Molecular and Cellular Biology, April 1999, p. 2657-2671, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.


International Centre for Genetic Engineering and Biotechnology, I-34012 Trieste, Italy
Received 3 August 1998/Returned for modification 14 September 1998/Accepted 28 December 1998
| |
ABSTRACT |
|---|
|
|
|---|
The fibronectin primary transcript undergoes alternative splicing in three noncoordinated sites: the cassette-type EDA and EDB exons and the more complex IIICS region. We have shown previously that an 81-nucleotide region within the EDA exon is necessary for exon recognition and that this region contains at least two splicing-regulatory elements: a polypurinic enhancer (exonic splicing enhancer [ESE]) and a nearby silencer element (exonic splicing silencer [ESS]). Here, we have analyzed the function of both elements in different cell types. We have mapped the ESS to the nucleotide level, showing that a single base change is sufficient to abolish its function. Testing of the ESE and ESS elements in heterologous exons, individually or as part of the complete EDA regulatory region, showed that only the ESE element is active in different contexts. Functional studies coupled to secondary-structure enzymatic analysis of the EDA exon sequence variants suggest that the role of the ESS element may be exclusively to ensure the proper RNA conformation and raise the possibility that the display of the ESE element in a loop position may represent a significant feature of the exon splicing-regulatory region.
| |
INTRODUCTION |
|---|
|
|
|---|
Alternative splicing is a widespread process used in higher eucaryotes to regulate gene expression. A single primary transcript can generate multiple proteins with distinct functions in a tissue- and/or development-specific manner. Differential pre-mRNA processing occurs via several pathways, including skipped exons, included introns, alternative 5' and 3' splice sites, mutually exclusive exons, alternative promoters, and different polyadenylation sites. The intron-exon junction sequences in complex organisms are degenerate, many pre-mRNAs contain multiple introns, and large introns may contain several cryptic splicing sites (16). The selection of splicing sites in constitutively or alternatively spliced pre-mRNAs is determined by parameters such as exon length (3, 32, 41), the presence of splicing enhancer and silencer elements (23), and the strength of splicing signals (16). In some cases the formation of secondary structure participates in the regulation of splice site selection by modifying the physical distances within introns or by being involved in the definition of exons (2, 7, 8, 12, 14, 25, 34, 40).
Considerable progress has been made in recent years in identifying the
sequences and the cellular factors that through protein-RNA and
protein-protein interactions regulate the alternative splice site
selection. However, less attention was given to the RNA
structural aspects. The cis-acting elements of
alternatively spliced exons must be exposed in order to be
recognized by the trans-acting cellular factors. In the case
of the chicken
-tropomyosin gene, the secondary structure of
the primary transcript regulates alternative splicing by
completely hiding the muscle-specific exon (8). It was
recently shown that the Drosophila SR proteins
Tra/Tra2 and B52 recognize specific RNA hairpin-loop structures in
their target RNAs (17, 33). This type of recognition may be
widespread. However, the definition of the structural features of the
RNA substrates has not progressed at the same pace as the study of the
protein partners of the system.
The fibronectin (FN) gene is a classical example to illustrate genome evolution by exon shuffling (20), generation of protein diversity by alternative splicing (20), and topological coordination between transcription and splicing (9). The FN primary transcript undergoes alternative splicing in three noncoordinated sites (5) that gives rise to 20 polypeptides in humans (for recent reviews, see references 22 and 15). One of the alternatively spliced regions, the EDA exon (also called EIIIA or EDI), is a cassette-type alternatively spliced exon. It is selectively excluded in the FN mRNAs produced by hepatocytes and is included to various extents by other cell types. Mardon et al. (28) found that the inclusion of the EDA exon was totally dependent on the presence of an 81-nucleotide sequence located within the central region of the exon. This region is also active in promoting EDA inclusion in an in vitro splicing assay (24). We have previously reported that this 81-nucleotide region contains a bipartite structure consisting of cis-acting exonic sequences that control the alternative splicing of the EDA exon (6). This region is composed of a purine-rich exonic splicing enhancer (ESE) (5'GAAGAAGA3') plus a second exonic element (5'CAAGG3') located 13 nucleotides downstream of the ESE, which acts as an exonic splicing silencer (ESS). In fact, deletion of the entire ESS results in constitutive inclusion of the EDA exon. This linear bipartite structure may be an oversimplification, and higher-order RNA structures may be implicated, as was shown for a different region of the EDA exon (35).
In this work we show that both the ESE and ESS regulate splicing of the EDA exon by a common mechanism in different cell types. The mapping of the silencer element has been extended to the nucleotide level, and both the ESE and ESS elements have been tested in heterologous exons. Enzymatic mapping has shown a peculiar secondary structure of the EDA exon that localizes the ESE element in an exposed position as part of a loop region. The ESS seems to be determinant for the RNA conformation, as it lies in a stem structure. We suggest that the secondary structure characterized here mediates proper recognition of the EDA exon by the splicing machinery.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid construction.
Constructs pSVED-A Tot, pSVED-A
Sac-Stu, pSVED-A
2E, pSVED-A
4, and pSVED-A
3 have been
previously described (6).
(i) Constructs pSVED-A ES.1, ES.2, ES.3U, ES.3A, ESE-Mut, and ESE-ESS-Mut. The SalI/SacI fragment obtained from the vector pSVED-A Tot Sac (6) was cloned into the pUC18 vector, creating the pUC-SS3.9 construct. ES.1, ES.2, ES.3U, ES.3A, ESE-Mut, and ESE-ESS-Mut mutations were obtained by annealing the degenerated primers containing the desired mutations. The mutated synthetic fragments were cloned in SacI-StuI-digested pUC-SS3.9 to obtain intermediate constructs, from which the SalI/SacI fragment was excised and ligated into the previously SalI-SacI-digested pSVED-A Tot Sac vector.
(ii) Constructs pSVED-A ES.4, ES.5, ES.6, and ES.7.
The
fragments ES.4, ES.5, ES.6, and ES.7 were obtained by PCR-directed
mutagenesis and cloned in the StuI-BamHI-digested
M13mp18 EDA Tot (6). From these constructs the
SalI/BamHI fragment was excised, blunt ended, and
cloned in BstEII-digested pSV
1W vector (18) to
obtain the final constructs.
