Molecular and Cellular Biology, April 1999, p. 3018-3028, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544
Received 8 October 1998/Returned for modification 9 November 1998/Accepted 8 December 1998
| |
ABSTRACT |
|---|
|
|
|---|
In Drosophila melanogaster, Sex-lethal (Sxl) controls autoregulation and sexual differentiation by alternative splicing but regulates dosage compensation by translational repression. To elucidate how Sxl functions in splicing and translational regulation, we have ectopically expressed a full-length Sxl protein (Sx.FL) and a protein lacking the N-terminal 40 amino acids (Sx-N). The Sx.FL protein recapitulates the activity of Sxl gain-of-function mutations, as it is both sex transforming and lethal in males. In contrast, the Sx-N protein unlinks the sex-transforming and male-lethal effects of Sxl. The Sx-N proteins are compromised in splicing functions required for sexual differentiation, displaying only partial autoregulatory activity and almost no sex-transforming activity. On the other hand, the Sx-N protein does retain substantial dosage compensation function and kills males almost as effectively as the Sx.FL protein. In the course of our analysis of the Sx.FL and Sx-N transgenes, we have also uncovered a novel, negative autoregulatory activity, in which Sxl proteins bind to the 3' untranslated region of Sxl mRNAs and decrease Sxl protein expression. This negative autoregulatory activity may be a homeostasis mechanism.
| |
INTRODUCTION |
|---|
|
|
|---|
Sex-lethal (Sxl) encodes an RNA recognition motif (RRM) class RNA binding protein that serves as the developmental switch for sex determination in Drosophila melanogaster (6). Sxl is expressed only in females, where it controls sexual differentiation and dosage compensation by posttranscriptional regulatory mechanisms that affect pre-mRNA splicing and mRNA translation. Misregulation of Sxl results in sex-specific lethality and sex transformations (see reference 15 and references therein).
Female sexual identity is maintained by an autoregulatory feedback loop in which Sxl proteins promote their own synthesis by directing the female-specific splicing of Sxl pre-mRNAs (Fig. 1A; references 5, 6, and 14). Functional female Sxl mRNA is generated by joining exon 2 to exon 4, skipping the third (male-specific) exon, which contains in-frame translation stop codons. Male identity is maintained by the default splicing machinery, which incorporates the third exon into the mature mRNAs, ensuring that no Sxl protein is produced. Sxl-dependent posttranscriptional regulation also controls the gene cascades that direct the different aspects of female or male development (Fig. 1A). Sxl protein promotes female differentiation by directing the female-specific splicing of transformer (tra) pre-mRNAs (25, 45, 46). In the absence of Sxl protein, the default splicing of tra results in mRNAs that do not encode functional protein. Sxl also regulates dosage compensation, which is responsible for equalizing the expression of X-linked genes in the two sexes. One component of the dosage compensation system is the hyperactivation of X-chromosome gene expression in males by the male specific lethal (msl) genes (1, 7, 32, 33). Sxl proteins prevent hyperactivation in females by blocking both the splicing and translation of transcripts from one of these genes, msl-2 (3, 18, 28, 51). A second component of the dosage compensation system is msl independent (8, 19, 20) and is thought to function in females to reduce X-chromosome gene expression. Kelley et al. (28) recently suggested that Sxl itself mediates this dosage compensation by repressing the translation of mRNAs expressed from X-linked genes.
|
The posttranscriptional regulatory activities of the Sxl gene depend on direct interactions between Sxl proteins and target RNAs. RNA binding activity is provided by Sxl's two RRM domains, R1 and R2 (26, 37, 43, 49). The two RRM domains recognize poly(U) runs of seven or more nucleotides, and all of the known Sxl regulatory targets have one or more of these arrays. In the case of tra, in vivo and in vitro studies indicate that Sxl protein directs female-specific splicing by binding to a poly(U) run in the polypyrimidine tract of the default 3' splice site (Fig. 1A) (25, 45, 46). It has been proposed that this prevents the generic splicing factor U2AF from binding to the default polypyrimidine tract and forces the assembly of a U2AF-U2 snRNP splicing complex on the weaker, female-specific 3' splice site downstream (22, 48).
While a direct competition for overlapping binding sites accounts for what is known about tra splicing, the RNA binding activity of Sxl is not sufficient to explain either Sxl autoregulation or the repression of msl-2 translation. The key targets for Sxl autoregulation are located in the introns upstream and downstream of the male exon at distances of 200 or more nucleotides from the regulated 3' and 5' splice sites (24). Hence, instead of a direct blockage mechanism, Sxl must indirectly prevent the assembly of productive splicing complexes at the male exon. One possibility is that homotypic interactions between Sxl proteins sequester the male exon from the splicing machinery (24, 35). Consistent with this possibility, Sxl proteins interact in vitro, and these interactions stabilize Sxl complexes on RNA (26, 36, 43, 49). These Sxl-Sxl interactions are mediated by the two RRM domains (37, 42, 50). A second model postulates that Sxl interacts with and inactivates components of the splicing machinery assembled at the male exon splice sites (e.g., U1 and U2 snRNPs [16, 40]). Consistent with this model, Sxl proteins in vivo are found in large complexes which contain both U1 and U2 snRNPs and Sxl pre-mRNAs (16, 43). In addition, mutations in the sans-fille (snf) gene, encoding the fly homologue of two mammalian snRNP proteins, U1A and U2B", disrupt autoregulation and exacerbate the female-lethal effects of Sxl mutations (38, 40). This synergism may be attributed to interactions between these two proteins; Snf-Sxl complexes can be detected in vivo and in vitro, and this interaction is mediated by the first Sxl RRM domain (16, 43). Finally, efficient translational repression of msl-2 mRNA requires Sxl protein binding sites in both the 5' and 3' untranslated regions (UTRs) (4, 18, 29). In a manner analogous to autoregulation, interactions between Sxl proteins upstream and downstream of the open reading frame could sequester the msl-2 mRNA from the translational machinery. Alternatively, Sxl might interact with and poison this machinery.
