Previous Article | Next Article 
Molecular and Cellular Biology, April 1999, p. 3145-3155, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
SAG, a Novel Zinc RING Finger Protein That Protects
Cells from Apoptosis Induced by Redox Agents
Hangjun
Duan,1
Yuli
Wang,1
Micheal
Aviram,2,
Manju
Swaroop,1
Joseph A.
Loo,3
Junhui
Bian,1,
Ye
Tian,1
Tom
Mueller,1
Charles L.
Bisgaier,2,§ and
Yi
Sun1,*
Departments of Molecular
Biology,1 Cardiac and Vascular
Diseases,2 and
Chemistry,3 Parke-Davis
Pharmaceutical Research, Division of Warner-Lambert Company, Ann
Arbor, Michigan 48105
Received 18 November 1998/Returned for modification 22 December
1998/Accepted 11 January 1999
 |
ABSTRACT |
SAG (sensitive to apoptosis gene) was cloned as an
inducible gene by 1,10-phenanthroline (OP), a redox-sensitive compound and an apoptosis inducer. SAG encodes a novel zinc RING
finger protein that consists of 113 amino acids with a calculated
molecular mass of 12.6 kDa. SAG is highly conserved during evolution,
with identities of 70% between human and Caenorhabditis
elegans sequences and 55% between human and yeast sequences. In
human tissues, SAG is ubiquitously expressed at high levels
in skeletal muscles, heart, and testis. SAG is localized in both the
cytoplasm and the nucleus of cells, and its gene was mapped to
chromosome 3q22-24. Bacterially expressed and purified human SAG binds
to zinc and copper metal ions and prevents lipid peroxidation induced
by copper or a free radical generator. When overexpressed in several
human cell lines, SAG protects cells from apoptosis induced by redox agents (the metal chelator OP and zinc or copper metal ions). Mechanistically, SAG appears to inhibit and/or delay metal ion-induced cytochrome c release and caspase activation. Thus, SAG is a
cellular protective molecule that appears to act as an antioxidant to
inhibit apoptosis induced by metal ions and reactive oxygen species.
 |
INTRODUCTION |
Reactive oxygen species (ROS) are a
group of very reactive, short-lived chemicals produced during normal
respiratory processes or after oxidative insults. ROS include
superoxide anion, hydrogen peroxide, hydroxyl radical, and organic
peroxides, among others (56). ROS, at low concentrations,
have been implicated in the regulation of several physiological
processes such as proliferation (55), differentiation
(3), apoptosis (25), and senescence (14). At high concentrations, ROS are highly toxic to cells, by inducing DNA damage, lipid peroxidation, and protein degradation (56). Several lines of evidence suggest that ROS may mediate apoptosis: (i) the production of ROS or depletion of antioxidants promotes apoptosis (43, 64); (ii) antioxidants inhibit
apoptosis (43, 64), and (iii) generation of ROS mediates
p53-induced apoptosis (48). ROS appear to function mainly at
the initiation/activation step of apoptosis since most apoptosis
inducers produce ROS. Examples include irradiation, UV, chemicals,
ceramides, and growth factor withdrawal, among many others (28,
66). How do ROS, as the highly reactive but nonspecific
molecules, mediate well-coordinated apoptosis? It is unlikely that ROS
themselves are direct signaling molecules that activate some crucial
components of apoptosis machinery due to their lack of biological
specificity. More likely, ROS act indirectly by modifying cellular
redox-sensitive molecules, such as p53 and NF-
B, that are directly
involved in apoptosis (6, 42, 58, 61).
Metal chelators and metal ions are redox-sensitive agents that could
mediate ROS generation through the Fenton reaction. 1,10-Phenanthroline (OP), a typical metal chelator (4), has been previously
shown to either induce or suppress apoptosis in a cell line-dependent manner (1, 2, 7, 41). OP induces apoptosis by increasing expression of cell surface APO/Fas ligand (41), by chelating zinc (2, 26), or by chelating copper and promoting its redox activity to induce internucleosomal DNA fragmentation (11,
67). Copper ion (Cu2+) is a highly reactive ion that
has been used in concert with OP, chemicals, or carcinogens to induce
apoptosis in a number of cellular models (11, 24, 51, 53, 67,
70). Cu2+ is readily reduced to Cu+, and
the latter reacts with H2O2 through the Fenton
reaction to form the highly toxic hydroxyl radical that causes cell
death (71). The zinc ion, however, is a rather stable trace
element. It has been found that zinc can either induce or suppress
apoptosis in a concentration-dependent manner (19, 49). High
concentrations of extracellular zinc (500 to 1,000 µM) suppress
apoptosis, probably by either inhibiting a
Ca2+/Mg2+-dependent endonuclease, which is
responsible for DNA fragmentation (73), or by inhibiting
caspase 3 (47). At lower concentrations (80 to 200 µM),
zinc appears to induce apoptosis (19, 49), most likely by
enhancing the generation of hydroxyl free radicals (46).
Furthermore, zinc induces neuronal death both in cultured cells
(12, 31, 39) and in animals (32).
To counteract the damaging effects of ROS, aerobic cells are endowed
with extensive antioxidant defense systems. These defense systems
consist mainly of antioxidant enzymes (e.g., superoxide dismutase,
catalase, glutathione peroxidase, and glutathione reductase), antioxidant proteins (e.g., thioredoxin and metallothionein [MT]), and small molecular antioxidants (e.g., glutathione,
N-acetyl-L-cysteine, and vitamin C). Almost all
antioxidant molecules have been shown to protect cells against
apoptosis induced by redox-sensitive reagents (5, 29, 33,
40).
In an attempt to understand signaling pathways leading to apoptosis
induced by OP, a metal-chelating and redox-sensitive reagent (58), we used the differential display (DD) technique for
identification of OP-responsive genes and reported the cloning of an
OP-inducible gene that encodes glutathione synthetase (GSS)
(57). Here we report the cloning and characterization of
second OP-inducible gene which encodes SAG (sensitive to apoptosis
gene), an evolutionarily conserved novel zinc RING finger protein with
features of metal ion binding and free radical scavenging. When
overexpressed in several human cell lines, SAG protects cells against
apoptosis induced by OP, zinc, and copper. Thus, SAG appears to
function as an antioxidant molecule to inhibit metal ion- or
ROS-induced apoptosis.
 |
MATERIALS AND METHODS |
Cell maintenance and drug treatment.
Human neuroblastoma
line SY5Y and human kidney line 293 were cultured in Dulbecco's
modified Eagle medium containing 10% fetal calf serum (FCS; Sigma).
Human colon carcinoma line DLD-1 was grown in Eagle minimal essential
medium (MEM) containing 10% FCS. Two mouse tumor lines, L-RT101 and
H-Tx, were used. L-RT101, a tumor promoter-transformed JB6 epidermal
line (62), was cultured in Eagle MEM containing, FCS; H-Tx,
a spontaneously transformed liver line (59a), was grown in
Dulbecco's modified Eagle medium supplemented with 10% FCS and 1 mM
sodium pyruvate. For drug treatment, subconfluent cells were exposed to
dimethyl sulfoxide vehicle control, OP or metal ions, zinc sulfate, or
copper sulfate (Sigma) for various periods of time up to 24 h.
DD.
Analysis was performed by using an RNAimage kit B
(GeneHunter) as instructed by the manufacturer, with slight
modification (59). Briefly, total RNA was isolated by using
RNAzol solution (Tel-Test) and subjected to reverse transcription
followed by PCR. PCR fragments were resolved in sequencing gels. The
fragments reproducibly showing differential expression were PCR
amplified and used as probes for Northern analysis. Northern
analysis-confirmed fragments were then subcloned into TA cloning vector
(Invitrogen) and sequenced by using DNA Sequenase version 2.0 (Amersham). The GenBank search was performed with the Genetics Computer
Group program.
cDNA library screening and 5' rapid amplification of cDNA
ends.
