Previous Article | Next Article 
Molecular and Cellular Biology, April 1999, p. 2577-2584, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Myogenic Basic Helix-Loop-Helix Proteins and Sp1 Interact as
Components of a Multiprotein Transcriptional Complex Required for
Activity of the Human Cardiac
-Actin Promoter
Elzbieta
Biesiada,1,
Yasuo
Hamamori,1
Larry
Kedes,1 and
Vittorio
Sartorelli1,2,*
Institute for Genetic Medicine and Department
of Biochemistry and Molecular Biology, University of Southern
California School of Medicine, Los Angeles,
California,1 and Institute of
Chemistry, University of Brescia School of Medicine, Brescia,
Italy2
Received 17 September 1998/Returned for modification 3 December
1998/Accepted 4 January 1999
 |
ABSTRACT |
Activation of the human cardiac
-actin (HCA) promoter in
skeletal muscle cells requires the integrity of DNA binding sites for
the serum response factor (SRF), Sp1, and the myogenic basic helix-loop-helix (bHLH) family. In this study we report that activation of the HCA correlates with formation of a muscle-specific
multiprotein complex on the promoter. We provide evidence that
proteins eluted from the multiprotein complex specifically react with
antibodies directed against myogenin, Sp1, and SRF and that the complex
can be assembled in vitro by using the HCA promoter and purified
MyoD, E12, SRF, and Sp1. In vitro and in vivo assays revealed a direct association of Sp1 and myogenin-MyoD mediated by the DNA-binding domain
of Sp1 and the HLH motif of myogenin. The results obtained in this
study indicate that protein-protein interactions and the cooperative
DNA binding of transcriptional activators are critical steps in the
formation of a transcriptionally productive multiprotein complex on the
HCA promoter and suggest that the same mechanisms might be
utilized to regulate the transcription of muscle-specific and other genes.
 |
INTRODUCTION |
Cooperative interactions of
transcriptional activators are pivotal in ensuring the proper execution
of the myogenic program. For instance, the cooperative binding to two
adjacent E boxes on the muscle creatine kinase enhancer by MyoD is
required for transcriptional activation (38). The
transcriptional activators that bind muscle regulatory regions often
establish direct contacts. In fact, protein-protein interactions
govern functional cooperativity of myogenic basic
helix-loop-helix (bHLH) with E proteins (17) and the
myocyte enhancer factor 2 (MEF2) in directing muscle transcription (24). In addition to the E box, numerous muscle-specific
regulatory regions contain binding sites for the MEF2 proteins, the
serum response factor (SRF), and Sp1, suggesting that the combinatorial binding of these factors to muscle regulatory regions has been selected
and is particularly favored for regulation of muscle-specific transcription (25, 39). Whereas both MEF2 and SRF have been shown to interact with the myogenic bHLH (24, 11), the
question of whether Sp1 can also directly associate with myogenic bHLH has not been addressed. Furthermore, it remains to be determined whether muscle and ubiquitous transcription factors found on
muscle-specific regulatory regions are associated as multiprotein complexes.
A region of the human cardiac
-actin (HCA) promoter spanning from
nucleotides
110 to +68 is a composite response element that directs
striated muscle-specific transcription (20). Electrophoretic mobility shift assay (EMSA) and footprinting experiments revealed sites
for the binding of three nuclear proteins in myogenic cells, including
a CArG box for the SRF (21, 5), a GC box for Sp1 (12), and an E box for one of the myogenic bHLH proteins
(33). Mutations in any of these three DNA elements result in
promoter inactivation (33). Furthermore, reconstitution
experiments conducted in Drosophila melanogaster-derived
Schneider cells have shown that exogenously supplied Sp1 and MyoD are
concomitantly required for the transactivation of the human cardiac
-actin (HCA) promoter (33).
This study reports the formation and analysis of a single major
multiprotein complex on the HCA promoter that correlates with muscle-specific transcriptional activation. The formation of this complex relies on the simultaneous presence of at least three factors
that bind to the cis-regulatory elements CArG, GC, and E
boxes. Through the use of a combined gel mobility shift-Western blot
technique, we first demonstrate that cellular Sp1, SRF, and myogenin
are all part of this transcriptional complex and are present on the
same DNA template. To further substantiate this observation, we
successfully attempted to reconstitute the multiprotein complex on the
HCA promoter with recombinant MyoD, E12, SRF, and Sp1. We report that
Sp1 and myogenic bHLH proteins associate both in vitro and in vivo and
that the HLH domain of myogenin and a region spanning the DNA-binding
motif of Sp1 mediate such interaction. Since many muscle regulatory
regions have been shown to be regulated by Sp1 and the myogenic bHLH
(see below), we believe that our findings are likely to be of
significance for the understanding of the transcriptional regulation of
a number of muscle genes and other genes that are activated by a
combination of tissue-specific and ubiquitously expressed factors.
 |
MATERIALS AND METHODS |
Cell culture, transfections, and nuclear extract
preparation.
C2C12 and HeLa cells were grown in Dulbecco modified
Eagle medium (DMEM) supplemented with 20 and 10% fetal calf serum
(FCS), respectively. Differentiation of C2C12 cells was induced by
switching the cells to DMEM containing 2% horse serum. C3H10T1/2 cells
were grown in DMEM supplemented with 10% FCS. Transfections were
performed by using the calcium phosphate precipitation protocol. The
Gal-Sp1, Gal-E12, and VP16-MyoD plasmids have been described earlier
(34). The UASx4-tk-LUC was kindly provided by R. Evans (Salk
Institute). Nuclear extracts derived from C2C12 were prepared after
culturing the cells for 4 days in differentiation medium and according
to the method of Dignam et al. (7). Protein concentrations
were measured by using the Bio-Rad protein assay kit, and extracts were
aliquoted and stored at
80°C.
EMSA.
The DNA probes used were the wild-type and mutated HCA
promoters extending from nucleotides
126 to
16 relative to the
start of transcription. Synthetic oligonucleotides were used as
specific competitors. Mutated bases of the CArG box, GC box, and E box are underlined. Mutations corresponding to the CArG-M and
E-sm boxes were introduced in the HCA promoter by
site-directed mutagenesis (QuikChange; Stratagene), and the resulting
templates were sequenced as follows:
CArG box GACCAAATAAGGCAAGGTGG
µCArG box GACCCAGATCGATCTGGTGG
CArG-M box GACCTATTATGGCAAGGTGG
GC box CCGGGCCCCCACCCCTGCCCCCGGC
µGC box CCGGGCCCCCAAACCTGCCCCCGGC
E box TGCTCCAACTGACCC
µE box TGCTTGGTCCTGACC
E-sm box TGCTCTAACTAACCC
In vitro complex reconstitution was obtained by using
bacterially produced and purified glutathione S-transferase
(GST)-MyoD (~20 ng), GST-E12 (~20 ng), His-SRF (~50 ng), and Sp1
(~40 ng) obtained from HeLa cells infected with a recombinant
vaccinia virus containing full-length Sp1 (Promega). The purified
proteins were incubated in 1× binding buffer [20mM HEPES (pH 7.6), 50 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, 5% glycerol, 300 ng of
double-stranded poly(dI-dC)] at 37°C for 20 min, after which 0.4 ng
of radiolabeled HCA (nucleotides
126 to
16) promoter was added to
the reaction for an additional 15 min at room temperature. The reaction
was loaded onto 4% nondenaturing polyacrylamide gel
(electrophoresis buffer, 0.5× TBE; 150 V; room temperature;
running time, 6 h).