While the two Sxl RRM domains have been implicated in both RNA binding and protein-protein interactions, much less is known about the functions of the N- and C-terminal domains. Though there are no known mutations in the N-terminal domain, there are some indications that it may be important for the regulatory functions of the Sxl protein. A truncated Sxl protein was detected in the heads of adult D. melanogaster males (11). This smaller isoform appears to result from translation initiation at an AUG codon in exon 4, downstream of the male exon (exon 3), and gives a protein lacking the first 40 amino acids (aa). A slightly larger male-specific protein is also detected in the related drosophilid, D. virilis (12). Although the D. melanogaster and D. virilis male proteins contain both RRM domains and appear to bind appropriate target RNAs, they do not have detectable feminizing activities. It was initially thought that the concentration of the truncated proteins might be too low to induce feminization. This explanation was called into question by Wang and Bell (49), who found that a truncated Sxl protein (SxlN1), similar to one observed in D. melanogaster male heads, was impaired in Sxl autoregulation when transiently expressed in tissue culture cells.
To learn more about the regulatory functions of the different Sxl protein domains, we have compared the biological activities of the full-length Sxl protein (Sx.FL) and Sx-N in vivo. We were able to uncouple the splicing and translational regulatory activities of Sxl protein. Sx-N is impaired in autoregulatory function, and contrary to the expectations of the U2AF blockage model, the N terminus plays an essential role in the regulation of tra splicing. However, these amino acids are not required to regulate msl-dependent dosage compensation. Finally, we provide evidence that Sxl is controlled by both positive and negative autoregulation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Fly stocks. All fly stocks, unless otherwise noted, are referenced by Lindsley and Zimm (31). Flies were grown on standard Drosophila medium and maintained at room temperature (22°C) unless otherwise specified. The Binsinscy (Bin) chromosome was the first chromosome balancer in all crosses.
Plasmid construction and Drosophila
transformation.
The Sxl MS3 cDNA described by Samuels
et al. (44) was the starting point for construction of the
Sxl transgenes. The MS3 cDNA encodes a 38-kDa Sxl
protein isoform; in the N-terminal domain it has the eight
additional amino acids which arise from the alternative splice in
exon 5, while the C terminus is encoded by exons 7 and 8. Consensus
translational start sites (13) were engineered into the
MS3 cDNA by PCR mutagenesis to generate the Sx.FL
and Sx-N transgenes. In the case of Sx.FL, the
entire 5' UTR was deleted and the sequence just upstream of the normal
Sxl start site was changed to an XhoI site followed by the
consensus initiation sequence (underlined;
GTCGACCAACATGTACGGC). In the case of
Sx-N, a methionine codon at the very 3' end of exon 4 was
used as the translation start site. Again this ATG was preceded by
a consensus initiation sequence (GTCGACCAACATGTCACGT)
and an XhoI restriction site. Sx.FL
and Sx-N
were generated by removing sequences 3'
of the HindIII site in the Sxl MS3 3' UTR.
All constructs were then cloned into the hsp83 mini-white
vector (24) as Xho/Not fragments. Germ line
transformations (47) were performed by injecting plasmid DNA
and helper vector pTurbo into white1
(w1) embryos.
RT-PCR analysis and Southern blotting. RNA was prepared as described by Bell et al. (5). Reverse transcription (RT) was performed according to the procedure of Frohman et al. (17). To make Sxl cDNAs, primer MES21 was used in the RT reaction. PCR was then performed with primers T41-3 and BellA1 spanning the sex-specific Sxl splice junctions (primers described in reference 5). The transgene mRNA (or cDNA) is not amplified since the BellA1 primer is upstream of the transgene breakpoint (Fig. 1). In the PCR, 1.5% of the cDNA was amplified for 30 cycles of 95°C for 1 min, 65°C for 45 s, and 72°C for 30 s. One percent of the reaction volume was diluted, loaded on 2% agarose gels, and Southern blotted onto nitrocellulose. Blots were hybridized with randomly primed Sxl MS3 cDNA (44).
To make tra cDNAs, RT was performed with the tra-3' primer (GATCTGGAGCGAGTGCGTCTG). Approximately 2% of tra cDNA was amplified with tra-5' and tra-2 primers (GGTCACACTGAGGAAAGTGC and CTTCTCACCCGATCCTGTTCTC). PCR conditions were 1 cycle of 95°C for 5 min, 50°C for 2 min, and 72°C for 10 min; 15 cycles of 95°C for 1.5 min, 52°C for 1 min, and 72°C for 1 min; and 17 or 20 cycles of 95°C for 1.5 min, 55°C for 1 min, and 72°C for 1 min. Ten percent of the reaction volume was separated on 2% agarose gels and Southern blotted onto nitrocellulose. Blots were hybridized with randomly primed DNA from a DraI/BamHI subclone of the 5' end of tra cDNA.Immunoprecipitations.
