Previous Article | Next Article 
Molecular and Cellular Biology, April 1999, p. 2567-2576, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Egr-1 Is a Downstream Effector of GnRH and
Synergizes by Direct Interaction with Ptx1 and SF-1 To Enhance
Luteinizing Hormone
Gene Transcription
Jacques J.
Tremblay and
Jacques
Drouin*
Laboratoire de Génétique
Moléculaire, Institut de Recherches Cliniques de
Montréal, Montréal, Québec, Canada H2W 1R7
Received 29 May 1998/Returned for modification 12 August
1998/Accepted 11 January 1999
 |
ABSTRACT |
Pituitary gonadotropins are critical regulators of gonadal
development and function. Expression and secretion of the mature hormones are regulated by gonadotropin-releasing hormone (GnRH), which
is itself secreted from the hypothalamus. GnRH stimulation of
gonadotropin expression and secretion occurs through the
G-protein-linked phospholipase C/inositol triphosphate intracellular
signaling pathway, which ultimately leads to protein kinase C (PKC)
activation and increased intracellular calcium levels. Transcription
factors mediating the effects of GnRH-induced signals on transcription of gonadotropin genes have not yet been identified. Recent studies have
identified key factors involved in luteinizing hormone
(LH
)
gonadotropin gene transcription: the nuclear receptor SF-1, the
bicoid-related homeoprotein Ptx1 (Pitx1), and the
immediate-early Egr-1 gene. We now show that GnRH is a potent
stimulator of Egr-1, but not Ptx1 or SF-1, expression. Further, Egr-1
activation of the LH
promoter is specifically enhanced by PKC, in
agreement with a role for Egr-1 in mediating a GnRH effect on
transcription. Egr-1 interacts directly with Ptx1 and with SF-1,
leading to an enhancement of Ptx1- and SF-1-induced LH
transcription. Thus, Egr-1 is a likely transcriptional mediator of
GnRH-induced signals for activation of the LH
gene.
 |
INTRODUCTION |
The gene for Egr-1 (also designated
as NGFI-A, Krox-24, and Zif268) belongs to a group of transcriptional
regulators that behave as immediate-early response genes. These genes
are transiently activated at the cellular level by a variety of
external stimuli, such as serum or growth factors, and they are thought
to be important regulators of cellular proliferation and
differentiation. The Egr-1 gene was first identified about 10 years ago
as a gene rapidly induced during nerve growth factor-induced
differentiation (9, 37). Egr-1 has since been cloned by
several groups and shown to be rapidly and transiently induced, both at
the transcriptional and protein levels, by a variety of mitogens,
developmental or differentiation cues, tissue damage, and signals that
induce neuronal excitation or apoptosis in numerous cell types
(7, 31, 50; for a review, see reference
9). The Egr-1 protein is a zinc-finger-containing transcription factor of the C2H2 class that
specifically binds the DNA sequence GCG(G/T)GGGCG to
activate transcription of target genes (5, 7, 32, 37, 40,
52). The DNA-binding activity of Egr-1 is apparently controlled
by the phosphorylation state of the protein. Indeed, Huang et al. have
shown that phosphorylated Egr-1 binds DNA more efficiently than the
nonphosphorylated form (16). Moreover, Egr-1 DNA binding is
significantly increased by inhibitors of protein serine/threonine
phosphatase 1 and 2A, suggesting that its DNA-binding activity is under
the control of protein kinase(s) and/or phosphatase(s) (4).
Taken together, these data suggest that Egr-1 serves as an intermediary
regulatory factor in many cellular response pathways.
Egr-1 is broadly expressed in tissues throughout development and in the
adult of many species. It can be found in the endothelial system,
thymus, muscle, cartilage, bone, and parts of the central and
peripheral nervous systems (36, 61). At a functional level, several in vitro studies initially characterized Egr-1 as having a role
in the control of macrophage differentiation and T-lymphocyte proliferation (38, 41), as well as in platelet-derived
growth factor-B gene expression in endothelial cells (23).
However, in two independent Egr-1 targeted gene deletion experiments,
these observations were not corroborated (30, 55). Rather,
Egr-1
/
mice of both sexes have reduced body sizes and
fertility problems due to a pituitary defect in the male and sterility
due to combined pituitary and ovarian dysfunction in the female
(29, 55). In the pituitary of knockout mice, the absence of
Egr-1 results in a lack of the gonadotropin luteinizing hormone
(LH
) gene expression in gonadotrope cells despite the presence of
other gonadotrope markers (29, 55). These observations have
suggested that Egr-1 is not involved in the differentiation of
gonadotrope cells but rather in the expression of the
gonadotrope-specific LH
gene. Indeed, Lee et al. have shown that
Egr-1 can bind to a conserved consensus GC-rich motif and directly
activate LH
transcription (29). Moreover, Egr-1 can act
in synergy with the orphan nuclear receptor SF-1 to further enhance
LH
transcription (28, 29).
Pituitary gonadotropes synthesize and secrete two gonadotropin
hormones: LH and follicle-stimulating hormone (FSH). Both hormones are
heterodimeric glycoproteins composed of a common peptide, the
glycoprotein hormone subunit
(
GSU), and either a specific FSH
or LH
polypeptide (43). Expression of the genes
encoding the
and
subunits, as well as secretion of the mature
hormones, is regulated by gonadotropin-releasing hormone (GnRH), which
is itself secreted from the hypothalamus (10). Naturally
occurring mutations in the GnRH (hpg mice) or GnRH receptor
(GnRH-R) genes both lead to hypogonadism due to a lack of gonadotropin
production (27, 35). GnRH binds the GnRH-R, a
seven-transmembrane G-protein-coupled receptor, present at the membrane
of pituitary gonadotropes: this triggers the activation of
phospholipase C (PLC), which cleaves phosphatidylinositol-4,5-biphosphate (PIP2) to generate
triphosphate inositol (IP3) and diacylglycerol (DAG).
IP3 increases intracellular calcium levels, whereas DAG
activates protein kinase C (PKC) (1, 2, 20). Activation of
PKC leads to increased mitogen-activated protein kinase kinase (MAPKK
or MEK) and mitogen-activated protein kinase (MAPK or ERK) activity and
to increased gonadotropin mRNA levels (15, 20, 51). Direct
activation of PKC by phorbol 12-myristate 13-acetate (PMA), as well as
calcium mobilization by ionomycin, reproduce the profile of
GnRH-induced LH
mRNA (1, 2). Conversely, depletion of PKC
activity significantly reduces the ability of GnRH to stimulate
LH
mRNA (1). Thus, GnRH-dependent activation of the PKC
pathway appears to be a major step for stimulation of LH
mRNA.
However, the transcriptional mediator(s) of PKC action on the
LH
promoter is presently unknown.
Recent studies have identified three factors involved in LH
gene
transcription: the nuclear receptor SF-1, the bicoid-related homeoprotein Ptx1 (Pitx1), and Egr-1 (14, 22, 29, 56, 57).
Numerous studies have demonstrated the importance of SF-1 at multiple
levels of the reproductive axis, including gonadotrope function in the
pituitary (39). Ptx1 is a homeobox transcription factor
first isolated as a regulator of pro-opiomelanocortin (POMC) gene
expression in pituitary corticotrope cells (25). Ptx1 was later shown to be present in all pituitary cells and to activate most
pituitary-hormone-coding gene promoters, including LH
(26, 57). In addition, Ptx1 contributes to lineage-restricted gene expression by synergism with cell-restricted transcription factors such
as SF-1, Pit1, and NeuroD1/Pan1 (44, 53, 56, 57).
In the present study, we report the identification of Egr-1 as a
downstream effector of the GnRH-induced PKC signal transduction pathway
in pituitary gonadotropes. Indeed, GnRH markedly induces Egr-1 gene
expression in model gonadotrope cells,
T3-1 and L
T2, and the
Egr-1-dependent activation of the LH
promoter is specifically enhanced by PKC. Also, we show that Egr-1 exerts its transcriptional effects on the LH
promoter by physical interactions with Ptx1 and
SF-1.
 |
MATERIALS AND METHODS |
Cell culture and transfection assays.
Murine
T3-1,
L
T2, and African green monkey kidney fibroblast-like CV-1 cells were
grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10%
fetal calf serum (FCS). CV-1 cells were transfected by the calcium
phosphate method as previously described (56). L
T2 cells
were plated at a density of 750,000 cells per well in a 12-well plate
the evening prior to transfection and then transfected the next day by
the calcium phosphate method. The following day, cells were rinsed and
DMEM-FCS containing either the vehicle phosphate-buffered saline (PBS)
or 100 nM GnRH was added for 15 min, followed by a 75-min incubation in
regular DMEM-FCS. This pulsatile treatment (58) was repeated
three more times and another four times the next day before the cells
were harvested. Data are presented as the means of 3 to 10 experiments,
each performed in duplicate, ± the standard error of the mean (SEM).
The weak (about twofold) background activation observed with Ptx1 (and with combination of factors containing Ptx1) of mutant promoters (see,
for example, Fig. 6F and G) has been observed with many negative
control promoters, such as herpes simplex virus thymidine kinase
promoter, minimal pituitary promoters, and Mullerian inhibiting substance promoter, that do not contain Ptx1 binding sites (56, 57); hence, we consider this to be a general nonspecific effect on reporter activity.
Hormone treatment, RNA extraction, and analysis.
GnRH,
forskolin, PMA, and cyclic ADP-ribose were obtained from Sigma.
T3-1
or L
T2 cells were treated with 10
5 M forskolin,
10
7 M GnRH, 5 × 10
7 M PMA, and 5 µM
cyclic ADP-ribose for the times indicated. Total cellular RNA was
extracted by the guanidium thiocyanate-phenol-chloroform method
(6) and analyzed by Northern blot analysis as described previously (57). DNA probes used for hybridization were cDNA fragments specific for Ptx1 (25), SF-1 (34),
GnRH-R (45),
GSU (11), and Egr-1
(50). As a loading control, the blots were stripped and
rehybridized with a 32P-labeled oligonucleotide specific
for 18S ribosomal RNA as described earlier (57).
Plasmids and oligonucleotides.
The bp
142 LH
promoter
reporter, the mutations of the SF-1 and/or Ptx1 binding sites, and the
generation of Ptx1 mutants were as described elsewhere (56).
The Ptx1 fragments used in the Gal4 DNA-binding domain (Gal4DBD)-Ptx1
fusions were generated by PCR with primers containing restriction sites
and were subsequently subcloned in frame in the corresponding sites of
a Gal4DBD vector. Mutations of the Egr-1 site and the double or triple
mutants were obtained by PCR with the bp
142 bovine LH
promoter as
a template. A common reverse primer that incorporates the Egr-1 site
mutation (shown in boldface) and a natural PstI site
5'-
31ACCTGCAGGCTCTAAGAACAGCAAGGCCGGGGGTGGCAGC
70-3' was used with various forward primers that were described
previously (56) to generate the mutants. The amplified
fragments were subcloned back into the bp
142 LH
reporter. All
mutations and deletions were confirmed by DNA sequencing.
Recombinant protein production and pull-down assays.
Maltose-binding protein (MBP) fusion proteins (MBP-SF-1, MBP-Egr-1,
MBP-Ptx1, and MBP-LacZ
) were produced as described earlier (56). 35S-labeled in vitro-translated Ptx1 (wild
type and mutants), SF-1, and luciferase were obtained by using the
TNT-coupled transcription-translation rabbit reticulocyte lysate system
(Promega). Protein-protein interaction assays were performed according
to the method of Tremblay et al. (56).
 |
RESULTS |
GnRH rapidly and transiently induces Egr-1.
LH
gene
expression requires the concerted action of several transcription
factors, some of which are involved in basal expression, whereas other
inducible factors are needed to elicit a rapid response to external
stimuli such as the hypothalamic hormone GnRH. As shown in Fig.
1, alignment of the LH
promoter from
several species reveals three highly conserved regions: one that binds
the orphan nuclear receptor SF-1, a consensus site for binding of the
homeobox transcription factor Ptx1, and a GC-rich region previously
shown to bind Egr-1. All of these factors were previously shown to
activate the LH
promoter (14, 22, 29, 57).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Egr-1, Ptx1, and SF-1 binding sites are conserved across
species in the LH promoter. Alignment of the mouse (24),
rat (19), bovine (60), sheep (3), pig
(8), horse (48), and human (54) LH
promoter sequences reveals consensus SF-1, Ptx1, and Egr-1 elements
(boxed) that are conserved across species.
|
|
In order to identify the factor(s) responsible for GnRH-dependent
activation of the LH