(iii) Constructs pSV
ESS+S, ESS+AS, ESS+2cS, ESS
S, and
ESS
AS.
pSV
BstINS was obtained by digestion of pSV
1W with
BstEII, blunt ending, and insertion of the synthetic
fragment SpeINS. The pSV
ESS+S, ESS+AS, ESS+2cS, and ESS
S, ESS
AS
variants were obtained by insertion of the fragments ESS+ and
ESS
inside the PmlI-digested pSV
BstINS vector in
different orientations (sense and antisense) and in tandem (+3cS). The
ESS sequence (5'AGCTGCAAGGCCTCAGACCGG3') was
inserted in sense and antisense orientations.
(iv) B series constructs.
The EDB hybrid minigene construct
B1 (see Fig. 3A), which is analogous to the pSVED-A Tot
FN-
-globin chimeric minigene, contains the genomic EDB exon
region, its flanking introns, and part of the
1 and +1 flanking
exons. This region was amplified from human genomic DNA cloned in the
pUC18 vector, creating pUC.EDBTot. The insert was fully sequenced,
excised, and cloned in the BstEII site of the pSV
1W
vector, creating the B1 plasmid. A new XhoI site was
introduced by PCR-directed mutagenesis 98 bases downstream of the
KpnI site of the EDB exon, generating the B2 construct. The
B4 plasmid was created by deleting the EDB sequence between the
KpnI and XhoI sites.
(v) BA series constructs.
To prepare the chimeric EDB-EDA
constructs (BA series), the respective EDA fragments were amplified
with primers bearing KpnI and SalI sites and
cloned in KpnI-XhoI-digested B4. For the
preparation of constructs lacking intron repeats, the 269-bp
PstI/SphI fragment in the +1 intron was excised
from the construct pUCEDBTot, creating pUCEDBTot
ir. The
KpnI/BamHI fragment from this construct was excised and cloned in B1 and B4, creating B3 and B5, respectively. The
chimeric BA constructs with intron deletions (BA2, BA6, BA8, and BA10)
were prepared from B5 by inserting the respective EDA fragments
amplified with primers EDA Kpn (5'TCCAGGTACCGGGTGACCTA3') and EDA Sal (5'TGACTGTCGACTCAGAACC3') in the
KpnI-XhoI cassette.
(vi) EDB-ESE and -ESS series constructs. To make the EDB-B2-X-ESE, EDB-B2-K-ESE, and EDB-B4-ESE constructs, the oligonucleotides hESEdir (5'CCTGATGGTGAAGAAGACACTGCA3') and hESErev (5'GTGACTTCTTCACCATCAGGTGCA3') were annealed and cloned at the XhoI, KpnI (Asp718), and XhoI-Asp718 sites (previously made blunt), respectively, of each vector. Orientation and copy number were verified by PCR and DNA sequencing. A similar approach was utilized to obtain the EDB-B2-K-ESS, EDB-B2-X-ESS, and EDB-B4-ESS plasmids by annealing the hESSdir (5'GCAAGGCCTCAGACCGAGCT3') and hESSrev (5'CGGTCTGAGGCCTTGCAGCT3') oligonucleotides.
Cell culture and transfection.
HeLa (human cervical
carcinoma), Hep3B (human hepatocarcinoma), CaCo2 (human colon
carcinoma), SK-N-SH (human neuroblastoma), WI38 Va13 (simian virus 40 [SV40]-transformed human fibroblast), MA104 (simian kidney), and COS1
(SV40-transformed simian kidney) cells were maintained in Dulbecco's
modified Eagle medium supplemented with 10% fetal calf serum, 50 µg
of gentamicin per ml, and 4 mM L-glutamine. NT2D1 (human
embryonal teratocarcinoma) cells were maintained in Dulbecco's
modified Eagle medium supplemented with 4.5 g of glucose per
liter, 10% fetal calf serum, 50 µg of gentamicin per ml, and 4 mM
L-glutamine. About 1.6 × 106 cells were
transfected with 5 µg of specific plasmid purified by CsCl gradient
centrifugation and 3 µg of T-antigen expression plasmid
(p
5'sVBglII) by means of a modified calcium phosphate precipitation method (21) or DOTAP reagent (Boehringer
Mannheim) as suggested by the manufacturers. Cells were harvested
36 h after transfection.
RNA preparation and RT-PCR analysis. Total RNA was prepared from the transfected cells by a single-step extraction method with RNAzol B (TEL-TEST Inc., Friendswood, Tex.). A standard reverse transcription (RT) protocol utilizing Moloney murine leukemia virus supplied by Gibco/BRL was used.
(i) RT-PCR assay for analysis of pSVED-A construct transfection. cDNA was synthesized by utilizing the specific primer pSVcDNA (5'GGTATTTGGAGGTCAGCA3'). Each cDNA was then amplified by PCR with the primers PSV5'J and PSV3'J as previously described (6).
(ii) RT-PCR assay for analysis of pSV
ESS construct
transfection.
cDNA from HeLa cells and HepG2 total RNA were
synthesized by using the specific primer
glocDNA
(5'GTATTTGGAGGTCAGCA3'). The cDNA was amplified by PCR
through 28 cycles of 93°C for 45 s, 59°C for 1 min, and 72°C
for 30 s. The primers
gloE1-5'
(5'CGCACGCTGGCGAGTATGGT3') and
gloE3-3'
(5'TCACAGAAGCCAGGAACT3') were used to discriminate the
transfected sequences from the endogenous
-globin messengers.
(iii) RT-PCR assay for analysis of pSV
-B (EDB) and BA
(EDA-EDA) construct transfection.
About 2 µg of RNA samples was
reverse transcribed in 25-µl reaction mixtures as described above
with 25 pM Pharmacia random hexanucleotide primer. FN message derived
from the transiently transfected constructs was specifically amplified
by the combination of sense primer in the
1 FN EDB exon (F1edb,
ACTGCCTGCTGGTGACCTG) and antisense primer in the third exon
of
-globin (Glob Rev, GAAGCCAGGAACTTGTCCA). The
amplifications were performed in a total volume of 50 µl for a
total of 30 cycles of amplification (30 s at 94°C, 30 s at
56°C, and 30 s at 72°C), and 5 µl of the PCR products was
analyzed on 1.5% agarose-ethidium bromide gels.
(iv) Quantification of the PCR results.
For quantification
purposes, 3 µCi of [
-32P]dCTP was added to the basic
PCR mixture, and reactions were carried through 24 cycles. Ten
milliliters of each reaction product was then run on a 6% acrylamide
gel, dried, and exposed with an A202400 Instant Imager (Camberra
Packard Instruments). The counts from each splicing band were corrected
by the number of C/G nucleotides in the product sequence. Four
independent transfection RT-PCR assays were carried out for each
sample. The data analysis was performed with the StatView (Abacus
Concept, Inc.) program. The unpaired Student t test was used
to determine significance. A P value of <0.05 was
considered significant.
