomal 40S subunits in a volume of 20 µl at 30°C for 30 min, and
the reaction was stopped by addition of SDS-polyacrylamide gel
electrophoresis (PAGE) sample buffer. Ribosomal proteins were separated
by SDS-PAGE (10% gel). After exposure of the dried gel to X-Omat RP
film (Kodak, Rochester, N.Y.), the band corresponding to S6 was excised
and counted by liquid scintillation spectrometry. Xenopus
ovary 40S ribosomal subunits were obtained as described by Erikson et
al. (22).
Reporter assays.
Oocytes injected with luciferase or
-galactosidase reporter constructs were lysed (20 µl per oocyte)
with 1× reporter lysis buffer (Promega) or lysis solution (with 0.5 mM
DTT; Tropix, Bedford, Mass.) respectively. Routinely, extract
corresponding to 0.05 or 0.5 oocyte was assayed for luciferase activity
by the injection of 100 µl of luciferase substrate (Promega) into a
Mono Light luminometer (Analytical Luminescence Laboratory, Ann Arbor,
Mich.) according to the manufacturer's protocol. For detection of
-galactosidase activity, 10 µl of extract corresponding to 0.5 oocyte was incubated with 70 µl of
-galactosidase reaction buffer
(Tropix) for 2 h at room temperature before injection of 100 µl
of light emission accelerator into the luminometer.
Nucleotide sequence accession number.
The sequence shown in
Fig. 1A has been deposited in the GenBank under accession no. AJ131521.
 |
RESULTS |
Cloning of X. laevis p70S6K
cDNA.
Earlier studies led to the identification of a PCR
product encoding a maternal form of p70S6K from
X. laevis (36). Hybridization screening of
an X. laevis cDNA library with rat and
Xenopus probes identified multiple clones with a
1.7-kb insert. The insert sequence of 1,717 nucleotides contains a
large open reading frame. The first ATG codon, nucleotides 97 to
99, is surrounded by a strong translation initiation start site
consensus sequence (33), and the following 1,503 nucleotides encode an amino acid sequence with 93% identity to the sequence of mammalian p70S6K (Fig.
1). Longer clones containing sequences
homologous to the p85S6K amino terminus were not found;
however, no stop codon was found in frame in the 5' sequence preceding
the ATG translation initiation codon. In addition, none of the other 20 phages isolated from the cDNA library contained a longer 5' sequence.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram and cDNA sequence of X. laevis p70S6K. (A) Amino acid sequence alignment
of X. laevis (Xen. l.)
p70S6K and rat p70S6K. Identical amino
acids are indicated by bars; similar amino acids are indicated by dots.
(B) Schematic diagram of X. laevis
p70S6K, showing the N-terminal (cross-hatched),
catalytic (open), linker (hatched), autoinhibitory (filled), and
C-terminal (dotted) domains. Phosphorylation sites conserved with
mammalian p70S6K, and known to be involved in kinase
activation, are indicated.
|
|
p70S6K activity during oocyte maturation and
embryonic development.
In the earlier study described above,
Lane et al. (36) showed with antibodies to mammalian
p70S6K that p70S6K activity in oocytes
declined after induction of maturation by progesterone. The high
sequence identity of xp70S6K with the mammalian enzyme
(Fig. 1) plus conservation of all the phosphorylation
sites and regulatory motifs present in the mammalian enzyme supports
the use of reagents based on mammalian p70S6K for study
of the Xenopus enzyme. In the experiments reported here, we
determined the activity profile of p70S6K during
oocyte maturation by assaying the kinase activity of
immunoprecipitated p70S6K, using 40S ribosomal subunits
as the substrate. p70S6K activity was high in resting
oocytes, decreased 6- to 10-fold within the first 1 to 2 h after
induction of maturation by progesterone, and stayed low until oocytes
reached germinal vesicle breakdown (GVBD) (Fig.
2). Similar results were obtained with
oocytes from PMSG-primed or unprimed frogs, and kinase activity in
resting oocytes was in the same range in both primed and unprimed
oocytes. Usually no increased activity was evident after progesterone
treatment, but in one experiment a 15% increase in
p70S6K activity was seen upon stimulation of oocytes
with progesterone (Fig. 2A). Western blotting confirmed that
electrophoretic shifts mirror the p70S6K activity
changes observed with immunocomplex-kinase assays (Fig. 2B). The
anti-p70S6K antibody recognized two clusters of bands
of equal intensity at ~70 and ~85 kDa, representing the p70 and p85
isoforms. These blots indicate that the p85 isoform described in
other species is also present in X. laevis, and both
isoforms undergo changes in activity together during maturation.
In immunoblots, both isoforms could be blocked by preincubation of the
antibody with the immunogenic peptide (data not shown). The bands in
each cluster have previously been shown to differ in
phosphorylation state (48). The samples with
the highest enzyme activity showed multiple bands for each isoform (lanes 1 and 7). With the gradual decrease of activity after
induction of maturation, the most retarded isoforms disappeared and the
abundance of the isoforms with higher mobility increased (lanes 2 to 6 and 8 to 12). Thus, the antibody recognized both isoforms on the
Western blot, and it also precipitated both forms from extracts
(data not shown). Therefore, in kinase assays both the p70 and p85
isoforms appear to contribute to total S6 kinase activity.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Activity of p70S6K during oocyte
maturation and early embryogenesis. (A) Oocyte maturation was induced
with progesterone (10 µg/ml), and samples were collected every 30 min
until 100% GVBD was reached. p70S6K immunoprecipitates
of oocytes from primed and unprimed frogs were assayed for
phosphorylation of ribosomal protein S6, as indicated.
(B) In the upper panel, extracts corresponding to one oocyte per lane
were separated by SDS-PAGE using 12.5% Anderson gels. Proteins were
transferred to a nitrocellulose membrane and probed with an
anti-p70S6K antibody. The antibody recognized two
clusters of bands of approximately 70 and 85 kDa, which represent the
p70 and p85 isoforms of the enzyme. The time after progesterone
addition is indicated at the top of each lane. The lower panel shows an
autoradiograph of p70S6K kinase activity of unprimed
(lanes 1 to 6) and primed (lanes 7 to 12) oocytes. (C)
Immunoprecipitates of p70S6K from the indicated stages
of embryonic development were assayed for
phosphorylation of S6. High activity was observed
immediately after fertilization, at around stage 7 shortly before the
MBT, and during late gastrula stages. (D) Confirmation of the results
of the kinase assays in panel C by monitoring the abundance of
slower-migrating isoforms of the protein on Western blots (upper panel)
and autoradiograph of immunoprecipitated p70S6K
activity from the same embryo samples (lower panel).
|
|
After fertilization of
X. laevis eggs, all new protein
synthesis is translationally controlled prior to the midblastula
transition
(MBT) (
18). Therefore we also investigated the
activity of p70
S6K during early embryonic
development (Fig.