Mouse anti-Sxl and mouse
anti-
-galactosidase (
-Gal) antibodies were cross-linked to
protein A-Sepharose beads as described in reference
23. Beads were stored at 4°C in
immunoprecipitation buffer. Total embryonic extracts were made
according to the protocol of Bopp et al. (11). One
milliliter of extract was added to 100 µl of antibody-coupled beads
and shaken overnight at 4°C. Beads were washed five times in
immunoprecipitation buffer with protease inhibitors (aprotinin,
phenylmethylsulfonyl fluoride, and pepstatin). RNA was prepared from
beads by extraction with 200 µl of 1:1 phenol (pH 4.0)-chloroform and
then ethanol precipitated with tRNA carrier (1.5 µg/ml). RNA pellets
were suspended in 85 µl of double-distilled water with 10 µl of
10× DNase buffer and 5 µl of DNase. Following a 2-h incubation at
37°C and 15 min at 65°C, the RNA was reextracted and ethanol
precipitated. Pellets were resuspended in 20 µl of double-distilled
water; 2 µl each of RNA and control white female RNA (also DNase
treated) was used for RT.
Western analysis. Five flies of each genotype were collected and frozen on dry ice; 50 µl of 2× Laemmli sample buffer was added to the flies, which were then homogenized with a hand-held Dounce homogenizer. Samples were boiled for 5 min and spun for 3 min at 14,000 rpm, and then 10 µl of sample (equivalent to one fly) was loaded on sodium dodecyl sulfate (SDS)-12% acrylamide gels. Western blotting was performed as described elsewhere (11). Blots were prehybridized in PBST-5% nonfat dry milk and probed with mouse anti-Sxl antibody M114 (1:10) overnight at 4°C. Blots were washed three times for 10 min each in PBST and hybridized with horseradish peroxidase-conjugated anti-mouse antibody (1:5,000) in PBST-5% milk for 2 h at room temperature. Blots were again washed three times for 10 min each in PBST and visualized with enhanced chemiluminescence reagent. For loading controls, blots were then reprehybridized and probed with mouse anti-Snf (1:10) or rat anti-GAGA (1:2,000) antibody and then processed as described above with anti-mouse and anti-rat horseradish peroxidase-conjugated antibodies as secondary probes.
| |
RESULTS |
|---|
|
|
|---|
Sxl transgenes. To address the function of the amino terminus of the Sxl protein, we used the Sxl MS3 cDNA (44) to generate two transgenes, hsp83::SxlFL-MS3 (Sx.FL) and hsp83::Sxl-N40aa (Sx-N) (Fig. 1B). Sx.FL encodes a full-length Sxl isoform (see Materials and Methods), while Sx-N encodes a 40-aa acid truncation which corresponds to the species believed to present in the heads of D. melanogaster males. To try to ensure equal translation, we deleted the 5' UTRs from the Sx.FL and Sx-N cDNAs and changed the translation start regions to match the Drosophila Kozak consensus sequence (13). Both cDNAs retain the long 1.6-kb 3' UTR of the original MS3 cDNA. To drive expression in transgenic animals, the two cDNAs were placed under the control of the constitutive hsp83 promoter.
Full-length Sxl transgenes. We analyzed the biological functions of the Sx.FL transgene and compared its activity to that of the previously analyzed hsp70::SxlcF1 transgene (5). The cF1 transgene differs in two important respects from our transgenes. First, the Sxl cDNA is expressed under the control of the inducible hsp70 promoter. Second, while the cF1 cDNA encodes the same Sxl protein isoform as Sx.FL, it has a nearly full length 5' UTR (with the normal Sxl translation initiation sequence) and a much shorter (220-bp) 3' UTR. The cF1 lines were classified into three groups based on the phenotypic effects of the transgene in wild-type (Sxl+) males. In the first group, males with either one or two copies of the transgene had no obvious phenotype at either 25 or 29°C. In the second, the viability of males with a single copy of the transgene at 25°C was reduced by about one half and the survivors were often, but not always, intersexual. At 29°C, viability of the transgenic males dropped to less than one-fourth; however, the extent of sex transformation remained about the same. This is due to the linkage of sexual differentiation and dosage compensation: an increase in Sxl activity which would make the sex transformation of these males more complete would also enhance male lethality by further disrupting the dosage compensation system. In the third group, viability of males with a single copy of the transgene was reduced to only a few percent, even at 25°C. Our three Sx.FL transgenic lines resemble the strongest cF1 lines in that they are completely male lethal in single copy even at 18°C.
Several experiments show that the lethal effects of Sx.FL are due to the ability of the transgene to both initiate autoregulation and repress dosage compensation. To test the contribution of autoregulation, we examined whether removing the endogenous Sxl locus mitigates the effects of Sx.FL. It does. In a Sxl deficiency background (Sxl7B0 [39]), Sx.FL males are ~15% (143 of 923) as viable as their siblings without the transgene (Fig. 2A). Since the transgene associated lethality is less in the Sxl
background than in the Sxl+ background, the
transgene must be able to transactivate the endogenous gene.
|
Amino-terminal deletion of Sxl. (i) The Sx-N transgene has substantially reduced activity. Deletion of 40 aa from the amino terminus significantly impairs the activity of the Sxl protein. Whereas a single copy of the Sx.FL transgene is fully male lethal, no effects on male viability or morphology were evident in eight of the nine Sx-N lines isolated (Fig. 2B). In the exceptional line, 152, viability was reduced about one-third. Since Western blots indicate that the truncated proteins are expressed (data not shown), the apparent lack of activity of a single copy of the Sx-N transgene indicates that the N-terminal 40 aa are important for the regulatory functions of Sxl protein.