Enzymatic analysis of RNA secondary structure.
Single-strand-specific (S1 nuclease and T1 RNase) and
double-strand-specific (V1 RNase) enzymes were used to
analyze the secondary structures of the in vitro-transcribed RNAs. The
EDA sequences originally inserted in the pSVED-A Tot Sac construct
(6) or in the
4,
2e, ES.3A, ES.3U, ESE-Mut, BA1, or
BA7 mutant constructs were cloned in the SmaI site of the
pBSKSII(+) plasmid and transcribed with T7 RNA polymerase. Enzymatic
digestion was performed essentially as described previously
(4). Briefly, reaction mixes contained 1 µg of RNA and
0.02 U of RNase V1 (Pharmacia Biotech), 0.5 U of RNase
T1 (Sigma), or 20 U of S1 nuclease (Pharmacia Biotech) and
were incubated at 30°C for 15 min. A control aliquot of RNA without
the addition of RNases was processed simultaneously with the
digested samples. The RNase cleavage sites were identified by
primer extension with a 32P-end-labelled oligonucleotide
primer (5'CTGTGGACTGGGTTCCAATC3'), and the RT reaction
products were loaded on a 6% polyacrylamide gel and exposed to Kodak
X-Omat AR films for 12 to 24 h.
| |
RESULTS |
|---|
|
|
|---|
The EDA splicing-regulatory mechanism is similar in a variety of
cell types.
To study the alternative splicing regulation of the FN
EDA exon, we used an FN-
-globin hybrid minigene, named pSVED-A
Tot, which contains the EDA exon, fragments of the flanking exons, and
the complete flanking introns. We have previously established that the
EDA expression is controlled by a bipartite splicing-regulatory region
constituted by the ESE and ESS. Deletion of the polypurinic ESE
sequence in the pSVED-A
2e plasmid causes complete exon skipping, while deletion of the ESS sequence in the pSVED-A
4 construct causes
total exon inclusion (Fig. 1A and B,
lanes 2 and 4, respectively) (6). Since the previous
studies were performed exclusively with HeLa cells, we wanted to
analyze the cell type specificity of the two elements that constitute
this bipartite splicing-regulatory region by transfecting a variety of
cell types derived from different tissues.
|
Xho-Stu), as well as the deletion of the positive
polypurine element (
2e), abolished alternative splicing of EDA,
producing exclusively EDA
RNA (Fig. 1B, lanes 2 and 3).
In contrast, the deletion of the negative element (
4) resulted in
complete or almost complete inclusion of the EDA exon (Fig. 1B, lanes
4), as seen previously in HeLa cells (6, 28, 39). In HeLa,
HepG2, COS1, NT2D1, CaCo2, and WI38 Va13 cells, the EDA exon is
completely included (Fig. 1B, lanes 4), while in MA104,
Hep3B, and SK-N-SH cells (not shown), a small amount (5 to 15%)
of mRNA lacking the exon is sometimes evident.
These results show that the exonic splicing-regulatory region
containing the ESE and ESS controls EDA splicing ubiquitously and not
in a cell-type-specific manner.
Single point mutations in the ESS element can promote
complete EDA exon inclusion.
The ESS sequence
(5'CAAGG3') has been previously characterized by deletion
analysis, and it was desirable to finely map the element by introducing
single and paired point mutations in the sequence previously defined as
the ESS and in its nearby 3' flanking sequence. Since the EDA is
predominantly included in HeLa cells, slight variations towards an
increased exon inclusion are difficult to detect. RT-PCR analysis of
the expression of the pSVED-A Tot plasmid showed that in the HepG2 cell
line the EDA exon is included in 60% of the endogenous FN messengers
(Fig. 1B). As all of the different cell lines had a common mechanism
that regulates the expression of the FN-
-globin minigene, we
performed the following experiments with the HepG2 cell line, where
small variations in the splicing inclusion/exclusion ratios of the
various FN minigenes are easier to observe. Minigenes carrying single
and combined point mutations were transiently transfected in HepG2
cells, and the processed messenger was analyzed by RT-PCR. Single point
mutations of the ESS AGG core sequence were as efficient as the
original 5-nucleotide deletion in increasing the EDA inclusion to 95 to 100% of the mRNA product (Fig. 2A,
lanes 2 to 5). Increased exon inclusion was also observed after the
substitution of the two cytosine nucleotides immediately downstream
from the ESS element (82 and 79% in the ES.4 and ES.5 constructs,
respectively [Fig. 2A, lanes 6 and 7]), while mutations further
downstream did not produce any significant effect (63 and 59% in the
ES.6 and ES.7 constructs, respectively [Fig. 2A, lanes 8 and 9]). We
did not analyze the nucleotides at the 5' end, since previous deletion analysis indicated that they were not primarily involved in the EDA
regulation (
3 construct in reference 6).
Moreover, the disruption of the silencing effect by a single point
mutation was also observed in all of the cell types tested (Fig. 1A and B, lane 5). In addition, the expression of the double or triple base
substitutions reflected the behavior of the single point mutations
showed in Fig. 2A (data not shown). Single point mutations can produce
the same effect of the original CAAGG deletion, and these data
indicate that the core sequence of this element must be extended to
CAAGGCC.
|
Nonpurine exonic sequences flanking the polypurinic ESE sequence
are also involved in EDA exon inclusion.
Most ESE sequences
are polypurine stretches with a general sequence
(GAR)n, where R is either A or G
(23). We have introduced four point mutations completely
disrupting the polypurine arrangement in the pSVED-A ESE-Mut construct
(the GAAGAAGA sequence was replaced by GACTACTA).