The mouse lung cDNA library (Stratagene) was screened with a
DD fragment to clone full-length mouse SAG
(mSAG). The longest clone isolated was a 1.0-kb fragment
consisting of partial open reading frame and the entire 3'-end
untranslated region. A mouse brain Marathon-Ready cDNA (Clontech) was
used to clone the 5'-end upstream sequence, which yielded a 100-bp
fragment consisting of the 5'-end untranslated sequence and some of the
coding sequence. To clone human SAG (hSAG), the
1.0-kb mSAG fragment was used as a probe to screen a human
HeLa cDNA library (Stratagene). A 0.75-kb fragment flanking the entire
open reading frame and some 3'-end untranslated region was obtained.
Cellular localization by immunofluorescence.
Cells were
plated on coverslips in 24-well culture dishes and transfected by the
calcium phosphate method with the following constructs: pcDNA3.1
(vector control with a Myc-His tag; Invitrogen); pcDNA3.1-SAG
(SAG cDNA cloned upstream and in frame with Myc-His tag); or
pcDNA3.1-LacZ. Two days posttransfection, cells were washed with cold
phosphate-buffered saline (PBS) and fixed with 3% formaldehyde in PBS
for 10 min followed by 5 min in methanol-acetone (1:1). The fixed cells
were washed with PBS four times and incubated with Myc tag antibody
(1:200 dilution; Invitrogen) in PBS containing 1% bovine serum
albumin, 0.1% saponin, and 2 µg of 4',6-diamidino-2-phenylindole (DAPI) per ml for 1 h in the dark with shaking. Cells were then washed with 0.1% saponin in PBS and incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse antibody (1:100 dilution; Jackson Laboratory) for 1 h in the same condition as the
first antibody. After incubation, cells were washed first with 0.1%
saponin in PBS and then with PBS. The coverslips were mounted to glass
slides with nonfade mounting medium and analyzed in a Leica Dialux 20 microscope.
Fluorescence in situ hybridization (FISH) chromosome mapping. (i)
Slide preparation.
Lymphocytes isolated from human blood were
cultured in MEM supplemented with 10% FCS and phytohemagglutinin (PHA)
at 37°C for 68 to 72 h. The lymphocyte cultures were treated
with bromodeoxyuridine (0.18 mg/ml; Sigma) to synchronize the cell
population. The synchronized cells were washed with serum-free medium
and recultured at 37°C for 6 h in
-MEM with thymidine (2.5 µg/ml; Sigma). Cell were harvested, and slides were made by using
standard procedures including hypotonic treatment, fixation, and air drying.
(ii) In situ hybridization and FISH detection.
A 750-bp
hSAG cDNA probe was biotinylated with dATP, using the
Bethesda Research Laboratories BioNick labeling kit (15°C, 1 h)
(22). FISH detection was performed as described previously (22, 23). Briefly, slides were baked at 55°C for 1 h.
After RNase treatment, the slides were denatured in 70% formamide in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) for 2 min
at 70°C followed by dehydration with ethanol. Probes were denatured
at 75°C for 5 min in a hybridization mix consisting of 50% formamide
and 10% dextran sulfate. Probes were loaded on the denatured
chromosomal slides. After overnight hybridization, slides were washed
and signals were detected. FISH signals and the DAPI banding pattern
were recorded separately by taking photographs, and FISH mapping data
were correlated with chromosomal bands by superimposing FISH signals
with DAPI-banded chromosomes.
ESI-MS.
Electrospray ionization mass spectrometry (ESI-MS)
was performed with a double-focusing hybrid mass spectrometer (MAT
900Q; Finnigan, Bremen, Germany) with a mass-to-charge range of 10,000 at 5-kV full acceleration potential. A
position-and-time-resolved-ion-counting (PATRIC) scanning array
detector was used. An ESI interface based on a heated metal capillary
inlet and a low-flow micro ESI source (analyte flow rate of 150 nl
min
1) were used (50). The metal capillary
temperature was maintained at around 150 to 200°C for metal-protein
complex studies. Recombinant protein in a 7 M urea-denaturing solution
was refolded by dialysis in 50 µM ZnSO4 for 3 days with
three changes of buffer. Prior to ESI-MS measurement, the SAG solution
was washed with a solution of 10 mM ammonium bicarbonate (pH 7) and 1 mM dithiothreitol (DTT), and excess zinc was removed by centrifugal
ultrafiltration by passage through a 10-kDa-molecular-mass cutoff
centrifugal filtration cartridge (Microcon-10 microconcentrator;
Amicon, Beverly, Mass.). For ESI-MS analysis, a small portion of the
filtered SAG protein solution was diluted into either a denaturing
solvent (80:15:5 [vol/vol/vol] acetonitrile-water-acetic acid [pH
2.5]) or a nondenaturing solution (10 mM ammonium bicarbonate, 1 mM
DTT [pH 7]).
Assay for lipoprotein oxidation.
Lipoproteins (100 µg of
protein/ml; Intraocel) were incubated with 10 µM CuSO4 or
with 5 mM 2,2-azo-bis-2-amidinopropane hydrochloride (AAPH) for 4 h at 37°C in the presence of various concentrations of purified SAG
protein. AAPH is a water-soluble azo compound that thermally decomposes
and generates water-soluble peroxyl radicals at a constant rate
(21). Oxidation was terminated by the addition of 10 µM
butylated hydroxytoluene and refrigeration at 4°C. The extent of
lipoprotein oxidation was measured by the thiobarbituric acid-reactive
substances (TBARS) assay, using malondialdehyde for the standard curve,
as described previously (10).
Antibody generation.
Two polyclonal antibodies against hSAG
protein were generated, using standard methods, by Zymed Laboratories,
Inc. (San Francisco, Calif.). Briefly, the peptide antibody was
generated as following. A 16-amino-acid peptide (SAG-Pepl;
QNNRCPLCQQDWWQR) located in the C terminus of SAG protein (codons 95 to
110) was synthesized and purified via standard techniques. The purified
peptide was conjugated to keyhole limpet hemocyanin via cysteine
residues. The conjugated peptide (0.5 mg) was emulsified with an equal
volume of complete Freund's adjuvant and subcutaneously injected into rabbits, followed by four boosts with 0.5 mg each in incomplete Freund's adjuvant at 3-week intervals. Rabbits were bled 10 days after
the final boost, and antiserum was collected. The same protocol was
used for protein antibody production using bacterially expressed and
purified hSAG protein as the antigen.
Preparation of subcellular fractions.
Subcellular fractions
of the D1-6 and D12-1 cells or 293 transfectants were prepared as
described previously (74). Briefly, the cells were harvested
after exposure to ZnSO4 or CuSO4 for various
periods of time and washed twice with ice-cold PBS. The cell pellet was
resuspended in 5 volumes of cold buffer A (20 mM HEPES-KOH [pH 7.5],
10 mM KCl, 1.5 mM MgCl2, 1 mM sodium EDTA, 1 mM sodium
EGTA, 1 mM DTT, and 0.1 mM phenylmethylsulfonyl fluoride) containing
250 mM sucrose and freshly added protease inhibitor cocktail
(Boehringer Mannheim). After homogenization for 10 strokes with a
Dounce homogenizer, the nuclei were discarded by centrifugation at
1,000 × g for 10 min at 4°C. The supernatant was
further centrifuged at 10,000 × g for 15 min at 4°C,
and the resulting supernatants were used for protein and immunoblot assays.
Immunoblot assay.
The cytosolic proteins (50 µg) prepared
as described above were resolved on a sodium dodecyl
sulfate-polyacrylamide gel and transferred to a polyvinylidene
difluoride membrane. Immunoblots were probed with a monoclonal antibody
against caspase 3 (Transduction Laboratories), a monoclonal antibody
against human cytochrome c (PharMingen), or a rabbit
polyclonal antibody against caspase 7 (15). For SAG
detection, either rabbit anti-SAG antibody (1:1,000 dilution) or Flag
antibody (Sigma) was used. Proteins were detected by horseradish
peroxidase-conjugated secondary antibody coupled with enhanced
chemiluminescence Western blotting detection reagents (Amersham).
Northern analysis and immunoprecipitation.