promoter, we tested whether GnRH and
other
second messenger inducers could stimulate Ptx1, SF-1, and/or
Egr-1 gene
expression in the

T3-1 gonadotrope cell line. As shown
in Fig.
2A, treatment of

T3-1 cells with
forskolin (an inducer
of protein kinase A [PKA]) or cyclic ADP-ribose
(a calcium ionophore)
had no significant effect on Ptx1 and Egr-1 mRNA
levels. Interestingly,
1 h after treatment with 10
7
M GnRH, Egr-1, but not Ptx1, mRNA levels were dramatically increased.
Egr-1 mRNA returned to normal levels by 8 h after initiation of
GnRH treatment. Egr-1 induction was transient, since mRNA levels
were
back to basal levels by 2 h of GnRH treatment (Fig.
2B).
Densitometric analysis revealed that Egr-1 mRNA levels were 50
times
higher in GnRH-treated cells compared to vehicle-treated
cells after
only 30 min (Fig.
2B and C). Consistent with a previous
report by
Windle et al. (
62),

GSU mRNA levels were slightly
increased after 8 h of GnRH treatment (Fig.
2B). GnRH treatment
did not significantly affect GnRH-R mRNA levels nor those of the
two
other transcription factors known to be involved in LH

gene
expression, Ptx1 and SF-1 (Fig.
2B). The effect of GnRH on Egr-1
mRNA
levels was also ascertained in another model gonadotrope
cell line, the
L

T2 cells, and a similar transient increase was
observed on Egr-1
mRNA (Fig.
2D), but not on

GSU, Ptx1, SF-1,
or GnRH-R mRNAs (data
not shown). Taken together, these results
suggest that Egr-1 may be a
downstream mediator of the GnRH-induced
signal transduction pathway in
pituitary gonadotropes.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
GnRH rapidly induces Egr-1 gene expression. (A) T3-1
cells were treated as indicated for 60 min or 8 h, and total RNA
was isolated for use in Northern blot analysis of Egr-1, GnRH-R, and
Ptx1 mRNA. The blot was subsequently probed with an 18S rRNA probe to
ensure integrity and loading of the RNA. (B) Time course analysis of
GnRH effect on T3-1 cells. Total RNA was isolated at the indicated
time after GnRH treatment (10 7 M) and analyzed by
Northern blot as in panel A. (C) The Egr-1 mRNA levels from B were
quantified by densitometry. (D) Time course analysis of GnRH effect on
Egr-1 mRNA levels in L T2 cells.
|
|
PKC enhances Egr-1-dependent LH
promoter activation.
Egr-1
has been shown recently to be involved in LH
gene expression
(28, 29, 55). As shown in Fig.
3A, LH
promoter activation by Egr-1
(NGFI-A) was specific, since the closely related factor WT-1 or the
products of three other immediate-early genes, Nur77 (NGFI-B), Nurr1,
and NOR-1, failed to activate the LH
promoter. GnRH stimulation of
gonadotropin expression and secretion occurs through activation of PKC
and increased intracellular calcium levels (1, 2, 20); in
turn, PKC is thought to activate a downstream transcription factor(s)
that controls LH
gene expression. Consistent with this model, we
showed that the PKC activator PMA is as efficient as GnRH in inducing
Egr-1 mRNA levels in
T3-1 cells (Fig. 3B). The activity of Egr-1 may
also be enhanced by phosphorylation (4, 16) and,
consequently, we tested various protein kinase catalytic subunits for
the enhancement of Egr-1-dependent LH
promoter activation. As shown
in Fig. 3C, PKC potentiated the ability of Egr-1 to activate the LH
promoter. This potentiation was specific for PKC since none of the
other kinases tested, including PKA, Jun kinase (JNK), and calmodulin
kinase (CamK) markedly enhanced basal (not shown) or Egr-1-induced
LH
promoter activation (Fig. 3C). These results suggest that
induction of Egr-1 gene expression and phosphorylation of Egr-1, both
events specifically mediated through the PKC pathway, constitute part
of the intracellular signaling cascade induced by GnRH in gonadotropes.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Involvement of PKC pathway in Egr-1-dependent activation
of LH promoter. (A) The effect of Egr-1 or the related factor WT-1
and of the products of other immediate-early genes (Nurr1, Nur77, and
NOR-1) was assessed on the bp 776 bovine LH promoter. The
LH -luciferase reporter was cotransfected in CV-1 cells together with
a control plasmid (empty expression vector, open bar) or with
expression vectors for Egr-1, WT-1, Nurr1, Nur77, or NOR-1 as indicated
(solid bars). (B) Effect of PMA treatment on Egr-1 mRNA levels. T3-1
cells were treated with 5 × 10 7 M PMA for 60 min
before harvest and RNA isolation. Egr-1 mRNA was revealed by Northern
blot. (C) Enhancement of Egr-1-dependent stimulation of LH promoter
activity by PKC, but not other kinases. CV-1 cells were cotransfected
with the bp 776 LH reporter and either a control empty expression
vector (Ctl) or with expression vectors for Egr-1 with or without PKC,
PKA, JNK, or CamK. Results are shown as fold activation (± SEM).
|
|
Mutagenesis of Egr-1 site affects GnRH activation of LH
promoter.
The Egr-1 and SF-1 sites of the LH
promoter were
mutated separately in order to test their involvement in responsiveness to GnRH. Pulsatile treatment of L
T2 cells with GnRH was previously shown to increase LH
mRNA (58), and a similar approach
was used to test for GnRH responsiveness of LH
promoter constructs. This treatment increased LH
promoter activity, and mutagenesis of
the SF-1 binding site did not affect this response (Fig.
4). However, mutagenesis of the Egr-1
site significantly reduced GnRH responsiveness of the LH
promoter.
Thus, at least part of the GnRH-induced signals exert their effect on
LH
transcription through this Egr-1 site.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
GnRH stimulation of LH promoter activity is reduced
by mutation of Egr-1, but not SF-1, binding site. L T2 cells were
transfected with three different bp 142 LH reporters (wild type,
mutated Egr-1 binding site, and mutated SF-1 binding site). Cells were
subjected to four daily pulses of either vehicle (open bars) or 100 nM
GnRH (solid bars) over a 2-day period as described in Materials and
Methods. Results are shown as fold activation (± SEM).
|
|
Egr-1, Ptx1, and SF-1 cooperatively activate the LH
promoter.
Ptx1 and SF-1 are both present at high levels in
unstimulated pituitary gonadotropes (26, 39, 57) and in
T3-1 cells, whereas Egr-1 is not (Fig. 2). Binding sites for these
three factors are conserved across species within the LH
promoter
(Fig. 1). It has already been shown that, individually, Ptx1 and SF-1
activate the LH
promoter by binding to their cognate sites (14,
22, 57), while, together, they act synergistically (56,
57). Since Egr-1 and SF-1 have also been documented to synergize
with each other (28, 29), we tested whether Ptx1 could
synergistically enhance transcription with Egr-1. Both Ptx1 and Egr-1
activated the bp
776 LH
reporter, and they also acted
synergistically to enhance promoter activity (Fig.
5A). The product of another Egr-1-related
gene, WT-1, or other immediate-early genes, such as Nurr1, Nur77, and
NOR-1, did not synergize with Ptx1 (Fig. 5A).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Egr-1, Ptx1, and SF-1 synergize for activation of the
LH promoter. (A) Transcriptional cooperation between Egr-1 and Ptx1.
Ptx1 was tested for synergism on the bp 776 LH reporter with
either Egr-1, WT-1, Nurr1, Nur77, or NOR-1. (B) Egr-1 has a cumulative
effect on Ptx1-SF-1 synergism. CV-1 cells were cotransfected with the
bp 776 LH reporter and the indicated expression plasmids. The
SF-1 LBD mutant is deleted of its LBD, and it was previously shown to
have constitutive transcriptional activity (47, 56). The
results are shown as fold activation (± SEM).
|
|
We have recently demonstrated that Ptx1 can modulate the activity of
SF-1 by bypassing the requirement for its ligand (
56).
Indeed, as shown in Fig.
5B, a constitutively active SF-1 mutant
devoid
of its ligand binding domain (

LBD) was as active as the
synergistic
activity of Ptx1-SF-1 (compare lanes 5 and 7), suggesting
that Ptx1
serves to unmask SF-1 activity (
56). Since Egr-1 also
synergizes with SF-1 (references
28 and
33 and Fig.
5B, column
9), we tested whether Egr-1
has a similar unmasking effect on
SF-1 as does Ptx1. Although Egr-1 and
Ptx1 each markedly enhanced
the activity of wild-type SF-1 (columns 9 and 7, respectively),
only Egr-1 synergized with SF-1

LBD (compare
lanes 10 and 8),
suggesting that Egr-1 and Ptx1 have different
mechanisms for synergizing
with SF-1. As expected, when the three
factors were combined,
a cumulative effect was observed (Fig.
5B,
column 11). Moreover,
the cumulative activity of the three factors
(column 11) was the
same as that of Egr-1 with SF-1