In both HeLa and HepG2 cells, pSVED-A ESE-Mut
expression failed to produce complete exon skipping. In fact,
about 10% of exon inclusion occurred (Fig. 2B, lane 2), while it was
completely skipped in the
2e construct (Fig. 1B, lane 2), where the
entire element was deleted. The polypurine is therefore necessary for
efficient exon inclusion, although its sequence can be disrupted
without total loss of the splicing enhancement activity. This suggests
that the purine stretch is likely to be part of a more complex sequence
and/or secondary structure. More evidence that supports the hypothesis
that sequences flanking the defined polypurine ESE are involved in the
inclusion of the EDA exon was obtained with the constructs pSVED-A
ESE-ESS-Mut and pSVED-A
Sac-Stu. In pSVED-A ESE-ESS-Mut both
the ESE and the ESS were mutated, and the splicing patterns
obtained showed that the mutation of the ESS element could partially
rescue the loss of splicing enhancement activity due to the purine
mutation (34 versus 61% of the activity of the Tot plasmid [Fig. 2B,
lanes 1 to 3]). A strikingly different effect is observed upon
expression and analysis of the construct pSVED-A
Sac-Stu, where a
34-nucleotide region including both the ESE and the ESS region has been
deleted. The EDA exon was totally skipped (Fig. 2B, lane 4), suggesting that exonic sequences other than the polypurine ESE exert a positive control on the EDA exon splicing. Therefore, it would be more correct
to refer to the FN ESE as an exonic region that contains the
characterized polypurine sequence.
Function of the ESE and ESS elements in a heterologous exonic
context.
To test whether the ESE and ESS could modify splicing of
constitutive and alternatively spliced heterologous exons, a series of
plasmids was created. The ESS sequence was inserted into the constitutively spliced second exon of the
-globin gene, and both the ESS and ESE were inserted into the FN EDB alternatively spliced exon.
mRNA forms. On the other hand the human EDB exon
was completely excluded in HeLa cells (Fig.
3A, lane 1). A similar splicing
efficiency was observed with the B2 plasmid, where an XhoI
site was introduced to facilitate further cloning (Fig. 3A, lane 2).
The deletion of the central portion of the EDB exon (B4) caused no
modification in the alternative splicing pattern (Fig. 3A, lane 4).
Deletion of five of the intronic splicing enhancer (ISE) elements out
of the total seven repeats present in the human gene (B3 and B5
constructs) completely abolished the inclusion of the EDB exon. These
results confirm those observed with the rat ISE elements (19,
26). Transfection into HeLa cells, whose endogenous pattern is
EDB minus, showed no difference between the different constructs (Fig. 3A).
|
-globin- and FN EDB-bearing plasmids. The EDA polypurinic enhancer element notably enhanced the EDB exon inclusion in a series of
EDA-EDB chimeric constructs. The stimulatory effect was better seen
with the Hep3B cell line, where the EDB exon is normally skipped
(Fig. 4A, lane 1). When the ESE
element plus its flanking sequences was inserted at the place of the
deleted KpnI/XhoI fragment of the B4 plasmid or
at the XhoI site of the B2 construct, constitutive inclusion
of the EDB exon was observed (B4-ESE and B2-X-ESE plasmids,
respectively [Fig. 4A, lanes 2 and 3]). The same splicing-stimulatory
effect was observed when the ESE was placed at the KpnI site
of the B2 construct (B2-K-ESE plasmid), although a cryptic 5' splicing
site located 30 bases downstream of the KpnI site was
utilized (Fig. 4A, lane 4). The inclusion of the ESE element in
the B2 and B4 constructs also produced constitutive EDB exon
inclusion in different cell types (not shown). A secondary band close
to the EDB plus product was observed in the case of the B2-X-ESE
construct (Fig. 4A, lane 3), and direct sequencing of the PCR
product revealed that a 5' cryptic splicing site located near
the newly generated XhoI site was utilized in this case
by a minority of the mRNAs.
|
-globin gene
constructs produced no modification in the constitutive globin exon 2 inclusion, even when added in multiple copies (Fig. 4B, lanes 1 and 2).
This result indicates that the splicing-inhibitory activity of the ESS
sequence is not significant in a constitutive exon and that the
inhibitory mechanism may depend on other factors such as weak splicing
sites and/or the adjacent ESE. To test this possibility, we prepared a
group of constructs by inserting the ESS element, in one or multiple
copies, in different positions inside the EDB exon or by replacing the
central part of the exon (Fig. 4C). Surprisingly, the ESS had no
inhibitory activity when placed in the alternatively spliced EDB exon,
even in multiple copies and at different distances from the 5'
splicing site (Fig. 4C). In fact, no reduction in the inclusion ratio
was observed after transient transfection of the NT2D1 cells with the
constructs bearing the silencer element. In lanes 2 and 3 of Fig.
4C, a second band can be seen and is the result of the activation of a
5' cryptic splice site, probably due to the excessive length of the
chimeric exon.
The EDA ESS element activity depends exclusively on the complete
EDA context.
The transfection experiments with the ESS inserted
into the EDB exon context presented in the previous sections
introduced the possibility for the requirement of a more complex
secondary structure and/or a crosstalk between the positive and
negative cis-acting elements present in the bipartite
enhancer. To elucidate this possibility we made a series of constructs
in which the entire EDA splicing-regulatory region was inserted into
the FN EDB heterologous exon. The KpnI-XhoI
region in the hybrid minigene B2 was replaced with the wild-type
regulatory region of the EDA exon (Fig. 3B, BA1 to BA4 constructs) or
with individual mutations of the positive or negative elements in the
chimeric EDB-EDA hybrid minigenes, with or without the ISE
elements (Fig. 3B, BA5 to BA10 constructs). These chimeric
constructs were transfected in two distinct classes of
cell lines representing predominantly the EDB+ or
EDB
phenotype (NT2D1 or WI38 Va13 [not shown] and HeLa
or Hep3B [not shown], respectively), and the splicing pattern was
analyzed by RT-PCR (Fig. 3B).
Sac-Stu
construct, the enhancer effect of the EDA splicing-regulatory
region elements is lost when the ESE and ESS elements are deleted, as
in the case of the BA3 and BA4 EDB-EDA hybrid constructs (compare BA3
to B1 and BA4 to B4). These results indicate that the bipartite
splicing enhancer from the EDA exon, when transferred to another
alternatively spliced exon regulated mainly by ISEs, can override the
necessity for ISEs. In addition, this effect is not cell type specific
as is true for the behavior of this bipartite enhancer in the context
of the EDA exon.
The construct BA5 has a deletion of the positive ESE element, but the
intronic enhancers have been preserved. There is up to 90% inclusion
of the EDB exon in NT2D1 cells (Fig. 3B, lane 5) and WI38 Va13 cells
(not shown). The deletion of both exonic and intronic positive elements
(BA6) considerably reduced the percentage of EDB inclusion in these
cells (30%), without producing complete exon skipping, confirming the
previous hypothesis that nonpurinic exonic sequences are involved in
the function of the EDA composite enhancer region.