2C). After fertilization,
p70
S6K
activity increased about 30-fold during the first cell cycle
and then
decreased over the next two to three cell cycles. Activity
increased
again two- to threefold at stage 8, shortly before the
MBT, and a third
peak was observed during gastrulation at stage
12. The results of the
kinase assays were confirmed by changes
in the abundance of
slower-migrating bands of both isoforms on
Western blots (Fig.
2D).
The first cell cycle is the only pre-MBT cell cycle to contain a G
phase. Therefore, the detailed kinetics of the increase
of p70 activity
in the first cell cycle after fertilization was
studied. Since embryos
require a 30-min dejellying procedure before
extracts can be made, we
measured p70
S6K activity in dejellied unfertilized eggs
activated with the calcium
ionophore A23187, which mimics the events of
fertilization. p70
S6K activity increased to a high
level within the first 30 min after
ionophore treatment, with
significant activity by 20 min after
treatment (Fig.
3A). The deadenylation of
mos
mRNA after fertilization
and the degradation of Mos protein after
activation of eggs paralleled
increases in p70
S6K
activity (Fig.
3B). These results indicate that in
X. laevis eggs, p70
S6K can be activated in the
absence of growth factors solely by elevation
of cellular calcium
levels, as has been shown in other systems
(
14,
25).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
p70S6K activity increases within 30 min
after activation of eggs. (A) Freshly laid eggs were dejellied and
incubated in rapamycin (2 µg/ml) in 1× MMR for 30 min. Eggs
were activated with the Ca2+ ionophore A23187 (5 µg/ml)
at time zero and collected at the indicated time points; S6 kinase was
measured in p70S6K immunoprecipitates. (B) Extracts
corresponding to one egg were separated on 10% polyacrylamide gels,
the proteins were transferred to a nitrocellulose membrane, and the
blot was probed with anti-Mos antibody. The extracts used were the same
as those used for panel A.
|
|
Rapamycin accelerates oocyte maturation and decreases the threshold
level of progesterone required for maturation.
The activity
profile of p70S6K after progesterone treatment suggests
that an even earlier down-regulation of its activity might play a role
in oocyte maturation. Rapamycin has been shown to be a potent inhibitor
of the p70S6K pathway in different systems,
specifically inhibiting TOR, a mediator of p70S6K
function (1, 16). Thus, to investigate the function of
p70S6K during oocyte maturation and embryogenesis,
rapamycin was used to block activation of the enzyme in oocytes
and embryos. Incubation of oocytes in rapamycin (2 µg/ml)
decreased the activity of p70S6K to the background
level (Fig. 4A). In embryos treated with
rapamycin after fertilization, p70S6K activity
was also reduced to the background level. At 30 min after
fertilization, corresponding to 10 min after addition of rapamycin, activity was lower than in control embryos (Fig.
4B). At all later time points, 45 to 105 min postfertilization,
p70S6K activity was undetectable. This indicates
that it takes between 10 and 30 min to fully inhibit
p70S6K activity by incubation of oocytes and
embryos in rapamycin.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Rapamycin inhibits the activity of
p70S6K in oocytes and embryos. (A) Oocytes were
pretreated with rapamycin (2 µg/ml) for 1 to 2 h, and
maturation was induced by addition of progesterone (10 µg/ml).
Samples were collected, and S6 kinase activity was measured from
immunoprecipitated p70S6K from an extract corresponding
to one oocyte per sample. Results are expressed relative to
p70S6K activity in stage VI oocytes. (B) Freshly laid
eggs were fertilized in vitro, dejellied, and treated with
rapamycin (2 µg/ml) 20 min after fertilization. Extracts were
prepared at the indicated times, and kinase activity was measured from
immunoprecipitated p70S6K.
|
|
Surprisingly, oocytes treated with rapamycin underwent
GVBD faster than untreated oocytes (Fig.
5). Fifty percent GVBD
(GVBD
50)
occurred between 1 and 2 h earlier at the
minimum concentration
of progesterone that led to 100% GVBD (Fig.
5A),
which is different
for oocytes from different frogs. This effect of
rapamycin could
not be detected in oocytes treated with a high
dose of progesterone,
indicating that high concentrations of
progesterone can override
the molecular effects of rapamycin.
Although rapamycin alone,
without addition of progesterone, was
not able to induce oocyte
maturation, it caused a higher percentage of
GVBD in treated oocytes
at suboptimal concentrations of progesterone
that cause less than
100% GVBD (Fig.
5B). Therefore, rapamycin
not only is able to
accelerate maturation but also increases the
sensitivity of oocytes
to progesterone, suggesting that the
progesterone-dependent down-regulation
of p70
S6K
activity is important for normal maturation kinetics.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Rapamycin accelerates GVBD and decreases the threshold
concentration of progesterone required for maturation. (A) Oocytes were
pretreated with rapamycin (2 µg/ml) for 2 h before
induction of maturation with a threshold level of progesterone. The
percentage of GVBD was scored by occurrence of a well-defined white
spot in the animal pole indicative of GVBD. At the lowest concentration
of progesterone that leads to 100% GVBD in untreated oocytes (60 ng/ml), GVBD50 occurred ~1 h earlier in
rapamycin-treated oocytes than in controls. (B) At a
subthreshold concentration of progesterone (40 ng/ml), at which only
30% of oocytes underwent GVBD, the final percentage of GVBD was
increased ~2-fold by rapamycin treatment.
|
|
Rapamycin does not inhibit p70
S6K directly but instead
inhibits the upstream kinase TOR, which leads to rapid deactivation of
p70
S6K (
1,
16). To exclude the possibility
that the effect of rapamycin
on oocyte maturation was due to
inhibition of another downstream
target of TOR, such as 4E-BP1/PHAS
I (
9,
38,
60), oocytes
were injected with 20 ng of in
vitro-transcribed mRNA encoding
a constitutively active and
rapamycin-insensitive mutant of rat
p70
S6K
(p70
S6KD3E-E
389). The protein level of the
expressed kinase was about
5- to 10-fold above that of the endogenous
p70
S6K (data not shown). In extracts from oocytes
injected with the
constitutively active p70
S6K, total
p70
S6K activity was about 30-fold higher than in
uninjected samples
at GVBD (Fig.