LBD (column 10)
or of Ptx1, Egr-1,
and SF-1

LBD (column 12), a finding consistent
with the putative
role of Ptx1 in unmasking the activation domain of
SF-1.
Binding site requirements for Egr-1-Ptx1-SF-1 synergism.
Previous studies have revealed that a bp
142 LH
promoter fragment
that retains the SF-1 element at bp
120, the Ptx1 binding site at bp
95, and the Egr-1 binding motif at bp
45 is sufficient for Ptx1 and
SF-1 transactivation and synergy (56). This construct also
allowed us to determine the binding sites required for the synergistic
cooperativity between SF-1, Ptx1, and Egr-1. Like the bp
776 LH
promoter (Fig. 5B), the three factors exhibited cumulative effects on
the shorter bp
142 LH
promoter fragment (Fig.
6A). The requirement for each promoter
binding site was tested by creating mutations of each site, either
individually (Fig. 6B, C, and D), in two-by-two combinations (Fig. 6E
and F), or all three together (Fig. 6G).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
Site requirements for Egr-1-Ptx1-SF-1 cooperation.
Transactivation by Egr-1, Ptx1, and SF-1 alone or in combination was
tested on bp 142 bovine LH reporters as follows: wild-type
promoter with intact binding sites for Egr-1, SF-1, and Ptx1 (A);
mutated Ptx1 site (25); mutated SF-1 site (14,
22) (C); mutated Egr-1 site (29) (D); double mutation
of the SF-1 and Egr-1 sites (E); double mutation of the Ptx1 and Egr-1
sites (F); and mutation of all three sites (G). Promoter constructs
were cotransfected in CV-1 cells with the indicated expression
plasmids. The results are shown as fold activation (± SEM).
|
|
Consistent with our previous study, mutation of the Ptx1 binding site
did not affect Ptx1-SF-1 synergism (Fig.
6B and reference
56). Similarly, this same mutation did not prevent
synergy between
Ptx1 and Egr-1 (Fig.
6B). Thus, the cooperativity
between Ptx1,
SF-1, and Egr-1 appears to be independent of Ptx1 binding
to DNA.
In contrast, mutation of the SF-1 element abolished both
Ptx1-SF-1
and SF-1-Egr-1 synergism (Fig.
6C). Finally, mutation of
the Egr-1
element prevented synergy with SF-1 but did not completely
abolish
Egr-1 interaction with Ptx1 (Fig.
6D). Taken together, these
results
suggest that Egr-1-SF-1 synergism requires the binding of both
factors to their cognate elements, since mutation of each site,
either
individually (Fig.
6C and D) or in combination (Fig.
6E)
abolished
synergy. Conversely, synergism between Egr-1 and Ptx1
apparently
requires only one of the two elements, since promoters
with single
mutations still exhibited some synergism (Fig.
6B
and D), although the
cumulative activity was not as great in these
cases as with the intact
promoter (Fig.
6A). In contrast, the
double Egr-1 and Ptx1 site
mutation completely abrogated Egr-1-Ptx1
synergism (Fig.
6F). As
expected, mutation of all three elements,
blocked LH

promoter
activation by any combination of Egr-1, Ptx1,
or SF-1 (Fig.
6G). The
results of this mutagenesis analysis (summarized
in Table
1) revealed that the synergies observed
between Egr-1,
SF-1, and Ptx1 on the LH

promoter have different site
requirements
and, thus, are likely mediated via different molecular
mechanisms.
Egr-1 and Ptx1 interact physically.
Cooperativity between
Ptx1, SF-1, and Egr-1 for activation of LH
promoter suggests that
the proteins may interact directly. We have, in fact, recently
demonstrated that Ptx1 and SF-1 interact in vitro and in vivo
(56). As shown in Fig. 7A, both SF-1 and Egr-1 immobilized
on beads also interacted with in vitro-synthesized Ptx1. These
interactions were specific since no binding was observed with
immobilized MBP-LacZ
(Fig. 7A, lane 4)
and labeled luciferase did not bind any immobilized protein (Fig. 7C).
Similarly, both Egr-1 and Ptx1 interacted with labeled SF-1 protein
(Fig. 7B). Thus, the Ptx1, SF-1, and Egr-1 cooperative effects are
likely to occur through direct protein-protein interactions.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 7.
Egr-1 directly interacts with Ptx1 and SF-1. Pull-down
assays were performed with immobilized, bacterially produced MBP fusion
proteins (MBP-SF-1, MBP-Egr-1, MBP-Ptx1, and MBP-LacZ as a
control) with 35S-labeled Ptx1 (A), SF-1 (B), or luciferase
(C). Complexes were separated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis, transferred onto polyvinylidene difluoride
membranes, and visualized by autoradiography. The input protein (lanes
1) corresponds to 20% of the labeled protein used in the assay.
|
|
Egr-1-Ptx1 synergism maps to a C-terminal domain of Ptx1.
In
order to identify the domain of Ptx1 involved in the synergistic and
physical interactions with Egr-1, a series of Ptx1 mutants was tested
in transfection and pull-down assays. The expression level, nuclear
localization, and transcriptional properties of the Ptx1 mutant
proteins have been assessed previously (56). Deletion of the
N-terminal domain of Ptx1 (mutants
N1 and
N2) did not affect its ability to synergize with Egr-1
(Fig. 8A). However, deletion of a
49-amino-acid region in the C-terminal domain of Ptx1 (amino acids 234 to 283), which deletes an activation domain (56), led to a
significant decrease in synergy with Egr-1 (Fig. 8A, compare mutant
C2 with mutant
C1). Pull-down assays were
then used to identify the region involved in the physical interaction
with Egr-1 (Fig. 8B). Consistent with the transactivation data, the
N-terminal region of Ptx1 was not required for interaction with Egr-1
(Fig. 8B, mutant
N2). The Egr-1 interacting domain mapped to a 37-amino-acid region located between residues 197 (mutant
C3) and 234 (mutant
C2) of Ptx1.
Interestingly, this same Ptx1 region was recently shown to be the
domain involved in the physical interaction with SF-1 (Fig. 8B and
reference 56). We also used an in vivo system to
ascertain the direct interaction between Ptx1 and Egr-1 documented in
vitro by using the pull-down assay. For this purpose, C-terminal
fragments of Ptx1 that have little (between endpoints C4 and C2 defined
in Fig. 8A) or no (endpoints C3 to C2) transcriptional activity were
fused to the Gal4DBD. These fusion proteins did not show marked
transcriptional activity when expressed with an upstream activating
sequence (UAS)-containing reporter; however, coexpression of Egr-1
significantly enhanced the activity of the chimeras but not of Gal4DBD
(Fig. 8C). Egr-1 alone had no effect on this reporter, and Gal4DBD
fusions containing other Ptx1 fragments were not affected by Egr-1
(data not shown). Thus, it appears that an activation domain of Ptx1
(localized between residues 234 and 283) is required for its
transcriptional synergism with both Egr-1 and SF-1, while physical
interactions involve a contiguous region of Ptx1 (between residues 197 and 234).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 8.
The C-terminal domain of Ptx1 is required for physical
interaction and transcriptional cooperation with Egr-1. (A) CV-1 cells
were cotransfected with the bovine bp 142 LH reporter, along with
expression vectors for Egr-1 (open bar) or for Egr-1 together with Ptx1
mutants (solid bars). The Ptx1 mutants were as described previously
(56). (B) The indicated Ptx1 mutant proteins were labeled by
in vitro translation and tested for binding to MBP-SF-1 (lanes 2),
MBP-Egr-1 (lanes 3), or MBP-LacZ (lanes 4) as a control. Bound
complexes were separated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, transferred onto polyvinylidene difluoride membranes,
and visualized by autoradiography. The input proteins (lanes 1)
correspond to 20% of the labeled protein used in the assay. (C) In
vivo hybrid assay for interaction between Egr-1 and fragments of Ptx1
fused to Gal4DBD. A UAS-containing thymidine kinase promoter-luciferase
reporter plasmid was cotransfected in CV-1 cells either alone (open
bar) or with a Gal4DBD fused (or not) to Ptx1 C-terminal fragments
C4-C2 (amino acids 150 to 234) or C3-C2 (amino acids 197 to 234) in the
absence (hatched bars) or the presence (solid bars) of Egr-1.
|
|
 |
DISCUSSION |
The regulation of gonadotropin synthesis and secretion by GnRH is
well established. The lack of LH
expression in the hpg mouse, which harbors mutations in the GnRH gene (35), and
naturally occurring mutations in the GnRH receptor in humans
(27), have corroborated the importance of this hypothalamic
hormone for control of gonadotropin function. Although it is clear that
GnRH is essential for gonadotropin gene expression, the transcription
factors that, ultimately, are targets of GnRH action remain unknown. In
the present study, we have identified the immediate-early response Egr-1 gene as a potential effector of GnRH-elicited responses in
pituitary gonadotropes. Moreover, we propose a model in which Egr-1
physically and functionally cooperates with two other transcription factors, Ptx1 and SF-1, to elicit a rapid increase in LH
gene expression in response to GnRH.
Regulation of Egr-1 activity.
The rapid and strong induction
of Egr-1 mRNA in response to GnRH (Fig. 2) and to PMA (Fig. 3B)
suggested that this early response transcription factor may mediate
some of the effects of the hypothalamic hormone (Fig. 9). It was
previously shown that GnRH binding to its receptor elevates
intracellular Ca2+ and activates the PKC cascade (1,
2, 20). We now show that PKC activation by PMA elevates Egr-1
mRNA levels (Fig. 3B) and that PKC enhances Egr-1-dependent
transcription (Fig. 3C). Although these data do not exclude the
putative involvement of other signaling events, they suggest that Egr-1
may be a transcriptional effector of GnRH action. This would be
achieved by two complementary mechanisms: (i) stimulation of Egr-1
expression and (ii) direct enhancement by PKC-elicited modification
(phosphorylation?) of Egr-1 transcriptional potency. This model (Fig.
9) is entirely consistent with the
presence of a conserved Egr-1 target site in the LH
promoter of many
species (Fig. 1) and with its conserved position in relation to binding
sites for Ptx1 and SF-1 which synergistically (Fig. 5, 6, and 8A) and
physically (Fig. 7 and 8B and C) interact with Egr-1.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 9.
Model for control of LH gene expression by Egr-1,
Ptx1, and SF-1. (A) In the absence of GnRH, Egr-1 is expressed at a low
level. The LH gene is activated by Ptx1, SF-1, and low levels of
Egr-1. (B) When GnRH is secreted from the hypothalamus, it binds to its
receptor (GnRH-R), leading to activation of G-protein-linked PLC and
IP3 intracellular signaling pathways (20). PLC
cleaves PIP2 to generate IP3 and DAG.
IP3 increases intracellular calcium levels (by L-type
voltage-sensitive channel and release by the endoplasmic reticulum
[ER]), whereas DAG activates PKC. Activation of PKC leads to
increased mitogen-activated protein kinase kinase (MAPKK) and
mitogen-activated protein kinase (MAPK) activity, leading to
phosphorylation of Egr-1 (4, 16). Egr-1 mRNA levels are
rapidly increased by GnRH via the PKC pathway, rather than by PKA or
calcium (Ca2+). Egr-1 synergizes with Ptx1 and SF-1 to
rapidly increase LH gene expression.
|
|
Mechanism of Egr-1, Ptx1, and SF-1 cooperation.
We have
recently shown that synergistic cooperation between two transcription
factors, Ptx1 and SF-1, contributes to LH
gene expression. This
synergism is achieved through a Ptx1-SF-1 physical interaction that
mimics the activity of a constitutively active form of SF-1 (LBD
deletion) and thus appears to bypass the need for an SF-1 ligand
(56). We now show that Egr-1 also cooperates with these two
factors, Ptx1 and SF-1, to activate LH
promoter activity. However,
the molecular mechanism of the Egr-1 synergism appears to be different
(Table 1). Interestingly, the cumulative effects of these factors may
serve to confer hormone responsiveness, since Egr-1 activity is greatly
stimulated by GnRH, whereas Ptx1 and SF-1 mRNA levels are not hormone
regulated. In resting cells, low-level expression of Egr-1 may
contribute only slightly to LH
expression (Fig. 9A); after GnRH
stimulation, increased levels of Egr-1, as well as enhancement of Egr-1
transcriptional potency by PKC (for example, by phosphorylation), is
likely to contribute to stimulation of LH
gene transcription (Fig.
9B).
Egr-1 as a downstream effector of GnRH.
None of the
transcription factors so far implicated in regulation of LH
gene
expression act as a downstream effector of GnRH action. The orphan
nuclear receptor SF-1 was initially thought to play such a role since
gonadectomy, which is known to increase hypothalamic GnRH secretion,
led to a threefold increase in SF-1 mRNA levels in the pituitary
(12, 59) and because SF-1 directly regulates LH
promoter
activity (14, 22, 56, 57). Moreover, targeted ablation of
the SF-1 gene resulted in a severe decrease in LH
mRNA levels
(18, 49). However, the recovery of normal LH
mRNA levels
by GnRH injection in SF-1 knockout mice has unambiguously eliminated
SF-1 as a mediator of GnRH action (17). The absence of LH
mRNA in the SF-1
/
animals was later proven to be the
result of a blockade of GnRH secretion (17, 49). Our results
are also consistent with this interpretation since GnRH did not affect
SF-1 mRNA levels in
T3-1 cells (Fig. 2B).
Ptx1 is unlikely to be a mediator of GnRH action since Ptx1 gene
expression was unaffected by GnRH treatment (Fig.
2). In
contrast, the
dramatic upregulation of the Egr-1 mRNA by GnRH
(nearly 50-fold [Fig.
2C and D]), taken together with the dependence
on an intact Egr-1
binding site for GnRH responsiveness of the
LH