Detection of the protein components present in the gel-retarded
complex.
Protein-DNA complexes were resolved by gel mobility shift
assay. The wet gel was autoradiographed to locate the protein-DNA complexes, and the proteins present in the shifted complex (see Fig. 1)
were eluted with 0.4 M acetic acid-1 M NaCl at 65°C for 40 min,
precipitated for 30 min with 10% cold CCl3COOH, washed in
acetone and in cold 100% ethanol, vacuum dried, resuspended, denatured
in sodium dodecyl sulfate (SDS) buffer, and subjected to SDS-10%
polyacrylamide gel electrophoresis. The Western blot technique was
performed by using ECL Western blotting detection reagents kit
according to the manufacturer's instructions (Amersham). The
polyclonal antiserum against SRF was the gift of R. Prywes (Columbia
University), and the monoclonal antibody against myogenin (FD5) was
kindly supplied by W. Wright (University of Texas Southwestern Medical Center).
In vitro transcription and translation, GST and His fusion
proteins, and protein complex precipitation.
The pBS-Sp1 plasmids
(14) were linearized with EcoRI. In vitro
transcription was induced with T3 RNA polymerase. The resulting synthetic RNAs were translated in vitro with a rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine
according to the manufacturer's instructions. The pGEX-Sp1C168
construct was obtained by cloning a PCR-generated DNA fragment encoding
the last C-terminal 168 amino acids of Sp1 in the pGEX-2TK vector.
Preparation of the GST-Sp1C168, GST-myogenin, and GST-E12 proteins was
performed as previously described (32). The His-SRF protein
was prepared from the pET11d-SRF plasmid (42) as suggested
by the manufacturer (Novagen).
Immunoprecipitation of the Sp1-myogenin complex from radiolabeled
C2 cells.
C2C12 cells were first incubated in 10 ml of
methionine-free DMEM supplemented with 5% dialyzed FCS for 30 min. Then, 5 ml of prewarmed methionine-free DMEM-5% dialyzed FCS
containing 1.020 mCi of [35S]methionine was added to the
cells followed by incubation for 3 h. Cells were lysed in nuclear
lysis buffer (20 mM HEPES, pH 7.7; 20% glycerol; 100 mM NaCl; 1.5 mM
MgCl2; 0.2 mM EDTA; 0.1% Triton X-100; 1 mM
dithiothreitol; 1 mM phenylmethylsulfonyl fluoride; 10 µg of
pepstatin per ml; 100 µg of aprotinin per ml), rocked for 1 h at
4°C and centrifuged at 12,000 × g for 5 min at
4°C. The supernatant was recovered and approximately
3.2 × 107 cpm was incubated in 400 µl of a buffer
containing 10 mM HEPES (pH 7.7), 250 mM NaCl, 0.25% Nonidet P-40, and
5 mM EDTA. Sequential immunoprecipitation with the myogenin monoclonal
antibody FD5 and the Sp1 antiserum (Santa Cruz Biotechnology) was
performed as previously described (34). For blocking
experiments, the Sp1 antiserum (5 µg) was incubated with 25 µg of a
peptide corresponding to amino acids 520 to 538 of Sp1 (Santa Cruz Biotechnology).
 |
RESULTS |
Formation of a muscle-specific multiprotein complex on the HCA
promoter.
Oligonucleotides spanning the CArG box, GC box, and E
box of the HCA promoter interact autonomously with their cognate
binding factors in C2C12 cell nuclear extracts. Nevertheless, the
affinity of the binding proteins for their individual DNA sites is
relatively low since most of the DNA probe remains in an unbound state
(12, 33). Because these three binding sites are each
required for expression from the HCA promoter, we have attempted to
determine whether or not the proteins bind simultaneously to the
promoter and whether their binding is independent or interactive. After the HCA promoter fragment encompassing nucleotides
126 to
16 was
incubated with C2C12 myotube nuclear extract, an EMSA revealed a slowly
migrating complex (Fig. 1A, lane 1). The
complex appears to be specific since its formation is inhibited by
excess copies of unlabeled promoter (lane 2). To begin to identify the
proteins present in the complex, we competed for binding with a series of oligonucleotides that bind either purified Sp1, MyoD, or SRF (see
Materials and Methods). Surprisingly, the inclusion in the binding
reactions of an oligonucleotide carrying a single GC-box, CArG-box, or
E-box sequence eliminated the formation of the retarded complex (Fig.
1B, lanes 2, 4, and 6). The DNA-binding specificity of the complex was
tested by using mutated CArG-box, GC-box, and E-box oligonucleotides in
competition experiments (Fig. 1B, lanes 3, 5, and 7). Unlike the
wild-type oligonucleotides, the mutated oligonucleotides (see
Materials and Methods) µCArG box, µGC box, and µE box fail
to compete for complex formation. The finding that oligonucleotides
bearing any one of three solitary binding sites can disrupt the complex
suggests that at least three proteins are engaged in its formation and
that the removal of any one of the three destabilizes the complex. The
HCA promoter fragment employed in this study is sufficient to direct
tissue-specific transcription in skeletal muscle cells but is inactive
in nonmuscle cells. To investigate whether the protein complex formed
on the HCA promoter is cell type specific, we employed nuclear extracts from muscle and nonmuscle cells by EMSA and found that the retarded complex is generated with C2C12 muscle cells but not with HeLa cell
nuclear extracts (Fig. 1C, lanes 1 and 2). Since HCA is expressed exclusively in differentiated myotubes and not in
undifferentiated myoblasts, we analyzed whether formation of the
shifted complex was differentially regulated in C2C12 myoblasts and
myotubes. Our results indicate that the presence of the complex
correlates with the activation of the endogenous HCA gene in
differentiated myotubes (Fig. 1C, lanes 3 and 4).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Formation of a muscle-specific protein complex on HCA
promoter. (A) EMSA analysis for binding of nuclear factors. Samples (10 µg) of C2C12 myotube nuclear extracts were employed with radiolabeled
HCA promoter fragment in the absence of specific competitor (lane 1)
and in the presence of a 50-fold molar excess of the unlabeled fragment
(lane 2). (B) Competition analysis. Nuclear extracts from C2C12
myotubes were assayed in the absence of specific competitor (lane 1)
and in the presence of a 100-fold molar excess of unlabeled synthetic
double-stranded oligonucleotides containing the following sequences:
the normal and mutated GC boxes (lanes 2 and 3), the normal and mutated
CArG boxes (lanes 4 and 5), the normal and mutated E boxes (lanes 6 and
7). (C) The shifted protein complex is cell type specific and
differentiation dependent. An EMSA of the radiolabeled HCA promoter
incubated with equal amounts of nuclear extracts from HeLa (lane 1) and
from C2C12 myotubes (lane 2) cells is shown. Equivalent amounts of
nuclear extracts derived from either undifferentiated C2C12 myoblasts
(MB, lane 3) or differentiated myotubes (MT, lane 4) were analyzed by
EMSA with the radiolabeled HCA promoter.
|
|
Identification of Sp1, SRF, and myogenin as components of the
multiprotein complex.