The truncated protein is not, however, completely inert. This can be seen by increasing the dose of Sx-N transgene. In all but one line (line 111), males homozygous for the Sx-N transgene were only 5 to 50% as viable as their homozygous Sx-N sisters (cf. 23 and 11 in Fig. 2B). The reduction in male viability for particular Sx-N inserts is not due to inactivation of vital genes by insertion of the transgene since similar effects are observed in males transheterozygous for different Sx-N transgene inserts (data not shown). Although two copies of the Sx-N transgene reduce male viability, the surviving males are phenotypically normal.(ii) Truncated Sxl protein is capable of initiating autoregulation. As was the case for the full-length protein, the male-lethal effects of the Sx-N protein could be indirect, arising from activation of the endogenous Sxl gene, or could be direct, through repression of dosage compensation. Consistent with the former possibility, viability of Sx-N males carrying two copies of the transgene improves when the Sxl+ gene is removed. In the Sxl+ background, only 5% of the expected Sx-N line 11 males eclose, whereas in the Sxl7B0 background, 50% of the expected male progeny eclose. The increase in viability observed with removal of the endogenous Sxl gene indicates that the Sx-N protein must retain some autoregulatory activity. The remaining lethality (40 to 50%) suggests that the Sx-N transgenes also have dosage compensation activity.
To confirm that the Sx-N transgenes were able to initiate the autoregulatory feedback loop, we analyzed the splicing of endogenous Sxl+ transcripts in an RT-PCR assay (5). As shown in Fig. 3, splicing of Sxl transcripts in wild-type flies is sex specific: only the exon 2:4 splice is observed in females, while only the exon 2:3:4 splice is detected in males (Fig. 1A). If the Sx-N transgene activates the Sxl autoregulatory feedback loop, we should be able to detect some female-specific splice products in Sxl+; transgene males. As can be seen in Fig. 3, female-specific Sxl transcripts are present in males from the five Sx-N transgenic lines examined. Consistent with the presence of female spliced mRNAs, Western blots indicate that the two major Sxl protein isoforms are expressed in these Sx-N males (data not shown). Significant levels of male-specific Sxl transcripts are also present in all but line 152 (which shows lethal effects as a heterozygote). The presence of both female and male splice forms in Sx-N transgenic males implies that the autoregulatory feedback loop either is not activated in every cell or is not activated fully in all cells. Additionally, since these males escaped the lethal effects of the transgene, the autoregulatory feedback loop may not have been turned on in these animals until relatively late in development.
|
(iii) Truncated Sxl protein is impaired for tra
splicing.
While the results described above indicate that the Sx-N
protein retains at least some autoregulatory and dosage compensation activities, the most striking finding is that the protein seems to lack
the ability to regulate the tra sexual differentiation pathway. Shown in Fig. 4A is a comparison of the feminization activities of the Sx.FL and Sx-N transgenes in
males which do not contain the endogenous Sxl locus. This
background allows us to unambiguously ascribe alterations in somatic
sexual differentiation to the Sxl proteins expressed by the transgenes.
The extent of sex transformation that we see in escaper
Sx.FL males again appears to resemble that for the strong
cF1 lines. The males are intersexual; they have
lighter abdominal pigmentation, rotated genitalia, and fewer
sex combs, and they are sterile (Fig.
4A). In sharp contrast, Sxl
; Sx-N males are morphologically
indistinguishable from wild-type males and are fertile (compare flies
in Fig. 4A).
|
|
The Sxl 3' UTR is a cis regulatory region. (i) Sxl protein binds to the 3' UTRs of msl-2 and Sxl mRNAs in vivo. Sxl is thought to block the expression of Msl-2 protein by binding to multiple target sites in the 5' and 3' UTRs of the msl-2 mRNA (4, 29). While full repression requires both UTRs, removal of either the 5' or the 3' UTR alone does not lead to complete derepression. These observations (as well as the msl-independent dosage compensation function of Sxl proposed by Kelley et al. [28]) led us to question whether our Sx.FL and Sx-N transgenes were providing an accurate assessment of the regulatory potential of the full-length and truncated proteins. The long, ~1.6-kb 3' UTRs of the Sx.FL and Sx-N cDNAs contain 10 sequences which closely match the consensus Sxl binding sites, as well as several additional lower-affinity sites (26, 36, 43, 49). If Sxl proteins bind these sites in the transgene mRNAs, they might repress translation by a mechanism analogous to that used in msl-2 regulation.
To explore this possibility, we examined whether Sxl proteins are associated with the 3' UTRs of Sxl and msl-2 RNAs in vivo. RNA was isolated by immunoprecipitating wild-type embryo extracts with either Sxl or
-Gal antibodies and was RT-PCR amplified
by using primers specific to the 3' UTRs of Sxl RNA,
msl-2 RNA, and, as a negative control, mle RNA.
As shown in Fig. 6B and C, 3' UTR
sequences from both Sxl and msl-2 mRNAs are
present in Sxl immunoprecipitates but are not found in
-gal
immunoprecipitates. Confirming the specificity of Sxl
immunoprecipitation, mle RNA can be readily detected in bulk
RNA but is not present in the Sxl (or
-Gal) immunoprecipitate
(Fig. 6A). In previous studies (16), we have found that most
RNAs are partially hydrolyzed during the immunoprecipitation
procedure even in the presence of RNase inhibitors. As a consequence,
RNA sequences distant from the (presumptive) protein binding sequences
are usually absent or present in much lower yields. As would be
expected from the fact that Sxl protein binding sites are located in
the 3' UTR of Sxl mRNAs but not in the translated
sequences, we were unable to detect amplification products in Sxl
immunoprecipitates by using primers for exon sequences encoding the C
terminus of the Sxl protein (data not shown).
|
(ii) Deleting sequences from the 3' UTR increases expression of the
transgene protein.