6A, lanes 1 and 2). Kinase activity in
oocytes injected
with an inactive mutant of rat p70
S6K
(p70
S6KQ
100) was the same as in uninjected
control oocytes (Fig.
6A,
lanes 1 and 3).
Importantly, at a subthreshold concentration of
progesterone, injection
of the active form of p70
S6K reversed the accelerating
effect of rapamycin, whereas oocytes
injected with the inactive
form of p70
S6K behaved like uninjected oocytes
incubated with rapamycin (Fig.
6B). This result suggests
that the acceleration of oocyte maturation
by rapamycin is
indeed mediated by specific blocking of the
p70
S6K pathway and not by an alternative pathway that
is also blocked
by rapamycin.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Constitutively active p70S6K reverses
the effect of rapamycin. (A) Oocytes were pretreated with
rapamycin (2 µg/ml) for 1 to 2 h and then microinjected
with 20 ng of mRNA encoding either
p70S6KD3E-E389 (active form) or
p70S6KQ100 (kinase-dead form). After
incubation for 2 h at room temperature, S6 kinase activity of
immunoprecipitated p70S6K was measured in extracts of
resting or matured oocytes. Kinase activity was about 30-fold higher at
GVBD in oocytes injected with the active form of
rp70S6K than in control GVBD oocytes. (B) Oocytes were
treated with rapamycin (rap.), and some were then injected with
the constitutively active (p70S6KD3E-E389)
or inactive (p70S6KQ100) form of rat
p70S6K. Maturation induced with progesterone (40 ng/ml)
occurred a lower percentage in oocytes injected with the active isoform
of p70S6K in the presence of rapamycin, whereas
inactive p70S6K did not affect the kinetics of
maturation.
|
|
Rapamycin does not block increased S6
phosphorylation during maturation.
If inhibiting
p70S6K accelerates maturation, one might have predicted
that expression of a constitutively active p70S6K would
not only reverse the effects of rapamycin on acceleration of
GVBD but also retard the kinetics of GVBD with low-dose progesterone. As shown in Fig. 6, elevated p70S6K activity does
not retard maturation. A possible explanation for this
result is that the normal function of p70S6K to
phosphorylate S6 is being performed in progesterone-treated oocytes by
p90Rsk. In support of this idea, p90Rsk was
originally purified as the only S6 kinase activity present in fully
mature eggs (19-22), and p70S6K activity is
undetectable by GVBD (Fig. 2 and reference 36). Moreover, p90Rsk phosphorylates all five sites in S6 in the
same ordered fashion as observed with p70S6K
(63). Thus, it is likely that in
p70S6K-injected oocytes at GVBD, S6
phosphorylation is already maximal due to the activity
of p90Rsk. To test this hypothesis further, we determined
the levels of S6 phosphorylation in the presence and
absence of rapamycin (44). The results show that S6
phosphorylation was greater in progesterone-treated than in untreated oocytes, with the majority of the protein migrating in derivatives b and c, containing 2 and 3 mol, respectively, of
phosphate (Fig. 7A and B, respectively), as
reported previously (44). In the presence of
rapamycin the progesterone response was largely
unaffected, although slightly less phosphorylated S6
derivative d was evident (compare Fig. 7B and C). The insensitivity of
S6 phosphorylation to rapamycin (Fig. 7B)
supports the identification of p90Rsk as the enzyme
responsible for increased S6 phosphorylation in response to progesterone treatment. Recently, a second immunologically distinct form of p70S6K, termed
p70S6K2, was identified in
p70S6K1-deficient mice (57). However,
this enzyme is also rapamycin sensitive and therefore unlikely
to account for S6 phosphorylation in oocytes when
p70S6K1 is down-regulated (Fig. 2). Despite the fact
that p90Rsk accounts for S6 phosphorylation
during maturation, it cannot be excluded that p70S6K
regulates translation of mRNAs on the minor (1%) fraction of ribosomes that are on polysomes in resting oocytes, since the constitutively active p70 overcomes rapamycin effects that are evident before Rsk activation (Fig. 6).

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 7.
Rapamycin does not block increased S6 phosphorylation
during maturation. Groups of 300 oocytes each were incubated in MMR
(A), MMR containing progesterone (10 µg/ml) (B), or MMR containing
progesterone and rapamycin (2 µg/ml) (C). After progesterone-treated
oocytes reached a time equivalent to 2.0 GVBD50, oocytes
were frozen and subsequently ribosomal proteins were analyzed by
two-dimensional PAGE and silver staining as indicated in Materials and
Methods. The derivatives of S6 labeled a through d represent forms with
1 to 4 mol of phosphate in S6.
|
|
Translational up-regulation of non-5'-TOP mRNAs
and down-regulation of 5'-TOP mRNAs.
The first
new protein synthesis during oocyte maturation that is regulated at the
translational level is the synthesis of Mos (34, 54-56).
Mos protein concentration needs to reach a threshold level in
order to further activate downstream events (12,
13). Therefore, we compared the expression of Mos in control and
rapamycin-treated oocytes during maturation (Fig.
8A). In rapamycin-treated oocytes immunoblotting detected earlier expression of Mos, and the amount of
protein was increased as well. Since Mos protein is sufficient to
induce maturation (52, 65), this provides an explanation for
how rapamycin facilitates oocyte maturation. It has been shown in other systems that rapamycin can specifically inhibit
initiation of translation of mRNAs containing a 5'-TOP
(28, 29, 59). The mouse mos mRNA, and
presumably its X. laevis homolog, does not contain a
5'-TOP in the 5' UTR (23). As 5'-TOP mRNAs can represent up to 20% of the total mRNA in the cell (2,
5), translation of mRNAs lacking this sequence may be
up-regulated in rapamycin-treated oocytes by a
mechanism involving the release of 5'-TOP mRNAs from
polyribosomes. Since oocytes have no spare translational capacity
(37), this may enable mRNAs without a 5'-TOP, like
mos mRNA, to be translated more efficiently, as shown in
Fig. 8A.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 8.