The assays were
performed as detailed previously (60, 62). Briefly, total
RNA was isolated and subjected to Northern analysis using
mSAG and hSAG cDNA as probes. For
immunoprecipitation, subconfluent SAG transfectants and the
vector control cells were subjected to methionine starvation for 1 h and metabolically labeled with Trans[35S]-label (0.2 mCi/ml) for 3 h. Cells were then lysed on ice for 30 min in lysis
buffer (60) and spun at 12,000 × g. The
equal counts of trichloroacetic acid-precipitable radioactivity in the supernatant (3 × 107 cpm) were immunoprecipitated
with rabbit anti-human SAG antibody. The immunoprecipitates were then
collected, washed, and analyzed by separation on a sodium dodecyl
sulfate-10 to 20% polyacrylamide gel followed by autoradiography.
Densitometric quantitation was performed on a densitometer (Molecular Dynamics).
Construction of SAG expression vectors and
establishment of stable expressing clones.
Reverse
transcription-PCR (60) was performed to clone the
hSAG coding region into the following expression vectors:
pcDNA 3C (containing a Myc tag; Invitrogen), for immunolocalization study; and pcDNA3 (Invitrogen), for stable transfection in DLD-1 cells.
To generate a Flag-tagged SAG expression construct,
hSAG cDNA was PCR amplified by using primers Flag-SAG
(5'-CG GGGTACCGCCATGGACTACAAGGACGACGATGACAAGGCCGACGT GGAAGAC-3')
and SAG-XhoI (5'-CCGCTCGAGTCATTTGCCGATTCTTTGGACCAC-3'). The PCR fragment was subcloned into pcDNA3. All PCR-generated clones were verified by DNA sequencing for appropriate orientation and
freedom of mutations. To establish stable SAG-expressing lines, the
pcDNA3-SAG or pcDNA3-Flag-SAG construct, respectively, was transfected
by Lipofectamine (Bethesda Research Laboratories), along with the
vector control, into DLD-1 human colon carcinoma cells or SY5Y human
neuroblastoma cells that express a low level of endogenous SAG. After
G418 (600 µg/ml) selection, stable clones were ring isolated and SAG
expression was monitored by Northern analysis; selected clones were
then examined for protein expression by immunoprecipitation or Western
analysis. For 293 cells, transient transfection was performed by the
calcium phosphate method as described previously (58).
DNA fragmentation assay.
Subconfluent cells (80 to 90%)
were treated with OP (150 µM) or ZnSO4 (125 µM) for
24 h. Both detached and attached cells were harvested by scraping
with a rubber policeman. Cells were collected by centrifugation and
lysed in lysis buffer (5 mM Tris-HCl [pH 8], 20 mM EDTA, 0.5% Triton
X-100) on ice for 45 min. Fragmented DNA in the supernatant after
centrifugation at 14,000 rpm (45 min at 4°C) was extracted twice with
phenol-chloroform and once with chloroform and then precipitated with
ethanol and salt. The DNA pellet was washed once with 70% ethanol and
resuspended in Tris-EDTA buffer with 100 µg of RNase per ml at 37°C
for 2 h. The fragmented DNA was separated in 1.8% agarose gel
electrophoresis, stained with ethidium bromide, and visualized under UV
light (58).
TUNEL assay.
The terminal
deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling
(TUNEL) assay was performed as instructed by the manufacturer
(Boehringer Mannheim). Briefly, 5 × 104 cells were
plated onto eight-well glass slides. After being treated with 1.25 mM
copper (CuSO4) or 200 µM zinc (ZnSO4) for
16 h, cells were fixed with 0.5% glutaraldehyde for 10 min and
then washed with PBS twice. The fixed cells were incubated in a
permeabilization solution (0.1% Triton X-100, 0.1% sodium citrate)
for 2 min on ice. The TUNEL reaction mixture (50 µl) was added to
samples, which were incubated for 1 h at 37°C and then washed
with PBS three times. Samples were embedded with antifade prior to
analysis under a fluorescence microscope.
Nucleotide sequence accession numbers.
The SAG
sequences have been deposited in GenBank with accession no. AF092877
(mouse) and AF092878 (human). The cDNA clones have also been deposited
in the American Type Culture Collection with assigned numbers 98402 (mouse) and 98405 (human).
 |
RESULTS |
Cloning of a novel protein that is evolutionarily conserved and
contains a zinc RING finger domain.
The DD technique was used in
an attempt to isolate genes responsible for or associated with
OP-induced apoptosis in two murine tumor lines (58). Two
OP-inducible cDNA fragments were isolated. One encodes GSS, while the
other is novel (57). The novel cDNA fragment was used as a
probe to screen a mouse lung cDNA library. The resulting cDNA clone
identified by this method contains a 1,140-bp insert encoding an open
reading frame of 113 amino acids, including 12 cysteine residues (Fig.
1). The open reading frame was preceded
by a 17-bp upstream sequence. An initiation codon was located in a
context that conformed precisely 100% to the Kozak consensus sequence
(34). The 3'-end untranslated region consists of 792 bp of
sequence with two polyadenylation signals (AATAAA). Taken
together, these features indicates that we have cloned a nearly full
length cDNA. Since this clone was inducible in association with the
OP-induced apoptosis pathway, we have named it SAG, for
"sensitive to apoptosis gene."

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1.
SAG is evolutionarily conserved among different species.
Primary amino acid sequences of human and mouse SAG were deduced from
cDNAs cloned through DD and library screening. (A) Comparative
alignments of SAG coding sequences from human, mouse, C. elegans, and yeast. Identity is shaded, and similarity is boxed.
(B) Consensus sequence for the RING-H2 motif and comparison
of the zinc RING finger domain of SAG with the RING-H2
motif. The C3H2C3 residues are in
boldface.
|
|
To clone human
SAG (
hSAG), the mouse
SAG (
mSAG) cDNA was used as a probe to screen a
HeLa cDNA library, and a 754-bp human
clone was isolated. This clone
encodes an open reading frame of
113 amino acids and contains a
polyadenylation signal at the 3'-end
untranslated region. Sequence
identity between the mouse and human
genes at the DNA level is 82%
overall and 94% in the coding region.
At the protein level, they show
96.5% identity. A database search
revealed that these are novel genes
but exhibit in the coding
region 55% identity to yeast (accession no.
Z74876) and 70%
identity to
C. elegans (accession no.
U80449) hypothetical
genes (Fig.
1A).
A motif search of the
SAG open reading frame reveals a
putative C
3H
2C
3
(RING-H
2) zinc RING finger domain at the C terminus
of the
molecule (Fig.
1B). The zinc RING finger protein belongs
to a newly
identified protein family (
9), and
RING-H
2-containing
proteins have been identified in many
species (for a list, see
reference
27). The
RING-H
2 domain identified in the products
of the cloned
SAG genes is completely conserved among the
C. elegans,
mouse, and human homologs. In yeast, only the last
cysteine residue
in C
3H
2C
3 motif is
not conserved (Fig.
1B), which strongly suggests
a functional role for
this
motif.
SAG is inducible by OP in mouse tumor cells.
To confirm that
SAG is subject to OP induction, we performed Northern
analysis with RNAs isolated from two mouse tumor lines, L-RT101 (tumor
promoter-transformed JB6 epidermal cells)(62) and H-Tx
(spontaneously transformed mouse liver cells) (59a). As
shown in Fig. 2, mSAG cDNA
detects an OP-inducible transcript of 1.2 kb in size. Induction occurs
1 h after drug treatment and persists for up to 24 h in both
cell lines, indicating that SAG is an early-response gene.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 2.
SAG is inducible by OP. Subconfluent mouse L-RT101 and
H-Tx cells were treated with OP (150 µM) for various periods of time
up to 24 h and subjected to total RNA isolation and Northern
analysis (with 15 µg of total RNA) using mouse SAG cDNA as a probe.
Ethidium bromide staining of 28S and 18S rRNAs as loading controls is
shown at the bottom.
|
|
Tissue distribution and cellular and chromosomal localization of
SAG.
hSAG expression in several human tissues was examined.