promoter (Fig.
4),
strongly suggest that Egr-1 is an effector
of GnRH action in pituitary
gonadotropes. It was recently shown
(
13) that the proximal
LH

promoter contains a second, weaker
Egr-1 binding site (ca. bp

105); this site may account for the
weak GnRH responsiveness of the
LH

promoter mutated at the major
(bp

45) Egr-1 site (Fig.
4). This
weak GnRH responsiveness could
also be the result of a direct
protein-protein interaction between
Egr-1 and DNA-bound Ptx1, since the
Ptx1 binding site can be sufficient
for some Egr-1-Ptx1 synergy (Fig.
6D and E and Table
1). Binding
of GnRH to its cognate receptor
activates the G-protein-linked
PLC-IP
3 intracellular
signaling pathway, leading to PKC activation
and increased
intracellular calcium levels (
1,
2,
20).
Since Egr-1 mRNA
levels are similarly induced by PMA, a PKC activator,
and GnRH (Fig.
3B) but not by cyclic ADP-ribose (Fig.
2A), a calcium
ionophore, it
appears that GnRH-induced stimulation of Egr-1 gene
expression is
primarily mediated by PKC. This observation is consistent
with recent
work showing preferential activation of LH

, but not

GSU, promoter
activity by the PKC pathway (
46). The involvement
of Egr-1,
together with Ptx1 and SF-1, in mediating GnRH action
is also
compatible with recent LH

promoter mapping data (
21).
Our
working model (Fig.
9) is strongly supported by the recent
characterization of Egr-1 knockout mice that have undetectable
LH

expression despite the presence of other gonadotrope markers
(FSH

and

GSU) and normal GnRH secretion; further, gonadectomy,
which
increases GnRH secretion, induced FSH