The EMSA results imply, but do not directly
demonstrate, that the multiprotein complex contains Sp1, myogenic bHLH,
and SRF proteins. To directly identify components of the multiprotein complex formed on the HCA promoter, we performed a preparative EMSA and
subjected the proteins eluted from the shifted complex to Western blot
analysis. As shown in Fig. 2, antibodies
against Sp1 (A), myogenin (B), and SRF (C), but not unrelated
antibodies (data not shown), reacted with proteins eluted from the
complex that migrated with the same mobility as the corresponding in
vitro-synthesized proteins. To eliminate the possibility of
coincidental protein migration into the preparative gels that was
not dependent on specific interactions with the DNA probe, a
control experiment was performed in which nuclear proteins were
electrophoresed under similar conditions but in the absence of the DNA
probe. Under these experimental conditions we failed to detect any
specific reaction between eluted proteins and the antibodies against
Sp1, SRF, and myogenin (data not shown). These results are the first direct evidence that Sp1, SRF, and myogenin are all part of the multiprotein complex that occupies the HCA promoter.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of the protein components of the shifted
complex. (A) Proteins eluted from the shifted complex (Fig. 1, lane 1)
were subjected to Western blotting with a polyclonal rabbit
antiserum raised against Sp1 protein. Lanes: 1, in vitro-synthesized
SRF protein; 2, recombinant Sp1 protein; 3, blank lane; and 4, proteins
eluted from the shifted complex. (B) Complex proteins were subjected to
Western blotting with a monoclonal antibody against myogenin (FD5).
Lanes: 1, in vitro-synthesized myogenin; 2, recombinant Sp1 protein; 3, blank lane; and 4, proteins eluted from the shifted complex. (C)
Complex proteins were subjected to Western blotting with polyclonal
rabbit antiserum raised against SRF protein. Lanes: 1, in
vitro-synthesized SRF protein; 2, recombinant Sp1 protein; 3, blank
lane; and 4, proteins eluted from the complex.
|
|
In vitro assembly of a protein complex on the HCA promoter by
purified MyoD, E12, SRF, and Sp1.
The data reported in Fig. 1 and
2 indicate that the HCA promoter is occupied by a protein complex
containing myogenic bHLH, SRF, and Sp1 and that the presence of each
individual protein is required for the integrity of the complex. We
attempted to reconstitute the multiprotein complex by assembling in
vitro the individual, purified proteins on the HCA promoter. Since the
myogenic bHLH increase their DNA binding ability upon interaction with E proteins and require heterodimerization with E12 for functional activity (17), E12 was included in the experiments described below. At relatively low protein concentrations, MyoD, E12, SRF, or Sp1
is incapable of individually binding to the HCA promoter (Fig.
3A, lanes 1 to 4). Similarly, the
MyoD/Sp1 and MyoD-SRF combinations fail to interact with the HCA
probe (lanes 7 and 8), whereas heterodimers of MyoD and E12 are readily
observed (lane 6). Only when the four individual proteins were present in the binding reaction was the formation of a slowly migrating complex
evident (lane 11). This complex was absent in any of the reactions
containing other protein combinations (lanes 5 to 9). The results of
these experiments suggest that myogenic bHLH (MyoD), E12, SRF, and Sp1
can form a protein complex on the HCA if they are simultaneously
present. As indicated by the competition experiments shown in Fig. 1B,
preventing binding of any of the three factors to the HCA results in
abolishment of the complex. To investigate whether the multiprotein
complex described in Fig. 1 and that described in this paragraph (Fig.
3A) share similar properties, competition experiments were performed.
After assembling MyoD, E12, SRF, and Sp1 on the HCA promoter, molar
excess of oligonucleotides spanning the GC box (Sp1 binding), CArG box
(SRF binding), and E box (MyoD/E12 binding) of the HCA promoter
were added to the binding reactions (Fig. 3B). Inclusion of any of the
three oligonucleotides interfered with the formation of the shifted
complex (lanes 2 to 4), whereas mutant oligonucleotides that no
longer interact with their respective binding proteins (µGC
box, µCArG box, and µE box) left the complex unaltered (lanes
5 to 7). Similar experiments were conducted with HCA promoter
fragments bearing subtle mutations in the GC, CArG, or E box (see
below) and purified MyoD, E12, Sp1, and SRF proteins. Mutations of any
of the three binding sites interfered with complex assembly (Fig. 3C,
lanes 2 to 4), confirming our previous findings (Fig. 1) that their
integrity is a prerequisite for complex formation. The experiments
illustrated in Fig. 3 suggest that the affinity of the individual
transcriptional activators for the HCA promoter is weak and show that a
protein complex that displays higher affinity is assembled solely in
the presence of a defined protein combination.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
In vitro assembly of a protein complex on the HCA
promoter by purified MyoD, E12, SRF, and Sp1. (A) EMSA was performed
with the radiolabeled HCA promoter with different combinations of
GST-MyoD, E12, His-SRF, and Sp1 purified proteins. The arrow points to
a shifted complex containing MyoD-E12 heterodimers. The asterisk
indicates a low-mobility complex observed exclusively in the presence
of MyoD, E12, SRF, and Sp1. (B) Competition analysis of the
low-mobility complex described in panel A. Oligonucleotides
containing the GC, CArG, or E box but not their respective mutated
sequences compete for the formation of the low-mobility complex. (C)
EMSA was performed with radiolabeled HCA promoter fragments derived
from the HCA wild type and the HCA-µGC, HCA-CArGM, and
HCA-E-sm constructs (see Materials and Methods) and purified
MyoD, E12, SRF, and Sp1 proteins. The low-mobility complex described in
panel A and indicated by the asterisk is observed when the HCA wild
type (lane 1) but not the HCA mutants (lanes 2 to 4) are employed.
|
|
Refining the CArG- and E-box mutations associated with HCA promoter
inactivation.
The mutations introduced in the CArG and E boxes and
investigated in the present study, as well as in previous studies,
extend outside the minimal binding sites required for SRF and
MyoD-myogenin. This raises the question of whether promoter
inactivation might be the consequence of lack of binding of additional,
yet uncharacterized proteins that might recognize sequences
surrounding the CArG and E boxes. To stringently evaluate the
individual contributions of the single trans-acting factors,
finer mutations were created. The CArG-box sequence of the HCA promoter
was altered to create the CArG-M motif (see Materials and Methods). The
CArG-M sequence is recognized by the yeast SRF homolog MCM1 but not by
mammalian SRF (13). Similarly, the E box of the HCA was
slightly modified (CAACTG > TAACTA) to generate the E-sm
box. The HCA promoter bearing either the CArG-M (HCA-CArG-M) or
the E-sm (HCA-E-sm) boxes was tested in a
transient-transfection assay and found to be inactive in muscle cells,
thus confirming the findings that SRF and myogenic bHLH proteins are
essential for promoter activation (Table
1). Oligonucleotides for the CArG-M and
E-sm boxes were tested by EMSA and found to be unable to
bind purified SRF and MyoD-myogenin, respectively. They
were also not able to compete for the formation of the muscle-specific
multiprotein complex analyzed in the experiments reported in Fig. 1
(data not shown).