As shown in Fig. 3, hSAG was
ubiquitously expressed in all tissues examined, although relatively low
levels were detected in brain, placenta, lung, and kidney. Very high
mRNA levels were detected in the heart, skeletal muscle, and testis
(lanes 1, 6, and 12).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
SAG expression in multiple human tissues.
hSAG cDNA was used as a probe for Northern analysis of
poly(A)+ RNA isolated from different human tissues
(Clontech). For an internal loading control, the housekeeping -actin
gene was used (bottom).
|
|
The cellular localization of hSAG was examined by immunofluorescent
staining using a Myc-tagged antibody. As shown in Fig.
4A, hSAG is expressed in both the
cytoplasm and nuclei of cells.
As controls, the vector does not show
any staining (Fig.
4B) and

-galactosidase is expressed mainly in the
cytoplasm (Fig.
4C).
The cytoplasm/nuclear localization of hSAG was
also confirmed
in a stable
hSAG transfectant by using rabbit
anti-hSAG antibody
(data not shown). Chromosomal localization of the
hSAG gene was
determined by SeeDNA Inc. (Toronto, Ontario,
Canada), using the
FISH mapping technique with
hSAG cDNA as
a probe. It is mapped
to chromosome 3q22-24 (Fig.
4, bottom).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
Cellular and chromosomal localization of human SAG. (A
to C) Cellular localization. NIH 3T3 cells were plated onto coverslips,
transiently transfected with plasmid encoding SAG-Myc tag, and
immunofluoresced by antibody against Myc tag as detailed in Materials
and Methods. Shown are the SAG-expressing cells (A), vector control
cells (B), and LacZ-expressing cells (C). FISH mapping (bottom) was
done as detailed in Materials and Methods. Shown are the FISH signals
on the chromosome (left) and the same mitotic figure stained with DAPI
to identify chromosome 3 (right).
|
|
Biochemical characterization of hSAG. (i) SAG binds to metal
ions.
We first examined the biochemical activity of SAG. hSAG
protein was expressed in bacteria and purified to near homogeneity (submitted for publication). Since SAG is a cysteine-rich protein containing a zinc RING finger domain, it has the potential to bind with
metal ions. We used ESI-MS (17) to measure the potential zinc ion binding of SAG by comparing the molecular mass of SAG under
denaturing and nondenaturing solution conditions (37, 72).
Prior to ESI-MS analysis, urea-denatured pure SAG protein was dialyzed
against 50 µM ZnSO4 for 3 days with three changes of
dialysis buffer. Higher concentrations of zinc solution were found to
induce precipitation of the protein (data not shown). Under a
denaturing acidic solution (pH 2.5 and high organic concentration) where the protein is not expected to retain metal binding
characteristics even in the presence of zinc, the molecular mass of SAG
was determined to be 12,550 Da, in close agreement with the expected
mass for the apoprotein (12,552 Da) (Fig.
5A). ESI-MS analysis of the SAG protein
in a nondenaturing aqueous solution (pH 7) resulted in higher masses of
12,733 and 12,800 Da (Fig. 5B), consistent for the holoprotein binding
three and four zinc metal ions, respectively.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
SAG is a zinc binding protein. Shown are electrospray
mass spectra of SAG protein in denaturing solvent (80:15:5
[vol/vol/vol] acetonitrile-water-acetic acid [pH 2.5]) (A) and
nondenaturing solution (10 mM ammonium bicarbonate, 1 mM DTT [pH 7])
(B). The expected molecular mass of the apoprotein is 12,552 Da, with
the first methionine deleted during expression and purification in
bacteria. Assay conditions are detailed in Materials and Methods.
|
|
Copper ion binding to SAG was also investigated. As little as 1 µM
CuSO
4 in the dialysis solution causes SAG precipitation
with a blue (copper) color, suggesting copper binding (data not
shown).
Using ESI-MS, we then measured the potential copper binding
of SAG in a
nondenaturing solution as described above. Addition
of copper acetate
to a final concentration of 10 µM results in
a further increase in
mass to approximately 12,929 Da (data not
shown). However, a precise
mass could not be obtained, as a wide
distribution of copper adducts
appears to bind to SAG protein.
Adding copper to higher concentrations
resulted in precipitation
of the
protein.
(ii) SAG prevents LDL oxidation induced by copper ion or a free
radical generator.
Since SAG binds to metal ions, we reasoned that
SAG may prevent metal ion-induced oxidation of macromolecules.
Copper-induced oxidation of low-density lipoprotein (LDL) was used as a
testing model. As shown in Fig. 6,
copper-induced LDL oxidation, as measured by the formation of TBARS, is
slightly enhanced by SAG at low concentrations. At higher SAG
concentrations, however, a dose-dependent inhibition (up to 90%) of
LDL oxidation is observed (Fig. 6A). Inhibition is heat resistant since
heat-treated (60°C for 15 min) SAG retains the activity (Fig. 6B),
suggesting that enzymatic activity is not involved. Inhibitory activity
is, however, completely or partially abolished by pretreatment of SAG
with the alkylating reagent N-ethylmaleimide or
p-hydroxymercuric benzoate, respectively (Fig. 6B). The
results indicate that free SH groups in the SAG molecule are the major
contributors to this activity. Furthermore, MT, a small metal ion
binding protein consisting of 20 cysteine residues out of 61 amino
acids (44), shows an inhibitory curve similar to that for
SAG (Fig. 6C). Glutathione, an additional cysteine-containing peptide,
showed 25% inhibition at a concentration of 100 µM (data not shown).
Inhibition of copper-induced LDL oxidation is, however, not observed in
other known antioxidant enzymes such as superoxide dismutase or
catalase or other proteins such as bovine serum albumin or cytochrome
c (submitted for publication). These results clearly showed
that by binding and chelating copper ion through its free SH groups,
SAG prevents copper-initiated free radical reactions leading to lipid
peroxidation. Superoxide or hydrogen peroxide appears not to be
involved in the process. To test whether protection of SAG against LDL
oxidation is mediated solely through copper binding, we initiated LDL
oxidation by AAPH, a free radical generator (21). In this
metal ion-free system, SAG also inhibits LDL oxidation (up to 85%) at
a concentration of 59 µM (750 µg/ml) (Fig. 6D). Thus, by metal
binding and free radical scavenging, SAG acts as a protector against
lipid peroxidation.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
SAG inhibits LDL oxidation induced by copper or AAPH.
(A) Dose-dependent inhibition of copper-induced LDL oxidation by SAG.
Different amounts of SAG protein were incubated with LDL in the
presence of CuSO4 (10 µM) for 10 min. Oxidation of LDL
was measured by the formation of TBARS as detailed in Materials and
Methods. (B) Abrogation of SAG protection by pretreatment with
alkylating reagents but not by heat. SAG (750 µg/ml, 59 µM) was
preincubated for 10 min with alkylating reagents
N-ethylmaleimide (NEM; 50 mM) and
p-hydroxymercuric benzoate (PHMB; 1 µmol/mg of SAG
protein) or preheated (60°C for 15 min) before being subjected to LDL
oxidation assay. Cont, control. (C) Dose-dependent inhibition of
copper-induced LDL oxidation by MT. Different amounts of MT (from
rabbit liver or horse kidney) were incubated with LDL in the presence
of CuSO4 (10 µM) for 10 min. Oxidation of LDL was
measured by the formation of TBARS. (D) Inhibition of LDL oxidation
induced by AAPH. SAG (750 µg/ml, 59 µM) was incubated with LDL in
the presence of AAPH (5 mM) for 10 min. Formation of TBARS was measured
as a index of LDL oxidation.
|
|
SAG protects cells from apoptosis induced by redox-sensitive
reagents.
Apoptosis has been widely implicated in human diseases
such as cancers and neurodegenerative disorders (66). Since
(i) SAG is inducible concurrent with the OP-induced
apoptosis pathway, (ii) bacterially expressed SAG binds to metal ions,
zinc, and copper, which also mediate apoptosis (19, 67), and
(iii) bacterially expressed hSAG prevents copper or ROS-induced lipid
peroxidation, we examined the potential role of SAG in redox-induced
apoptosis. Several stable hSAG transfectants were generated
in DLD-1 human colon carcinoma cells. Two transfectants (D12-1 and
D12-8) showed high expression of SAG mRNA and protein compared to the
neo controls (D1-3 and D1-6) (Fig. 7A).