Unexpectedly, the deletion of the negative element (BA7 plasmid)
produced the opposite effect from that observed for the
4 construct
(Fig. 1) (6). In fact, a reduction in exon inclusion was observed in BA7 when compared with the BA1, which contains the
entire EDA region. Moreover, in the absence of both the negative ESS
element and the ISE elements (BA8 construct), the percentage of exon
inclusion was surprisingly lower than that for the products of the
constructs BA2 and BA7 (which contain the intronic positive elements).
The combination of the G/T point mutation in the ESS element and
the absence of the ISE elements (BA10 plasmid) produced a minor
increase in EDB exon skipping in NT2D1 cells (compare BA2 with BA10 in
Fig. 3B). This unexpected result, analogous to the one observed for the
BA7 and BA8 constructs, was in contrast with the stimulatory effect
seen in the EDA context for the same mutations (Fig. 2A). The presence
of the intron enhancers in the BA9 construct may have masked the G/T
mutation effect, as no difference in splicing could be seen (compare
BA1 with BA9 in Fig. 3B). The splicing pattern was unaffected when the
same constructs were tested in HeLa cells. Deletion of the
positive or negative elements (BA5 and BA7, respectively) had a more
pronounced effect in HeLa cells, reducing the EDB inclusion to 60%.
There was no further reduction when the intron repeats were deleted
(BA6 and BA8).
These results indicate that the positive and negative elements from the
EDA exon behave as parts of a composite enhancer in the context of
the EDB exon and that the EDB exon is recognized independently of the
presence or absence of the ISE elements when the EDA regulatory region
is inserted in the place of its exonic regulatory region (polypurinic
enhancer plus downstream silencer elements [13]).
The paradoxical behavior of the ESS element in the BA7 to BA10 plasmids
and its loss of function after its inclusion in a heterologous
alternatively spliced exon (B4-ESS, B2-X-ESS, and B2-K-ESS constructs
[Fig. 4C]) strongly suggest that the ESS is part of an EDA-specific
splicing-regulatory region. This may indicate a possible structural
role for the ESS element that depends exclusively on a complete EDA
context. This result is in contrast to the full function of the nearby
enhancer element in different heterologous contexts.
The EDA presents a secondary structure and the ESE is located in a terminal loop. To evaluate the structure of the EDA-specific splicing-regulatory region, we have investigated the RNA secondary structures of the wild-type EDA exon and some mutants. The conformations of the in vitro-transcribed RNAs were mapped by enzymatic reactions. Both RNase T1 (cleaves after a guanosine residue) and S1 nuclease (cleaves single-stranded nucleic acids) were used to identify single-stranded regions. Double-stranded or stacked regions were investigated with RNase V1, which has no apparent base specificity. The cleaved bases in the RNA molecules were then identified by primer extension analysis. To help with the interpretation of the mapping experiments, a systematic search of potential base pairing possibilities was assisted by use of the Zuker M-Fold computer program with free energy minimization (42).
Using computer predictions and mutational analysis, Staffa et al. (35) had already suggested the existence of a conserved RNA secondary structure within the first 118 nucleotides of the EDA exon. Our enzymatic cleavage analysis not only confirms the presence of the proposed structure in the first 118 nucleotides of the exon but also extends the analysis of the EDA secondary structure to the whole exon, focusing on the polypurine enhancer element. In fact, confirmatory cleavages in the stem-loop I, II, and III structures proposed by Staffa et al. (35) were observed with both single- and double-strand-specific nucleases (Fig. 5).
|
2e construct, where the ESE was deleted, the
overall secondary structure is well conserved, with a shortening and
modification of region V (Fig. 5). In any case, the absence of
the ESE from loop V completely abolished EDA exon recognition, as
observed in Fig. 1. The other stem-loop structures remained invariable.
Deletion or single-base mutation of the ESS element increases
single-strand-specific digestion in the ESE region.
Probing of
the mutant
4 RNA lacking the silencer element showed the
conservation of the stem-loop I, II, III, IV, and VII structures and a
partial conservation of the stem-loop VI structure (Fig. 5). Although
there is a modification of the stem-loop V structure as seen by
computer prediction analysis, the enhancer element is still
digested by S1 and T1 nucleases, indicating its positioning
in an exposed and single-stranded region. Significantly, there is an
increase of single-strand-specific digestion in the ESE-ESS area,
indicating an overall change in the stem-loop V and VI structures that
is consistent with the enhanced in vivo splicing activity of the
4
construct (Fig. 1).
4
construct. In fact, both RNase T1 and S1 nuclease
produced cleavages within the ESE sequence, suggesting its localization
in a single-stranded region (Fig. 6), as already observed for the
pSVED-A Tot and
4 plasmids (Fig. 5). The digestion pattern also
suggests a more open structure in the ESE flanking area, similar to the
observed results for the
4 construct. The ESS element region shows
single-strand-specific enzymatic digestion, suggesting that the overall
structure of the region is modified in a similar manner in the ES.3A,
ES.3U, and
4 constructs. This is consistent with in vivo experiments that indicate complete, or even enhanced, function of the ESE in the
4, ES.3A, and ES.3U constructs (Fig. 1 and 2A). The enhanced activity of the ESE could be explained by a different conformation of
the RNA, as seen in Fig. 5. This suggestion is supported by the fact
that the digestion pattern surrounding the enhancer element indicates
changes towards a more open structure that may facilitate both
protein-RNA and protein-protein interactions between the basic splicing
machinery and the SR proteins recognizing the region (24).
|
EDB splicing efficiency is reduced when the ESE element is not exposed in the loop of a hairpin structure. We had particular interest in the unexpected reduction of splicing activity obtained with the chimeric BA7 and BA8 constructs (which contain a deletion in the ESS element) when compared with the BA1 and BA2 constructs (bearing the complete EDA splicing regulatory region). This result is contradictory if the ESS element was acting through interactions mediated by a linear sequence, and this difference in splicing activity may be the consequence of a particular secondary structure.