in these mice as
in wild-type
animals, but not LH

(
29,
55).
The transcriptional signaling of GnRH action through activation of
Egr-1 (NGFI-A) is reminiscent of our recent identification
of Nur77
(NGFI-B) as a mediator of corticotropin-releasing hormone
stimulation
of POMC gene transcription (
42). Thus, two different
pituitary lineages utilize immediate-early response genes as
transcriptional
effectors to mediate the effects of its trophic
hypothalamic
hormone.
 |
ACKNOWLEDGMENTS |
The Egr-1 expression vector and the bovine bp
776 LH
luciferase reporter were kindly provided by Vikas Sukhatme and John Nilson, respectively. We are grateful to Keith Parker for the SF-1
expression plasmid, to Jerry Pelletier for the WT-1 expression plasmid,
to Pamela Mellon for the
T3-1 and L
T2 cell lines, to Thomas
Perlmann for the Gal4 plasmids, to Robert Viger for providing some of
the reagents, and to Cynthia Goodyer for critical reading of the
manuscript. The efficient secretarial assistance of Lise Laroche was
much appreciated.
This work was funded by the National Cancer Institute of Canada
supported with funds provided by the Canadian Cancer Society.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Génétique Moléculaire, Institut de Recherches
Cliniques de Montréal, 110 des Pins Ouest, Montréal,
Québec, Canada H2W 1R7. Phone: (514) 987-5680. Fax: (514)
987-5575. E-mail: drouinj{at}ircm.qc.ca.
 |
REFERENCES |
| 1.
|
Andrews, W. V.,
R. A. Maurer, and P. M. Conn.
1988.
Stimulation of rat luteinizing hormone-beta messenger RNA levels by gonadotropin releasing hormone. Apparent role for protein kinase C.
J. Biol. Chem.
263:13755-13761[Abstract/Free Full Text].
|
| 2.
|
Ben-Menahem, D., and Z. Naor.
1994.
Regulation of gonadotropin mRNA levels in cultured rat pituitary cells by gonadotropin-releasing hormone (GnRH): role for Ca2+ and protein kinase C.
Biochemistry
33:3698-3704[Medline].
|
| 3.
|
Brown, P.,
J. R. McNeilly,
R. M. Wallace,
A. S. McNeilly, and A. J. Clark.
1993.
Characterization of the ovine LH beta-subunit gene: the promoter directs gonadotrope-specific expression in transgenic mice.
Mol. Cell. Endocrinol.
93:157-165[Medline].
|
| 4.
|
Cao, X.,
R. Mahendran,
G. R. Guy, and Y. H. Tan.
1993.
Detection and characterization of cellular EGR-1 binding to its recognition site.
J. Biol. Chem.
268:16949-16957[Abstract/Free Full Text].
|
| 5.
|
Cao, X. M.,
R. A. Koski,
A. Gashler,
M. McKiernan,
C. F. Morris,
R. Gaffney,
R. V. Hay, and V. P. Sukhatme.
1990.
Identification and characterization of the Egr-1 gene product, a DNA-binding zinc finger protein induced by differentiation and growth signals.
Mol. Cell. Biol.
10:1931-1939[Abstract/Free Full Text].
|
| 6.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidium thyocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 7.
|
Christy, B. A.,
L. F. Lau, and D. Nathans.
1988.
A gene activated in mouse 3T3 cells by serum growth factors encodes a protein with "zinc finger" sequences.
Proc. Natl. Acad. Sci. USA
85:7857-7861[Abstract/Free Full Text].
|
| 8.
|
Ezashi, T.,
T. Hirai,
T. Kato,
K. Wakabayashi, and Y. Kato.
1990.
The gene for the beta subunit of porcine LH: clusters of GC boxes and CACCC elements.
J. Mol. Endocrinol.
5:137-146[Abstract/Free Full Text].
|
| 9.
|
Gashler, A., and V. P. Sukhatme.
1995.
Early growth response protein 1 (Egr-1): prototype of a zinc- finger family of transcription factors.
Prog. Nucleic Acid Res. Mol. Biol.
50:191-224[Medline].
|
| 10.
|
Gharib, S. D.,
M. E. Wierman,
M. A. Shupnik, and W. W. Chin.
1990.
Molecular biology of the pituitary gonadotropins.
Endocr. Rev.
11:177-199[Abstract/Free Full Text].
|
| 11.
|
Gordon, D. F.,
W. M. Wood, and E. C. Ridgway.
1988.
Organization and nucleotide sequence of the mouse alpha-subunit gene of the pituitary glycoprotein hormones.
DNA
7:679-690[Medline].
|
| 12.
|
Haisenleder, D. J.,
M. Yasin,
A. C. Dalkin,
J. Gilrain, and J. C. Marshall.
1996.
GnRH regulates steroidogenic factor-1 (SF-1) gene expression in the rat pituitary.
Endocrinology
137:5719-5722[Abstract].
|
| 13.
|
Halvorson, L. M.,
M. Ito,
J. L. Jameson, and W. W. Chin.
1998.
Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone beta-subunit gene expression.
J. Biol. Chem.
273:14712-14720[Abstract/Free Full Text].
|
| 14.
|
Halvorson, L. M.,
U. B. Kaiser, and W. W. Chin.
1996.
Stimulation of luteinizing hormone beta gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1.
J. Biol. Chem.
271:6645-6650[Abstract/Free Full Text].
|
| 15.
|
Horn, F.,
L. M. Bilezikjian,
M. H. Perrin,
M. M. Bosma,
J. J. Windle,
K. S. Huber,
A. L. Blount,
B. Hille,
W. Vale, and P. L. Mellon.
1991.
Intracellular responses to gonadotropin-releasing hormone in a clonal cell line of the gonadotrope lineage.
Mol. Endocrinol.
5:347-355[Abstract/Free Full Text].
|
| 16.
|
Huang, R. P., and E. D. Adamson.
1994.
The phosphorylated forms of the transcription factor, Egr-1, bind to DNA more efficiently than nonphosphorylated.
Biochem. Biophys. Res. Commun.
200:1271-1276[Medline].
|
| 17.
|
Ikeda, Y.,
X. Luo,
R. Abbud,
J. H. Nilson, and K. L. Parker.
1995.
The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus.
Mol. Endocrinol.
9:478-486[Abstract/Free Full Text].
|
| 18.
|
Ingraham, H. A.,
D. S. Lala,
Y. Ikeda,
X. Luo,
W. H. Shen,
M. W. Nachtigal,
R. Abbud,
J. H. Nilson, and K. L. Parker.
1994.
The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis.
Genes Dev.
8:2302-2312[Abstract/Free Full Text].
|
| 19.
|
Jameson, L.,
W. W. Chin,
A. N. Hollenberg,
A. S. Chang, and J. F. Habener.
1984.
The gene encoding the beta-subunit of rat luteinizing hormone. Analysis of gene structure and evolution of nucleotide sequence.
J. Biol. Chem.
259:15474-15480[Abstract/Free Full Text].
|
| 20.
|
Kaiser, U. B.,
P. M. Conn, and W. W. Chin.
1997.
Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-expressing pituitary cell lines.
Endocr. Rev.
18:46-70[Abstract/Free Full Text].
|
| 21.
|
Kaiser, U. B.,
E. Sabbagh,
B. D. Saunders, and W. W. Chin.
1998.
Identification of cis-acting deoxyribonucleic acid element that mediate gonadotropin-releasing hormone stimulation of the rat luteinizing hormone -subunit gene.
Endocrinology
139:2443-2451[Abstract/Free Full Text].
|
| 22.
|
Keri, R. A., and J. H. Nilson.
1996.
A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone beta subunit promoter in gonadotropes of transgenic mice.
J. Biol. Chem.
271:10782-10785[Abstract/Free Full Text].
|
| 23.
|
Khachigian, L. M.,
V. Lindner,
A. J. Williams, and T. Collins.
1996.
Egr-1-induced endothelial gene expression: a common theme in vascular injury.
Science
271:1427-1431[Abstract].
|
| 24.
|
Kumar, T. R., and M. M. Matzuk.
1995.
Cloning of the mouse gonadotropin beta-subunit-encoding genes, II. Structure of the luteinizing hormone beta-subunit-encoding genes.
Gene
166:335-336[Medline].
|
| 25.
|
Lamonerie, T.,
J. J. Tremblay,
C. Lanctôt,
M. Therrien,
Y. Gauthier, and J. Drouin.
1996.
PTX1, a bicoid-related homeobox transcription factor involved in transcription of pro-opiomelanocortin (POMC) gene.
Genes Dev.
10:1284-1295[Abstract/Free Full Text].
|
| 26.
| Lanctôt, C., Y. Gauthier, and J. Drouin.
Pituitary homeobox 1 (Ptx1) is differentially expressed during
pituitary development. Endocrinology, in press.
|
| 27.
|
Layman, L. C.,
D. P. Cohen,
M. Jin,
J. Xie,
Z. Li,
R. H. Reindollar,
S. Bolbolan,
D. P. Bick,
R. R. Sherins,
L. W. Duck,
L. C. Musgrove,
J. C. Sellers, and J. D. Neill.
1998.
Mutations in gonadotropin-releasing hormone receptor gene cause hypogonadotropic hypogonadism.
Nat. Genet.
18:14-15[Medline].
|
| 28.
|
Le Drean, Y.,
D. Liu,
F. Xiong, and C. L. Hew.
1997.
Presence of distinct cis-acting elements on gonadotropin gene promoters in diverse species dictates the selective recruitment of different transcription factors by steroidogenic factor-1.
Mol. Cell. Endocrinol.
135:31-40[Medline].
|
| 29.
|
Lee, S. L.,
Y. Sadovsky,
A. H. Swirnoff,
J. A. Polish,
P. Goda,
G. Gavrilina, and J. Milbrandt.
1996.
Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGFI-A (Egr-1).
Science
273:1219-1221[Abstract].
|
| 30.
|
Lee, S. L.,
Y. Wang, and J. Milbrandt.
1996.
Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transplantation factor NGFI-A (EGR1).
Mol. Cell. Biol.
16:4566-4572[Abstract].
|
| 31.
|
Lemaire, P.,
O. Revelant,
R. Bravo, and P. Charnay.
1988.
Two mouse genes encoding potential transcription factors with identical DNA-binding domains are activated by growth factors in cultured cells.
Proc. Natl. Acad. Sci. USA
85:4691-4695[Abstract/Free Full Text].
|
| 32.
|
Lemaire, P.,
C. Vesque,
J. Schmitt,
H. Stunnenberg,
R. Frank, and P. Charnay.
1990.
The serum-inducible mouse gene Krox-24 encodes a sequence-specific transcriptional activator.
Mol. Cell. Biol.
10:3456-3467[Abstract/Free Full Text].
|
| 33.
|
Li, T.,
M. R. Stark,
A. D. Johnson, and C. Wolberger.
1995.
Crystal structure of the MATa1/MAT alpha 2 homeodomain heterodimer bound to DNA.
Science
270:262-269[Abstract/Free Full Text].
|
| 34.
|
Luo, X.,
Y. Ikeda,
D. A. Schlosser, and K. L. Parker.
1995.
Steroidogenic factor 1 is the essential transcript of the mouse ftz-f1 gene.
Mol. Endocrinol.
9:1233-1239[Abstract/Free Full Text].
|
| 35.
|
Mason, A. J.,
J. S. Hayflick,
R. T. Zoeller,
W. S. Young,
H. S. Phillips,
K. Nikolics, and P. H. Seeburg.
1986.
A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse.
Science
234:1366-1371[Abstract/Free Full Text].
|
| 36.
|
McMahon, A. P.,
J. E. Champion,
J. A. McMahon, and V. P. Sukhatme.
1990.
Developmental expression of the putative transcription factor Egr-1 suggests that Egr-1 and c-fos are coregulated in some tissues.