Sensitivity to apoptosis induced by OP as well as metal ions (zinc and
copper) was examined by morphological appearance and DNA fragmentation.
Treatment of cells with 150 µM OP or 125 µM ZnSO4 for
24 h induced marked cell shrinkage and detachment in the neo
control cells. These morphological signs of apoptosis were
significantly reduced in SAG-expressing cells (data not shown). In the
same treated cells, a DNA fragmentation ladder is clearly seen in two
neo control lines (Fig. 7B [lanes 1 and 3] and C [lanes 1 and 2])
but significantly reduced in two SAG-overexpressing transfectants (Fig.
7B [lanes 2 and 4] and C [lanes 3 and 4]). In the case of copper
sensitivity (up to 750 µM), expression of SAG does not offer
significant protection when judged by morphological signs of apoptosis
(not shown). Higher doses induce apoptosis in both lines (data not
shown). These results indicated that when overexpressed, SAG protected
DLD-1 colon carcinoma cells from apoptosis induced by OP and zinc.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 7.
Overexpression of hSAG protects DLD-1 colon carcinoma
cells from apoptosis induced by OP and zinc. (A) Selection of
SAG-expressing stable clones. DLD-1 cells were transfected with the neo
control pcDNA3 or hSAG expression plasmid pcDNA-SAG. After
G418 selection, resistant colonies were ring cloned and subjected to
detection of exogenous SAG expression. (a) Expression of SAG mRNA.
Total RNA was isolated and subjected to Northern analysis. Vector
controls, D1-3 and D1-6; hSAG transfectants, D12-1 and
D12-8. (b) 28S and 18S rRNAs for loading controls. (c) Expression of
SAG protein in transfectants. The vector control lines and
hSAG transfectants were subjected to immunoprecipitation.
Shown is SAG protein expression in the neo controls (D1-3 and D1-6) and
hSAG transfectants (D12-1 and D12-8). (B and C) hSAG
overexpression protects cells from DNA fragmentation induced by OP or
zinc. hSAG transfectants (D12-1 and D12-8), along with the
vector control cells (D1-3 and D1-6), were seeded at 3.0 × 106 to 3.5 × 106 per 100-mm-diameter dish
and exposed after 16 to 24 h to OP (150 µM; B) or zinc sulfate
(125 µM; C) for 24 h. Both detached and attached cells in 2- by
100-mm dishes were harvested and subjected to DNA fragmentation assay.
The 100-bp size marker is shown in the leftmost lane.
|
|
To examine a potential role of SAG in the protection against neuronal
apoptosis, we transfected
hSAG into SY5Y human neuroblastoma
cells and selected stable lines that expressed exogenous SAG,
as
determined by Western blotting (Fig.
8A).
One
hSAG transfectant
(SYW-20) and a vector
control (SYV-3) were evaluated for sensitivity
to the metal ions zinc
and copper. As shown in Fig.
8B, SAG expression
causes no morphological
change in untreated cells (panels a and
b). Treatment with 1.25 mM
CuSO
4 (panels c and d) or 200 µM ZnSO
4 (panels e and f) for 16 h induces cell shrinkage and detachment
in
the neo control cells (panels c and e) but to a lesser extent
in
SAG-expressing cells (panels d and f). The morphological difference
is
more obvious with zinc treatment. To determine the nature of
cell
death, the TUNEL assay, a fluorescein labeling assay specific
for free
3'-OH termini generated during cleavage of genomic DNA
during
apoptosis, was performed. As shown in Fig.
8C, substantially
more
fluorescein staining is seen in the vector control cells
than that in
hSAG-expressing cells after 16 h of treatment with
either 1.25 mM
CuSO
4 (compare panels c and d) or 200 µM
ZnSO
4 (compare panels e and f). Results of the TUNEL assay
agree well
with morphological observations, and both assays indicate a
protective
role of SAG in apoptosis induced by metal ions.


View larger version (137K):
[in this window]
[in a new window]
|
FIG. 8.
Overexpression of hSAG protects SY5Y neuroblastoma cells
from apoptosis induced by copper and zinc. (A) Selection of
SAG-expressing stable clones. SY5Y cells were transfected with the neo
control pcDNA3 or hSAG expression plasmid pcDNA-Flag-SAG.
After G418 selection, resistant cell lines were ring cloned and
subjected to Western blot analysis for exogenous SAG expression with
anti-Flag antibody. (B) Protection of metal-induced apoptosis as shown
by morphological appearance. SAG-expressing cells (SYW20 [b, d, and
f]) and neo control cells (SYV3 [a, c, and e]) were untreated (a and
b) or exposed to CuSO4 (1.25 mM [c and d]) or
ZnSO4 (200 µM [e and f]) for 16 h. Morphology was
visualized at a magnification of ×200. (C) Protection of metal-induced
apoptosis as shown by TUNEL assay. Cells were exposed to metal ions for
16 h as described above (without treatment [a and b]; with 1.25 mM CuSO4 [c and d]; with 200 µM ZnSO4 [e
and f]), then subjected to TUNEL assay as detailed in Materials and
Methods, and analyzed under a fluorescence microscope with a blue
filter. Magnification, ×200.
|
|
To examine SAG protection of an entire cell population against
apoptosis, 293 human kidney cells were transiently transfected
with an
hSAG expression construct. Under our experimental
conditions,
50 to 70% transfection efficiency can be reached with 293 cells
(not shown). Twenty-four hours posttransfection, one set of
transfectants
was examined by Western blot analysis to confirm SAG
expression
(not shown), whereas the other set was exposed to
CuSO
4 or ZnSO
4.
SAG expression in these 293 cells protects against copper- but
not zinc-induced morphological signs
of apoptosis (data not shown).
These results obtained from three
independent human cell lines
demonstrate that SAG acts as an
antioxidant molecule to protect
cells against apoptosis induced by
redox agents. Protection against
metal-induced apoptosis appears to be
cell line
dependent.
To examine whether SAG functions in antioxidant pathways mainly to
inhibit apoptosis, SAG stable transfectants (DLD-1 and
SY5Y) along with
the vector controls were exposed to other common
apoptosis inducers.
Appearance of apoptosis was examined by morphological
observation and
DNA fragmentation assay. SAG protects cells only
partially against
apoptosis induced by etoposide (a DNA-damaging
reagent) or UV but not
at all against staurosporine-induced apoptosis
(data not shown). Thus,
SAG appears to play a role mainly in inhibiting
apoptosis induced by
redox
agents.
Metal ions induce cytochrome c release and caspase
activation that can be inhibited or delayed by SAG expression.
Although metal ions have been shown to induce apoptosis through ROS
generation, the mechanism of action underlying their effect is not
clear. Since cytochrome c release from mitochondria and subsequent caspase activation are the key events in apoptosis (30,
35, 36, 43, 74), levels of cytochrome c released into
the cytoplasm and potential activation of caspase were examined following treatment with metal ions. As shown in Fig. 9A
(top), there is a low basal level of
cytoplasmic cytochrome c in DLD-1 cells. Treatment of cells
with 140 µM ZnSO4 induces the release of cytochrome
c into the cytoplasm. Densitometric analysis shows a 2.7- or
2.26-fold increase of cytoplasmic cytochrome c in the vector
control D1-6 cells at 16 or 24 h posttreatment, respectively. In
SAG-expressing D12-1 cells, an increase of cytoplasmic cytochrome c does not occur until 24 h and reaches a lower level
(0.87- or 1.5-fold increase over the control at 16 or 24 h,
respectively). Likewise, activation of caspase 7, inferred from the
disappearance of the proenzyme form, is seen in a time-dependent manner
after zinc treatment (bottom panel). More extensive activation
(disappearance of the band) is observed in the vector-transfected cells
(0.6- or 0.47-fold below that in untreated control at 16 or 24 h,
respectively) than in SAG-expressing cells (1- or 0.68-fold lower than
the control value at 16 h or 24 h, respectively). A similar
result was obtained with caspase 3 activation (data not shown).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 9.
