Previous Article | Next Article 
Molecular and Cellular Biology, April 1999, p. 2594-2600, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The c-fos Proto-Oncogene Is a Target for
Transactivation by the p53 Tumor Suppressor
Adi
Elkeles,
Tamar
Juven-Gershon,
David
Israeli,
Sylvia
Wilder,
Amir
Zalcenstein, and
Moshe
Oren*
Department of Molecular Cell Biology, The
Weizmann Institute of Science, Rehovot 76100, Israel
Received 26 October 1998/Returned for modification 21 December
1998/Accepted 6 January 1999
 |
ABSTRACT |
The p53 tumor suppressor gene is mutated in over 50% of human
cancers, resulting in inactivation of the wild-type (wt) p53 protein. The most notable biochemical feature of p53 is its ability to
act as a sequence-specific transcriptional activator. Through use
of the suppression subtractive hybridization differential screening
technique, we identified c-fos as a target for
transcriptional stimulation by p53 in cells undergoing
p53-mediated apoptosis. Overexpression of wt p53 induces
c-fos mRNA and protein. Moreover, in vivo induction of
c-fos in the thymus following whole-body exposure to
ionizing radiation is p53 dependent. p53 responsiveness does not reside
in the basal c-fos promoter. Rather, a distinct region
within the c-fos gene first intron binds
specifically to p53 and confers upon the c-fos promoter
the ability to become transcriptionally activated by wt p53.
Identification of c-fos as a specific target for
transcriptional activation by p53 establishes a direct link between
these two pivotal regulatory proteins and raises the possibility that
c-fos contributes to some of the biological effects of p53.
| |
INTRODUCTION |
The p53 tumor suppressor gene plays
a central role in the prevention of cancer through its ability to
recruit several signaling pathways toward the regulation of cell fate
(reviewed in references 4, 17, 21, 29, and
33). Mutations in the gene for p53 which inactivate
its biological and biochemical functions are found in about half of all
human cancers (23).
Most notable among the biochemical activities of p53 is its ability to
mediate sequence-specific transactivation of genes harboring distinct
p53-binding elements. Positive regulation of target genes by p53 has
been implicated in the two major biological outcomes of p53 activation,
growth arrest and apoptosis (21, 29, 33). p53-mediated
G1 arrest is largely brought about by induction of the
cyclin-dependent kinase inhibitor p21/Waf1 (13). Similarly,
the p53 target BTG2 (44) and 14-3-3 
(22)
genes have been implicated in the control of the G2-M
checkpoint by p53.
p53 can mediate apoptosis under a variety of physiological and
pathological conditions (4, 7, 17, 48, 49). A growing number
of p53-inducible genes have been suggested to be involved in this
process, including those for bax (37), IGF-BP3
(6), Fas/APO1 (38), p85 (50), and
PAG608 (24) and several redox-related genes (40).
This diverse list suggests that p53 mediates apoptosis through several
independent pathways. In addition, p53 may also utilize
transcriptionally independent pathways toward induction of apoptosis
(reviewed in references 4, 21, and
49).
We employed the suppression subtractive hybridization (SSH)
method (10) to identify new target genes that are induced by p53 in cells undergoing p53-mediated apoptosis. Surprisingly, one
strongly p53-inducible cDNA was found to correspond to the mouse
c-fos proto-oncogene, suggesting that c-fos is a
target for positive regulation by p53. The c-fos protein is
a constituent of the AP-1 transcription factor complex (reviewed in
references 1 and 26). Changes in
c-fos expression have been implicated in a variety of
biological processeses, including proliferation, differentiation,
tumorigenesis, and apoptosis. Previously, the c-fos basal
promoter was shown to be repressed in cells possessing very high levels
of wild-type (wt) p53 activity (15, 28, 45). By using more
physiological levels of p53 in this study, we demonstrated that, unlike
the c-fos basal promoter when studied in isolation, the
c-fos gene as a whole is actually positively regulated by p53, giving rise to a p53-dependent increase in both
c-fos mRNA and protein. This effect is mediated through a
distinct element within the first intron of the c-fos gene
which binds specifically to p53. These findings establish
c-fos as a new p53 target gene whose activation may
contribute to the downstream effects of p53.
| |
MATERIALS AND METHODS |
Cell lines.
M1, LTR6 (51), and H1299
(36) cells were maintained routinely at 37°C in RPMI
medium supplemented with 10% fetal calf serum (FCS). DA-1
(16), MCO1 (3), MCO1-cG9 (3), Clone6 (39), and F89 (normal human diploid fibroblast) cells were
maintained at 37°C in Dulbecco modified Eagle medium supplemented
with 10% FCS. MCO-1 cells are mouse fibrosarcoma cells devoid of p53
expression (20), while MCO1-cG9 cells are MCO1 derivatives
stably transfected with temperature-sensitive (ts) mutant protein
p53val135 (2).
RNA analysis.
Total RNA was extracted by using either the
RNAzol or the ULTRASPEC (Biotex Laboratories) reagent. Northern blot
analysis was performed as previously described (14), by
using mouse c-fos and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) cDNA probes. Semiquantitative reverse
transcription (RT)-PCR was performed as previously described
(24), by using the following primer combinations: mouse
c-fos, 5'GCTGACAGATACACTCCAAGCGG3' and
5'AGGAAGACGTGTAAGTAGTGCAG3' or
5'GGTTTCAACGCCGACTACGAG3' and 5'CTCCTCCGATTCCGGCACTT3';
rat c-fos, 5'GATCTGTCCGTCTCTAGTGCCAAC3' and
5'CTCCTCCGATTCCGGCACTT3'; human c-fos,
5'CCTCACCCTTTCGGAGTCCC3' and
5'CTCCTTCAGCAGGTTGGCAATCT3'; GAPDH,
5'CAGCAATGCATCCTGCACC3' and
5'TGGACTGTGGTCATGAGCCC3'.
SSH.
SSH (10) was utilized to produce a cDNA
library enriched for p53 target genes. The starting material consisted
of two poly(A)+ RNA populations extracted from either M1 or
LTR6 cells incubated for 4 h at 32°C. After removal of adapters,
the cDNA clones present in the enriched library were ligated into
vector pBLKS+. Positive clones were individually amplified by PCR using
T3 and T7 primers. The PCR products were separated on agarose gels,
transferred to membranes, and hybridized against radiolabeled
population probes prepared by radiolabeling the same
poly(A)+ RNA pools used as the starting material for SSH.