RNase and S1 nuclease digestion, assisted by computer modelling of the EDB-EDA hybrid exons (BA1 and BA2 constructs [Fig. 3]) showed essentially a conservation of the EDA structure with the ESE in a loop (Fig. 7). Strong S1 nuclease and T1 RNase cleavages can be observed at the ESE position, suggesting, as already observed for the EDA Tot construct, that the ESE resides in an exposed position in a loop region. The absence of the ESS sequence resulted in a different digestion pattern in the BA7 and BA8 constructs, confirming the structural role of the ESS element. However, in contrast with the
4,
ES.3A, and ES.3U structures (Fig. 5 and 6), the BA7 and BA8 constructs
show a clear reduction, if not complete absence, of
single-strand-specific digestion in the ESE region (Fig. 7A). In fact,
deletion of the ESS sequence results in a different secondary structure
of the EDA region, where the ESE polypurinic sequence is no longer
displayed in a loop but is masked in a stem (Fig. 7B), providing a
clear explanation for the decrease in exon inclusion observed when the
ESS element is deleted (Fig. 3B).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have previously shown that an 81-nucleotide region in the FN EDA exon regulates its alternative splicing in HeLa cells (28). More recently, the sequence elements responsible for this regulation have been mapped to a GAAGAAGA element that functions as a positive modulator of splicing and to a CAAGG element that functions as a negative modulator of splicing in HeLa cells (6).
Since FN alternative splicing is subjected to tissue-specific and developmental stage-specific regulation (29), the effect of these positive and negative elements on EDA splicing could change in different cell types. We have tested a series of cell lines derived from a variety of tissues, including liver, kidney, intestine, and nervous system, by transfecting EDA hybrid minigene constructs. The analysis of the splicing patterns showed that both the positive and negative elements of the EDA exon are functional in all of these cell types and that the minigene splicing is modulated in the same fashion as the endogenous FN gene in all cell lines tested. This result indicates that each cell type carries a specific combination of trans-acting factors that determine the degree of inclusion or exclusion of the alternatively spliced exon.
The silencer activity can be abolished by single base mutations. The EDA exonic silencer element was the first reported mammalian sequence to act as a negative modulator of splicing. Deletion of the previously described ESS element, a 5-nucleotide stretch (5'CAAGG3'), results in total EDA inclusion (6). Here we have shown that single nucleotide substitutions can induce the same effect and that the mutation of the two cytosine residues downstream also increases exon inclusion, redefining the ESS element as a CAAGGCC sequence. This sequence does not have common features with the human immunodeficiency virus type 1 tat exon 2 and 3 ESS (1, 36) or with the splicing silencer present in the K-SAM alternative exon of fibroblast growth factor 2 (10), but it is remarkably similar to a CAGACCT ESS in the bovine growth hormone exon 5 (37). Nevertheless, when the EDA ESS was mutated to match the core sequence of the latter repressor in the construct pSVED-A ES.3A (Fig. 2A, lane 5), the EDA exon was included in 100% of the final messengers, diminishing the significance of the sequence homology and pointing more to structural elements as the basis of the observed functions.
Extra sequences besides the polypurine enhancer are required
for efficient exon recognition.
The FN ESE element
sequence (GAAGAAGA) contains the consensus obtained
for the ASF/SF2 splicing factor (38). It has been previously
shown that there is an interaction of the proteins recognizing
the ESE with the splicing machinery recognizing the EDA splicing sites
(24, 30). However, the interaction with other
cis- and trans-acting regulatory elements and
factors is not yet well understood. When the EDA polypurine
GAAGAAGA is mutated to GACUACUA, the
exon is still included in 15% of the mRNA molecules, while
deletion of the purine stretch causes total exon exclusion (Fig. 2B).
Further evidence that the ESE sequence is not limited to the purine
stretch is given by the comparison of the results obtained
with the minigenes pSVED-A
Sac-Stu and pSVED-A ESE-ESS-Mut (Fig. 2B) and with the BA5 and BA6 constructs (Fig. 3). In the first
case, the complete deletion of the EDA regulatory region leads to
complete exclusion of the EDA exon, while the inactivation of the ESS
can partially overcome the effect due to the purine mutations in the
ESE (15% of inclusion in pSVED-A ESE-Mut and 35% in pSVED-A
ESE-ESS-Mut). In the second case, a stimulatory effect in
splicing was observed with the BA5 and BA6 constructs despite the
absence of the polypurinic enhancer element in the chimeric EDB-EDA
exon. Thus, the splicing enhancement activity of the EDA
splicing-regulatory region is also exerted by sequences other than the
GAAGAAGA polypurinic enhancer. This is consistent with
the observation that overlapping SRp40, ASF/SF2, and SRp55 binding sites (as defined by the systematic evolution of
ligands by exponential enrichment [SELEX] methodology by Liu et al.
[27]) can be found in the region between the ESE
and ESS elements. An increase in the EDA exon inclusion
efficiency in the
4, ES.3A, and ES.3U constructs may be the
consequence of a two- and three-dimensional structural
modification. This change may improve the exposure of the
positive cis-acting elements to the splicing machinery and may generate an increase in the EDA exon inclusion rate.
Furthermore, the complete regulatory region is dominant over the ESS
inhibition, as we can see from the ESE-Mut and ESE-ESS double-mutant
transfection experiments.
The splicing-regulatory region of the EDA exon is active in the EDB exon and dominates over the EDB ISE and ESE elements. The cell-type-specific regulation of EDB splicing was altered when the EDA regulatory element was introduced inside the EDB exon. This chimeric construct showed 100% exon inclusion in both NT2D1 and HeLa cells, irrespective of the wild-type pattern and independently of the presence or absence of the ISEs. The insertion of the 81-bp region from the EDA exon in the antisense direction within the EDB exon (BA3) did not have a considerable effect on the splicing pattern, confirming that the enhancer effect is sequence specific. Similar dominant effects of exonic splicing modulators were also obtained when the negative TAGG element from the FGFR2 K-SAM exon was inserted inside the rat FN EDB exon (11). In spite of the presence of the enhancer positive elements in the downstream intron, the EDB exon was skipped when the TAGG silencer element was inserted in the exon, suggesting that the exonic splicing-regulatory elements present in the FN EDA exon and in the K-SAM exon of the FGFR-2 gene are dominant over the intronic regulatory elements present in the EDB downstream intron. In contrast, the activity of the exonic splicing-regulatory elements present within the EDB exon is dependent on the presence of the ISEs in the downstream intron.