Lack of binding by Sp1 and myogenic bHLH proteins correlates with
the absence of the multiprotein complex and with inactivation of
the HCA promoter.
The importance of the CArG box for the
activation of the cardiac
-actin promoters (20,
23; the present study) for muscle-specific expression and for
expression in general has been extensively demonstrated (reference
30 and references therein), and the recent finding
that SRF interacts with myogenic bHLH proteins might provide a
molecular explanation for this phenomenon (11). Nevertheless, our data (Fig. 1) (33) indicate that the
presence of the CArG and E boxes is insufficient for promoter activity and complex formation. In fact, deletion or mutation of the GC box is
also deleterious for HCA promoter function and the results shown in
Fig. 2 clearly demonstrate that Sp1 is part of the multiprotein complex. To further address the role of Sp1, SRF, and the myogenic bHLH
in controlling the activation of the HCA promoter, we investigated whether formation of the multiprotein complex correlates with HCA
promoter activity. The HCA promoter constructs described in Table 1 and
bearing an individually mutated GC, CArG, or E box were employed in
both functional and DNA binding assays. Mutations of the GC, CArG, or E
box extinguish the transcriptional activity of the HCA promoter in
muscle cells (Fig. 4A). Consistent with this observation, EMSA conducted with C2C12 nuclear extracts indicates that the multiprotein complex is not formed when HCA promoter probes
containing a mutated GC, CArG, or E-box are used in EMSA (Fig. 4B).
Our findings strongly correlate proper function of the HCA promoter
with the presence of the multiprotein complex and the binding of Sp1,
SRF, and myogenic bHLH proteins.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
The presence of the protein complex correlates with the
HCA promoter activity in muscle cells. (A) Schematic representation of
the HCA promoter fragments used in transfection and EMSA assays.
Mutations introduced in the GC, CArG, and E boxes are in lowercase
letters. The relative promoter activity is expressed as a percentage
and refers to the luciferase activities generated by the different HCA
constructs when transiently transfected in C2C12 cells. The numbers in
parenthesis represent standard deviations. (B) Gel retardation analysis
for binding of nuclear factors from C2C12 cells with different HCA
promoter fragments. Nuclear extract from C2 myotubes was employed with
radiolabeled fragment of the wild type (wt) or HCA promoter containing
mutated GC box (µGC), CarG box (CArG-M), or E box
(E-sm).
|
|
Evidence for specific protein-protein interactions: myogenic bHLH
proteins form heterodimeric complexes with Sp1 both in vitro and in
vivo.
The preceding data raise the possibility that Sp1 and the
myogenic bHLH might directly interact. To test for such protein-protein contacts, GST-myogenin immobilized on agarose beads was reacted with in
vitro-synthesized Sp1. As shown in Fig.
5A, GST-myogenin, but not the GST alone,
retained Sp1 (lanes 3 and 4). We proceeded to investigate whether the
in vitro interaction between Sp1 and the myogenic bHLH proteins
could be recapitulated in the cell. To this end, we performed a
two-hybrid system assay employing the Sp1 coding regions fused to the
DNA binding domain of Gal4 (Gal-Sp1) and MyoD grafted to the viral
activator VP16 (VP16-MyoD). C3H10T1/2 fibroblasts were transiently
transfected with an indicator plasmid bearing multimerized copies
of Gal4 binding sites driving expression of the luciferase gene
(UASx4-tk-LUC). As shown in Fig. 5B, cotransfection of the Gal-Sp1 and
VP16-MyoD plasmids caused a transcriptional activation of
the indicator construct that was approximately 10-fold stronger than
that provoked by the individual Gal-Sp1 or VP16-MyoD plasmid and of
similar magnitude to that displayed by Gal-E12 and VP16-MyoD. This
indicates that a physical association between Sp1 and MyoD
takes place within the cell.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Sp1 interact with two myogenic bHLH proteins, myogenin
and MyoD, in vitro and in vivo. (A) The GST protein (lane 3) or the
GST-myogenin (lane 4) were mixed with 10 µl of reticulocyte lysate
programmed by Sp1-encoding RNA and supplemented with
[35S]methionine and then processed and resolved on a 10%
denaturing polyacrylamide gel. Lane 2 shows the input radiolabeled Sp1.
(B) C3H10T1/2 cells were transiently transfected with the UASx4-tk-LUC
indicator plasmid and the Gal-Sp1, Gal-E12, and VP16-MyoD activators.
To correct for transfection efficiency, the CMV-lacZ plasmid
was added to the transfection reaction. After 48 h, cells were
processed and luciferase and -galactosidase assays were performed on
an automated microtiter plate luminometer (MLX; Dynex Technology). Bars
indicate standard deviations. (C) Nuclear extracts derived from
metabolically radiolabeled C2C12 cells were incubated with unblocked
(lane 2) or blocked (lane 3) Sp1 antiserum in low-stringency
conditions. Double immunoprecipitation with -myogenin antibody,
followed by unblocked (lane 5) or blocked (lane 6) Sp1 antiserum in
high-stringency conditions, with radiolabeled C2C12 nuclear extracts
reveals that the protein associated with myogenin is bona fide Sp1.
Lane 4 shows radiolabeled in vitro-synthesized Sp1.
|
|
While strongly suggesting that the overexpressed Sp1 and myogenic bHLH
can interact in the cell, the two-hybrid system experiments
do not
prove that endogenous Sp1 and myogenic bHLH proteins are
naturally
associated in muscle cells. To address this point, we
performed a
double immunoprecipitation experiment with metabolically
radiolabeled
C2C12 myotube nuclear extracts and antibodies directed
against myogenin
and Sp1 (Fig.
5C). Under low-salt conditions,
the Sp1 antiserum
immunoprecipitates a major band migrating at
~95 kDa and several
other minor bands (lane 2). The Sp1 antiserum
failed to
immunoprecipitate the ~95-kDa band, but not the other
bands,
when the reaction was blocked with the immunogen, a peptide
spanning
amino acids 520 to 538 of Sp1 (lane 3). Furthermore,
Sp1
synthesized in vitro comigrates with the major band precipitated
by the
Sp1 antiserum (lane 4). Altogether, these data indicate
that the
~95-kDa band represents a polypeptide immunologically
indistinguishible from and of the same molecular size as Sp1.
C2C12 nuclear extracts were sequentially immunoprecipitated first
with
an antimyogenin antibody in low-salt conditions and in a
second, more
stringent step, with an Sp1 antiserum to determine
whether Sp1 is
associated with the immunoprecipitated myogenin.
Indeed, the ~95-kDa
band corresponding to bona fide Sp1 was detected
according to the
sequential immunoprecipitation protocol (lane
5). Blocking the Sp1
antiserum with the immunogenic peptide (lane
6) or substituting the
myogenin antibody with a preimmune serum
(data not shown) prevented
immunoprecipitation of the ~95-kDa
band. These results indicate that
the protein immunoprecipitated
by the combination of myogenin and Sp1
antibodies is Sp1 and provide
evidence that endogenous Sp1 and myogenin
directly associate in
C2C12 muscle
cells.