Overexpression of SAG inhibits or delays metal
ion-induced cytochrome c release and caspase activation. (A)
SAG-expressing DLD cells (D12-1) and neo control cells (D1-6) were
subjected to ZnSO4 (140 µM) treatment for the indicated
periods of time. The cytoplasmic fraction was extracted and subjected
to Western blot analysis with antibodies against cytochrome
c (top) and caspase 7 (bottom). (B) Human 293 cells were
transiently transfected with hSAG expression plasmid or the
neo control. Twenty-four hours posttransfection, cells were treated
with CuSO4 (2 mM) for the indicated periods of time and
subjected to Western blot analysis with antibodies against cytochrome
c (top) and caspase 7 (bottom). Densitometric quantitation
was performed in a densitometer. The band density from the untreated
control was arbitrarily chosen as 1.
|
|
To further examine the potential protection by SAG against metal
ion-induced cytochrome
c release and caspase activation,
we
also measured cytochrome
c release and caspase activation in
293 cells transiently transfected with the SAG-expressing plasmid
following exposure to copper. As shown in Fig.
9B (top), a significant
increase of cytochrome
c release begins to occur 6 h
after CuSO
4 (2.0 mM) treatment and lasts for up to 12 h (1-, 2.52-, 1.36-,
1.49-, or 0.97-fold increase at 0, 6, 8, 12, or
16 h posttreatment,
respectively). Expression of SAG decreases as
well as delays cytochrome
c release (1-, 1.15-, 1.25-, 1.18-, or 1.02-fold increase at 0,
6, 8, 12, or 16 h,
respectively). Significant activation of caspase
7 is seen in the
vector control cells 12 and 16 h after copper
treatment (1-, 0.91-, 0.95-, 0.75-, or 0.58-fold decrease at 0,
6, 8, 12, or 16 h, respectively). In contrast, no significant
activation is seen in
hSAG transfectants (1-, 1.09-, 1.2-, 1.08-,
or 0.87-fold at
0, 6, 8, 12, or 16 h, respectively) (bottom panel).
Similar
results were seen with caspase 3 activation (data not
shown). These
results indicate that metal ion treatment induces
cytochrome
c release and caspase activation during apoptosis which
can
be largely inhibited or delayed by SAG
overexpression.
 |
DISCUSSION |
SAG is a novel member of the zinc RING finger family of
proteins.
Using the DD technique, we identified an OP-inducible
gene, SAG, that encodes a novel protein containing zinc RING
finger domain. Zinc RING finger genes represent is a new and growing family of genes (20, 52) whose members contain
C3HC4 or
C3H2C3 (a cysteine-to-histidine
change) motif and are involved biochemically in DNA binding, RNA
binding, and protein-protein interactions (8, 9, 16, 38).
Biologically, the zinc RING finger proteins are involved in many
processes, including oncogenesis, signal transduction, and development,
among others (52). Some RING finger proteins, including the
baculovirus protein p35 and mammalian homologs of baculovirus
inhibitors of apoptosis, are known to inhibit apoptosis (13, 63,
68). SAG, described here, consists of 113 amino acids with 12 cysteine residues. It is the smallest of the RING finger proteins, with
50% of the polypeptide consisting of a RING domain. The protective
activity against redox-induced apoptosis renders SAG the first
antioxidant molecule among RING finger family members.
SAG is evolutionarily conserved and expressed highly in
energy-consuming organs.
SAG is evolutionarily conserved, with 55 or 70% identity, respectively, between human and yeast or human
and C. elegans sequences. High sequence homology often
suggests a functional conservation, as seen in many other proteins,
including the apoptosis-related proteins Bcl-2, Apaf-3/caspase 9, and Apaf-1 and their C. elegans homologs, ced-9, ced-3, and
ced-4, respectively (35, 69, 75). Indeed, hSAG
and ySAG (yeast homolog of hSAG) have similar
functions: yeast lethality induced by disruption of ySAG can
be fully complemented by hSAG (unpublished data). Thus,
hSAG could be a growth-essential gene by functioning as an
antioxidant molecule to protect cells against ROS-induced death or by
promoting cell growth through other mechanisms (unpublished data).
Consistent with its antioxidant activity, SAG is expressed at high
levels in human heart, skeletal muscle, and testis. These
three organs
consist of either muscle cells for contraction or
sperm cells for
mobility. The cellular movement in these organs
requires much higher
amounts of oxygen, resulting in high collateral
levels of ROS. It is
conceivable, therefore, that these organs
express a high constitutive
level of SAG as a defense against
ROS-induced damage. Accordingly, the
striated myofibers in skeletal
muscle and heart are long-lived cells,
while several inherited
muscle diseases, including muscular dystrophy
and spinal muscle
atrophy, are characterized by degeneration of muscle
fibers through
apoptosis and necrosis (
18,
65). It will be
of great interest
to examine SAG expression in these diseased
cells.
SAG is an antioxidant molecule that inhibits apoptosis
in multiple human tumor lines.
In an attempt to isolate genes that
mediate OP-induced apoptosis (58), we used the DD technique
and isolated two OP-inducible genes. The first gene encodes GSS, the
enzyme involved in the last step of glutathione synthesis
(57), and the second is SAG. Both seem to be
involved in antioxidant pathways that counteract rather than potentiate
OP-induced apoptosis (reference 57 and this report).
Induction of GSS and SAG, therefore, appears to be a cellular defense response against OP-induced redox disturbance. When this disturbance is dominant and overcomes the protective response, cells eventually undergo apoptosis. In addition to being inducible by the redox agent OP in mouse cell lines, SAG was
also induced in mouse brain after ischemia damage (unpublished
observation). Thus, SAG appears to be a stress-responsive
gene in cells that acts as a protector against ROS-induced damage.
Metal chelators and metal ions have been shown to induce apoptosis
through ROS generation. Under our experimental conditions,
OP,
Cu
2+, or Zn
2+ alone induces apoptosis in DLD-1
colon carcinoma cells, SY5Y
neuroblastoma cells, or 293 cells, as
evidenced by morphological
appearance, TUNEL assay, and DNA
fragmentation. SAG, when overexpressed
in these cells, plays a
protective role, although the degree of
protection against each reagent
varies among the tested cell lines.
How does SAG function as an
inhibitor of redox-induced apoptosis?
In vitro biochemical analysis
could provide a clue. Bacterially
expressed and purified hSAG has metal
ion binding activity. This
is likely mediated by cysteine residues (a
total of 12) as well
as histidine residues (a total of three) in SAG
molecule. The
fact that SAG binds to three or four zinc ions but the
zinc RING
finger structure would predict binding of only two zinc ions
may
imply that in vitro-purified SAG does not adapt a RING finger
conformation or that other cysteine or histidine residues not
involved
in the RING structure also bind to zinc. As a result
of copper binding,
SAG prevents copper-induced LDL oxidation which
is the result of a
radical chain reaction initiated by Cu
2+ reduction. The
same activity but with a higher specificity was
detected by using MT, a
cysteine-rich small protein which was
found to bind with seven metal
ions per molecule (
45). A similar
dose-dependent inhibition
curve between SAG and MT suggests that
the reaction follows similar
kinetics. It is conceivable that
a lower concentration of MT than of
SAG is needed to achieve the
same degree of inhibition due to MT's
higher content of cysteine
residues and higher capacity for metal
binding per molecule. It
is not clear, however, why at a low
concentration both SAG and
MT stimulate lipid peroxidation under this
experimental condition.
In addition to inhibiting copper-induced LDL
oxidation, SAG also
inhibits lipid peroxidation induced by AAPH, a free
radical generator.
Thus, SAG binds to copper to prevent initiation of
radical reactions
as well as scavenges the radicals to terminate the
reaction. Furthermore,
subcellular localization of SAG in both the
cytoplasm and the
nucleus makes it readily accessible to metal ions and
ROS generated
during oxidative
stress.
We observed that the sensitivity to metal ions and protection by SAG
were cell density as well as cell line dependent. In
general, cells at
a higher density can tolerate a higher concentration
of metal ions,
particularly zinc due to cell-cell communication.