In addition to the enriched clones, each gel also included GAPDH and
PAG608 (24) cDNAs as negative and positive controls, respectively.
Protein analysis.
Nuclear extracts were prepared from M1,
LTR6, or Clone6 cells incubated at either 37 or 32°C as previously
described (53). Extract proteins (100 µg per lane) were
resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis,
Western blotted, and reacted with a c-fos antibody (SC-52;
Santa-Cruz). Blots were developed with the SuperSignal
enhanced-chemiluminescence system (Pierce).
Reporter plasmids, transfections, and gel mobility shift
assays.
A genomic fragment containing the murine c-fos
promoter (550 bp), exon 1, and intron 1 was obtained from mouse genomic
DNA by PCR amplification using primers
5'GGGGTACCAAAAAAAGTTCCAGATTGCTGGAC3' and
5'GGGGATAAAGTTGGCACTAGAGA3'. The PCR product was digested with KpnI and BglII and ligated upstream of the
gene for luciferase in pGL3-basic (Promega) to yield reporter plasmid
FL:PEI. Subsequent deletion mutants were generated through digestion of
FL:PEI with various restriction enzymes (see Fig. 3 and 4). To create
FL:PEI-X, FL:PEI was digested with XhoI and
BglII, and the vector containing the remaining
c-fos sequences was filled in and self-ligated. To create
FL-PEI-B, FL-PEI was digested with BsmI, blunt ended, and
then redigested with KpnI; the excised c-fos
genomic DNA fragment was ligated into pGL3-basic digested with
KpnI and SmaI. To create FL-PEI-A, FL-PEI was
digested with ApaLI; the desired 2-kb fragment was
blunt ended and digested with KpnI, and the excised
c-fos DNA fragment was ligated into pGL3-basic digested with
KpnI and SmaI. To create FL-PE, FL-PEI-X was
digested with KpnI and BglII, and the
c-fos genomic DNA fragment was gel extracted and partially digested with HincII; the resultant DNA fragment containing
the promoter and exon sequences of c-fos was ligated into
pGL3-basic digested with KpnI and SmaI. To create
FL-P, FL-PEI was digested with AccI, blunt ended, and
digested with KpnI; the desired c-fos fragment
was ligated into pGL3-basic digested with KpnI and
SmaI. FL:PEI-X(mut) was created by PCR amplification of an
FL:PEI-X template using primers
5'GGGGTACCAAAAAAAGTTCCAGATTGCTGGAC3' and 5'ACAAGTGTGCACGCGCTCAGAGAATTCCTGGGTTCC3'. The 3' primer
contains a double mutation of the wt sequence (see Fig. 4b) that
introduces a unique EcoRI site. The PCR product was digested
with KpnI (restriction site within the 5' primer) and
ApaLI (restriction site within the 3' primer). To restore
the entire FL:PEI-X(mut) sequence, the PCR product was ligated to the
120-bp ApaLI-XhoI fragment present downstream of
the ApaLI site in FL:PEI-X in a triple ligation that also
included pGL3-basic DNA digested with KpnI and
XhoI. The presence of the correct mutations was confirmed by
sequencing the entire PCR-amplified region.
H1299 cells were transfected transiently by the calcium phosphate
method (53). Transfections were performed in triplicate by
using 1 µg of each reporter plasmid and 25 ng of
either pCMVp53wt (encoding wt mouse p53) or pCMVp53m (encoding
the murine mutant protein p53gly168ile234). Luciferase assays were
performed by standard procedures with the aid of a Turner Designs luminometer.
Gel mobility shift assays were performed as previously described
(
53).
| |
RESULTS |
p53 overexpression induces c-fos.
The SSH method
(10) was employed to identify p53 target genes. The starting
material consisted of two mRNA populations, one extracted from p53-null
M1 mouse myeloid leukemia cells and the other from LTR6 cells, derived
by stable transfection of M1 cells with ts mutant p53 protein p53Val135
(51, 52). Prior to RNA extraction, cells were incubated for
4 h at 32°C; in LTR6, this restores wt p53 activity, leading to
apoptosis (51, 52). cDNA was synthesized off each mRNA
population, and the two cDNA pools were used for SSH. Clones in
which LTR6 cDNA is overrepresented relative to M1 cDNA included
the p53 target genes for GLN-LTR (53) and EI24
(32) (data not shown). Unexpectedly, c-fos
transcripts were also enriched in p53-activated LTR6 cDNA (data not shown).
Induction of c-
fos mRNA in LTR6 cells following p53
activation at 32°C was confirmed by Northern blot analysis (Fig.
1a, lanes
3 and 4). No induction was seen
in M1 cells (lanes 1 and 2), ruling
out a nonspecific temperature
effect. Semiquantitative RT-PCR
revealed a prominent increase in
c-
fos mRNA within 80 min after
the temperature shift (Fig.
1b). This resembles the rate of induction
in this system of
p21Waf1,
mdm2,
gadd45,
bax, and the gene for GLN-LTR, well-established
p53 target
genes (
18,
34,
53). A corresponding increase
in c-Fos
protein was evident in LTR6, but not M1, cells 4 h after
the
temperature shift (Fig.
1d, lanes 1 to 4).