The in vivo association of Sxl proteins with
the 3' UTRs of Sxl mRNAs is consistent with the
possibility that they negatively regulate their own expression. This
negative autoregulation model makes two predictions. First, the
activities of the Sx.FL and Sx-N transgenes
should be increased by removing target sites for the Sxl protein.
Second, an increase in biological activity should be accompanied
by a corresponding increase in expression of transgene proteins. To test these predictions, we generated two new
transgenes, Sx.FL
and Sx-N
, by deleting
~1 kb from the 3' UTRs of Sx.FL and Sx-N,
respectively. These deletions eliminate 8 of the 10 consensus Sxl
binding sites in the 3' UTR (Fig. 1B).
and Sx-N
transgenes are substantially
enhanced. This is most obvious in the case of the Sx-N
transgene. Whereas a single copy of Sx-N had no male-lethal
effects, males are killed by a single copy of the Sx-N
transgene. Two of the Sx-N
lines (21 and 28) are fully
male lethal (Fig. 2C), while in the third line, 26, less than 10% of
the males survive (data not shown). The activity of the
Sx-FL
transgene is also greater than that of the
Sx.FL transgene; however, since all of the original
Sx.FL lines (as heterozygotes) are completely male lethal in
a Sxl+ background, it is possible to detect the increased
activity only in special genetic backgrounds (see below).
Consistent with the second prediction, deletion of the 3' UTR
increases expression of the transgene proteins. Again this is most easily illustrated for the Sx-N
transgene. Figure
7 compares the amount of Sx-N protein in
Sxl
males from the Sx-N
lines 21 and 28 with that in two Sx-N lines, 152 and 11. Of the nine
Sx-N lines, the highest level of Sx-N protein is found in
line 152, while the other lines resemble line 11 (data not shown). The
amount of Sx-N protein in the two Sx-N
lines is about
twofold higher than that of Sx-N line 152 and nearly threefold higher
than that of line 11. Even more pronounced differences in Sx-N
expression (four to fivefold) between the Sx-N
and
Sx-N lines are observed in females. Western blots of
Sx-FL
and Sx-FL females suggest that there is
also a significant increase in protein expression when the 3' UTR is
deleted (see Fig. 9). However, exact differences in protein expression
cannot be quantified since the Sx.FL protein comigrates with one of the
endogenous proteins.
|
Autoregulatory and dosage compensation activities of the
Sx.FL
and Sx-N
transgenes.
To more
precisely compare the autoregulatory and dosage compensation activities
of Sx.FL
and Sx-N
with those of their
Sx.FL and Sx-N counterparts, we introduced the
UTR deletion transgenes into different genetic backgrounds. As shown
for two of the Sx.FL
lines in Fig. 2C, removal of the
Sxl+ gene (by the 7B0 mutation)
provides no relief from the lethal effects of the transgene. Similar
results were obtained for other lines (not shown). By contrast,
Sx.FL requires the endogenous Sxl locus for
full male lethality. Sx.FL
also has more dosage compensation activity than Sx.FL, as shown by the finding
that Sx.FL
males are not rescued by the H83M2
transgene. Moreover, even when the H83M2 transgene was
combined with the Sxl7B0 mutation, the viability
of the Sx.FL
transgenic males was increased only to
around 20% (Fig. 2C). These results suggest that the
Sx.FL
transgene may kill males by regulating both the
msl-dependent and msl-independent dosage compensation systems.
, the male-lethal effects of Sx-N
do not depend on a functional Sxl+ gene. As
shown in Fig. 2C, the Sxl7B0 mutation did
not rescue Sx-N
line 28 males and resulted in only a very
small (0.1%) increase in viability of Sx-N
line 21 males. In fact, by this measure the dosage compensation activity of the Sx-N
transgene is greater than that of the
Sx.FL transgene (Fig. 2A). The rescuing activity of the
H83M2 transgenes shows that the lethal effects of the
Sx-N
transgene are largely due to a down-regulation of
msl-dependent dosage compensation. Unlike the case for
Sx-FL
, viability of Sx-N
males is
substantially increased by the H83M2 transgene. In the case
of Sx-N
line 28, male viability increases to about 50%,
while in Sx-N
line 21 it is nearly 40%. The fact that
Sx-N
males can be rescued by the H83M2
transgene would also suggest that Sx-N
is less effective
than Sx-FL
in activating the splicing autoregulatory
feedback loop. On the other hand, Sx-N
does have
significant positive autoregulatory activity since Sx-N
males are fully viable when the H83M2 transgene is combined
with the Sxl7B0 mutation but are only partially
viable in either background alone.
The Sx-N
transgene lacks feminization activity.