Mos and Cdc25A protein levels are increased after
rapamycin treatment. (A) Extracts equivalent to one oocyte from
untreated or rapamycin-treated oocytes were separated by
SDS-PAGE (10% gel), transferred to a nitrocellulose membrane, and
probed with anti-Mos antibody. Time after addition of progesterone
is indicated at the top. (B) Dejellied eggs were treated with
rapamycin (2 µg/ml) for 30 min. After activation with the
Ca2+ ionophore A23187, samples were collected, and extracts
were separated by SDS-10% PAGE, transferred to a nitrocellulose
membrane, and probed with anti-Cdc25A antibody. Time after activation
of the eggs is indicated at the top.
|
|
A similar situation may occur after fertilization. An increase in
p70
S6K activity (Fig.
2) and protein synthesis is
evident after fertilization
in
X. laevis, and one
protein identified in this increase is Cdc25A
(Fig.
8B). In
ionophore-activated eggs, we observed earlier and
increased translation
of Cdc25A after rapamycin treatment (Fig.
8B), further
supporting the ability of p70
S6K to control the timing
and extent of translation of specific
mRNAs.
To ascertain directly whether this effect of p70
S6K in
oocytes involves changes in 5'-TOP translation, we performed
luciferase
reporter assays with two different constructs, one with and
one
without the 5'-TOP of EF2 at the transcriptional start site,
both
driven by the genomic hamster EF2 promoter. Plasmid DNA
encoding
these constructs was injected into the nuclei of
untreated or
rapamycin-treated stage VI oocytes. As a control
for possible
differences in transcription due to rapamycin,
another reporter
construct encoding a

-galactosidase was coinjected
(see Materials
and Methods). After incubation for 10 h at room
temperature, luciferase
and

-galactosidase activity was measured in
extracts equivalent
to 0.5 or 1 oocyte. After normalization for
transcription based
on

-galactosidase assays, the luciferase
activity of oocytes
not treated with rapamycin was set to 100%
and compared to the
activity of treated oocytes (Fig.
9). In rapamycin-treated oocytes,
luciferase activity was consistently 30 to 40% lower with the
construct containing the 5'-TOP, whereas rapamycin
treatment led
to 30 to 40% higher luciferase activity in extracts from
oocytes
injected with the construct that did not contain a 5'-TOP
(Fig.
9A). This result supports the hypothesis that rapamycin
increases
translational capacity for non-5'-TOP mRNAs by
inhibiting translation
of mRNAs with a 5'-TOP region.
These results were confirmed in
studies using direct
injection of mRNAs. The 5'-TOP construct
described above
was transcribed in vitro and injected into oocytes
in the presence and
absence of rapamycin. Rapamycin treatment
caused a 30 to 40%
decrease in translation (Fig.
9B), similar
to the level of inhibition
after cDNA injection. To evaluate whether
this decrease led to a
commensurate increase in available translational
capacity for other
mRNAs, we used injection of an mRNA with an
internal IRES,
which should be independent of many complex 5'
UTR controls. Indeed,
recent studies have shown that in virus-infected
cells treated with
rapamycin, the viral IRES-containing transcripts
are more
efficiently translated (
8). As shown in Fig.
9B, translation
of an IRES mRNA in oocytes was increased nearly 40% by
rapamycin
treatment.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 9.
Rapamycin decreases expression of 5'-TOP RNA and
increases expression of non 5'-TOP RNA. (A) Plasmid DNA (1.5 ng) of
luciferase reporter constructs containing the genomic promoter of
hamster EF2 with (+ TOP) or without ( TOP) a 5'-TOP region was
injected into the germinal vesicle of either rapamycin-treated
(rap) or untreated stage VI oocytes. A -galactosidase reporter was
coinjected to control for any effect of rapamycin on
transcription. Extracts were prepared, and luciferase and
-galactosidase activities were measured in an aliquot equivalent to
0.5 oocyte. Luciferase activity was normalized to -galactosidase
activity, and the luciferase activity of untreated oocytes was set to
100%. Similar results were obtained in three independent experiments.
(B) In vitro-transcribed mRNA (10 ng) encoding a luciferase
reporter construct with 5'-TOP or a -galactosidase reporter with
an IRES was injected into stage VI oocytes in the presence or absence
of rapamycin (rap). Luciferase and -galactosidase activities
were measured in extracts corresponding to 0.5 or 0.05 oocyte after
incubation of the oocytes for 5 h. Similar results were obtained
in five independent experiments.
|
|
 |
DISCUSSION |
Fully grown stage VI oocytes are arrested in prophase of meiosis
I, which corresponds to late G2 phase in the cell cycle. During maturation a hormonal stimulus releases the oocytes from their
arrest, inducing completion of meiosis I and progression to metaphase
of meiosis II, where they arrest again awaiting fertilization (24,
40, 54). p70S6K activity is present in unmatured
stage VI oocytes (reference 36 and Fig. 2A, 2B, and
4A) and in earlier stages (data not shown). Upon induction of
maturation by progesterone, activity of p70S6K
decreases, suggesting that low kinase activity facilitates progression through the cell cycle in the oocyte. This notion is supported by the
observation that incubation of oocytes in rapamycin, leading to
a complete loss of p70S6K activity, accelerates oocyte
maturation and increases sensitivity to progesterone (Fig. 4 to 6).
During oogenesis, each oocyte produces a huge stockpile of
1012 ribosomes that supports embryonic development
until the swimming tadpole stage (2-5).
Recruitment of rp-mRNAs onto polysomes, a measure of translational
activity, increases throughout oogenesis, reaching its maximum in stage
VI oocytes (7, 10). This elevated accumulation of ribosomal
proteins is due largely to the preferential translation of rp-mRNAs
in mid to late stages of oogenesis (15). At that time,
translation of rp-mRNAs comprises ~20% of total protein
synthesis, and ribosomal proteins are the major class of protein being
produced. p70S6K activity is present during this period
(data not shown) and decreases (Fig. 2) concomitant with the cessation
of ribosomal protein synthesis during oocyte maturation
(27). This finding suggests that decreased p70S6K activity may be responsible for the
down-regulation of translation of rp-mRNAs, which contain
5'-TOP regions. In our experiments, synthesis of Mos protein, whose
mRNA does not contain a 5'-TOP, starts earlier and reaches a
higher amount in rapamycin-treated oocytes (Fig. 8A), resulting
in accelerated GVBD (Fig. 5). Also, an IRES reporter construct without
a 5'-TOP was translated more efficiently in
rapamycin-treated oocytes, whereas expression of a construct
containing a 5'-TOP was decreased (Fig. 9). This result suggests a
model in which preferential translation of rp-mRNAs with 5'-TOP
regions occurs in oocytes when p70S6K activity is high.