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of c-fos gene expression in cell
lines harboring ts mutant protein p53Val135. (a) Poly(A)+ RNA was
extracted from M1 and LTR6 cells incubated at either 37 or 32°C for
4 h. Aliquots (5 µg) were separated by agarose gel
electrophoresis, transferred to a nylon membrane, and probed with a
mouse c-fos cDNA probe. The same membrane was
subsequently reprobed for GAPDH. Total cellular RNA was extracted
from LTR6 (b) or Clone6 (c) cells following incubation at 32°C for
the indicated periods. An 8-µg sample of each RNA was subjected to
semiquantitative RT-PCR performed with c-fos- and
GAPDH-specific primers. The numbers of PCR cycles for c-fos
and GAPDH were 26 and 21 (b), and 30 and 21 (c) respectively. (d)
Nuclear extracts were prepared from M1, LTR6 and Clone6 cells incubated
at either 37 or 32°C for 4 h. Equal amounts of protein (100 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, transferred to a nitrocellulose membrane, and probed
with an anti-c-Fos antibody. Total cellular RNA was extracted from
MCO1-cG9 or MCO1 cells following either incubation at 32°C for the
indicated periods (e) or starvation for 24 h in 0.1% FCS,
followed by incubation in 20% FCS for the indicated periods (f). A
5-µg sample of each RNA was subjected to semiquantitative RT-PCR as
described above. The numbers of PCR cycles were 30 and 20 (e) and 26 and 20 (f) for c-fos and GAPDH, respectively.
|
|
Activation of ts p53 at 32°C also induced c-
fos in mouse
DP-16 cells transfected with p53val135 (
25) (data not shown)
and
in the p53val135-overexpressing fibroblastic lines Clone6 (Fig.
1c)
and MCO1-cG9 (Fig.
1e), with a corresponding increase in c-Fos
protein
(Fig.
1d). However, p53 was not required for c-
fos induction
by serum stimulation (Fig.
1f). In the fibroblastic cell lines
Clone6
and MCO1-cG9, the induction of c-
fos following p53
activation
was transient, peaking within 2 h of the temperature
shift and
markedly declining by 8 h (Fig.
1c and e). This
transient induction
pattern differs from that of other p53 target
genes, such as
p21 (data not shown) and
mdm2 (
2), whose transcripts keep accumulating
for
at least 24 h. As observed for many other p53-responsive genes
(
30), the ability of p53 to elevate c-
fos gene
expression appears
to be cell type dependent. Thus, in several
situations, including
HeLa cells stably transfected with
p53val135, p53 activation did
not result in significant induction of
c-
fos mRNA (data not
shown).
c-fos mRNA is induced by DNA damage in a p53-dependent
manner.
To determine whether c-fos is also induced upon
activation of endogenous p53, c-fos expression was examined
in cells exposed to ionizing radiation (IR), a potent p53 activator
(27). Interleukin-3 (IL-3)-dependent DA-1 mouse lymphoma
cells contain functional, IR-responsive wt p53 (16).
Exposure of DA-1 cells to 3 Gy of IR, with or without IL-3,
strongly elevated c-fos mRNA (Fig.
2a, lanes 3 and 4). A milder
increase occurred in irradiated normal human diploid fibroblasts
(Fig. 2b).
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Induction of c-fos gene expression following
DNA damage. (a) RNA was extracted from DA-1 cells, incubated either in
the absence or in the presence of IL-3, 6 h after exposure to 3 Gy
of gamma irradiation. The RNA was subjected to semiquantitative RT-PCR,
as described in the legend to Fig. 1, using c-fos (28 cycles)- and GAPDH (21 cycles)-specific primers. (b) RNA was extracted
from F89 normal human diploid fibroblasts at the indicated time points
following exposure to 5 Gy of gamma irradiation and subjected to
semiquantitative RT-PCR with c-fos (33 cycles)- and GAPDH
(21 cycles)-specific primers. (c) p53 knockout mice (p53 K/O) and their
wt littermates (wtp53) were obtained through a cross between two p53
+/ mice. One 40-day-old mouse of each genotype was exposed to 5 Gy of
whole-body gamma irradiation (+), while another pair of mice were left
untreated (). Animals were sacrificed 4 h later, and total RNA
was extracted from each thymus and subjected to semiquantitative RT-PCR
with c-fos (28 cycles)- and GAPDH (23 cycles)-specific
primers. (d) Two-month-old rats were either exposed to 5 Gy of
whole-body gamma irradiation (+) or left untreated (). Animals were
sacrificed 4 h later, and total RNA was extracted from each thymus
and subjected to semiquantitative RT-PCR with c-fos (29 cycles)- and GAPDH (21 cycles)-specific primers.
|
|
IR exposure in vivo activates p53 in the thymus, triggering
apoptosis (
9,
35). c-
fos expression was
strongly induced
in mouse and rat thymuses (Fig.
2c and d) 4 h after whole-body
irradiation. Importantly, no increase was seen in
p53 knockout
mice (Fig.
2c, lanes 1 and 2). Hence, c-
fos is
p53 responsive
both in vitro and in vivo. p53-independent mechanisms
may also
contribute to c-
fos induction by IR; however, at
least in thymocytes,
this is insufficient in the absence of functional
p53.
The first intron of the c-fos gene contains a
p53-responsive element.
The c-fos basal promoter is
unlikely to mediate the observed p53 responsiveness; in fact, it can
even be repressed by very high levels of p53 (15, 45). In
contrast, the sequence of the c-fos first intron suggests
the presence of several candidate p53-binding motifs (5). In
particular, a stretch of 40 nucleotides (nt) (boxed in Fig.
3a) can be viewed as a tandem array of
four 10-mer motifs exhibiting various degrees of homology to the p53 consensus half site (12) (consensus matches are
indicated by uppercase letters in Fig. 3a; see also Fig. 4b).
In addition, two potential half sites separated from one another
by 17 bp reside further downstream in intron 1 (boldface in Fig. 3a).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Transactivation of a c-fos reporter by p53.
(a) Sequence of a 5' segment of c-fos intron 1 containing
putative p53-binding elements. The numbers at both ends of the sequence
correspond to nucleotide positions within the c-fos gene,
where 1 corresponds to the transcription start site. The arrows
represent the two primers (p1 and p2) used to PCR amplify the region
for gel mobility analysis (see Fig. 5). The box depicts the putative
p53-RE as deduced from subsequent experiments (see Fig. 4 and the
text). Boldface letters denote the four tandem putative 10-mer
p53-binding consensus half sites and lowercase identifies nucleotides
which deviate from the consensus. The indicated restriction enzymes
were used to produce luciferase constructs with deletions (Fig. 4). (b)
Schematic diagram of the c-fos gene. Boxes represent the
four exons. The first in-frame ATG is indicated. The position of the
sequence presented in panel a is indicated by the filled box. Also
shown are relative positions of the c-fos genomic DNA
fragments used to construct reporter plasmids FL:PEI and FL:P (see
panel c). (c) Luciferase activity of the reporter plasmids depicted in
panel b. H1299 cells (4 × 105 per 60-mm-diameter
dish) were transfected in triplicate with a combination of the
indicated reporter plasmid (1 µg/dish) and either pCMVp53wt (wtp53,
encoding murine wt p53) or pCMVp53m (mutp53, encoding the murine
p53gly168ile234 mutant protein) at 25 ng/dish. Extracts were prepared
36 h later and assayed for luciferase activity. Values are
presented in arbitrary machine units. The numbers above the bars
represent fold of activation of wtp53 over mutp53. Transfections were
done in triplicate, and standard errors are shown.
|
|
A genomic fragment spanning the c-
fos promoter, exon 1, intron 1, and the 5' end of exon 2 was cloned upstream of a
luciferase
reporter gene (plasmid FL:PEI in Fig.