While the male-lethal effects of Sx-N are enhanced
substantially by removal of the 3' UTR, we were surprised to discover
that there is no evidence of a corresponding increase in tra
activity. Sxl
; Sx-N
males which are
rescued by expression of the msl-2 constitutive transgene are morphologically indistinguishable from wild-type males
and are fertile (not shown). In contrast, the few Sx.FL
males that manage to survive in the Sxl
; H83M2
background have a typical intersexual phenotype (defective or missing
sex combs, female abdominal pigmentation, and rotated or feminized
genitalia [14]) and are sterile (not shown). These results again indicate that the tra regulatory activity of
the truncated Sx-N protein is severely impaired.
is nearly complete. As illustrated
in Fig. 4B for Sx.FL
line 16, Sx.FL
transgene fm3 females are essentially indistinguishable from
wild-type females with respect to external morphology and
pigmentation. A quite different result is obtained for the
Sx-N
transgenes. Although the Sx-N
transgenes increase the viability of the fm3 and
fm7 females as well as if not better than the
Sx.FL
transgenes (Fig. 8), all of the surviving
females remain completely masculinized. As shown for Sx-N
line
28 in Fig. 4B, the rescued fm3 females resemble
wild-type males. This result provides an additional demonstration
that the Sx-N protein is defective in regulating tra
pre-mRNA splicing in vivo.
|
Sxl transgenes alter expression of the endogenous
Sxl gene.
One unexpected finding was that the
Sx.FL
transgene is, if anything, less able to rescue
females from the lethal effects of the fm3 and
fm7 mutations than is the original Sx.FL
transgene (Fig. 8). Since the phenotypic effects of the
Sx.FL
transgene are, by all other measures, much greater
than those of Sx.FL, it should also have been much more effective in
improving the viability of these Sxl mutant females.
Interestingly, the same result was obtained for the
Sxlf2593 allele (14), a hypomorphic,
temperature-sensitive Sxl mutation. Under restrictive growth
conditions, we find that the Sx.FL
transgene does
not rescue female viability as well as the Sx-N
transgene (Fig. 8), although the few Sx-FL
survivors are
completely feminized and are fertile (data not shown). A more complete
rescue of viability is observed for the Sx.FL transgene, but
the survivors are intersexual.
transgenes and their ability to rescue hypomorphic Sxl mutations is that the high levels of
the Sx.FL protein produced by these transgenes negatively regulate the
endogenous Sxl gene. A prediction of the negative
autoregulation model is that an increase in the expression of the
transgene protein (by deleting the 3' UTR) should be accompanied
by a concomitant decrease in the expression of Sxl proteins from the
endogenous gene. To test this, we examined the levels of Sxl protein in
Sx.FL and Sx.FL
transgene females by Western
blotting. The Sx.FL and Sx.FL
transgenes
encode full-length Sxl proteins which comigrate with the 38-kDa (upper)
band observed in wild-type females. Like the Sx-N transgenes
(see above), we found that removal of the 3' UTR sequences
enhanced expression of the full-length protein: females
transgenic for the Sx.FL
construct have higher
levels of the 38-kDa isoform than lines with the full-length 3' UTR
(Fig. 9A; compare lanes 2, 3, and 4 with
lines 5 and 6).
|
lines (which express very high
levels of the 38-kDa Sx.FL transgene protein), there is a reduction in
the amount of the 36-kDa isoform encoded by the endogenous gene to
almost undetectable levels (Fig. 9A). To confirm and extend these
results, we examined the Sxl protein profile in adult carcasses, in
ovaries, and at different stages of development. In carcasses from
adult females, as in whole extracts, only the 38- and 36-kDa Sxl
isoforms are detected. In Sx.FL
females, there is a 1.5- to 3-fold reduction in the yield of the 36-kDa species compared to the
wild type (see the legend to Fig. 9B for quantitation of data for each
line). A more dramatic reduction (three- to sevenfold) of this isoform
is observed in ovaries from Sx.FL
females. In addition to
the isoforms which comigrate with the 36- and 38-kDa species seen in
total extracts, two minor bands of 41 and 43 kDa are typically present
in ovaries. These larger isoforms arise from the use of a 5' donor site
in the middle of exon 8 (44). They are typically found at
much lower yield and can be difficult to resolve. As shown in Fig. 9B,
these isoforms do not appear to be affected by the Sx.FL
transgenes. Furthermore, the transgenes did not have much effect on the
expression of endogenous Sxl proteins (the 36-kDa species) in either 0- to 12-h or 12- to 24-h embryos, but there was a modest reduction in
first-instar larvae (data not shown).
We also examined Sxl protein expression in females carrying the
Sx-N
transgenes. The strongest Sx-N
line
(line 28) shows a modest reduction in the levels of the endogenous 36- and 38-kDa Sxl proteins. However, in other lines that express less Sx-N
protein, there is little effect on the expression of the endogenous Sxl proteins (data not shown). These findings suggest that the Sx-N protein
is less able to repress Sxl protein expression from the endogenous gene
than is Sx.FL.
| |
DISCUSSION |
|---|
|
|
|---|
Sxl belongs to a large family of RRM domain RNA binding proteins (6). Family members play significant roles in all aspects of RNA processing, including splicing, polyadenylation, and translational regulation (30). The strong similarity between family members and their involvement in multiple processes raises the question of how functional specificity is attained. The Drosophila Sxl protein is one of the best-characterized members of this family, and it provides a useful model for understanding what features of the protein contribute to its target specificity and regulatory functions. In this study, we examined the role of the Sxl N-terminal domain by comparing the biological activities of transgenes expressing a full-length Sxl protein and an N-terminal truncation. We show that deletion of the N terminus has much more severe consequences for the splicing functions of the Sxl protein than for its translation functions.