Development
108:281-287[Abstract].
|
| 37.
|
Milbrandt, J.
1987.
A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor.
Science
238:797-799[Abstract/Free Full Text].
|
| 38.
|
Nguyen, H. Q.,
B. Hoffman-Liebermann, and D. A. Liebermann.
1993.
The zinc finger transcription factor Egr-1 is essential for and restricts differentiation along the macrophage lineage.
Cell
72:197-209[Medline].
|
| 39.
|
Parker, K. L., and B. P. Schimmer.
1997.
Steroidogenic factor 1: a key determinant of endocrine development and function.
Endocr. Rev.
18:361-377[Abstract/Free Full Text].
|
| 40.
|
Pavletich, N. P., and C. O. Pabo.
1991.
Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A.
Science
252:809-817[Abstract/Free Full Text].
|
| 41.
|
Perez-Castillo, A.,
C. Pipaon,
I. Garcia, and S. Alemany.
1993.
NGFI-A gene expression is necessary for T lymphocyte proliferation.
J. Biol. Chem.
268:19445-19450[Abstract/Free Full Text].
|
| 42.
|
Philips, A.,
S. Lesage,
R. Gingras,
M. H. Maira,
Y. Gauthier,
P. Hugo, and J. Drouin.
1997.
Novel dimeric Nur77 signaling mechanisms in endocrine and lymphoid cells.
Mol. Cell. Biol.
17:5946-5951[Abstract].
|
| 43.
|
Pierce, J. G., and T. F. Parsons.
1981.
Glycoprotein hormones: structure and function.
Annu. Rev. Biochem.
50:465-495[Medline].
|
| 44.
|
Poulin, G.,
B. Turgeon, and J. Drouin.
1997.
NeuroD1/BETA2 contributes to cell-specific transcription of the POMC gene.
Mol. Cell. Biol.
17:6673-6682[Abstract].
|
| 45.
|
Reinhart, J.,
L. M. Mertz, and K. J. Catt.
1992.
Molecular cloning and expression of cdna encoding the murine gonadotropin-releasing hormone receptor.
J. Biol. Chem.
267:21281-21284[Abstract/Free Full Text].
|
| 46.
|
Saunders, B. D.,
E. Sabbagh,
W. W. Chin, and U. B. Kaiser.
1998.
Differential use of signal transduction pathways in the gonadotropin-releasing hormone-mediated regulation of gonadotropin subunit gene expression.
Endocrinology
139:1835-1843[Abstract/Free Full Text].
|
| 47.
|
Shen, W. H.,
C. C. Moore,
Y. Ikeda,
K. L. Parker, and H. A. Ingraham.
1994.
Nuclear receptor steroidogenic factor 1 regulates the mullerian inhibiting substance gene: a link to the sex determination cascade.
Cell
77:651-661[Medline].
|
| 48.
|
Sherman, G. B.,
M. W. Wolfe,
T. A. Farmerie,
C. M. Clay,
D. S. Threadgill,
D. C. Sharp, and J. H. Nilson.
1992.
A single gene encodes the beta-subunits of equine luteinizing hormone and chorionic gonadotropin.
Mol. Endocrinol.
6:951-959[Abstract/Free Full Text].
|
| 49.
|
Shinoda, K.,
H. Lei,
H. Yoshii,
M. Nomura,
M. Nagano,
H. Shiba,
H. Sasaki,
Y. Osawa,
Y. Ninomiya,
O. Niwa, et al.
1995.
Developmental defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-F1 disrupted mice.
Dev. Dynamics
204:22-29[Medline].
|
| 50.
|
Sukhatme, V. P.,
X. Cao,
L. C. Chang,
C. H. Tsai-Morris,
D. Stamenkobich,
P. C. P. Ferreira,
D. R. Cohen,
S. A. Edwards,
T. B. Shows,
T. Curran,
M. M. Le Beau, and E. D. Adamson.
1988.
A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization.
Cell
53:37-43[Medline].
|
| 51.
|
Sundaresan, S.,
I. M. Colin,
R. G. Pestell, and J. L. Jameson.
1996.
Stimulation of mitogen-activated protein kinase by gonadotropin-releasing hormone: evidence for the involvement of protein kinase.
Endocrinology
137:304-311[Abstract].
|
| 52.
|
Swirnoff, A. H., and J. Milbrandt.
1995.
DNA-binding specificity of NGFI-A and related zinc finger transcription factors.
Mol. Cell. Biol.
15:2275-2287[Abstract].
|
| 53.
|
Szeto, D. P.,
A. K. Ryan,
S. M. O'Connell, and M. G. Rosenfeld.
1996.
P-OTX: a PIT-1-interacting homeodomain factor expressed during anterior pituitary gland development.
Proc. Natl. Acad. Sci. USA
93:7706-7710[Abstract/Free Full Text].
|
| 54.
|
Talmadge, K.,
N. C. Vamvakopoulos, and J. C. Fiddes.
1984.
Evolution of the genes for the beta subunits of human chorionic gonadotropin and luteinizing hormone.
Nature
307:37-40[Medline].
|
| 55.
|
Topilko, P.,
S. Schneider-Maunoury,
G. Levi,
A. Trembleau,
D. Gourdji,
M. A. Driancourt,
C. V. Rao, and P. Charnay.
1998.
Multiple pituitary and ovarian defects in Krox-24 (NGFI-A, Egr-1)-targeted mice.
Mol. Endocrinol.
12:107-122[Abstract/Free Full Text].
|
| 56.
| Tremblay, J. J., Y. Gauthier, and J. Drouin.
Ptx1 regulates SF-1 activity by an interaction that bypasses the need
for ligand. Submitted for publication.
|
| 57.
|
Tremblay, J. J.,
C. Lanctôt, and J. Drouin.
1998.
The Pan-pituitary activator of transcription, Ptx-1 (pituitary homeobox1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3.
Mol. Endocrinol.
12:428-441[Abstract/Free Full Text].
|
| 58.
|
Turgeon, J. L.,
Y. Kimura,
D. W. Waring, and P. L. Mellon.
1996.
Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line.
Mol. Endocrinol.
10:439-450[Abstract/Free Full Text].
|
| 59.
|
Turzillo, A. M.,
C. C. Quirk,
J. L. Juengel,
T. M. Nett, and C. M. Clay.
1997.
Effects of ovariectomy and hypothalamic-pituitary disconnection on amounts of steroidogenic factor-1 mRNA in the ovine anterior pituitary gland.
Endocrine
6:251-256.
[Medline] |
| 60.
|
Virgin, J. B.,
B. J. Silver,
A. R. Thomason, and J. H. Nilson.
1985.
The gene for the beta subunit of bovine luteinizing hormone encodes a gonadotropin mRNA with an unusually short 5'-untranslated region.
J. Biol. Chem.
260:7072-7077[Abstract/Free Full Text].
|
| 61.
|
Watson, M. A., and J. Milbrandt.
1990.
Expression of the nerve growth factor-regulated NGFI-A and NGFI-B genes in the developing rat.
Development
110:173-183[Abstract].
|
| 62.
|
Windle, J. J.,
R. I. Weiner, and P. L. Mellon.
1990.
Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice.
Mol. Endocrinol.
4:597-603[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 1999, p. 2567-2576, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bliss, S. P., Miller, A., Navratil, A. M., Xie, J., McDonough, S. P., Fisher, P. J., Landreth, G. E., Roberson, M. S.
(2009). ERK Signaling in the Pituitary Is Required for Female But Not Male Fertility. Mol. Endocrinol.
23: 1092-1101
[Abstract]
[Full Text]
-
Salisbury, T. B., Binder, A. K., Grammer, J. C., Nilson, J. H.
(2009). GnRH-Regulated Expression of Jun and JUN Target Genes in Gonadotropes Requires a Functional Interaction between TCF/LEF Family Members and {beta}-Catenin. Mol. Endocrinol.
23: 402-411
[Abstract]
[Full Text]
-
Fustin, J. M., Dardente, H., Wagner, G. C., Carter, D. A., Johnston, J. D., Lincoln, G. A., Hazlerigg, D. G.
(2009). Egr1 involvement in evening gene regulation by melatonin. FASEB J.
23: 764-773
[Abstract]
[Full Text]
-
Walsh, H. E., Shupnik, M. A.
(2009). Proteasome Regulation of Dynamic Transcription Factor Occupancy on the GnRH-Stimulated Luteinizing Hormone {beta}-Subunit Promoter. Mol. Endocrinol.
23: 237-250
[Abstract]
[Full Text]
-
Fortin, J., Lamba, P., Wang, Y., Bernard, D. J.
(2009). Conservation of mechanisms mediating gonadotrophin-releasing hormone 1 stimulation of human luteinizing hormone {beta} subunit transcription. Mol Hum Reprod
15: 77-87
[Abstract]
[Full Text]
-
Mayer, S. I., Dexheimer, V., Nishida, E., Kitajima, S., Thiel, G.
(2008). Expression of the Transcriptional Repressor ATF3 in Gonadotrophs Is Regulated by Egr-1, CREB, and ATF2 after Gonadotropin-Releasing Hormone Receptor Stimulation. Endocrinology
149: 6311-6325
[Abstract]
[Full Text]
-
Xie, J., Allen, K. H., Marguet, A., Berghorn, K. A., Bliss, S. P., Navratil, A. M., Guan, J. L., Roberson, M. S.
(2008). Analysis of the Calcium-Dependent Regulation of Proline-Rich Tyrosine Kinase 2 by Gonadotropin-Releasing Hormone. Mol. Endocrinol.
22: 2322-2335
[Abstract]
[Full Text]
-
Shima, Y., Zubair, M., Komatsu, T., Oka, S., Yokoyama, C., Tachibana, T., Hjalt, T. A., Drouin, J., Morohashi, K.-i.
(2008). Pituitary Homeobox 2 Regulates Adrenal4 Binding Protein/Steroidogenic Factor-1 Gene Transcription in the Pituitary Gonadotrope through Interaction with the Intronic Enhancer. Mol. Endocrinol.
22: 1633-1646
[Abstract]
[Full Text]
-
Salisbury, T. B., Binder, A. K., Nilson, J. H.
(2008). Welcoming {beta}-Catenin to the Gonadotropin-Releasing Hormone Transcriptional Network in Gonadotropes. Mol. Endocrinol.
22: 1295-1303
[Abstract]
[Full Text]
-
Ferris, H. A, Walsh, H. E, Stevens, J., Fallest, P. C, Shupnik, M. A
(2007). Luteinizing Hormone Beta Promoter Stimulation by Adenylyl Cyclase and Cooperation with Gonadotropin-Releasing Hormone 1 in Transgenic Mice and LBetaT2 Cells. Biol. Reprod.
77: 1073-1080
[Abstract]
[Full Text]
-
Vallette-Kasic, S., Couture, C., Balsalobre, A., Gauthier, Y., Metherell, L., Dattani, M., Drouin, J.
(2007). The TPIT Gene Mutation M86R Associated with Isolated Adrenocorticotropin Deficiency Interferes with Protein: Protein Interactions. J. Clin. Endocrinol. Metab.
92: 3991-3999
[Abstract]
[Full Text]
-
Zhu, X., Gleiberman, A. S., Rosenfeld, M. G.
(2007). Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks. Physiol. Rev.
87: 933-963
[Abstract]
[Full Text]
-
Lim, S., Luo, M., Koh, M., Yang, M., bin Abdul Kadir, M. N., Tan, J. H., Ye, Z., Wang, W., Melamed, P.
(2007). Distinct Mechanisms Involving Diverse Histone Deacetylases Repress Expression of the Two Gonadotropin {beta}-Subunit Genes in Immature Gonadotropes, and Their Actions Are Overcome by Gonadotropin-Releasing Hormone. Mol. Cell. Biol.
27: 4105-4120
[Abstract]
[Full Text]
-
Zheng, W., Jimenez-Linan, M., Rubin, B. S., Halvorson, L. M.
(2007). Anterior Pituitary Gene Expression with Reproductive Aging in the Female Rat. Biol. Reprod.
76: 1091-1102
[Abstract]
[Full Text]
-
Maudsley, S., Naor, Z., Bonfil, D., Davidson, L., Karali, D., Pawson, A. J., Larder, R., Pope, C., Nelson, N., Millar, R. P., Brown, P.