A reduction of p70S6K activity reduces translation of
rp-mRNAs and releases translational capacity for mRNAs without
a 5'-TOP region, like Mos, which are required for oocyte maturation.
p70S6K activity changes may also affect protein
synthesis after fertilization. In the embryo, translation of ribosomal
proteins S3, L17, and L31 starts from stage 1 onward, and protein L5
begins to be synthesized around stage 7 (49), corresponding
to one of the peaks of activity of p70S6K (Fig. 2C). It
is possible the high p70S6K activity in early embryos
contributes to specific translation of these selected rp-mRNAs.
Phosphorylation of ribosomal protein S6 correlates with translation of
5'-TOP RNA, as shown for EF1
in cultured cells after mitogenic
stimulation (30). This finding suggests that in cultured cells the rapamycin effects on translation are mediated via
p70S6K-dependent S6 phosphorylation. In
mitogen-treated cells, the highly phosphorylated
derivatives of S6 are selectively found in polysomes (61).
In contrast, in oocytes despite increased S6
phosphorylation prior to GVBD (reference
44 and Fig. 7), only 1% of the ribosomes are in
polysomes. Moreover, the kinase responsible for this increased rapamycin-insensitive S6 phosphorylation
does not appear to be p70S6K, whose activity is
undetectable at GVBD, but rather p90Rsk (19,
20) (Fig. 7). An analogous situation occurs after
fertilization, when p90RSK activity and S6
phosphorylation rapidly decrease (reference
19 and unpublished data) despite an increase in
p70S6K activity (Fig. 2). Although there is a twofold
increase in total protein synthesis and maximal S6
phosphorylation at GVBD, ribosomal protein 5'-TOP
mRNAs are no longer being translated. Indeed, since the
p90Rsk-dependent S6 phosphorylation in this
system occurs long after p70S6K is inactivated (Fig. 2), it
is possible that the minor fraction of ribosomal 40S subunits on
polysomes is phosphorylated by p70S6K
before and shortly after induction of maturation with progesterone. Similarly, although most S6 is dephosphorylated after
fertilization in concert with deactivation of p90Rsk
(19, 44), it cannot be excluded that a minor fraction of S6
is phosphorylated by p70S6K after
fertilization. Alternatively, these results could indicate that other
targets of p70S6K besides S6, such as
trans-acting factors (11, 39), account for
rapamycin effects on 5'-TOP mRNA translation.
The fact that progesterone down-regulates p70S6K
activity and rapamycin affects the progesterone response
implies that the rapamycin-sensitive pathway is under hormonal
control in oocytes. Although it is evident that p70S6K
deactivation in progesterone-treated oocytes is due to
dephosphorylation (Fig. 2), at present we cannot
distinguish between inhibition of upstream kinases such as mammalian
TOR versus activation of phosphatases. Since the effect of
rapamycin could be observed only at threshold levels of
progesterone, it is likely that other mechanisms activated by
progesterone also contribute to the switch to preferential translation
of non-5'-TOP RNAs during oocyte maturation. These might include
changes in both the 3' and 5' UTRs of mRNAs such as mos
that occur following progesterone treatment (34). Translation of such mRNAs, however, is still constrained by the need for additional translational capacity afforded by down regulation of p70S6K activity and reduced translation of
5'-TOP mRNAs.
 |
ACKNOWLEDGMENTS |
We are grateful to Brad Lattes, Jan Kyes, and Andrea Lewellyn for
excellent technical assistance and to Jo Erikson and C. Finkielstein
for critical reading of the manuscript. We are also thankful to Thomas
Radimerski for preparing two-dimensional gels.
This work was supported in part by a grant from the NIH to J.L.M.
(DK28353-17) and grants to S.C.K. and G.T. from the EEC and
HFSPO. M.S.S. is an Associate and J.L.M. is an
Investigator of the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute and Department of Pharmacology, University of
Colorado School of Medicine, Biomedical Research Building, Room 433, 4200 East Ninth Ave., Denver, CO 80262-0236. Phone: (303) 315-7075. Fax: (303) 315-7160. E-mail: mallerj{at}essex.uchsc.edu.
 |
REFERENCES |
| 1.
|
Abraham, R. T., and G. J. Wiederrecht.
1996.
Immunopharmacology of rapamycin.
Annu. Rev. Immunol.
14:483-510[Medline].
|
| 1a.
|
Alessi, D. R.,
M. T. Kozlowski,
Q. P. Weng,
N. Morrice, and J. Avruch.
1998.
3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro.
Curr. Biol.
8:69-81[Medline].
|
| 2.
|
Amaldi, F.,
I. Bozzoni,
E. Beccari, and P. Pierandrei-Amaldi.
1989.
Expression of ribosomal protein genes and regulation of ribosome biosynthesis in Xenopus development.
Trends Biochem. Sci.
14:175-178[Medline].
|
| 3.
|
Amaldi, F.,
O. Camacho-Vanegas,
B. Cardinall,
F. Cecconi,
C. Crosio,
F. Loreni,
P. Mariottini,
L. Pellizzoni, and P. Pierandrei-Amaldi.
1995.
Structure and expression of ribosomal protein genes in Xenopus laevis.
Biochem. Cell Biol.
73:969-977[Medline].
|
| 4.
|
Amaldi, F., and P. Pierandrei-Amaldi.
1997.
TOP genes: a translationally controlled class of genes including those coding for ribosomal proteins.
Prog. Mol. Subcell. Biol.
18:1-17[Medline].
|
| 5.
|
Amaldi, F., and P. Pierandrei-Amaldi.
1990.
Translational regulation of the expression of ribosomal protein genes in Xenopus laevis.
Enzyme
44:93-105[Medline].
|
| 6.
|
Bandi, H. R.,
S. Ferrari,
J. Krieg,
H. E. Meyer, and G. Thomas.
1993.
Identification of 40 S ribosomal protein S6 phosphorylation sites in Swiss mouse 3T3 fibroblasts stimulated with serum.
J. Biol. Chem.
268:4530-4533[Abstract/Free Full Text].
|
| 7.
|
Baum, E. Z., and W. M. Wormington.