The cell line
dependence could result from differences in cellular
redox buffering
capacity, including levels of other antioxidant
molecules as well as
the balance of prooxidants and antioxidants
in these cells. It is
noteworthy that there is a very narrow range
of concentration in metal
ion-induced apoptosis. A slight increase
of metal ion concentration
above the threshold would lead to a
marked appearance of apoptosis. As
expected, SAG could protect
cells only up to a certain level, above
which the protective effect
was abolished. It is conceivable that zinc
and copper are trace
elements in cells and OP is not present. Exogenous
challenge with
excess metal ions or a redox agent could induce a series
of cellular
responses. If the concentration was beyond tolerable
levels, apoptosis
would occur rapidly, as seen in OP-induced apoptosis
(
58), even
though both GSS and SAG were induced
(
57).
Since apoptosis is mediated in many cases by cytochrome
c
release followed by caspase activation (
30,
35,
36,
43,
74),
we examined this signaling pathway in a metal ion-induced
apoptosis
model. We showed, for the first time, that either zinc
or copper would
induce cytochrome
c release and caspase activation.
How do
metal ions induce cytochrome
c release? The simplest
explanation
is that metal ions trigger ROS generation followed by
mitochondrial
membrane damage that leads to cytochrome
c
release. Additional
studies on mitochondrial membrane integrity and
permeability following
exposure to metal ions needs to be conducted to
understand the
process. Bcl-2, a well-known apoptosis inhibitor, blocks
cytochrome
c release from mitochondria in cells undergoing
apoptosis (
30,
74). Bcl-2 has also been shown to inhibit
apoptosis in an antioxidant
pathway (
25). Difference in
subcellular localization between
SAG (cytoplasm and nucleus) and Bcl-2
(mitochondria and endoplasmic
reticulum) may determine their
antioxidant functions at different
organelles. In addition to
antioxidant activity, Bcl-2 also possesses
pore-forming properties that
prevent cytochrome
c release (
54).
Protection by
SAG against cytochrome
c release and caspase activation
is
most likely to operate through its metal ion binding and radical
scavenging
activities.
In summary, we have cloned and characterized a novel, evolutionarily
conserved antioxidant protein, SAG, that in vitro binds
to metal ions
and inhibits lipid peroxidation and in vivo protects
cells from
redox-induced apoptosis. Based on its tissue distribution
and
biological functions, SAG could have potential therapeutic
applications
in diseases such as cancers (
66), neurodegenerative
disorders (
66), stroke (
32), and muscular
dystrophy (
18,
65).
 |
ACKNOWLEDGMENTS |
We thank Steve Hunt (Parke-Davis) for helpful discussion and Paul
Miller (Pfizer Central Research) for critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, Parke-Davis Pharmaceutical Research, Division of
Warner-Lambert Company, 2800 Plymouth Road, Ann Arbor, MI 48105. Phone:
(734) 622-1959. Fax: (734) 622-7158. E-mail:
yi.sun{at}wl.com.
Present address: Lipid Research Laboratory, Rambam Medical Center,
Bat-Galim, Haifa 31096, Israel.
Present address: Abilene Christian University, Abilene, TX 79699.
§
Present address: Esperion Therapeutic, Inc., Ann Arbor, MI 48108.
 |
REFERENCES |
| 1.
|
Abello, P. A.,
S. A. Fidler,
G. B. Bulkley, and T. G. Buchman.
1994.
Antioxidants modulate induction of programmed endothelial cell death (apoptosis) by endotoxin.
Arch. Surg.
129:134-141[Abstract/Free Full Text].
|
| 2.
|
Adebodun, F., and J. F. Post.
1995.
Role of intracellular free Ca(II) and Zn(II) in dexamethasone-induced apoptosis and dexamethasone resistance in human leukemic CEM cell lines.
J. Cell. Physiol.
163:80-86[Medline].
|
| 3.
|
Allen, R. G., and A. K. Balin.
1989.
Oxidative influence in development and differentiation: an overview of a free radical theory of development.
Free Radical Biol. Med.
6:631-661[Medline].
|
| 4.
|
Auld, D. S.
1988.
Use of chelating agents to inhibit enzymes.
Methods Enzymol.
158:110-114[Medline].
|
| 5.
|
Baker, A.,
C. M. Payne,
M. M. Briehl, and G. Powis.
1997.
Thioredoxin, a gene found overexpressed in human cancer, inhibits apoptosis in vitro and in vivo.
Cancer Res.
57:5162-5167[Abstract/Free Full Text].
|
| 6.
|
Beg, A. A., and D. Baltimore.
1996.
An essential role for NF- B in preventing TNF- induced cell death.
Science
274:782-784[Abstract/Free Full Text].
|
| 7.
|
Bessho, R.,
K. Matsubara,
M. Kubota,
K. Kuwakado,
H. Hirota,
Y. Wakazono,
Y. W. Lin,
A. Okada,
M. Kawai, and R. Nishikomori.
1994.
Pyrrolidine dithiocarbamate, a potent inhibitor of nuclear factor B (NF- B) activation, prevents apoptosis in human promyelocytic leukemia HL-60 cells and thymocytes.
Biochem. Pharmacol.
48:1883-1889[Medline].
|
| 8.
|
Boddy, M. N.,
P. S. Freemont, and K. L. B. Borden.
1994.
The p53-associated protein MDM2 contains a newly characterized zinc-binding domain called the RING finger.
Trends Biochem. Sci.
19:198-199[Medline].
|
| 9.
|
Borden, K. L. B., and P. S. Freemont.
1996.
The ring finger domain: a recent example of a sequence-structure family.
Curr. Opin. Struct. Biol.
6:395-401[Medline].
|
| 10.
|
Buege, J. A., and S. D. Aust.
1976.
Microsomal lipid peroxidation.
Methods Enzymol.
52:302-310.
|
| 11.
|
Burkitt, M. J.,
L. Milne,
P. Nicotera, and S. Orrenius.
1996.
1,10-Phenathroline stimulates internucleosomal DNA fragmentation in isolated rat-liver nuclei by promoting the redox activity of endogenous copper ions.
Biochem. J.
313:163-169.
|
| 12.
|
Chio, D. W.,
M. Yokoyama, and J. Koh.
1988.
Zinc neurotoxicity in cortical cell culture.
Neuroscience
24:67-79[Medline].
|
| 13.
|
Clem, R. J., and L. K. Miller.
1994.
Control of programmed cell death by the baculovirus genes p35 and iap.
Mol. Cell. Biol.
14:5212-5222[Abstract/Free Full Text].
|
| 14.
|
deHaan, J. B.,
F. Cristiano,
R. Ianello,
C. Bladier,
M. J. Kelner, and I. Kola.
1996.
Elevation in the ratio of Cu/Zn superoxide dismutase to glutathione peroxidase activity induces features of cellular senescence and this effect is mediated by hydrogen peroxide.
Hum. Mol. Genet.
5:283-292[Abstract/Free Full Text].
|
| 15.
|
Duan, H.,
A. M. Chinnaiyan,
P. L. Hudson,
J. P. Wing,
W.-W. He, and V. M. Dixit.
1996.
ICE-LAP3, a novel mammalian homologue of the Caenorhabditis elegans cell death protein Ced-3 is activated during Fas- and tumor necrosis factor-induced apoptosis.
J. Biol. Chem.
271:1621-1625[Abstract/Free Full Text].
|
| 16.
|
Elenbass, B.,
M. Dobbelstein,
J. Roth,
T. Shenk, and A. J. Levine.
1996.
The MDM2 oncoprotein binds specifically to RNA through its RING finger domain.
Mol. Med.
2:439-451[Medline].
|
| 17.
|
Fenn, J. B.,
M. Mann,
C. K. Meng,
S. F. Wong, and C. M. Whitehouse.
1989.
Electrospray ionization for mass spectrometry of large biomolecules.
Science
246:64-71[Abstract/Free Full Text].
|
| 18.
|
Fidzianska, A.,
H. H. Goebel, and I. Warlo.
1990.
Acute infantile spinal muscular atrophy. Muscle apoptosis as a proposed pathogenetic mechanism.
Brain
113:433-445[Abstract/Free Full Text].
|
| 19.
|
Fraker, P. J., and W. G. Telford.
1997.
A reappraisal of the role of zinc in life and death decision of cells.
Proc. Soc. Exp. Biol. Med.
215:229-236[Medline].
|
| 20.
|
Freemont, P. S.,
I. M. Hanson, and J. Trowsdale.
1991.