Regulation of the tra pathway. In the current model for tra regulation, Sxl protein prevents the use of the default 3' splice site by binding to the polypyrimidine tract and thereby blocking the binding of U2AF (48). A strong prediction of this model is that RNA binding activity should be sufficient for efficient tra regulation. Since the RNA binding activity of the full-length Sxl protein is reconstituted in vitro by a protein containing only the two RRM domains (26, 37, 42, 50), deletion of the N terminus should have little or no effect on tra splicing. Contrary to this expectation, our in vivo results demonstrate that the truncated Sx-N protein is defective in tra splicing regulation. Thus, additional activities of the Sxl protein are required for tra regulation.
Three lines of evidence support this conclusion. First, the Sx-N transgenes have no effect on the sexual differentiation of Sxl
males. Even under conditions which
suppress the strong male-lethal effects of the most active
Sx-N
transgene (the Sxl
;
msl-2c transgene combination) and hence would be
favorable for detecting sexual transformations, transgenic males are
phenotypically wild type and fertile. Second, although the
Sx-N
transgenes rescue the viability of females carrying
several hypomorphic Sxl mutations at least as well as the
Sx.FL
transgene, they do not rescue the sexual phenotype,
and survivors are still phenotypically male. By contrast, the animals
rescued by the Sx.FL
transgene resemble wild-type
females. Finally, consistent with the apparent lack of biological
activity, tra pre-mRNAs are spliced in a male-like pattern in Sxl
; Sx-N males. In this assay the
Sx-N protein is not, however, completely inert, and very small amounts
of female spliced tra mRNA can be detected after more
extensive PCR amplification. In this context, it should be noted that
Granadino et al. (22) generated an hsp70
transgene that expresses a Sxl protein lacking 94 aa from the N
terminus and examined the state of tra splicing in these
males following heat shock and recovery. After 40 cycles of PCR
amplification, they found significant levels of female spliced
tra in these males. They therefore concluded that the truncated protein has normal tra activity. However, we
have found that the tra female splice product is
preferentially amplified: the relative amount of the female
product increases with each round of amplification, and after very
extensive amplifications, its yield from the Sx-N transgenic
lines can be equal to or greater than the yield of the unspliced and
default PCR products. Therefore, Granadino et al. may have
overestimated the tra regulatory activity of their much
larger N-terminal truncation. It should also be noted that these
authors did not determine whether their very large N-terminal
truncation has biological function and can sex transform males.
Our finding that the first 40 aa of the Sxl protein play an essential
role in the regulation of tra splicing is inconsistent with
the current version of the U2AF blockage model. One possible explanation for the discrepancy is that the N terminus is essential for
Sxl protein binding to tra pre-mRNAs in vivo, even
though it is not critical in vitro. However, if this is the case, it is
not clear why this special requirement for RNA binding would apply to
tra but not to either msl-2 or Sxl
RNA. An alternative, and we believe more plausible, hypothesis is that
this region of the N terminus plays a critical role in some
protein-protein interaction(s). In the simplest revision of the U2AF
competition model, this interaction would be necessary to stabilize the
association of Sxl with the default 3' splice site. A precedent for
this suggestion is the finding that protein-protein interactions are
required to stabilize the binding of Tra, Transformer-2, and SR
proteins to the dsx splicing enhancer in vitro
(34). It is also possible that the N terminus is required in
vivo because tra regulation involves mechanisms different
from those envisioned in the U2AF competition model. For example,
instead of simply competing with U2AF, Sxl might poison snRNP complexes
associated with the default 3' splice site via contacts mediated by its
N-terminal domain. Alternatively, Sxl could have a positive role,
promoting the assembly of snRNP complexes on the downstream
female-specific splice site. Supporting the idea that tra
regulation requires specific protein-protein interactions involving the
N terminus, we have found that a chimeric protein consisting of the
entire Sxl N terminus (but not the RRM domains) fused to
-Gal can
weakly promote the female-specific splicing of tra
pre-mRNAs in vivo in males (16a). Since both of the
known Sxl protein-protein (Sxl-Sxl and Sxl-Snf) interactions are
mediated by the RRM domains, we suppose that the N terminus would have
to interact with some other, as yet unidentified protein. A good
candidate would be the Fl(2)d protein, which Granadino et al.
(21) have shown to be essential for tra
pre-mRNA splicing.
Sxl positive autoregulation. In agreement with the in vitro results of Wang and Bell (49), we find that the N-terminal truncation substantially impairs Sxl splicing regulation in vivo. As suggested above for tra, we presume that the female-specific splicing of Sxl pre-mRNAs is facilitated by a protein-protein interaction(s) mediated by the N-terminal domain. However, the fact that the Sx-N transgenes retain some autoregulatory activity argues that this interaction either is not absolutely essential for Sxl splicing or is redundant. With respect to the latter possibility, the truncated Sx-N protein should be able to participate in both Sxl-Sxl and Sxl-Snf interactions since it retains both RRM domains.
Dosage compensation.
The strong male lethality of the
Sx-N
transgene even in the absence of a
Sxl+ gene indicates that the N-terminal
truncation retains substantial dosage compensation function. Since
these male-lethal effects are suppressed by the constitutive
H83M2 transgene, it would appear that the male-lethal
effects of the truncated protein arise from a down-regulation of
msl-2 translation. It has been suggested that repression of
msl-2 depends on synergistic interactions between Sxl
proteins bound to the 5' and 3' UTRs of the mRNA (3).