3b). When
cotransfected
into p53-null human H1299 cells together with small
amounts of
p53 expression plasmids, FL:PEI was strongly
activated by wt but
not tumor-derived mutant p53 (Fig.
3c). In
contrast, no activation
was observed with deletion mutant FL:P,
comprising mainly the
c-
fos promoter. Thus, the
c-
fos gene contains a p53-responsive
domain downstream of
its
promoter.
Deletion constructs (Fig.
4a) were next
tested for retention of p53-mediated transactivation. Removal of
sequences downstream
of the putative p53-binding domain (plasmid
FL:PEI-X) maintained
full activation (Fig.
4c); the 3' part of
intron 1 is therefore
dispensable. Nevertheless, FL:PEI-X did exhibit
lower basal activity
than FL:PEI, presumably owing to loss of a splice
acceptor site.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion analysis mapping of the region responsible for
p53-mediated c-fos transactivation. (a) Schematic map of the
reporter plasmids used for transactivation analysis. Each plasmid
contains the indicated region of the c-fos gene placed
upstream of the luciferase gene in a promoterless luciferase construct
(pGL3basic). Italics identify the positions of restriction enzymes used
to create the various deletion mutants: H,
HincII; Ac, AccI; A,
ApaLI; B, BsmI; X,
XhoI. Construct FL:PE was created through partial digestion
of FL:PEI with HincII. The black vertical bars indicate the
two clusters of p53 consensus half sites (Fig. 3a). The white bar
represents the mutated p53-RE. (b) Alignment of the consensus (CON)
p53-binding site (12) and the 40-bp p53-RE of the mouse
c-fos gene. Vertical bars within the consensus sequence
indicate the four half-site decamers. The positions of the
site-directed mutations in the p53-RE, as well as that of the unique
EcoRI site created during mutagenesis, are shown at the
bottom. (c) Luciferase activity of the reporter plasmids depicted in
panel a. For details, see the legend to Fig. 3c.
|
|
Deletion of the promoter-distal pair of potential half sites (FL:PEI-B)
had only a mild effect on p53-mediated activation
(Fig.
4c). However,
deletion into the promoter-proximal 40-nt
stretch (FL:PEI-A) caused a
substantial decrease in activation,
whereas complete deletion of intron
1 (FL:PE) entirely abolished
p53 inducibility. Hence, a functional
p53-responsive element (p53-RE)
resides within the 5' part of intron
1.
To map more precisely the structural requirements for c-
fos
activation by p53, we mutated 2 nt in the 5' part of the potential
p53-RE [p53RE(mut) in Fig.
4b]. These particular nucleotides were
chosen because they reside at invariant positions within a 10-mer
motif
perfectly matching the p53 consensus half site. As seen
in Fig.
4c,
these mutations [FL:PEI-X(mut)] totally eliminated
the ability of the
reporter to be activated by wt p53 in H1299
cells. This confirms the
correct assignment of the p53-RE and
defines critical residues within
this
element.
To investigate whether the c-
fos intronic region binds p53
directly, the entire region was PCR amplified using primers
p1
and p2 (Fig.
3a) and used as a radiolabeled probe for gel
mobility
shift analysis. Incubation of the probe with purified
recombinant
wt p53 yielded a distinct retarded band (Fig.
5a, middle arrow;
compare lanes 1 and 5)
partially supershifted by p53-specific
monoclonal antibody PAb248 (lane
2, upper arrow). Hence, p53 can
bind this c-
fos intron
1-derived DNA fragment. No shift was obtained
with p53cys270, a
mutant protein defective in sequence-specific
DNA binding (lanes
3 and 4). The specificity of the binding was
confirmed by
its ability to be competed efficiently by an excess
of a
nonlabeled probe (lane 6) but not by an unrelated DNA fragment
(lane
7). A synthetic 40-bp oligonucleotide comprising the proposed
p53-RE
(boxed in Fig.
3a) was also shifted by wt p53 but not by
p53cys270
(Fig.
5b, lanes 1 to 5), confirming that this defined
DNA element is
indeed sufficient for p53 binding. Importantly,
a similar
oligonucleotide carrying the two mutations described
in Fig.
4b was
severely compromised for p53 binding (Fig.
5b,
lanes 6 and 7). Thus,
these mutations, which abolish p53-mediated
transactivation, also
strongly reduce p53 binding. The residual
binding seen with p53RE(mut)
suggests that the mutated element
retains some ability to interact with
p53, albeit far less efficiently.
This is consistent with the ability
of excess p53RE(mut) to compete
to a limited extent for p53
binding (Fig.
5b, compare lanes 1
and 10). The residual p53
binding may be mediated by the three
remaining 10-mer motifs but
is obviously not enough for transcriptional
activation.
View larger version (75K):
[in this window]
[in a new window]
|
FIG. 5.