The ESS function strictly depends on the EDA exonic context. The insertion of the ESS element in either a constitutively or alternatively spliced exon (as a single or multiple element or as a part of the entire EDA region) showed no effect on splicing. These results suggest that the silencer element function depends exclusively on the complete EDA exonic context. On the other hand, we have shown that the ESE is functional in different exonic contexts, confirming the results reported by Staffa and Chochrane (36), who utilized a two-exon, one-intron minigene system. This observation may be the consequence of a peculiar characteristic of the enhancer sequence (a polypurine) that may facilitate its display in an RNA structure. It should be noted that when the ESS element was deleted (BA7 and BA8 constructs [Fig. 3]), the proportion of exon inclusion paradoxically diminished. This effect is particularly visible in the absence of the ISE elements (BA8 construct). Again, this result suggests that the recognition motifs are not only linear nucleotide sequences and that there may be structural features whose conservation is essential for optimal exon recognition.
The EDA exon has a secondary structure that may mediate its recognition by trans-acting factors. The secondary structures derived from computer modelling supported the data obtained by enzymatic digestion of RNA templates within the exonic region of the EDA exon. The presence of three stem-loop structures in the first 118 bases of the exon has already been suggested by Staffa et al. (35), who utilized computer predictions and mutational analysis. We have confirmed these structures, and we have further identified the presence of other stem-loop structures in the rest of the exon. In our model, the GAAGAAGA enhancer sequence resides within a terminal loop in domain V of the exon (Fig. 5), a situation that may facilitate interactions with trans-acting factors. It was recently shown that the Drosophila SR proteins Tra/Tra2 and B52 interact with hairpin-loop structures containing the ESE elements (17, 33) and that the RRM domain of the RNA binding protein U1A, which is similar to that present in the SR proteins, specifically interacts with the single-stranded region of a hairpin structure formed by U1A snRNA (31). Furthermore, Lavigueur et al. (24) demonstrated that SR proteins interact with the polypurine element of the EDA exon. We propose that the stem-loop structure where the enhancer resides may be necessary for this interaction. Furthermore, the efficient function of the ESE element depends on the maintenance of the single-stranded configuration. This hypothesis is supported by the in vivo data obtained by transfecting the BA series of constructs and the ESS mutants. An unexpected decrease in EDB exon inclusion was observed when the ESS was absent from the EDB-EDA chimeric construct (compare results for the BA1 and BA2 constructs with those for the BA7 and BA8 constructs). Detailed analysis of the RNA secondary structure showed that the ESE element was displayed in a single-stranded region when the wild-type EDA sequence was inserted into the EDB exon (Fig. 7). In the case of the BA7 and BA8 constructs, the ESE element was partially masked in a stem (Fig. 7), providing an explanation for the paradoxical behavior of the hybrid minigene, which, notwithstanding the absence of the ESS silencer, decreases significantly the inclusion of the exon. In the case of the ESS mutants, there is an overall increase in single-stranded cleavages in the ESE-ESS region, suggesting an enhanced ability to interact with trans-acting factors. The overlapping SRp40, ASF/SF2, and SRp55 binding sites found in this region (see above) may be more accessible, and therefore there is an increase of exon inclusion.
The display of the ESE in a loop may be the main feature of the exon identifier. The function of the silencer sequences, which are so context dependent, may be to ensure the proper structure that facilitates display of the SR binding sequences. The understanding of this regulatory mechanism will be complete after further characterization of the trans-acting factors that participate in EDA exon recognition. Experiments to identify the proteins involved in the modulation of the EDA exon splicing are under way.| |
ACKNOWLEDGMENTS |
|---|
A.F.M., M.C., and R.P. contributed equally to the manuscript and should be considered joint first authors.
We thank A. Iaconcig and C. Stuani for technical help.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: ICGEB, Padriciano 99, I-34012 Trieste, Italy. Phone: (39)-040-3757337. Fax: (39)-040-3757361. E-mail: baralle{at}icgeb.trieste.it.
Present address: Department of Biology, Sinsheimer Laboratories,
University of California, Santa Cruz, Santa Cruz, CA 95064.
Present address: Cardiovascular Institute, Mount Sinai School of
Medicine, New York, NY 10029.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amendt, B. A., Z. H. Si, and C. M. Stoltzfus. 1995. Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol. Cell. Biol. 15:4606-4615[Abstract]. |
| 2. | Balvay, L., D. Libri, and M. Y. Fiszman. 1993. Pre-mRNA secondary structure and the regulation of splicing. Bioessays 15:165-169[Medline]. |
| 3. |
Black, D. L.
1991.
Does steric interference between splice sites block the splicing of a short c-src neuron-specific exon in non-neuronal cells?
Genes Dev.
5:389-402 |
| 4. |
Brown, E. A.,
S. P. Day,
R. W. Jansen, and S. M. Lemon.
1991.
The 5' nontranslated region of hepatitis A virus RNA: secondary structure and elements required for translation in vitro.
J. Virol.
65:5828-5838 |
| 5. | Caputi, M., F. E. Baralle, and C. A. Melo. 1995. Analysis of the linkage between fibronectin alternative spliced sites during ageing in rat tissues. Biochim. Biophys. Acta 1263:53-59[Medline]. |
| 6. |
Caputi, M.,
G. Casari,
S. Guenzi,
R. Tagliabue,
A. Sidoli,
C. A. Melo, and F. E. Baralle.
1994.
A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon.
Nucleic Acids Res.
22:1018-1022 |
| 7. |
Chebli, K.,
R. Gattoni,
P. Schmitt,
G. Hildwein, and J. Stevenin.
1989.
The 216-nucleotide intron of the E1A pre-mRNA contains a hairpin structure that permits utilization of unusually distant branch acceptors.
Mol. Cell. Biol.
9:4852-4861 |
| 8. |
Clouet d'Orval, B.,
Y. d'Aubenton Carafa,
P. Sirand-Pugnet,
M. Gallego,
E. Brody, and J. Marie.
1991.
RNA secondary structure repression of a muscle-specific exon in HeLa cell nuclear extracts.
Science
252:1823-1828 |
| 9. |
Cramer, P.,
C. G. Pesce,
F. E. Baralle, and A. R. Kornblihtt.
1997.
Functional association between promoter structure and transcript alternative splicing.
Proc. Natl. Acad. Sci. USA
94:11456-11460 |
| 10. | Del Gatto, F., and R. Breathnach. 1995. Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon. Mol. Cell. Biol. 15:4825-4834[Abstract]. |
| 11. |
Del Gatto, F.,
M. C. Gesnel, and R. Breathnach.
1996.
The exon sequence TAGG can inhibit splicing.
Nucleic Acids Res.
24:2017-2021 |
| 12. |
Domenjoud, L.,
H. Gallinaro,
L. Kister,
S. Meyer, and M. Jacob.
1991.