(2007). Proline-Rich Tyrosine Kinase 2 Mediates Gonadotropin-Releasing Hormone Signaling to a Specific Extracellularly Regulated Kinase-Sensitive Transcriptional Locus in the Luteinizing Hormone {beta}-Subunit Gene. Mol. Endocrinol.
21: 1216-1233
[Abstract]
[Full Text]
-
Salisbury, T. B., Binder, A. K., Grammer, J. C., Nilson, J. H.
(2007). Maximal Activity of the Luteinizing Hormone{beta}-Subunit Gene Requires {beta}-Catenin. Mol. Endocrinol.
21: 963-971
[Abstract]
[Full Text]
-
Zheng, W., Yang, J., Jiang, Q., He, Z., Halvorson, L. M
(2007). Liver receptor homologue-1 regulates gonadotrope function. J Mol Endocrinol
38: 207-219
[Abstract]
[Full Text]
-
Ruf, F., Park, M.-J., Hayot, F., Lin, G., Roysam, B., Ge, Y., Sealfon, S. C.
(2006). Mixed Analog/Digital Gonadotrope Biosynthetic Response to Gonadotropin-releasing Hormone. J. Biol. Chem.
281: 30967-30978
[Abstract]
[Full Text]
-
Sato, T., Kitahara, K., Susa, T., Kato, T., Kato, Y.
(2006). Pituitary transcription factor Prop-1 stimulates porcine pituitary glycoprotein hormone {alpha} subunit gene expression.. J Mol Endocrinol
37: 341-352
[Abstract]
[Full Text]
-
Melamed, P., Zhu, Y., Tan, S. H., Xie, M., Koh, M.
(2006). Gonadotropin-Releasing Hormone Activation of C-jun, But Not Early Growth Response Factor-1, Stimulates Transcription of a Luteinizing Hormone {beta}-Subunit Gene. Endocrinology
147: 3598-3605
[Abstract]
[Full Text]
-
Ellestad, L. E., Carre, W., Muchow, M., Jenkins, S. A., Wang, X., Cogburn, L. A., Porter, T. E.
(2006). Gene expression profiling during cellular differentiation in the embryonic pituitary gland using cDNA microarrays. Physiol. Genomics
25: 414-425
[Abstract]
[Full Text]
-
De Mees, C., Laes, J.-F., Bakker, J., Smitz, J., Hennuy, B., Van Vooren, P., Gabant, P., Szpirer, J., Szpirer, C.
(2006). Alpha-Fetoprotein Controls Female Fertility and Prenatal Development of the Gonadotropin-Releasing Hormone Pathway through an Antiestrogenic Action.. Mol. Cell. Biol.
26: 2012-2018
[Abstract]
[Full Text]
-
Luo, M., Koh, M., Feng, J., Wu, Q., Melamed, P.
(2005). Cross Talk in Hormonally Regulated Gene Transcription through Induction of Estrogen Receptor Ubiquitylation. Mol. Cell. Biol.
25: 7386-7398
[Abstract]
[Full Text]
-
Jiang, Q., Jeong, K.-H., Horton, C. D, Halvorson, L. M
(2005). Pituitary homeobox 1 (Pitx1) stimulates rat LH{beta} gene expression via two functional DNA-regulatory regions. J Mol Endocrinol
35: 145-158
[Abstract]
[Full Text]
-
Wieland, G. D., Nehmann, N., Muller, D., Eibel, H., Siebenlist, U., Suhnel, J., Zipfel, P. F., Skerka, C.
(2005). Early growth response proteins EGR-4 and EGR-3 interact with immune inflammatory mediators NF-{kappa}B p50 and p65. J. Cell Sci.
118: 3203-3212
[Abstract]
[Full Text]
-
Charles, M. A., Suh, H., Hjalt, T. A., Drouin, J., Camper, S. A., Gage, P. J.
(2005). PITX Genes Are Required for Cell Survival and Lhx3 Activation. Mol. Endocrinol.
19: 1893-1903
[Abstract]
[Full Text]
-
Cheng, C. K., Leung, P. C. K.
(2005). Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans. Endocr. Rev.
26: 283-306
[Abstract]
[Full Text]
-
Vadlamudi, U., Espinoza, H. M., Ganga, M., Martin, D. M., Liu, X., Engelhardt, J. F., Amendt, B. A.
(2005). PITX2, {beta}-catenin and LEF-1 interact to synergistically regulate the LEF-1 promoter. J. Cell Sci.
118: 1129-1137
[Abstract]
[Full Text]
-
Hsia, N., Brousal, J. P., Hann, S. R., Cornwall, G. A.
(2005). Recapitulation of Germ Cell- and Pituitary-Specific Expression With 1.6 kb of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Promoter in Transgenic Mice. J Androl
26: 249-257
[Abstract]
[Full Text]
-
Kam, K.-Y., Jeong, K.-H., Norwitz, E. R., Jorgensen, E. M., Kaiser, U. B.
(2005). Oct-1 and Nuclear Factor Y Bind to the SURG-1 Element to Direct Basal and Gonadotropin-Releasing Hormone (GnRH)-Stimulated Mouse GnRH Receptor Gene Transcription. Mol. Endocrinol.
19: 148-162
[Abstract]
[Full Text]
-
Burger, L L, Haisenleder, D J, Dalkin, A C, Marshall, J C
(2004). Regulation of gonadotropin subunit gene transcription. J Mol Endocrinol
33: 559-584
[Abstract]
[Full Text]
-
West, B. E., Parker, G. E., Savage, J. J., Kiratipranon, P., Toomey, K. S., Beach, L. R., Colvin, S. C., Sloop, K. W., Rhodes, S. J.
(2004). Regulation of the Follicle-Stimulating Hormone {beta} Gene by the LHX3 LIM-Homeodomain Transcription Factor. Endocrinology
145: 4866-4879
[Abstract]
[Full Text]
-
Jorgensen, J. S., Quirk, C. C., Nilson, J. H.
(2004). Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone. Endocr. Rev.
25: 521-542
[Abstract]
[Full Text]
-
Jeong, K.-H., Chin, W. W., Kaiser, U. B.
(2004). Essential Role of the Homeodomain for Pituitary Homeobox 1 Activation of Mouse Gonadotropin-Releasing Hormone Receptor Gene Expression through Interactions with c-Jun and DNA. Mol. Cell. Biol.
24: 6127-6139
[Abstract]
[Full Text]
-
Shozu, M., Murakami, K., Segawa, T., Kasai, T., Ishikawa, H., Shinohara, K., Okada, M., Inoue, M.
(2004). Decreased Expression of Early Growth Response-1 and Its Role in Uterine Leiomyoma Growth. Cancer Res.
64: 4677-4684
[Abstract]
[Full Text]
-
Nguyen, K. A., Santos, S. J., Kreidel, M. K., Diaz, A. L., Rey, R., Lawson, M. A.
(2004). Acute Regulation of Translation Initiation by Gonadotropin-Releasing Hormone in the Gonadotrope Cell Line L{beta}T2. Mol. Endocrinol.
18: 1301-1312
[Abstract]
[Full Text]
-
Curtin, D., Ferris, H. A., Hakli, M., Gibson, M., Janne, O. A., Palvimo, J. J., Shupnik, M. A.
(2004). Small Nuclear RING Finger Protein Stimulates the Rat Luteinizing Hormone-{beta} Promoter by Interacting with Sp1 and Steroidogenic Factor-1 and Protects from Androgen Suppression. Mol. Endocrinol.
18: 1263-1276
[Abstract]
[Full Text]
-
Lamolet, B., Poulin, G., Chu, K., Guillemot, F., Tsai, M.-J., Drouin, J.
(2004). Tpit-Independent Function of NeuroD1(BETA2) in Pituitary Corticotroph Differentiation. Mol. Endocrinol.
18: 995-1003
[Abstract]
[Full Text]
-
Mouillet, J.-F., Sonnenberg-Hirche, C., Yan, X., Sadovsky, Y.
(2004). p300 Regulates the Synergy of Steroidogenic Factor-1 and Early Growth Response-1 in Activating Luteinizing Hormone-{beta} Subunit Gene. J. Biol. Chem.
279: 7832-7839
[Abstract]
[Full Text]
-
Coss, D., Jacobs, S. B. R., Bender, C. E., Mellon, P. L.
(2004). A Novel AP-1 Site Is Critical for Maximal Induction of the Follicle-stimulating Hormone {beta} Gene by Gonadotropin-releasing Hormone. J. Biol. Chem.
279: 152-162
[Abstract]
[Full Text]
-
Fayard, E., Schoonjans, K., Annicotte, J.-S., Auwerx, J.
(2003). Liver Receptor Homolog 1 Controls the Expression of Carboxyl Ester Lipase. J. Biol. Chem.
278: 35725-35731
[Abstract]
[Full Text]
-
Jacobs, S. B. R., Coss, D., McGillivray, S. M., Mellon, P. L.
(2003). Nuclear Factor Y and Steroidogenic Factor 1 Physically and Functionally Interact to Contribute to Cell-Specific Expression of the Mouse Follicle-Stimulating Hormone-{beta} Gene. Mol. Endocrinol.
17: 1470-1483
[Abstract]
[Full Text]
-
Ghosh, A. K., Steele, R., Ray, R. B.
(2003). Modulation of Human Luteinizing Hormone {beta} Gene Transcription by MIP-2A. J. Biol. Chem.
278: 24033-24038
[Abstract]
[Full Text]
-
Ganga, M., Espinoza, H. M., Cox, C. J., Morton, L., Hjalt, T. A., Lee, Y., Amendt, B. A.
(2003). PITX2 Isoform-specific Regulation of Atrial Natriuretic Factor Expression: SYNERGISM AND REPRESSION WITH Nkx2.5. J. Biol. Chem.
278: 22437-22445
[Abstract]
[Full Text]
-
Haisenleder, D. J., Ferris, H. A., Shupnik, M. A.
(2003). The Calcium Component of Gonadotropin-Releasing Hormone-Stimulated Luteinizing Hormone Subunit Gene Transcription Is Mediated by Calcium/Calmodulin-Dependent Protein Kinase Type II. Endocrinology
144: 2409-2416
[Abstract]
[Full Text]
-
Keegan, C. E., Camper, S. A.
(2003). Mouse knockout solves endocrine puzzle and promotes new pituitary lineage model. Genes Dev.
17: 677-682
[Full Text]
-
Pulichino, A.-M., Vallette-Kasic, S., Tsai, J. P.-Y., Couture, C., Gauthier, Y., Drouin, J.
(2003). Tpit determines alternate fates during pituitary cell differentiation. Genes Dev.
17: 738-747
[Abstract]
[Full Text]
-
Johnston, J. D., Messager, S., Ebling, F. J. P., Williams, L. M., Barrett, P., Hazlerigg, D. G.
(2003). Gonadotrophin-releasing hormone drives melatonin receptor down-regulation in the developing pituitary gland. Proc. Natl. Acad. Sci. USA
100: 2831-2835
[Abstract]
[Full Text]
-
Suh, H., Gage, P. J., Drouin, J., Camper, S. A.
(2003). Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification. Development
129: 329-337
[Abstract]
[Full Text]
-
Suszko, M. I., Lo, D. J., Suh, H., Camper, S. A., Woodruff, T. K.
(2003). Regulation of the Rat Follicle-Stimulating Hormone {beta}-Subunit Promoter by Activin. Mol. Endocrinol.
17: 318-332
[Abstract]
[Full Text]
-
Maira, M., Martens, C., Batsche, E., Gauthier, Y., Drouin, J.
(2003). Dimer-Specific Potentiation of NGFI-B (Nur77) Transcriptional Activity by the Protein Kinase A Pathway and AF-1-Dependent Coactivator Recruitment. Mol. Cell. Biol.
23: 763-776
[Abstract]
[Full Text]
-
Decker, E. L., Nehmann, N., Kampen, E., Eibel, H., Zipfel, P. F., Skerka, C.
(2003). Early growth response proteins (EGR) and nuclear factors of activated T cells (NFAT) form heterodimers and regulate proinflammatory cytokine gene expression. Nucleic Acids Res
31: 911-921
[Abstract]
[Full Text]
-
Quirk, C. C., Seachrist, D. D., Nilson, J. H.
(2003). Embryonic Expression of the Luteinizing Hormone beta Gene Appears to Be Coupled to the Transient Appearance of p8, a High Mobility Group-related Transcription Factor. J. Biol. Chem.
278: 1680-1685
[Abstract]
[Full Text]