A region encompassing the DNA-binding domain of Sp1 and the HLH
domain of myogenin mediate protein-protein interactions.
Sp1
specifically interacts with DNA regions containing defined GC boxes to
activate transcription (8). Distinct regions of this protein
have been shown to direct DNA binding and transcriptional activation.
In particular, the C-terminal 168 amino acids of Sp1 contain three
zinc-finger structures required for binding to the GC box
(13) (see Fig. 6B). Two major
transactivation domains rich in serine-threonine and glutamine
residues, respectively, are located within the N-terminal 478 amino
acids of Sp1 (15). To define the regions of Sp1 involved in
contacting a myogenic bHLH protein, truncated versions of Sp1 lacking
either the transactivation or the DNA binding domains were employed in
affinity selection with myogenin (Fig. 6A). A total of 236 amino acids
located at the C terminus and containing the DNA binding domain of Sp1
were efficiently retained on GST-myogenin-coated agarose beads
(lane 3). In contrast, the N-terminal 539 amino acids spanning
both transactivation domains of Sp1 failed to interact with
GST-myogenin (lane 4). These results indicate that the regions of
Sp1 located at the C terminus and containing the three DNA-recognizing
zinc fingers are necessary and sufficient for binding to myogenin.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
A region of Sp1 spanning the DNA-binding domain and the
HLH domain of myogenin mediate protein interactions. (A) Wild-type and
different truncated version of radiolabeled Sp1 were affinity purified
on GST-myogenin-coated agarose beads. The right panel shows input
proteins. (B) Schematic representation of the Sp1 polypeptides employed
in (A). Regions rich in serine and threonine (S/T), glutamic acid (Q),
and the zinc finger motif are indicated at the top. (C) The C-terminal
168 amino acids of Sp1 fused to GST were reacted with several versions
of radiolabeled myogenin. The left panel indicates the input proteins.
The myogenin N and C proteins were synthesized by using the
myogenin DM4-79 and DM158-224 constructs described elsewhere
(35). (D) Schematic representation of the myogenin deletions
employed in the experiments reported in panel C.
|
|
To confirm further that Sp1 interacts with myogenin and to define the
regions of myogenin involved in contacting Sp1, the
C-terminal 168 amino acids of Sp1 were fused to GST (GST-Sp1C168)
and used in affinity
selection experiments with different truncated
versions of radiolabeled
myogenin. The data reported in Fig.
6C
show that GST-Sp1C168
interacts with myogenin. Removal of the
HLH domain of myogenin
prevented interaction with GST-Sp1C168,
whereas deletions of
either the N or the C terminus had no effect,
indicating that the HLH
domain of myogenin is engaged in contacting
the carboxyl terminus of
Sp1.
 |
DISCUSSION |
In this study we describe the formation of a single major
DNA-binding complex on the HCA. This muscle-specific complex contains myogenic bHLH, Sp1, and SRF. Their simultaneous presence is essential for both complex formation and transcriptional activation of the promoter in muscle cells. In fact, competition experiments conducted with individual DNA-binding sites specific for the transcriptional activators indicate that the absence of any of the three proteins (i.e., MyoD-myogenin, Sp1, and SRF) is incompatible with promoter occupancy and therefore with transcriptional activation. When the HCA
promoter DNA segments bearing single site mutations were used as a
probe in EMSA experiments, we could not detect any complexes of
intermediate mobility. If any of the three transcription factors binds
to the HCA promoter independently or pairwise, we would have expected
to observe complexes of intermediate electrophoretic mobility with
two rather than three transcription factors. Thus, this protein complex
appears to be formed in an all-or-none fashion with the binding of SRF,
Sp1, and myogenic bHLH proteins to the HCA promoter being mutually
dependent. Our data do not exclude the likelihood that other proteins,
including E proteins, are involved in the formation of the multiprotein
complex. Indeed, we have assembled a protein complex on the HCA
promoter by using highly purified MyoD, E12, SRF, and Sp1.
E proteins are most likely a component of multiprotein
complex observed with nuclear extracts since the majority of endogenous MyoD is complexed with E12-E47 in muscle cell extracts (17). Even though we have not formally demonstrated that the multiprotein complex formed with muscle cell extract corresponds to the complex assembled by recombinant MyoD, E12, SRF, and Sp1, they both share several properties. Both complexes are formed in an all-or-none fashion
by myogenic bHLH, SRF, and Sp1 on the HCA promoter. Furthermore, competition with individual DNA-binding sites for the
transcriptional activators engaged in the complex specifically
abolishes the formation of both complexes. Other transcriptional
activators and coactivators may also be present, including
MEF2 that can interact with MyoD (16, 24) and the
coactivators p300 (9) and PCAF (40), whose
interactions with MyoD are required for MyoD transcriptional activity
(32). The HCA gene product is present exclusively in differentiated myotubes despite the fact that SRF, Sp1, and MyoD are
already synthesized in undifferentiated myoblasts. This raises the question of how the prevention of premature muscle gene
expression is achieved. Our study indicates that assembly of
multiprotein complexes might be the switch for HCA activation in
particular and for muscle gene expression in general. In fact, a
similar finding has been reported for the MCK gene (26). The
presence of a negative regulator of DNA binding such as Id
(3) or the absence of a hypothetical assembly factor might
mechanistically explain the lack of complex formation in myoblasts.
The potential involvement of protein-protein interactions in the
genesis of transcription complexes present on muscle-specific promoters
was also suggested by the observation that SRF and myogenin can
interact (11). While the interaction of SRF and myogenin might well be involved in the formation of the multiprotein complex observed on the HCA promoter, it was evident from previous data that additional proteins must be involved. We now show that Sp1 interacts with the myogenic bHLH proteins in vitro and in a
mammalian two-hybrid system. Furthermore, endogenous Sp1 is
coimmunoprecipitated with MyoD from extracts derived from
muscle cells. Physical interaction of Sp1 and myogenic bHLH
might help to explain the results obtained in Drosophila
melanogaster-derived Schneider cells, where Sp1 and MyoD
synergistically activated the HCA promoter (33) in the
presence of endogenous SRF-like molecules (28).
Our results, combined with the observation that GC and E boxes
are often juxtaposed in numerous muscle-specific enhancers, suggest the
possibility that protein-protein interactions between Sp1 and the
myogenic bHLH play a key role in the formation of transcriptional
complexes on muscle-specific regulatory regions. It is likely that the
functional synergism and physical interaction properties of the
proteins described here operate also for the regulation of
additional muscle genes controlled by the same set of proteins. We note
that several muscle-specific genes are positively regulated by a
combination of Sp1 and myogenic bHLH proteins, including the regulatory
regions of HCA (33), troponin I (19),
and
subunits of the acetylcholine receptor (4, 37), muscle sarcoplasmic reticulum Ca2+-ATPase gene (2), and
muscle phosphofructokinase P2 (18). Our findings support the
hypothesis that the regulation operated by Sp1 and myogenic bHLH on the
HCA promoter is a general mechanism that applies to many genes
expressed in skeletal muscle cells.
 |
ACKNOWLEDGMENTS |
Sarah Buranen and Terry Saluna provided excellent technical
assistance, and R. Evans, E. Olson, R. Prywes, R. Tjian, and W. Wright
generously provided critical biological materials.