Binding of p53 to the c-fos p53-RE. (a) Equal
amounts of a [32P]dATP end-labeled 180-bp probe prepared
by PCR amplification (Fig. 3a) were incubated with 250 ng of either wt
murine p53 (wtp53) or the murine p53cys270 mutant protein (mutp53),
each purified from Sf9 cells infected with the corresponding
recombinant baculovirus (53). Where indicated, reactions
mixtures also included p53-specific monoclonal antibody PAb248 (lanes 2 and 4) or a 40× molar excess of a nonlabeled probe, which served as a
specific competitor (s-comp., lane 6), or of the 180-bp multiple
cloning site of pBluescript, which served as a nonspecific competitor
(n-comp., lane 7). (b) Equal amounts of [32P]dATP
end-labeled double-stranded 40-bp oligonucleotides [p53-RE and
p53-RE(mut); Fig. 4b] were incubated with 250 ng of either wtp53 or
p53cys270, with or without addition of PAb248 (lanes 2, 3, and 7; lane
5 contained PAb248 without p53). The reactions mixtures in lanes 9 and
10 also incubated a 150× molar excess of a nonlabeled 40-bp p53-RE
oligonucleotide as a specific competitor (wt-comp., lane 9) or of
p53-RE(mut) (lane 10). The arrows indicate the free probes and the
shifted and supershifted bands.
|
|
Collectively, our findings identify c-
fos as a new p53
target gene whose transactivation is mediated through direct binding
of
p53 to a distinct cognate region within intron
1.
| |
DISCUSSION |
The present study identified c-fos as a new p53 target
gene. This conclusion drew on several lines of evidence: both the mRNA and protein of c-fos are strongly induced upon deliberate
activation of p53, and p53-dependent induction of c-fos
expression is observed in vivo following exposure to DNA damage.
A region containing a putative p53-binding site resides within the
first intron of the c-fos gene. This region mediates
transactivation by p53 in the context of genomic c-fos DNA.
Moreover, the wt, but not the mutant, form can bind directly to this
region, and base substitutions that abrogate this binding also abolish
p53-dependent transcriptional activation. Thus, p53-mediated
transactivation of c-fos is brought about by direct binding
of p53 to a distinct p53-binding element within intron 1 of the
c-fos gene. This relationship suggests that c-fos
acts downstream of p53 as part of a stress response pathway.
It has been shown that the basal c-fos promoter can be
repressed by large amounts of p53 (15, 28, 45). The finding
that the intact c-fos gene, in its chromosomal context, is
actually induced in a p53-dependent manner was therefore unexpected.
Yet, unlike earlier studies, the present analysis employed much smaller amounts of p53 expression plasmid DNA and was expected to
represent more physiologically relevant conditions. As the region
responsible for p53-mediated induction of c-fos is located
within an intron, it is obvious that constructs retaining only the
c-fos promoter are not suitable for studying the regulation
of this gene by p53. In fact, such constructs are indeed likely to
be repressed by excessive amounts of p53, presumably owing to
sequestration of essential components of the transcription machinery,
giving rise to transcriptional "squelching." It is also noteworthy
that the ability of p53 to trigger c-fos expression is often
cell type dependent (data not shown). This might suggest that
c-fos induction requires cooperation between p53 and
another transcription factor(s). The functional state of such a
putative factor may thus determine whether or not
c-fos and, presumably, other p53 target genes will be turned
on, thereby affecting the biological outcome of p53 activation.
c-fos participates in a plethora of signaling pathways
(26). In many situations (e.g., growth factor stimulation),
c-fos induction occurs very rapidly and transiently
(26). This induction, mediated through elements in the
c-fos promoter (26), does not involve
p53 (Fig. 1f). However, c-fos induction can also follow a
slower course, taking hours rather than minutes and persisting for an
extended period; in such situations, a role for p53 might be envisaged.
It is noteworthy, that persistent c-fos induction has been
associated with an apoptotic outcome (8, 19, 47). c-fos also facilitates IR-induced T-lymphocyte apoptosis
(42), a largely p53-dependent process (9, 35).
Combined with the fact that prominent c-fos induction
procedes p53-triggered apoptosis in LTR6 cells, our data therefore
raise the possibility that c-fos transactivation contributes
to the proapoptotic effects of p53 under circumstances such as
radiation damage, hypoxia, or oxidative stress. Alternatively, since a
p53-mediated increase in c-fos expression can also be
observed in cells like Clone6 and MCO-cG9 cells (Fig. 1), which undergo
growth arrest rather than apoptosis in response to p53 activation, it
is possible that c-fos induction is, in fact, involved in
biological effects of p53 distinct from apoptosis, such as positive
regulation of certain differentiation processes (43). It is
noteworthy, however, that in these fibroblastic cell lines, the
induction of c-fos by p53 is transient and that c-fos mRNA levels return to their ground state within a few
hours (Fig. 1c and e). It is thus conceivable that such a short
duration of c-fos overexpression is insufficient for
delivery of an irreversible apoptotic signal. Indeed, it was
earlier demonstrated that overexpressed c-fos and functional
wt p53 cooperate in the efficient induction of apoptosis in a human
cancer cell line (41).
Finally, one cannot rule out the possibility that c-fos
induction even plays a protective role, e.g., by facilitating recovery from DNA damage (11, 46). In fact, p53 itself has also been shown to exert an apparent antiapoptotic effect in primary fibroblasts under conditions of relatively mild stress (31).
Irrespective of the exact contribution of c-fos to the p53
pathway, our data support the existence of a direct link between these
two pivotal cell fate regulators.
| |
ACKNOWLEDGMENTS |
We thank S. Benchimol for the gift of DP-16 cells, Y. Shilo for
the gift of F89 cells, M. Uzan for excellent technical assistance, E. Gottlieb for helpful suggestions, and A. Rosen (QBI Enterprises, Inc.)
for advice on SSH.
This work was supported in part by grant RO1CA40099 from the National
Cancer Institute, by the Israel-USA Binational Science Foundation, by
the Leo and Julia Forchheimer Center for Molecular Genetics, and by a
fellowship grant from the Israel Cancer Research Fund.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department
of Molecular Cell Biology, The Weizmann Institute of Science,
Rehovot 76100, Israel. Phone: (972) 8-9342358. Fax: (972)
8-9465223. E-mail: lioren{at}dapsas1.weizmann.ac.il.
| |
REFERENCES |
| 1.
|
Angel, P., and M. Karin.
1991.
The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation.
Biochim. Biophys. Acta
1072:129-157[Medline].
|
| 2.
|
Barak, Y.,
T. Juven,
R. Haffner, and M. Oren.
1993.
mdm2 expression is induced by wild type p53 activity.
EMBO J.
12:461-468[Medline].
|
| 3.
|
Barak, Y., and M. Oren.
1992.
Enhanced binding of a 95 kDa protein to p53 in cells undergoing p53-mediated growth arrest.