-
Quentien, M.-H., Manfroid, I., Moncet, D., Gunz, G., Muller, M., Grino, M., Enjalbert, A., Pellegrini, I.
(2002). Pitx Factors Are Involved in Basal and Hormone-regulated Activity of the Human Prolactin Promoter. J. Biol. Chem.
277: 44408-44416
[Abstract]
[Full Text]
-
Scherrer, S. P., Rice, D. A., Heckert, L. L.
(2002). Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within Its Proximal Promoter. Biol. Reprod.
67: 1509-1521
[Abstract]
[Full Text]
-
Island, M.-L., Mesplede, T., Darracq, N., Bandu, M.-T., Christeff, N., Djian, P., Drouin, J., Navarro, S.
(2002). Repression by Homeoprotein Pitx1 of Virus-Induced Interferon A Promoters Is Mediated by Physical Interaction and trans Repression of IRF3 and IRF7. Mol. Cell. Biol.
22: 7120-7133
[Abstract]
[Full Text]
-
Vasilyev, V. V., Lawson, M. A., Dipaolo, D., Webster, N. J. G., Mellon, P. L.
(2002). Different Signaling Pathways Control Acute Induction versus Long-Term Repression of LH{beta} Transcription by GnRH. Endocrinology
143: 3414-3426
[Abstract]
[Full Text]
-
Cohen, L. E., Radovick, S.
(2002). Molecular Basis of Combined Pituitary Hormone Deficiencies. Endocr. Rev.
23: 431-442
[Abstract]
[Full Text]
-
Quentien, M.-H., Pitoia, F., Gunz, G., Guillet, M.-P., Enjalbert, A., Pellegrini, I.
(2002). Regulation of Prolactin, GH, and Pit-1 Gene Expression in Anterior Pituitary by Pitx2: An Approach Using Pitx2 Mutants. Endocrinology
143: 2839-2851
[Abstract]
[Full Text]
-
Zakaria, M. M., Jeong, K.-H., Lacza, C., Kaiser, U. B.
(2002). Pituitary Homeobox 1 Activates the Rat FSH{beta} (rFSH{beta}) Gene through Both Direct and Indirect Interactions with the rFSH{beta} Gene Promoter. Mol. Endocrinol.
16: 1840-1852
[Abstract]
[Full Text]
-
Melamed, P., Koh, M., Preklathan, P., Bei, L., Hew, C.
(2002). Multiple Mechanisms for Pitx-1 Transactivation of a Luteinizing Hormone beta Subunit Gene. J. Biol. Chem.
277: 26200-26207
[Abstract]
[Full Text]
-
Dumont, J. E., Dremier, S., Pirson, I., Maenhaut, C.
(2002). Cross signaling, cell specificity, and physiology. Am. J. Physiol. Cell Physiol.
283: C2-C28
[Abstract]
[Full Text]
-
Rosenberg, S. B., Mellon, P. L.
(2002). An Otx-Related Homeodomain Protein Binds an LH{beta} Promoter Element Important for Activation During Gonadotrope Maturation. Mol. Endocrinol.
16: 1280-1298
[Abstract]
[Full Text]
-
Woodmansee, W. W., Mouser, R. L., Gordon, D. F., Dowding, J. M., Wood, W. M., Ridgway, E. C.
(2002). Mutational Analysis of the Mouse Somatostatin Receptor Type 5 Gene Promoter. Endocrinology
143: 2268-2276
[Abstract]
[Full Text]
-
Liu, F., Austin, D. A., Mellon, P. L., Olefsky, J. M., Webster, N. J. G.
(2002). GnRH Activates ERK1/2 Leading to the Induction of c-fos and LH{beta} Protein Expression in L{beta}T2 Cells. Mol. Endocrinol.
16: 419-434
[Abstract]
[Full Text]
-
Duan, W. R., Ito, M., Park, Y., Maizels, E. T., Hunzicker-Dunn, M., Jameson, J. L.
(2002). GnRH Regulates Early Growth Response Protein 1 Transcription Through Multiple Promoter Elements. Mol. Endocrinol.
16: 221-233
[Abstract]
[Full Text]
-
Heckert, L. L., Griswold, M. D.
(2002). The Expression of the Follicle-stimulating Hormone Receptor in Spermatogenesis. Recent Prog Horm Res
57: 129-148
[Abstract]
[Full Text]
-
Wurmbach, E., Yuen, T., Ebersole, B. J., Sealfon, S. C.
(2001). Gonadotropin-releasing Hormone Receptor-coupled Gene Network Organization. J. Biol. Chem.
276: 47195-47201
[Abstract]
[Full Text]
-
Zhang, T., Wolfe, M. W., Roberson, M. S.
(2001). An Early Growth Response Protein (Egr) 1 cis-Element Is Required for Gonadotropin-releasing Hormone-induced Mitogen-activated Protein Kinase Phosphatase 2 Gene Expression. J. Biol. Chem.
276: 45604-45613
[Abstract]
[Full Text]
-
Curtin, D., Jenkins, S., Farmer, N., Anderson, A. C., Haisenleder, D. J., Rissman, E., Wilson, E. M., Shupnik, M. A.
(2001). Androgen Suppression of GnRH-Stimulated Rat LH{beta} Gene Transcription Occurs Through Sp1 Sites in the Distal GnRH-Responsive Promoter Region. Mol. Endocrinol.
15: 1906-1917
[Abstract]
[Full Text]
-
Jorgensen, J. S., Nilson, J. H.
(2001). AR Suppresses Transcription of the LH{beta} Subunit by Interacting with Steroidogenic Factor-1. Mol. Endocrinol.
15: 1505-1516
[Abstract]
[Full Text]
-
Tremblay, J. J., Robert, N. M., Viger, R. S.
(2001). Modulation of Endogenous GATA-4 Activity Reveals Its Dual Contribution to Mullerian Inhibiting Substance Gene Transcription in Sertoli Cells. Mol. Endocrinol.
15: 1636-1650
[Abstract]
[Full Text]
-
Demay, F., De Monti, M., Tiffoche, C., Vaillant, C., Thieulant, M. L.
(2001). Steroid-Independent Activation of ER by GnRH in Gonadotrope Pituitary Cells. Endocrinology
142: 3340-3347
[Abstract]
[Full Text]
-
Pernasetti, F., Vasilyev, V. V., Rosenberg, S. B., Bailey, J. S., Huang, H.-J., Miller, W. L., Mellon, P. L.
(2001). Cell-Specific Transcriptional Regulation of Follicle-Stimulating Hormone-{beta} by Activin and Gonadotropin-Releasing Hormone in the L{beta}T2 Pituitary Gonadotrope Cell Model. Endocrinology
142: 2284-2295
[Abstract]
[Full Text]
-
Heckert, L. L.
(2001). Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element. Mol. Endocrinol.
15: 704-715
[Abstract]
[Full Text]
-
Quirk, C. C., Lozada, K. L., Keri, R. A., Nilson, J. H.
(2001). A Single Pitx1 Binding Site Is Essential for Activity of the LH{beta} Promoter in Transgenic Mice. Mol. Endocrinol.
15: 734-746
[Abstract]
[Full Text]
-
Tremblay, J. J., Viger, R. S.
(2001). Nuclear Receptor Dax-1 Represses the Transcriptional Cooperation Between GATA-4 and SF-1 in Sertoli Cells. Biol. Reprod.
64: 1191-1199
[Abstract]
[Full Text]
-
Pincas, H., Amoyel, K., Counis, R., Laverrière, J.-N.
(2001). Proximal cis-Acting Elements, Including Steroidogenic Factor 1, Mediate the Efficiency of a Distal Enhancer in the Promoter of the Rat Gonadotropin-Releasing Hormone Receptor Gene. Mol. Endocrinol.
15: 319-337
[Abstract]
[Full Text]
-
Nilsson, C.H., Kaleva, M., Virtanen, H., Haavisto, A.M., Pettersson, K., Huhtaniemi, I.T.
(2001). Disparate response of wild-type and variant forms of LH to GnRH stimulation in individuals heterozygous for the LH{beta} variant allele. Hum Reprod
16: 230-235
[Abstract]
[Full Text]
-
Wolfahrt, S., Kleine, B., Jarry, H., Rossmanith, W. G.
(2001). Endogenous regulation of the GnRH receptor by GnRH in the human placenta. Mol Hum Reprod
7: 89-95
[Abstract]
[Full Text]
-
Zhao, L, Bakke, M, Krimkevich, Y, Cushman, L., Parlow, A., Camper, S., Parker, K.
(2001). Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development
128: 147-154
[Abstract]
-
Higa, M., Kanda, H., Kitahashi, T., Ito, M., Shiba, T., Ando, H.
(2000). Quantitative Analysis of fushi tarazu Factor 1 Homolog Messenger Ribonucleic Acids in the Pituitary of Salmon at Different Prespawning Stages. Biol. Reprod.
63: 1756-1763
[Abstract]
[Full Text]
-
Lopez, S., Island, M.-L., Drouin, J., Bandu, M.-T., Christeff, N., Darracq, N., Barbey, R., Doly, J., Thomas, D., Navarro, S.
(2000). Repression of Virus-Induced Interferon A Promoters by Homeodomain Transcription Factor Ptx1. Mol. Cell. Biol.
20: 7527-7540
[Abstract]
[Full Text]
-
Kaiser, U. B., Halvorson, L. M., Chen, M. T.
(2000). Sp1, Steroidogenic Factor 1 (SF-1), and Early Growth Response Protein 1 (Egr-1) Binding Sites Form a Tripartite Gonadotropin-Releasing Hormone Response Element in the Rat Luteinizing Hormone-{beta} Gene Promoter: an Integral Role for SF-1. Mol. Endocrinol.
14: 1235-1245
[Abstract]
[Full Text]
-
Tourtellotte, W. G., Nagarajan, R., Bartke, A., Milbrandt, J.
(2000). Functional Compensation by Egr4 in Egr1-Dependent Luteinizing Hormone Regulation and Leydig Cell Steroidogenesis. Mol. Cell. Biol.
20: 5261-5268
[Abstract]
[Full Text]
-
Keri, R. A., Bachmann, D. J., Behrooz, A., Herr, B. D., Ameduri, R. K., Quirk, C. C., Nilson, J. H.
(2000). An NF-Y Binding Site Is Important for Basal, but Not Gonadotropin-releasing Hormone-stimulated, Expression of the Luteinizing Hormone beta Subunit Gene. J. Biol. Chem.
275: 13082-13088
[Abstract]
[Full Text]
-
Weck, J., Anderson, A. C., Jenkins, S., Fallest, P. C., Shupnik, M. A.
(2000). Divergent and Composite Gonadotropin-Releasing Hormone-Responsive Elements in the Rat Luteinizing Hormone Subunit Genes. Mol. Endocrinol.
14: 472-485
[Abstract]
[Full Text]
-
Sevetson, B. R., Svaren, J., Milbrandt, J.
(2000). A Novel Activation Function for NAB Proteins in EGR-dependent Transcription of the Luteinizing Hormone beta Gene. J. Biol. Chem.
275: 9749-9757
[Abstract]
[Full Text]
-
Barnea, E., Bergman, Y.
(2000). Synergy of SF1 and RAR in Activation of Oct-3/4 Promoter. J. Biol. Chem.
275: 6608-6619
[Abstract]
[Full Text]
-
Ito, M., Park, Y., Weck, J., Mayo, K. E., Jameson, J. L.
(2000). Synergistic Activation of the Inhibin {alpha}-Promoter by Steroidogenic Factor-1 and Cyclic Adenosine 3',5'-Monophosphate. Mol. Endocrinol.
14: 66-81
[Abstract]
[Full Text]
-
Maira, M., Martens, C., Philips, A., Drouin, J.
(1999). Heterodimerization between Members of the Nur Subfamily of Orphan Nuclear Receptors as a Novel Mechanism for Gene Activation. Mol. Cell. Biol.
19: 7549-7557
[Abstract]
[Full Text]
-
Tremblay, J. J., Viger, R. S.
(1999). Transcription Factor GATA-4 Enhances Mullerian Inhibiting Substance Gene Transcription through a Direct Interaction with the Nuclear Receptor SF-1. Mol. Endocrinol.
13: 1388-1401
[Abstract]
[Full Text]
-
Sloop, K. W., Dwyer, C. J., Rhodes, S. J.
(2001). An Isoform-specific Inhibitory Domain Regulates the LHX3 LIM Homeodomain Factor Holoprotein and the Production of a Functional Alternate Translation Form. J. Biol. Chem.
276: 36311-36319
[Abstract]
[Full Text]