Identification of a specific exon sequence that is a major determinant in the selection between a natural and a cryptic 5' splice site.
Mol. Cell. Biol.
11:4581-4590 |
| 13. | Du, K., Y. Peng, L. E. Greenbaum, B. A. Haber, and R. Taub. 1997. HRS/SRp40-mediated inclusion of the fibronectin EIIIB exon, a possible cause of increased EIIIB expression in proliferating liver. Mol. Cell. Biol. 17:4096-4104[Abstract]. |
| 14. |
Estes, P. A.,
N. E. Cooke, and S. A. Liebhaber.
1992.
A native RNA secondary structure controls alternative splice-site selection and generates two human growth hormone isoforms.
J. Biol. Chem.
267:14902-14908 |
| 15. |
ffrench-Constant, C.
1995.
Alternative splicing of fibronectin many different proteins but few different functions.
Exp. Cell Res.
221:261-271[Medline].
|
| 16. | Green, M. R. 1991. Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Annu. Rev. Cell Biol. 7:559-599. |
| 17. | Hertel, K. J., K. W. Lynch, E. C. Hsiao, E. H. Liu, and T. Maniatis. 1996. Structural and functional conservation of the Drosophila doublesex splicing enhancer repeat elements. RNA 2:969-981[Abstract]. |
| 18. | Higgs, D. R., S. E. Goodbourn, J. Lamb, J. B. Clegg, D. J. Weatherall, and N. J. Proudfoot. 1983. Alpha-thalassaemia caused by a polyadenylation signal mutation. Nature 306:398-400[Medline]. |
| 19. |
Huh, G. S., and R. O. Hynes.
1994.
Regulation of alternative pre-mRNA splicing by a novel repeated hexanucleotide element.
Genes Dev.
8:1561-1574 |
| 20. | Hynes, R. 1990. Fibronectins. Springer-Verlag, New York, N.Y. |
| 21. |
Jordan, M.,
A. Schallhorn, and F. M. Wurm.
1996.
Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation.
Nucleic Acids Res.
24:596-601 |
| 22. | Kornblihtt, A. R., C. G. Pesce, C. R. Alonso, P. Cramer, A. Srebrow, S. Werbajh, and A. F. Muro. 1996. The fibronectin gene as a model for splicing and transcription studies. FASEB J. 10:248-257[Abstract]. |
| 23. | Krainer, A. R. 1997. Eukaryotic mRNA processing. Oxford University Press Inc, New York, N.Y. |
| 24. |
Lavigueur, A.,
H. La Branche,
A. R. Kornblihtt, and B. Chabot.
1993.
A splicing enhancer in the human fibronectin alternate ED1 exon interacts with SR proteins and stimulates U2 snRNP binding.
Genes Dev.
7:2405-2417 |
| 25. |
Libri, D.,
A. Piseri, and M. Y. Fiszman.
1991.
Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure.
Science
252:1842-1845 |
| 26. |
Lim, L. P., and P. A. Sharp.
1998.
Alternative splicing of the fibronectin EIIIB exon depends on specific TGCATG repeats.
Mol. Cell. Biol.
18:3900-3906 |
| 27. |
Liu, H. X.,
M. Zhang, and A. R. Krainer.
1998.
Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins.
Genes Dev.
12:1998-2012 |
| 28. |
Mardon, H. J.,
G. Sebastio, and F. E. Baralle.
1987.
A role for exon sequences in alternative splicing of the human fibronectin gene.
Nucleic Acids Res.
15:7725-7733 |
| 29. | McKeown, M. 1992. Alternative mRNA splicing. Annu. Rev. Cell Biol. 8:133-155. |
| 30. | Muro, A. F., A. Iaconcig, and F. E. Baralle. 1998. Regulation of the fibronectin EDA exon alternative splicing. Cooperative role of the exonic enhancer element and the 5' splice site. FEBS Lett. 437:137-141[Medline]. |
| 31. | Oubridge, C., N. Ito, P. R. Evans, C. H. Teo, and K. Nagai. 1994. Crystal structure at 1.92 A resolution of the RNA-binding domain of the U1A spliceosomal protein complexed with an RNA hairpin. Nature 372:432-438[Medline]. |
| 32. |
Robberson, B. L.,
G. J. Cote, and S. M. Berget.
1990.
Exon definition may facilitate splice site selection in RNAs with multiple exons.
Mol. Cell. Biol.
10:84-94 |
| 33. | Shi, H., B. E. Hoffman, and J. T. Lis. 1997. A specific RNA hairpin loop structure binds the RNA recognition motifs of the Drosophila SR protein B52. Mol. Cell. Biol. 17:2649-2657[Abstract]. |
| 34. | Solnick, D. 1985. Alternative splicing caused by RNA secondary structure. Cell 43:667-676[Medline]. |
| 35. |
Staffa, A.,
N. H. Acheson, and A. Cochrane.
1997.
Novel exonic elements that modulate splicing of the human fibronectin EDA exon.
J. Biol. Chem.
272:33394-33401 |
| 36. | Staffa, A., and A. Cochrane. 1995. Identification of positive and negative splicing regulatory elements within the terminal tat-rev exon of human immunodeficiency virus type 1. Mol. Cell. Biol. 15:4597-4605[Abstract]. |
| 37. |
Sun, Q.,
W. P. Dirksen, and F. M. Rottman.
1995.
An exonic splicing repressor in bovine growth hormone pre mRNA, p. 311.
In
RNA Processing Meeting 1995. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 38. | Tacke, R., and J. L. Manley. 1995. The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities. EMBO J. 14:3540-3551[Medline]. |
| 39. | Vibe-Pedersen, K., A. R. Kornblihtt, and F. E. Baralle. 1984. Expression of a human alpha-globin/fibronectin gene hybrid generates two mRNAs by alternative splicing. EMBO J. 3:2511-2516[Medline]. |
| 40. |
Watakabe, A.,
K. Inoue,
H. Sakamoto, and Y. Shimura.
1989.
A secondary structure at the 3' splice site affects the in vitro splicing reaction of mouse immunoglobulin mu chain pre-mRNAs.
Nucleic Acids Res.
17:8159-8169 |
| 41. |
Xu, R.,
J. Teng, and T. A. Cooper.
1993.
The cardiac troponin T alternative exon contains a novel purine-rich positive splicing element.
Mol. Cell. Biol.
13:3660-3674 |
| 42. | Zuker, M. 1989. Computer prediction of RNA structure. Methods Enzymol. 180:262-288[Medline]. |