1985.
Coordinate expression of ribosomal protein genes during Xenopus development.
Dev. Biol.
111:488-498[Medline].
|
| 8.
|
Beretta, L.,
Y. V. Svitkin, and N. Sonenberg.
1996.
Rapamycin stimulates viral protein synthesis and augments the shutoff of host protein synthesis upon picornavirus infection.
J. Virol.
70:8993-8996[Abstract].
|
| 9.
|
Burnett, P. E.,
R. K. Barrow,
N. A. Cohen,
S. H. Snyder, and D. M. Sabatini.
1998.
RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1.
Proc. Natl. Acad. Sci. USA
95:1432-1437[Abstract/Free Full Text].
|
| 10.
|
Cardinali, B.,
N. Campioni, and P. Pierandrei-Amaldi.
1987.
Ribosomal protein, histone and calmodulin mRNAs are differently regulated at the translational level during oogenesis of Xenopus laevis.
Exp. Cell Res.
169:432-441[Medline].
|
| 11.
|
Cardinali, B.,
M. Di Cristina, and P. Pierandrei-Amaldi.
1993.
Interaction of proteins with the mRNA for ribosomal protein L1 in Xenopus: structural characterization of in vivo complexes and identification of proteins that bind in vitro to its 5'UTR.
Nucleic Acids Res.
21:2301-2308[Abstract/Free Full Text].
|
| 12.
|
Chen, M., and J. A. Cooper.
1997.
The beta subunit of CKII negatively regulates Xenopus oocyte maturation.
Proc. Natl. Acad. Sci. USA
94:9136-9140[Abstract/Free Full Text].
|
| 13.
|
Chen, M.,
D. Li,
E. G. Krebs, and J. A. Cooper.
1997.
The casein kinase II beta subunit binds to Mos and inhibits Mos activity.
Mol. Cell. Biol.
17:1904-1912[Abstract].
|
| 14.
|
Conus, N. M.,
B. A. Hemmings, and R. B. Pearson.
1998.
Differential regulation by calcium reveals distinct signaling requirements for the activation of Akt and p70S6k.
J. Biol. Chem.
273:4776-4782[Abstract/Free Full Text].
|
| 15.
|
Dixon, L. K., and P. J. Ford.
1982.
Regulation of protein synthesis and accumulation during oogenesis in Xenopus laevis.
Dev. Biol.
93:478-497[Medline].
|
| 16.
|
Dumont, F. J., and Q. Su.
1996.
Mechanism of action of the immunosuppressant rapamycin.
Life Sci.
58:373-395[Medline].
|
| 17.
|
Duncan, R., and E. H. McConkey.
1982.
Preferential utilization of phosphorylated 40-S ribosomal subunits during initiation complex formation.
Eur. J. Biochem.
123:535-538[Medline].
|
| 18.
|
Duval, C.,
P. Bouvet,
F. Omilli,
C. Roghi,
C. Dorel,
R. LeGuellec,
J. Paris, and H. B. Osborne.
1990.
Stability of maternal mRNA in Xenopus embryos: role of transcription and translation.
Mol. Cell. Biol.
10:4123-4129[Abstract/Free Full Text].
|
| 19.
|
Erikson, E., and J. L. Maller.
1989.
In vivo phosphorylation and activation of ribosomal protein S6 kinases during Xenopus oocyte maturation.
J. Biol. Chem.
264:13711-13717[Abstract/Free Full Text].
|
| 20.
|
Erikson, E., and J. L. Maller.
1985.
A protein kinase from Xenopus eggs specific for ribosomal protein S6.
Proc. Natl. Acad. Sci. USA
82:742-746[Abstract/Free Full Text].
|
| 21.
|
Erikson, E., and J. L. Maller.
1986.
Purification and characterization of a protein kinase from Xenopus eggs highly specific for ribosomal protein S6.
J. Biol. Chem.
261:350-355[Abstract/Free Full Text].
|
| 22.
|
Erikson, E.,
J. L. Maller, and R. L. Erikson.
1991.
Xenopus ribosomal protein S6 kinase II.
Methods Enzymol.
200:252-268[Medline].
|
| 23.
|
Gao, C.,
R. B. Arlinghaus, and B. Singh.
1996.
Further characterization of the c-mos transcript and its cell cycle specific expression in NIH3T3 cells.
Oncogene
12:1571-1576[Medline].
|
| 24.
|
Gebauer, F., and J. D. Richter.
1997.
Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis.
Bioessays
19:23-28[Medline].
|
| 25.
|
Graves, L. M.,
Y. Q. He,
J. Lambert,
D. Hunter,
X. N. Li, and H. S. Earp.
1997.
An intracellular calcium signal activates P70 but not P90 ribosomal S6 kinase in liver epithelial cells.
J. Biol. Chem.
272:1920-1928[Abstract/Free Full Text].
|
| 26.
|
Hartley, R. S.,
R. E. Rempel, and J. L. Maller.
1996.
In vivo regulation of the early embryonic cell cycle in Xenopus.
Dev. Biol.
173:408-419[Medline].
|
| 27.
|
Hyman, L. E., and W. M. Wormington.
1988.
Translational inactivation of ribosomal protein mRNAs during Xenopus oocyte maturation.
Genes Dev.
2:598-605[Abstract/Free Full Text].
|
| 28.
|
Jefferies, H. B.,
S. Fumagalli,
P. B. Dennis,
C. Reinhard,
R. B. Pearson, and G. Thomas.
1997.
Rapamycin suppresses 5'TOP mRNA translation through inhibition of p70s6k.
EMBO J.
16:3693-3704[Medline].
|
| 29.
|
Jefferies, H. B.,
C. Reinhard,
S. C. Kozma, and G. Thomas.
1994.
Rapamycin selectively represses translation of the "polypyrimidine tract" mRNA family.
Proc. Natl. Acad. Sci. USA
91:4441-4445[Abstract/Free Full Text].
|
| 30.
|
Jefferies, H. B., and G. Thomas.
1994.
Elongation factor-1 alpha mRNA is selectively translated following mitogenic stimulation.
J. Biol. Chem.
269:4367-4372[Abstract/Free Full Text].
|
| 31.
|
Jeffries, H. B. J., and G. Thomas.
1996.