Part of this work was done while E.B. was a Research Fellow of the
American Heart Association, Greater Los Angeles Affiliate. This work
was supported in parts by grants from the NIH (to L.K.) and the
American Heart Association, Greater Los Angeles Affiliate (to L.K. and
to V.S.). Y.H. was supported by an Initial Investigatorship Award
(1104-FI1) from the American Heart Association, Greater Los Angeles Affiliate.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute
for Genetic Medicine, IGM 240, 2250 Alcazar St., Los
Angeles, CA 90033. Phone: (323) 442-2758. Fax: (323) 442-2764. E-mail:
sartorel{at}zygote.hsc.usc.edu.
Present address: Molecular Neurobiology, Children's Hospital of
Orange County, Orange, Calif.
 |
REFERENCES |
| 1.
|
Andres, V.,
S. Fisher,
P. Wearsch, and K. Walsh.
1995.
Regulation of Gax homeobox gene transcription by a combination of positive factors including myocyte-specific enhancer factor 2.
Mol. Cell. Biol.
15:4272-4281[Abstract].
|
| 2.
|
Baker, D. L.,
V. Dave,
T. Reed, and M. Periasamy.
1996.
Multiple Sp1 binding sites in the cardiac/slow twitch muscle sarcoplasmic reticulum Ca2+-ATPase gene promoter are required for expression in Sol8 muscle cells.
J. Biol. Chem.
271:5921-5928[Abstract/Free Full Text].
|
| 3.
|
Benezra, R.,
R. L. Davis,
D. Lockshon,
D. L. Turner, and H. Weintraub.
1990.
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins.
Cell
61:49-59[Medline].
|
| 4.
|
Bessereau, J. L.,
D. Mendelzon,
C. LePoupon,
M. Fiszman,
J. P. Changeux, and J. Piette.
1993.
Muscle-specific expression of the acetylcholine receptor alpha-subunit gene requires both positive and negative interactions between myogenic factors, Sp1 and GBF factors.
EMBO J.
12:443-449[Medline].
|
| 5.
|
Boxer, L. M.,
R. Prywes,
R. G. Roeder, and L. Kedes.
1989.
The sarcomeric actin CArG-binding factor is indistinguishable from the c-fos serum response factor.
Mol. Cell. Biol.
9:515-522[Abstract/Free Full Text].
|
| 6.
|
Brennan, T. J., and E. N. Olson.
1990.
Myogenin resides in the nucleus and acquires high affinity for a conserved enhancer element on heterodimerization.
Genes Dev.
4:582-595[Abstract/Free Full Text].
|
| 7.
|
Dignam, J. D.,
P. L. Martin,
B. S. Shastry, and R. G. Roeder.
1983.
Eukaryotic gene transcription with purified components.
Methods Enzymol.
101:582-598[Medline].
|
| 8.
|
Dynan, W. S., and R. Tjian.
1983.
Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II.
Cell
32:669-680[Medline].
|
| 9.
|
Eckner, R.,
M. E. Ewen,
D. Newsome,
M. Gerdes,
J. A. DeCaprio,
J. B. Lawrence, and D. M. Livingston.
1994.
Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor.
Genes Dev.
8:869-884[Abstract/Free Full Text].
|
| 10.
|
Eckner, R.,
T. P. Yao,
E. Oldread, and D. M. Livingston.
1996.
Interaction and functional collaboration of p300/CBP and bHLH proteins in muscle and B-cell differentiation.
Genes Dev.
10:2478-2490[Abstract/Free Full Text].
|
| 11.
|
Groisman, R.,
H. Masutani,
M. P. Leibovitch,
P. Robin,
I. Soudant,
D. Trouche, and B. A. Harel.
1996.
Physical interaction between the mitogen-responsive serum response factor and myogenic basic-helix-loop-helix proteins.
J. Biol. Chem.
271:5258-5264[Abstract/Free Full Text].
|
| 12.
|
Gustafson, T. A., and L. Kedes.
1989.
Identification of multiple proteins that interact with functional regions of the human cardiac alpha-actin promoter.
Mol. Cell. Biol.
9:3269-3283[Abstract/Free Full Text].
|
| 13.
|
Hill, C. S.,
R. Marais,
S. John,
J. Wynne,
S. Dalton, and R. Treisman.
1993.
Functional analysis of a growth factor-responsive transcription factor complex.
Cell
73:395-406[Medline].
|
| 14.
|
Johnson, J. L., and A. McLachlan.
1994.
Novel clustering of Sp1 transcription factor binding sites at the transcription initiation site of the human muscle phosphofructokinase P1 promoter.
Nucleic Acids Res.
22:5085-5092[Abstract/Free Full Text].
|
| 15.
|
Kadonaga, J. T.,
A. J. Courey,
J. Ladika, and R. Tjian.
1988.
Distinct regions of Sp1 modulate DNA binding and transcriptional activation.
Science
242:1566-1570[Abstract/Free Full Text].
|
| 16.
|
Kaushal, S.,
J. W. Schneider,
B. Nadal-Ginard, and V. Mahdavi.
1994.
Activation of the myogenic lineage by MEF2A, a factor that induces and cooperates with MyoD.
Science
266:1236-1240[Abstract/Free Full Text].
|
| 17.
|
Lassar, A. B.,
R. L. Davis,
W. E. Wright,
T. Kadesch,
C. Murre,
A. Voronova,
D. Baltimore, and H. Weintraub.
1991.
Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo.
Cell
66:305-315[Medline].
|
| 18.
|
Le, H. B.,
P. A. Vaisanen,
J. L. Johnson,
A. K. Raney, and A. McLachlan.
1994.
Regulation of transcription from the human muscle phosphofructokinase P2 promoter by the Sp1 transcription factor.
DNA Cell. Biol.
13:473-485[Medline].
|
| 19.
|
Lin, H.,
K. E. Yutzey, and S. F. Konieczny.
1991.
Muscle-specific expression of the troponin I gene requires interactions between helix-loop-helix muscle regulatory factors and ubiquitous transcription factors.
Mol. Cell. Biol.
11:267-280[Abstract/Free Full Text].
|
| 20.
|
Minty, A., and L. Kedes.
1986.
Upstream regions of the human cardiac actin gene that modulate its transcription in muscle cells: presence of an evolutionarily conserved repeated motif.
Mol. Cell. Biol.
6:2125-2136[Abstract/Free Full Text].
|
| 21.
|
Miwa, T., and L. Kedes.
1987.
Duplicated CArG box domains have positive and mutually dependent regulatory roles in expression of the human alpha-cardiac actin gene.
Mol. Cell. Biol.
7:2803-2813[Abstract/Free Full Text].
|
| 22.
|
Miwa, T.,
L. M. Boxer, and L. Kedes.
1987.
CArG boxes in the human cardiac alpha-actin gene are core binding sites for positive trans-acting regulatory factors.