The Sx-N protein should be capable of such synergistic interactions since the two RRM domains can mediate contacts between Sxl proteins (36, 42, 50). Although the Sx-N protein retains substantial dosage compensation function, its overall activity is less than that of
Sx.FL. This can be seen by comparing the male-lethal effects of the
Sx-N
and Sx.FL
transgenes in a
Sxl7B0; H83M2 background: while Sx-N
males
are fully rescued in this genetic background, Sx.FL
males are only
partially rescued. This difference could be due, at least in part, to a
reduced activity of the Sx-N protein in the msl-independent
dosage compensation system, where Sxl is thought to down-regulate
X-linked gene expression in females by binding to poly(U)
runs in the 3' UTRs of mRNAs from X-linked genes
(27). If this were correct, it would suggest that full
dosage compensation activity may require interactions between Sxl
and the translational machinery that depend on sequences in the N terminus.
Negative autoregulation.
The finding that Sxl
translationally regulates msl-2 expression prompted Kelley
and Kuroda (27) to examine the occurrence of multiple
Sxl binding sites in transcripts from other genes. They discovered that
mRNAs from many X-linked, but not autosomal, genes have three
or more Sxl consensus binding sites within their 3' UTRs. Surprisingly,
one of these X-linked genes is Sxl itself. This observation
raised the possibility that Sxl proteins might negatively regulate
their own expression by associating with the 3' UTR of the
Sxl mRNA. This hypothesis is supported by several of our
findings. First, we have shown that Sxl proteins are bound to the 3'
UTR of Sxl mRNAs in vivo. Second, the regulatory
activities of the Sx.FL and Sx-N transgenes are
substantially enhanced by deleting most of the 3' UTR from the
transgenes. Third, expression of the endogenous Sxl protein is reduced
when the Sx.FL and, to a lesser extent, Sx-N proteins are
highly expressed. Fourth, even though the activity of the
Sx.FL
transgene is by many criteria much stronger than
its Sx.FL counterpart, it is impaired in its ability to
rescue females from the lethal effects of several hypomorphic Sxl mutations. This paradoxical result could be explained by
the fact the Sx.FL
transgene may be more efficient than
Sx.FL in repressing Sxl protein expression from the
endogenous gene (upsetting the normal balance of Sxl protein isoforms).
and Sx-N
transgenes do not have dominant effects in wild-type females (data not
shown). Such a model is not without precedent; it is thought that the
snf homolog in mammals (U1A) and the poly(A) binding protein
in yeast control their own rates of accumulation by binding to the 3'
UTRs of their respective mRNAs and down-regulating translation
(2, 10). It is also possible that Sxl negative autoregulation is a vital process. In this case, the two- to threefold induction over background of our transgenes would not be
sufficient to reveal this essential role. Perhaps by removing the
additional Sxl binding sites from the 3' UTR of Sx.FL
we
might obtain drastically higher levels of Sxl protein and be able to
test this hypothesis.
This model would also help explain why the 3' UTR profile of the
Sxl mRNAs changes during development (41,
44). The Sxl mRNA profile is dynamic throughout
development. During early embryogenesis, when Sxl protein must be
rapidly synthesized to ensure that the positive (splicing)
autoregulatory feedback loop is activated in all female cells
(5), Sxl mRNAs with short 3' UTRs
and few Sxl protein binding sites
predominate. Later in development when the
Sxl gene is stably activated and a high rate of Sxl protein accumulation would no longer be required, the major Sxl
mRNA species have long 3' UTRs. Negative autoregulation mediated by
Sxl protein binding to multiple sites in the long 3' UTRs of these RNAs
would ensure that the concentration of Sxl protein is maintained at a
constant level. This concentration should be high enough to sustain the positive autoregulatory feedback loop but low enough to avoid toxic effects.
While our results are consistent with the idea that Sxl proteins
negatively regulate their own synthesis through binding sites in the 3'
UTRs of the Sxl mRNAs, the molecular mechanism(s) of repression remain unclear. Northern blots indicate that the level of
RNA from the transgenes with short 3' UTRs (Sx.FL
and
Sx-N
) is higher than from the transgenes with long 3'
UTRs (data not shown). This could mean that the RNAs with the longer
UTRs turn over more rapidly (in our model this would be a consequence
of Sxl protein binding). Alternatively, the reduction might be an indirect consequence of reduced translation. This puzzle is not unique
to the Sxl transgene RNAs; for example, the amount of
msl-2 RNA is less in females than in males (27).
An additional complication with the transgene data is that the RNAs
encoded by these constructs are not spliced. Since 3'-end processing is
often coupled to splicing, it is possible that the postulated
regulation of the transgene RNAs by Sxl proteins follows a
pathway that is different in some respects from that of RNAs
(like msl-2 or the endogenous Sxl mRNAs) which are subject to splicing. Further studies will clearly be required
to elucidate how Sxl is able to reduce protein expression and to show conclusively that Sxl negatively autoregulates
its own expression.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Schedl lab for poignant discussions and advice throughout the course of this work. Special thanks go to Mark Samuels for engineering the Sx.FL and Sx-N plasmids with consensus translation start sites and to Rick Kelley and Mitzi Kuroda for kindly providing the H83M2 transgenic flies and Msl-2 antibody. We also extend our gratitude to Ann Beyer and Sally Elgin for providing anti-Snf and anti-GAGA antibodies, respectively, and to Lynn Enquist, Sherri Bergsten, Julie Waterbury, and Harry Hochheiser for critical reading of the manuscript.
This work was supported by a grant from the National Institutes of Health to P.D.S.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Biology, Princeton University, Princeton, NJ 08544. Phone: (609) 258-5003. Fax: (609) 258-1028. E-mail: jly{at}phoenix.princeton.edu.