Ribosomal protein S6 phosphorylation and signal transduction, p. 389-409.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Kawasome, H.,
P. Papst,
S. Webb,
G. M. Keller,
G. L. Johnson,
E. W. Gelfand, and N. Terada.
1998.
Targeted disruption of p70(s6k) defines its role in protein synthesis and rapamycin sensitivity.
Proc. Natl. Acad. Sci. USA
95:5033-5038[Abstract/Free Full Text].
|
| 33.
|
Kozak, M.
1986.
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:283-292[Medline].
|
| 34.
|
Kuge, H., and J. D. Richter.
1995.
Cytoplasmic 3' poly(A) addition induces 5' cap ribose methylation: implications for translational control of maternal mRNA.
EMBO J.
14:6301-6310[Medline].
|
| 35.
|
Lane, H. A.,
A. Fernandez,
N. J. Lamb, and G. Thomas.
1993.
p70s6k function is essential for G1 progression.
Nature
363:170-172[Medline].
|
| 36.
|
Lane, H. A.,
S. J. Morley,
M. Doree,
S. C. Kozma, and G. Thomas.
1992.
Identification and early activation of a Xenopus laevis p70s6k following progesterone-induced meiotic maturation.
EMBO J.
11:1743-1749[Medline].
|
| 37.
|
Laskey, R. A.,
A. D. Mills,
J. B. Gurdon, and G. A. Partington.
1977.
Protein synthesis in oocytes of Xenopus laevis is not regulated by the supply of messenger RNA.
Cell
11:345-351[Medline].
|
| 38.
|
Lawrence, J. C., Jr., and R. T. Abraham.
1997.
PHAS/4E-BPs as regulators of mRNA translation and cell proliferation.
Trends Biochem. Sci.
22:345-349[Medline].
|
| 39.
|
Loreni, F., and F. Amaldi.
1997.
Translational control of terminal oligopyrimidine mRNAs requires a specific regulator.
FEBS Lett.
416:239-242[Medline].
|
| 40.
|
Maller, J. L.
1998.
Recurring themes in oocyte maturation.
Biol. Cell
90:453-460[Medline].
|
| 41.
|
Meyuhas, O.,
D. Avni, and S. Shama.
1996.
Translational control of ribosomal protein mRNAs in eukaryotes, p. 363-388.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 42.
|
Moser, B. A.,
P. B. Dennis,
N. Pullen,
R. B. Pearson,
N. A. Williamson,
R. E. Wettenhall,
S. C. Kozma, and G. Thomas.
1997.
Dual requirement for a newly identified phosphorylation site in p70S6K.
Mol. Cell Biol.
17:5648-5655[Abstract].
|
| 43.
|
Nakanishi, T.,
K. Kohno,
M. Ishiura,
H. Ohashi, and T. Uchida.
1988.
Complete nucleotide sequence and characterization of the 5' flanking region of mammalian elongation factor 2 gene.
J. Biol. Chem.
263:6384-6391[Abstract/Free Full Text].
|
| 44.
|
Nielsen, P. J.,
G. Thomas, and J. L. Maller.
1982.
Increased phosphorylation of ribosomal protein S6 during meiotic maturation of Xenopus oocytes.
Proc. Natl. Acad. Sci. USA
79:2937-2941[Abstract/Free Full Text].
|
| 45.
|
Nieuwkoop, P. D., and J. Faber.
1967.
Normal table of Xenopus laevis (Daudin).
North-Holland Publishing Co, Amsterdam, The Netherlands.
|
| 46.
|
Novak-Hofer, I., and G. Thomas.
1984.
An activated S6 kinase in extracts from serum- and epidermal growth factor-stimulated Swiss 3T3 cells.
J. Biol. Chem.
259:5995-6000[Abstract/Free Full Text].
|
| 47.
|
Olivier, A. R.,
L. M. Ballou, and G. Thomas.
1988.
Differential regulation of S6 phosphorylation by insulin and epidermal growth factor in Swiss mouse 3T3 cells: insulin activation of type 1 phosphatase.
Proc. Natl. Acad. Sci. USA
85:4720-4724[Abstract/Free Full Text].
|
| 48.
|
Pearson, R. B.,
P. B. Dennis,
J. W. Han,
N. A. Williamson,
S. C. Kozma,
R. E. Wettenhall, and G. Thomas.
1995.
The principal target of rapamycin-induced p70s6k inactivation is a novel phosphorylation site within a conserved hydrophobic domain.
EMBO J.
14:5279-5287[Medline].
|
| 49.
|
Pierandrei-Amaldi, P.,
N. Campioni,
E. Beccari,
I. Bozzoni, and F. Amaldi.
1982.
Expression of ribosomal-protein genes in Xenopus laevis development.
Cell
30:163-171[Medline].
|
| 49a.
|
Pullen, N.,
P. B. Dennis,
M. Andjelkovic,
A. Dufner,
S. C. Kozma,
B. A. Hemmings, and G. Thomas.
1998.
Phosphorylation and activation of p70s6k by PDK1.
Science
279:707-710[Abstract/Free Full Text].
|
| 50.
|
Rebagliati, M. R.,
D. L. Weeks,
R. P. Harvey, and D. A. Melton.
1985.
Identification and cloning of localized maternal RNAs from Xenopus eggs.
Cell
42:769-777[Medline].
|
| 50a.
|
Reinhard, C.,
G. Thomas, and S. C. Kozma.
1992.
A single gene encodes two isoforms of the p70 S6 kinase: activation upon mitogenic stimulation.
Proc. Natl. Acad. Sci. USA
89:4052-4056[Abstract/Free Full Text].
|
| 51.
|
Richter, J. D.,
W. J. Wasserman, and L. D. Smith.
1982.
The mechanism for increased protein synthesis during Xenopus oocyte maturation.
Dev. Biol.
89:159-167[Medline].
|
| 52.
|
Roy, L. M.,
O. Haccard,
T. Izumi,
B. G. Lattes,
A. L. Lewellyn, and J. L. Maller.
1996.
Mos proto-oncogene function during oocyte maturation in Xenopus.
Oncogene
12:2203-2211[Medline].
|
| 53.
|
Rupp, R. A.,
L. Snider, and H. Weintraub.
1994.
Xenopus embryos regulate the nuclear localization of XMyoD.
Genes Dev.
8:1311-1323[Abstract/Free Full Text].
|
| 54.
|
Sagata, N.
1997.
What does Mos do in oocytes and somatic cells?