EMBO J.
11:2115-2121[Medline].
|
| 4.
|
Bates, S., and K. H. Vousden.
1996.
p53 in signaling checkpoint arrest or apoptosis.
Curr. Opin. Genet. Dev.
6:12-18[Medline].
|
| 5.
|
Bourdon, J. C.,
V. Deguinchambon,
J. C. Lelong,
P. Dessen,
P. May,
B. Debuire, and E. May.
1997.
Further characterisation of the p53 responsive element identification of new candidate genes for trans-activation by p53.
Oncogene
14:85-94[Medline].
|
| 6.
|
Buckbinder, L.,
R. Talbott,
M. S. Velasco,
I. Takenaka,
B. Faha,
B. R. Seizinger, and N. Kley.
1995.
Induction of the growth inhibitor IGF-binding protein 3 by p53.
Nature
377:646-649[Medline].
|
| 7.
|
Canman, C. E., and M. B. Kastan.
1997.
Role of p53 in apoptosis.
Adv. Pharmacol.
41:429-460.
|
| 8.
|
Chen, S. C.,
T. Curran, and J. I. Morgan.
1995.
Apoptosis in the nervous system: new revelations.
J. Clin. Pathol.
48:7-12[Free Full Text].
|
| 9.
|
Clarke, A. R.,
C. A. Purdie,
D. J. Harrison,
R. G. Morris,
C. C. Bird,
M. L. Hooper, and A. H. Wyllie.
1993.
Thymocyte apoptosis induced by p53-dependent and independent pathways.
Nature
362:849-852[Medline].
|
| 10.
|
Diatchenko, L.,
Y. F. Lau,
A. P. Campbell,
A. Chenchik,
F. Moqadam,
B. Huang,
S. Lukyanov,
K. Lukyanov,
N. Gurskaya,
E. D. Sverdlov, and P. D. Siebert.
1996.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc. Natl. Acad. Sci. USA
93:6025-6030[Abstract/Free Full Text].
|
| 11.
|
Dosch, J., and B. Kaina.
1996.
Induction of c-fos, c-jun, junB and junD mRNA and AP-1 by alkylating mutagens in cells deficient and proficient for the DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT) and its relationship to cell death, mutation induction and chromosomal instability.
Oncogene
13:1927-1935[Medline].
|
| 12.
|
El-Deiry, W. S.,
S. E. Kern,
J. A. Pietenpol,
K. W. Kinzler, and B. Vogelstein.
1992.
Definition of a consensus binding site for p53.
Nat. Gene.
1:45-49[Medline].
|
| 13.
|
El-Deiry, W. S.,
T. Tokino,
V. E. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
W. E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[Medline].
|
| 14.
|
Elkeles, A.,
K. M. Devos,
D. Graur,
M. Zizi, and A. Breiman.
1995.
Multiple cDNAs of wheat voltage-dependent anion channels (VDAC): isolation, differential expression, mapping and evolution.
Plant Mol. Biol.
29:109-124[Medline].
|
| 15.
|
Ginsberg, D.,
F. Mechta,
M. Yaniv, and M. Oren.
1991.
Wild-type p53 can downmodulate the activity of various promoters.
Proc. Natl. Acad. Sci. USA
88:9979-9983[Abstract/Free Full Text].
|
| 16.
|
Gottlieb, E.,
R. Haffner,
T. Von Ruden,
E. F. Wagner, and M. Oren.
1994.
Down-regulation of wild-type p53 activity interferes with apoptosis of IL-3-dependent hematopoietic cells following IL-3 withdrawal.
EMBO J.
13:1368-1374[Medline].
|
| 17.
|
Gottlieb, T. M., and M. Oren.
1996.
p53 in growth control and neoplasia.
Biochim. Biophys. Acta
1287:77-102[Medline].
|
| 18.
|
Guillouf, C.,
X. Grana,
M. Selvakumaran,
A. Deluca,
A. Giordano,
B. Hoffman, and D. A. Liebermann.
1995.
Dissection of the genetic programs of p53-mediated G1 growth arrest and apoptosis: blocking p53-induced apoptosis unmasks G1 arrest.
Blood
85:2691-2698[Abstract/Free Full Text].
|
| 19.
|
Hafezi, F.,
J. P. Steinbach,
A. Marti,
K. Munz,
Z. Q. Wang,
E. F. Wagner,
A. Aguzzi, and C. E. Reme.
1997.
The absence of c-fos prevents light-induced apoptotic cell death of photoreceptors in retinal degeneration in vivo.
Nat. Med.
3:346-349[Medline].
|
| 20.
|
Halevy, O.,
J. Rodel,
A. Peled, and M. Oren.
1991.
Frequent p53 mutations in chemically-induced murine fibrosarcoma.
Oncogene
6:1593-1600[Medline].
|
| 21.
|
Hansen, R., and M. Oren.
1997.
p53; from inductive signal to cellular effect.
Curr. Opin. Genet. Dev.
7:46-51[Medline].
|
| 22.
|
Hermeking, H.,
C. Lengauer,
K. Polyak,
T. C. He,
L. Zhang,
S. Thiagalingam,
K. W. Kinzler, and B. Vogelstein.
1997.
14-3-3 is a p53-regulated inhibitor of G2/M progression.
Mol. Cell
1:3-11[Medline].
|
| 23.
|
Hollstein, M.,
T. Soussi,
G. Thomas,
M. von-Brevern, and H. Bartsch.
1997.
p53 gene alterations in human tumors: perspectives for cancer control.
Recent Results Cancer Res.
143:369-389[Medline].
|
| 24.
|
Israeli, D.,
E. Tessler,
Y. Haupt,
A. Elkeles,
S. Wilder,
R. Amson,
A. Telerman, and M. Oren.
1997.
A novel p53-inducible gene, PAG608, encodes a nuclear zinc finger protein whose overexpression promotes apoptosis.
EMBO J.
16:4384-4392[Medline].
|
| 25.
|
Johnson, P.,
S. Chung, and S. Benchimol.
1993.
Growth suppression of Friend virus-transformed erythroleukemia cells by p53 protein is accompanied by hemoglobin production and is sensitive to erythropoietin.
Mol. Cell. Biol.