Proc. Natl. Acad. Sci. USA
84:6702-6706[Abstract/Free Full Text].
|
| 23.
|
Mohun, T. J.,
M. V. Taylor,
N. Garrett, and J. B. Gurdon.
1989.
The CArG promoter sequence is necessary for muscle-specific transcription of the cardiac actin gene in Xenopus embryos.
EMBO J.
8:1153-1161[Medline].
|
| 24.
|
Molkentin, J. D.,
B. L. Black,
J. F. Martin, and E. N. Olson.
1995.
Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins.
Cell
83:1125-1136[Medline].
|
| 25.
|
Molkentin, J. D., and E. N. Olson.
1996.
Defining the regulatory networks for muscle development.
Curr. Opin. Genet. Dev.
6:445-453[Medline].
|
| 26.
|
Mueller, P. R., and B. Wold.
1989.
In vivo footprinting of a muscle-specific enhancer by ligation mediated PCR.
Science
246:780-786[Abstract/Free Full Text].
|
| 27.
|
Mutero, A.,
S. Camp, and P. Taylor.
1995.
Promoter elements of the mouse acetylcholinesterase gene. Transcriptional regulation during muscle differentiation.
J. Biol. Chem.
270:1866-1872[Abstract/Free Full Text].
|
| 28.
|
Norman, C.,
M. Runswick,
R. Pollock, and R. Treisman.
1988.
Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element.
Cell
55:989-1003[Medline].
|
| 29.
|
Olson, E. N.,
M. Perry, and R. A. Schulz.
1995.
Regulation of muscle differentiation by the MEF2 family of MADS box transcription factors.
Dev. Biol.
172:2-14[Medline].
|
| 30.
|
Phan-Dinh-Tuy, F.,
D. Tuil,
F. Schweighoffer,
C. Pinset,
A. Kahn, and A. Minty.
1988.
The "CC.Ar.GG" box. A protein-binding site common to transcription-regulatory regions of the cardiac actin, c-fos and interleukin-2 receptor genes.
Eur. J. Biochem.
173:507-515[Medline].
|
| 31.
|
Puri, P. L.,
M. L. Avantaggiati,
C. Balsano,
N. Sang,
A. Graessmann,
A. Giordano, and M. Levrero.
1997.
p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription.
EMBO J.
16:369-383[Medline].
|
| 32.
|
Puri, P. L.,
V. Sartorelli,
X.-J. Yang,
Y. Hamamori,
L. Kedes,
A. Graessmann,
Y. Nakatani, and M. Levrero.
1997.
Differential roles of p300 and PCAF acetyltransferases in muscle differentiation.
Mol. Cell
1:35-45[Medline].
|
| 33.
|
Sartorelli, V.,
K. A. Webster, and L. Kedes.
1990.
Muscle-specific expression of the cardiac alpha-actin gene requires MyoD1, CArG-box binding factor, and Sp1.
Genes Dev.
4:1811-1822[Abstract/Free Full Text].
|
| 34.
|
Sartorelli, V.,
J. Huang,
H. Hamamori, and L. Kedes.
1997.
Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS box of MEF2C.
Mol. Cell. Biol.
17:1010-1026[Abstract].
|
| 35.
|
Schwarz, J. J.,
T. Chakraborty,
J. Martin,
J. M. Zhou, and E. N. Olson.
1992.
The basic region of myogenin cooperates with two transcription activation domains to induce muscle-specific transcription.
Mol. Cell. Biol.
12:266-275[Abstract/Free Full Text].
|
| 36.
|
Taylor, M.,
R. Treisman,
N. Garrett, and T. Mohun.
1989.
Muscle-specific (CArG) and serum-responsive (SRE) promoter elements are functionally interchangeable in Xenopus embryos and mouse fibroblasts.
Development
106:67-78[Abstract].
|
| 37.
|
Walke, W.,
G. Xiao, and D. Goldman.
1996.
Identification and characterization of a 47 base pair activity-dependent enhancer of the rat nicotinic acetylcholine receptor delta-subunit promoter.
J. Neurosci.
16:3641-3651[Abstract/Free Full Text].
|
| 38.
|
Weintraub, H.,
R. Davis,
D. Lockshon, and A. B. Lassar.
1990.
MyoD binds cooperatively to two sites in a target enhancer sequence: occupancy of two sites is required for activation.
Proc. Natl. Acad. Sci. USA
87:5623-5627[Abstract/Free Full Text].
|
| 39.
|
Weintraub, H.,
R. Davis,
S. Tapscott,
M. Thayer,
M. Krause,
R. Benezra,
T. K. Blackwell,
D. Turner,
R. Rupp,
S. Hollenberg, et al.
1991.
The myoD gene family: nodal point during specification of the muscle cell lineage.
Science
251:761-766[Abstract/Free Full Text].
|
| 40.
|
Yang, X. J.,
V. V. Ogryzko,
J. Nishikawa,
B. H. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.
Nature
382:319-324[Medline].
|
| 41.
|
Yuan, W.,
G. Condorelli,
M. Caruso,
A. Felsani, and A. Giordano.
1996.
Human p300 protein is a coactivator for the transcription factor MyoD.
J. Biol. Chem.
271:9009-9013[Abstract/Free Full Text].
|
| 42.
|
Zhu, H.,
V. Joliot, and R. Prywes.
1994.
Role of TFIIF in SRF-activated transcription.
J. Biol. Chem.
269:3489-3497[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 1999, p. 2577-2584, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rettino, A., Rafanelli, F., Genovese, G., Goracci, M., Cifarelli, R. A., Cittadini, A., Sgambato, A.
(2009). Identification of Sp1 and GC-boxes as transcriptional regulators of mouse Dag1 gene promoter. Am. J. Physiol. Cell Physiol.
297: C1113-C1123
[Abstract]
[Full Text]
-
Li, D., Niu, Z., Yu, W., Qian, Y., Wang, Q., Li, Q., Yi, Z., Luo, J., Wu, X., Wang, Y., Schwartz, R. J., Liu, M.
(2009). SMYD1, the myogenic activator, is a direct target of serum response factor and myogenin. Nucleic Acids Res
0: gkp773v1-gkp773
[Abstract]
[Full Text]
-
Meadows, S. M., Warkman, A. S., Salanga, M. C., Small, E. M., Krieg, P. A.
(2008). The myocardin-related transcription factor, MASTR, cooperates with MyoD to activate skeletal muscle gene expression. Proc. Natl. Acad. Sci. USA
105: 1545-1550
[Abstract]
[Full Text]
-
Ray, S. K., Leiter, A. B.
(2007). The Basic Helix-Loop-Helix Transcription Factor NeuroD1 Facilitates Interaction of Sp1 with the Secretin Gene Enhancer. Mol. Cell. Biol.
27: 7839-7847
[Abstract]
[Full Text]
-
Ugarte, G., Brandan, E.
(2006). Transforming Growth Factor beta (TGF-beta) Signaling Is Regulated by Electrical Activity in Skeletal Muscle Cells: TGF-beta TYPE I RECEPTOR IS TRANSCRIPTIONALLY REGULATED BY MYOTUBE EXCITABILITY. J. Biol. Chem.
281: 18473-18481
[Abstract]
[Full Text]
-
Tang, H., Veldman, M. B., Goldman, D.