Bioessays
19:13-21[Medline].
|
| 55.
|
Sagata, N.,
I. Daar,
M. Oskarsson,
S. D. Showalter, and G. F. Vande Woude.
1989.
The product of the mos proto-oncogene as a candidate "initiator" for oocyte maturation.
Science
245:643-646[Abstract/Free Full Text].
|
| 56.
|
Sagata, N.,
M. Oskarsson,
T. Copeland,
J. Brumbaugh, and G. F. Vande Woude.
1988.
Function of c-mos proto-oncogene product in meiotic maturation in Xenopus oocytes.
Nature
335:519-525[Medline].
|
| 57.
|
Shima, H.,
M. Pende,
Y. Chen,
S. Fumagalli,
G. Thomas, and S. C. Kozma.
1998.
Disruption of the p70s6k/p85s6k gene reveals a small mouse phenotype and a new functional S6 kinase.
EMBO J.
17:6649-6659[Medline].
|
| 58.
|
Stewart, M. J., and G. Thomas.
1994.
Mitogenesis and protein synthesis: a role for ribosomal protein S6 phosphorylation?
Bioessays
16:809-815[Medline].
|
| 59.
|
Terada, N.,
H. R. Patel,
K. Takase,
K. Kohno,
A. C. Nairn, and E. W. Gelfand.
1994.
Rapamycin selectively inhibits translation of mRNAs encoding elongation factors and ribosomal proteins.
Proc. Natl. Acad. Sci. USA
91:11477-11481[Abstract/Free Full Text].
|
| 60.
|
Thomas, G., and M. N. Hall.
1997.
TOR signalling and control of cell growth.
Curr. Opin. Cell Biol.
9:782-787[Medline].
|
| 61.
|
Thomas, G.,
J. Martin-Perez,
M. Siegmann, and A. M. Otto.
1982.
The effect of serum, EGF, PGF2 alpha and insulin on S6 phosphorylation and the initiation of protein and DNA synthesis.
Cell
30:235-242[Medline].
|
| 62.
|
Turner, D. L., and H. Weintraub.
1994.
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate.
Genes Dev.
8:1434-1447[Abstract/Free Full Text].
|
| 63.
|
Wettenhall, R. E.,
E. Erikson, and J. L. Maller.
1992.
Ordered multisite phosphorylation of Xenopus ribosomal protein S6 by S6 kinase II.
J. Biol. Chem.
267:9021-9027[Abstract/Free Full Text].
|
| 64.
|
Woodland, H. R.
1974.
Changes in the polysome content of developing Xenopus laevis embryos.
Dev. Biol.
40:90-101[Medline].
|
| 65.
|
Yew, N.,
M. L. Mellini, and G. F. Vande Woude.
1992.
Meiotic initiation by the mos protein in Xenopus.
Nature
355:649-652[Medline].
|
Molecular and Cellular Biology, April 1999, p. 2485-2494, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bilanges, B., Argonza-Barrett, R., Kolesnichenko, M., Skinner, C., Nair, M., Chen, M., Stokoe, D.
(2007). Tuberous Sclerosis Complex Proteins 1 and 2 Control Serum-Dependent Translation in a TOP-Dependent and -Independent Manner. Mol. Cell. Biol.
27: 5746-5764
[Abstract]
[Full Text]
-
Hui, A. S., Bauer, A. L., Striet, J. B., Schnell, P. O., Czyzyk-Krzeska, M. F.
(2006). Calcium signaling stimulates translation of HIF-{alpha} during hypoxia. FASEB J.
20: 466-475
[Abstract]
[Full Text]
-
Hayashi, M., Fearns, C., Eliceiri, B., Yang, Y., Lee, J.-D.
(2005). Big Mitogen-Activated Protein Kinase 1/Extracellular Signal-Regulated Kinase 5 Signaling Pathway Is Essential for Tumor-Associated Angiogenesis. Cancer Res.
65: 7699-7706
[Abstract]
[Full Text]
-
Kang, S., Bader, A. G., Vogt, P. K.
(2005). Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc. Natl. Acad. Sci. USA
102: 802-807
[Abstract]
[Full Text]
-
Hay, N., Sonenberg, N.
(2004). Upstream and downstream of mTOR. Genes Dev.
18: 1926-1945
[Abstract]
[Full Text]
-
Pende, M., Um, S. H., Mieulet, V., Sticker, M., Goss, V. L., Mestan, J., Mueller, M., Fumagalli, S., Kozma, S. C., Thomas, G.
(2004). S6K1-/-/S6K2-/- Mice Exhibit Perinatal Lethality and Rapamycin-Sensitive 5'-Terminal Oligopyrimidine mRNA Translation and Reveal a Mitogen-Activated Protein Kinase-Dependent S6 Kinase Pathway. Mol. Cell. Biol.
24: 3112-3124
[Abstract]
[Full Text]
-
Sarkissian, M., Mendez, R., Richter, J. D.
(2004). Progesterone and insulin stimulation of CPEB-dependent polyadenylation is regulated by Aurora A and glycogen synthase kinase-3. Genes Dev.
18: 48-61
[Abstract]
[Full Text]
-
Christie, G. R., Hajduch, E., Hundal, H. S., Proud, C. G., Taylor, P. M.
(2002). Intracellular Sensing of Amino Acids in Xenopus laevis Oocytes Stimulates p70 S6 Kinase in a Target of Rapamycin-dependent Manner. J. Biol. Chem.
277: 9952-9957
[Abstract]
[Full Text]
-
Gingras, A.-C., Raught, B., Sonenberg, N.
(2001). Regulation of translation initiation by FRAP/mTOR. Genes Dev.
15: 807-826
[Full Text]
-
Coelho, C., Leevers, S.
(2000). Do growth and cell division rates determine cell size in multicellular organisms?. J. Cell Sci.
113: 2927-2934
[Abstract]
-
Bhatt, R. R., Ferrell, J. E. Jr.
(2000). Cloning and Characterization of Xenopus Rsk2, the Predominant p90 Rsk Isozyme in Oocytes and Eggs. J. Biol. Chem.
275: 32983-32990
[Abstract]
[Full Text]
-
Kim, J. E., Chen, J.
(2000). Cytoplasmic-nuclear shuttling of FKBP12-rapamycin-associated protein is involved in rapamycin-sensitive signaling and translation initiation. Proc. Natl. Acad. Sci. USA
97: 14340-14345
[Abstract]
[Full Text]