13:1456-1463[Abstract/Free Full Text].
|
| 26.
|
Karin, M.,
Z. g. Liu, and E. Zandi.
1997.
AP-1 function and regulation.
Curr. Opin. Cell Biol.
9:240-246[Medline].
|
| 27.
|
Kastan, M. B.,
O. Onyekwere,
D. Sidransky,
B. Vogelstein, and R. W. Craig.
1991.
Participation of p53 protein in the cellular response to DNA damage.
Cancer Res.
51:6304-6311[Abstract/Free Full Text].
|
| 28.
|
Kley, N.,
R. Y. Chung,
S. Fay,
J. P. Loeffler, and B. R. Seizinger.
1992.
Repression of the basal c-fos promoter by wild-type p53.
Nucleic Acids Res.
20:4083-4087[Abstract/Free Full Text].
|
| 29.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 30.
|
Komarova, E. A.,
L. Diatchenko,
O. W. Rokhlin,
J. E. Hill,
Z. J. Wang,
V. I. Krivokrysenko,
E. Feinstein, and A. V. Gudkov.
1998.
Stress-induced secretion of growth inhibitors: a novel tumor suppressor function of p53.
Oncogene
17:1089-1096[Medline].
|
| 31.
|
Lassus, P.,
M. Ferlin,
J. Piette, and U. Hibner.
1996.
Anti-apoptotic activity of low levels of wild-type p53.
EMBO J.
15:4566-4573[Medline].
|
| 32.
|
Lehar, S. M.,
M. Nacht,
T. Jacks,
C. A. Vater,
T. Chittenden, and B. C. Guild.
1996.
Identification and cloning of EI24, a gene induced by p53 in etoposide-treated cells.
Oncogene
12:1181-1187[Medline].
|
| 33.
|
Levine, A. J.
1997.
p53, the cellular gatekeeper for growth and division.
Cell
88:323-331[Medline].
|
| 34.
|
Levy, N.,
E. Yonish-Rouach,
M. Oren, and A. Kimchi.
1993.
Complementation by wild-type p53 of interleukin-6 effects on M1 cells induction of cell cycle exit and cooperativity with c-myc suppression.
Mol. Cell. Biol.
13:7942-7952[Abstract/Free Full Text].
|
| 35.
|
Lowe, S. W.,
E. M. Schmitt,
S. W. Smith,
B. A. Osborne, and T. Jacks.
1993.
p53 is required for radiation-induced apoptosis in mouse thymocytes.
Nature
362:847-849[Medline].
|
| 36.
|
Mitsudomi, T.,
S. M. Steinberg,
M. M. Nau,
D. Carbone,
D. Damico,
S. Bodner,
H. K. Oie,
R. I. Linnoila,
J. L. Mulshine,
J. D. Minna, and A. F. Gazdar.
1992.
p53 gene mutations is non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features.
Oncogene
7:171-180[Medline].
|
| 37.
|
Miyashita, T., and J. C. Reed.
1995.
Tumor suppressor p53 is a direct transcriptional activator of the human bax gene.
Cell
80:293-299[Medline].
|
| 38.
|
Owen-Schaub, L. B.,
W. Zhang,
J. C. Cusack,
L. S. Angelo,
S. M. Santee,
T. Fujiwara,
J. A. Roth,
A. B. Deisseroth,
W.-W. Zhang,
E. Kruzel, and R. Radinsky.
1995.
Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression.
Mol. Cell. Biol.
15:3032-3040[Abstract].
|
| 39.
|
Pinhasi-Kimhi, O.,
D. Michalovitz, and M. Oren.
1986.
Specific interaction between the p53 cellular tumor antigen and major heat-shock proteins.
Nature
320:182-185[Medline].
|
| 40.
|
Polyak, K.,
Y. Xia,
J. L. Zweier,
K. W. Kinzler, and B. Vogelstein.
1997.
A model for p53-induced apoptosis.
Nature
389:300-305[Medline].
|
| 41.
|
Preston, G. A.,
T. T. Lyon,
Y. Yin,
J. E. Lang,
G. Solomon,
L. Annab,
D. G. Srinivasan,
D. A. Alcorta, and J. C. Barrett.
1996.
Induction of apoptosis by c-Fos protein.
Mol. Cell. Biol.
16:211-218[Abstract].
|
| 42.
|
Pruschy, M.,
Y. Q. Shi,
N. E. A. Crompton,
J. Steinbach,
A. Aguzzi,
C. Glanzmann, and S. Bodis.
1997.
The proto-oncogene c-fos mediates apoptosis in murine T-lymphocytes induced by ionizing radiation and dexamethasone.
Biochem. Biophys. Res. Commun.
241:519-524[Medline].
|
| 43.
|
Rotter, V.,
R. Aloni-Grinstein,
D. Schwartz,
N. B. Elkind,
A. Simons,
R. Wolkowicz,
M. Lavigne,
P. Beserman,
A. Kapon, and N. Goldfinger.
1994.
Does wild-type p53 play a role in normal cell differentiation?
Semin. Cancer Biol.
5:229-236[Medline].
|
| 44.
|
Rouault, J. P.,
N. Falette,
F. Guehenneux,
C. Guillot,
R. Rimokh,
Q. Wang,
C. Berthet,
C. Moyretlalle,
P. Savatier,
B. Pain,
P. Shaw,
R. Berger,
J. Samarut,
J. P. Magaud,
M. Ozturk,
C. Samarut, and A. Puisieux.
1996.
Identification of BTG2, an antiproliferative p53-dependent component of the DNA damage cellular response pathway.
Nat. Genet.
14:482-486[Medline].
|
| 45.
|
Santhanam, U.,
A. Ray, and P. B. Sehgal.
1991.
Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product.
Proc. Natl. Acad. Sci. USA
88:7605-7609[Abstract/Free Full Text].
|
| 46.
|
Schreiber, M.,
B. Baumann,
M. Cotten,
P. Angel, and E. F. Wagner.
1995.
Fos is an essential component of the mammalian UV response.
EMBO J.
14:5338-5349[Medline].
|
| 47.
|
Smeyne, R. J.,
M. Vendrell,
M. Hayward,
S. J. Baker,
G. G. Miao,
K. Schilling,
L. M. Robertson,
T. Curran, and J. I. Morgan.
1993.