(2006). Characterization of a Muscle-specific Enhancer in Human MuSK Promoter Reveals the Essential Role of Myogenin in Controlling Activity-dependent Gene Regulation. J. Biol. Chem.
281: 3943-3953
[Abstract]
[Full Text]
-
Kim, C.-H., Xiong, W. C., Mei, L.
(2005). Inhibition of MuSK Expression by CREB Interacting with a CRE-Like Element and MyoD. Mol. Cell. Biol.
25: 5329-5338
[Abstract]
[Full Text]
-
Tapscott, S. J.
(2005). The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Development
132: 2685-2695
[Abstract]
[Full Text]
-
Lemonnier, M., Buckingham, M. E.
(2004). Characterization of a Cardiac-specific Enhancer, Which Directs {alpha}-Cardiac Actin Gene Transcription in the Mouse Adult Heart. J. Biol. Chem.
279: 55651-55658
[Abstract]
[Full Text]
-
Powell, L. M., zur Lage, P. I., Prentice, D. R. A., Senthinathan, B., Jarman, A. P.
(2004). The Proneural Proteins Atonal and Scute Regulate Neural Target Genes through Different E-Box Binding Sites. Mol. Cell. Biol.
24: 9517-9526
[Abstract]
[Full Text]
-
Broussard, S. R., McCusker, R. H., Novakofski, J. E., Strle, K., Shen, W. H., Johnson, R. W., Dantzer, R., Kelley, K. W.
(2004). IL-1{beta} Impairs Insulin-Like Growth Factor I-Induced Differentiation and Downstream Activation Signals of the Insulin-Like Growth Factor I Receptor in Myoblasts. J. Immunol.
172: 7713-7720
[Abstract]
[Full Text]
-
Kolbe, D., Taylor, J., Elnitski, L., Eswara, P., Li, J., Miller, W., Hardison, R., Chiaromonte, F.
(2004). Regulatory Potential Scores From Genome-Wide Three-Way Alignments of Human, Mouse, and Rat. Genome Res
14: 700-707
[Abstract]
[Full Text]
-
Guo, C. S., Degnin, C., Fiddler, T. A., Stauffer, D., Thayer, M. J.
(2003). Regulation of MyoD Activity and Muscle Cell Differentiation by MDM2, pRb, and Sp1. J. Biol. Chem.
278: 22615-22622
[Abstract]
[Full Text]
-
Azmi, S., Sun, H., Ozog, A., Taneja, R.
(2003). mSharp-1/DEC2, a Basic Helix-Loop-Helix Protein Functions as a Transcriptional Repressor of E Box Activity and Stra13 Expression. J. Biol. Chem.
278: 20098-20109
[Abstract]
[Full Text]
-
Zheng, J., Wu, J., Sun, Z.
(2003). An approach to identify over-represented cis-elements in related sequences. Nucleic Acids Res
31: 1995-2005
[Abstract]
[Full Text]
-
Meech, R., Makarenkova, H., Edelman, D. B., Jones, F. S.
(2003). The Homeodomain Protein Barx2 Promotes Myogenic Differentiation and Is Regulated by Myogenic Regulatory Factors. J. Biol. Chem.
278: 8269-8278
[Abstract]
[Full Text]
-
Sepulveda, J. L., Vlahopoulos, S., Iyer, D., Belaguli, N., Schwartz, R. J.
(2002). Combinatorial Expression of GATA4, Nkx2-5, and Serum Response Factor Directs Early Cardiac Gene Activity. J. Biol. Chem.
277: 25775-25782
[Abstract]
[Full Text]
-
Marinovic, A. C., Zheng, B., Mitch, W. E., Price, S. R.
(2002). Ubiquitin (UbC) Expression in Muscle Cells Is Increased by Glucocorticoids through a Mechanism Involving Sp1 and MEK1. J. Biol. Chem.
277: 16673-16681
[Abstract]
[Full Text]
-
Majesky, M. W.
(2002). Smooth Muscle-Specific Transcription Without a CArG Box Element. Circ. Res.
90: 628-630
[Full Text]
-
Layne, M. D., Yet, S.-F., Maemura, K., Hsieh, C.-M., Liu, X., Ith, B., Lee, M.-E., Perrella, M. A.
(2002). Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells. Circ. Res.
90: 728-736
[Abstract]
[Full Text]
-
Gong, X. Q., Li, L.
(2002). Dermo-1, a Multifunctional Basic Helix-Loop-Helix Protein, Represses MyoD Transactivation via the HLH Domain, MEF2 Interaction, and Chromatin Deacetylation. J. Biol. Chem.
277: 12310-12317
[Abstract]
[Full Text]
-
Calvo, S., Vullhorst, D., Venepally, P., Cheng, J., Karavanova, I., Buonanno, A.
(2001). Molecular Dissection of DNA Sequences and Factors Involved in Slow Muscle-Specific Transcription. Mol. Cell. Biol.
21: 8490-8503
[Abstract]
[Full Text]
-
Perkins, K. J., Burton, E. A., Davies, K. E.
(2001). The role of basal and myogenic factors in the transcriptional activation of utrophin promoter A: implications for therapeutic up-regulation in Duchenne muscular dystrophy. Nucleic Acids Res
29: 4843-4850
[Abstract]
[Full Text]
-
Dellow, K. A., Bhavsar, P. K., Brand, N. J., Barton, P. J.R.
(2001). Identification of novel, cardiac-restricted transcription factors binding to a CACC-box within the human cardiac troponin I promoter. Cardiovasc Res
50: 24-33
[Abstract]
[Full Text]
-
Johnson-Pais, T., Degnin, C., Thayer, M. J.
(2001). pRB induces Sp1 activity by relieving inhibition mediated by MDM2. Proc. Natl. Acad. Sci. USA
98: 2211-2216
[Abstract]
[Full Text]
-
Xing, W., Ram Sairam, M.
(2001). Characterization of Regulatory Elements of Ovine Follicle-Stimulating Hormone (FSH) Receptor Gene: The Role of E-Box in the Regulation of Ovine FSH Receptor Expression. Biol. Reprod.
64: 579-589
[Abstract]
[Full Text]
-
Belaguli, N. S., Sepulveda, J. L., Nigam, V., Charron, F., Nemer, M., Schwartz, R. J.
(2000). Cardiac Tissue Enriched Factors Serum Response Factor and GATA-4 Are Mutual Coregulators. Mol. Cell. Biol.
20: 7550-7558
[Abstract]
[Full Text]
-
Kophengnavong, T., Michnowicz, J. E., Blackwell, T. K.
(2000). Establishment of Distinct MyoD, E2A, and Twist DNA Binding Specificities by Different Basic Region-DNA Conformations. Mol. Cell. Biol.
20: 261-272
[Abstract]
[Full Text]
-
Layne, M. D., Yet, S.-F., Maemura, K., Hsieh, C.-M., Liu, X., Ith, B., Lee, M.-E., Perrella, M. A.
(2002). Characterization of the Mouse Aortic Carboxypeptidase-Like Protein Promoter Reveals Activity in Differentiated and Dedifferentiated Vascular Smooth Muscle Cells. Circ. Res.
90: 728-736
[Abstract]
[Full Text]