Continuous c-fos expression precedes programmed cell death in vivo.
Nature
363:166-169[Medline].
|
| 48.
|
White, E.
1996.
Life, death, and the pursuit of apoptosis.
Genes Dev.
10:1-15[Free Full Text].
|
| 49.
|
Wyllie, A.
1997.
Apoptosisclues in the p53 murder mystery.
Nature
389:237-238[Medline].
|
| 50.
|
Yin, Y. X.,
Y. Terauchi,
G. G. Solomon,
S. Aizawa,
P. N. Rangarajan,
Y. Yazaki,
T. Kadowaki, and J. C. Barrett.
1998.
Involvement of p85 in p53-dependent apoptotic response to oxidative stress.
Nature
391:707-710[Medline].
|
| 51.
|
Yonish-Rouach, E.,
D. Grunwald,
S. Wilder,
A. Kimchi,
E. May,
J. J. Lawrence,
P. May, and M. Oren.
1993.
p53-mediated cell death: relationship to cell cycle control.
Mol. Cell. Biol.
13:1415-1423[Abstract/Free Full Text].
|
| 52.
|
Yonish-Rouach, E.,
D. Resnitzky,
J. Lotem,
L. Sachs,
A. Kimchi, and M. Oren.
1991.
Wild-type p53 induces apoptosis of myeloid leukemic cells that is inhibited by interleukin-6.
Nature
352:345-347[Medline].
|
| 53.
|
Zauberman, A.,
Y. Barak,
N. Ragimov,
N. Levy, and M. Oren.
1993.
Sequence-specific DNA binding by p53: identification of target sites and lack of binding to p53-MDM2 complexes.
EMBO J.
12:2799-2808[Medline].
|
Molecular and Cellular Biology, April 1999, p. 2594-2600, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hess, J., Angel, P., Schorpp-Kistner, M.
(2004). AP-1 subunits: quarrel and harmony among siblings. J. Cell Sci.
117: 5965-5973
[Abstract]
[Full Text]
-
Shih, A., Zhang, S., Cao, H. J., Boswell, S., Wu, Y.-H., Tang, H.-Y., Lennartz, M. R., Davis, F. B., Davis, P. J., Lin, H.-Y.
(2004). Inhibitory effect of epidermal growth factor on resveratrol-induced apoptosis in prostate cancer cells is mediated by protein kinase C-{alpha}. Molecular Cancer Therapeutics
3: 1355-1364
[Abstract]
[Full Text]
-
Nakade, K., Zheng, H., Ganguli, G., Buchwalter, G., Gross, C., Wasylyk, B.
(2004). The Tumor Suppressor p53 Inhibits Net, an Effector of Ras/Extracellular Signal-Regulated Kinase Signaling. Mol. Cell. Biol.
24: 1132-1142
[Abstract]
[Full Text]
-
Wu, G., Nomoto, S., Hoque, M. O., Dracheva, T., Osada, M., Lee, C.-C. R., Dong, S. M., Guo, Z., Benoit, N., Cohen, Y., Rechthand, P., Califano, J., Moon, C.-s., Ratovitski, E., Jen, J., Sidransky, D., Trink, B.
(2003). {Delta}Np63{alpha} and TAp63{alpha} Regulate Transcription of Genes with Distinct Biological Functions in Cancer and Development. Cancer Res.
63: 2351-2357
[Abstract]
[Full Text]
-
Inga, A., Storici, F., Darden, T. A., Resnick, M. A.
(2002). Differential Transactivation by the p53 Transcription Factor Is Highly Dependent on p53 Level and Promoter Target Sequence. Mol. Cell. Biol.
22: 8612-8625
[Abstract]
[Full Text]
-
Gohler, T., Reimann, M., Cherny, D., Walter, K., Warnecke, G., Kim, E., Deppert, W.
(2002). Specific Interaction of p53 with Target Binding Sites Is Determined by DNA Conformation and Is Regulated by the C-terminal Domain. J. Biol. Chem.
277: 41192-41203
[Abstract]
[Full Text]
-
Shih, A., Davis, F. B., Lin, H.-Y., Davis, P. J.
(2002). Resveratrol Induces Apoptosis in Thyroid Cancer Cell Lines via a MAPK- and p53-Dependent Mechanism. J. Clin. Endocrinol. Metab.
87: 1223-1232
[Abstract]
[Full Text]
-
Eichhorst, S. T., Müller, M., Li-Weber, M., Schulze-Bergkamen, H., Angel, P., Krammer, P. H.
(2000). A Novel AP-1 Element in the CD95 Ligand Promoter Is Required for Induction of Apoptosis in Hepatocellular Carcinoma Cells upon Treatment with Anticancer Drugs. Mol. Cell. Biol.
20: 7826-7837
[Abstract]
[Full Text]
-
Jolly, C., Morimoto, R. I.
(2000). Role of the Heat Shock Response and Molecular Chaperones in Oncogenesis and Cell Death. JNCI J Natl Cancer Inst
92: 1564-1572
[Abstract]
[Full Text]
-
Zhu, J., Chen, X.
(2000). MCG10, a Novel p53 Target Gene That Encodes a KH Domain RNA-Binding Protein, Is Capable of Inducing Apoptosis and Cell Cycle Arrest in G2-M. Mol. Cell. Biol.
20: 5602-5618
[Abstract]
[Full Text]
-
Blattner, C., Kannouche, P., Litfin, M., Bender, K., Rahmsdorf, H. J., Angulo, J. F., Herrlich, P.
(2000). UV-Induced Stabilization of c-fos and Other Short-Lived mRNAs. Mol. Cell. Biol.
20: 3616-3625
[Abstract]
[Full Text]
-
Kohn, K. W.
(1999). Molecular Interaction Map of the Mammalian Cell Cycle Control and DNA Repair Systems. Mol. Biol. Cell
10: 2703-2734
[Abstract]
[Full Text]
-
Saifudeen, Z., Du, H., Dipp, S., El-Dahr, S. S.
(2000). The Bradykinin Type 2 Receptor Is a Target for p53-mediated Transcriptional Activation. J. Biol. Chem.
275: 15557-15562
[Abstract]
[Full Text]
Top
Abstract
Introduction