A novel cystein-rich sequence motif.
Cell
64:483-484[Medline].
|
| 21.
|
Frei, B.,
R. Stocker, and B. N. Ames.
1988.
Antioxidant defenses and lipid peroxidation in human blood plasma.
Proc. Natl. Acad. Sci. USA
85:9748-9752[Abstract/Free Full Text].
|
| 22.
|
Heng, H. H. Q.,
J. Squire, and L. C. Tsui.
1992.
High resolution mapping of mammalian genes by in situ hybridization to free chromatin.
Proc. Natl. Acad. Sci. USA
89:9509-9513[Abstract/Free Full Text].
|
| 23.
|
Heng, H. H. Q., and L. C. Tsui.
1993.
Modes of DAPI banding and simultaneous in situ hybridization.
Chromosoma
102:325-332[Medline].
|
| 24.
|
Hiraku, Y., and S. Kawanishi.
1996.
Oxidative DNA damage and apoptosis induced by benzene metabolites.
Cancer Res.
56:5172-7178[Abstract/Free Full Text].
|
| 25.
|
Hockenbery, D. M.,
Z. N. Oltwai,
X. M. Yin,
C. L. Milliman, and S. J. Korsmeyer.
1993.
Bcl-2 functions in an antioxidant pathway to prevent apoptosis.
Cell
22:241-251.
|
| 26.
|
Hughes, F. M., Jr., and J. A. Cidlowski.
1994.
Regulation of apoptosis in S49 cells.
J. Steroid Biochem. Mol. Biol.
49:303-310[Medline].
|
| 27.
|
Inouye, C.,
N. Dhillon, and J. Thorner.
1997.
Ste5 RING-H2 domain: role in Ste4-promoted oligomerization for yeast pheromone signaling.
Science
278:103-106[Abstract/Free Full Text].
|
| 28.
|
Jacobson, M. D.
1996.
Reactive oxygene species and program cell death.
Trends Biochem. Sci.
21:83-86[Medline].
|
| 29.
|
Kayanoki, Y.,
J. Fujii,
K. N. Islam,
K. Suzuki,
S. Kawata,
Y. Matsuzawa, and N. Taniguchi.
1996.
The protective role of glutathione peroxidase in apoptosis induced by reactive oxygen species.
J. Biochem.
119:817-822[Abstract/Free Full Text].
|
| 30.
|
Kluck, R. M.,
E. Bossy-Wetzel,
D. R. Green, and D. D. Newmeyer.
1997.
The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis.
Science
275:1132-1136[Abstract/Free Full Text].
|
| 31.
|
Koh, J.-Y., and D. W. Choi.
1994.
Zinc toxicity on cultured cortical neurons: involvement of N-methyl-D-aspartate receptors.
Neuroscience
60:1049-1057[Medline].
|
| 32.
|
Koh, J.-Y.,
S. Suh,
B. Gwag,
Y. He,
C. Hsu, and D. W. Choi.
1996.
The role of zinc in selective neuronal death after transient global cerebral ischemia.
Science
272:1013-1016[Abstract].
|
| 33.
|
Kondo, Y.,
J. M. Rusnak,
D. G. Hoyt,
C. E. Settineri,
B. R. Pitt, and J. S. Lazo.
1997.
Enhanced apoptosis in metallothionein null cells.
Mol. Pharmacol.
52:195-201[Abstract/Free Full Text].
|
| 34.
|
Kozak, M.
1991.
Structural features in eukaryotic mRNAs that modulate the initiation of translation.
J. Biol. Chem.
266:19867-19870[Free Full Text].
|
| 35.
|
Li, P.,
D. Nijhawan,
I. Budihardjo,
S. M. Srinivasula,
M. Ahmad,
E. S. Alnemri, and X. Wang.
1997.
Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.
Cell
91:479-489[Medline].
|
| 36.
|
Liu, X.,
C. N. Kim,
J. Yang,
R. Jemmerson, and X. Wang.
1996.
Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c.
Cell
86:147-157[Medline].
|
| 37.
|
Loo, J. A.
1997.
Studying noncovalent protein complexes by electrospray ionization mass spectrometry.
Mass Spectrom. Rev.
16:1-23[Medline].
|
| 38.
|
Lovering, R.,
I. M. Hanson,
K. L. B. Bordern,
S. Martin,
N. J. O'Reilly,
G. I. Evan,
D. Rahman,
D. J. C. Pappin,
J. Trowsdale, and P. S. Freemont.
1993.
Identification and preliminary characterization of a protein motif related to the zinc finger.
Proc. Natl. Acad. Sci. USA
90:2112-2116[Abstract/Free Full Text].
|
| 39.
|
Manev, H.,
E. Kharlamov,
T. Uz,
R. P. Mason, and C. M. Cagnoli.
1997.
Characterization of zinc-induced neuronal death in primary cultures of rat cerebellar granule cells.
Exp. Neurol.
146:171-178[Medline].
|
| 40.
|
Manna, S. K.,
H. J. Zhang,
T. Yan,
L. W. Oberley, and B. B. Aggarwal.
1998.
Overexpression of manganese superoxide dismutase suppresses tumor necrosis factor-induced apoptosis and activation of nuclear transcription factor-kappaB and activated protein-1.
J. Biol. Chem.
273:13245-13254[Abstract/Free Full Text].
|
| 41.
|
Mariani, S. M.,
B. Matiba,
C. Baumler, and P. H. Krammer.
1995.
Regulation of cell surface APO-1/Fas (CD95) ligand expression by metalloproteases.
Eur. J. Immunol.
25:2303-2307[Medline].
|
| 42.
|
Mayo, M. W.,
C.-Y. Wang,
P. C. Cogswell,
K. S. Rogers-Graham,
S. W. Lowe,
C. J. Der, and A. S. Baldwin, Jr.
1997.
Requirement of NF- B activation to suppress p53-independent apoptosis induced by oncogenic Ras.
Science
278:1812-1815[Abstract/Free Full Text].
|
| 43.
|
Mignotte, B., and J.-L. Vayssiere.
1998.
Mitochondria and apoptosis.
Eur. J. Biochem.
252:1-15[Medline].
|
| 44.
|
Nordberg, M.
1986.
Metallothionein deserves attention.
Prog. Clin. Biol. Res.
214:401-410[Medline].
|
| 45.
|
Otvos, J. D., and I. M. Armitage.
1980.
Structure of the metal clusters in rabbit liver metallothionein.
Proc. Natl. Acad. Sci. USA
77:7094-7098[Abstract/Free Full Text].
|
| 46.
|
Paramanantham, R.,
K. H. Sit, and B. H. Bay.
1997.
Adding Zn2+ induces DNA fragmentation and cell condensation in cultured human Chang liver cells.
Biol. Trace Elem. Res.
58:135-147[Medline].
|
| 47.
|
Perry, D. K.,
M. J. Smyth,
H. R. Stennicke,
G. S. Salvesen,
P. Duriez,
G. G. Poirier, and Y. A. Hannun.
1997.
Zinc is a potent inhibitor of the apoptotic protease, caspase-3: a novel target for zinc in the inhibition of apoptosis.
J. Biol. Chem.
272:18530-18533[Abstract/Free Full Text].
|
| 48.
|
Polyak, K.,
Y. Xia,
J. L. Zweier,
K. W. Kinzler, and B. Vogelstein.
1997.
A model for p53-induced apoptosis.
Nature
389:300-305[Medline].
|
| 49.
|
Provinciali, M.,
G. D. Stefano, and N. Fabris.
1995.
Dose-dependent opposite-effect of zinc on apoptosis in mouse thymocytes.
Int. J. Immunopharmacol.
17:735-744[Medline].
|
| 50.
|
Sannes-Lowery, K. A.,
P. Hu,
D. P. Mack,
H.-Y. Mei, and J. A. Loo.
1997.
HIV-1 tat peptide binding to TAR RNA by electrospray ionization mass spectrometry.
Anal. Chem.
69:5130-5135[Medline].
|
| 51.
|
Satoh, K.,
T. Kadofuku, and H. Sakagami.
1997.
Copper, but not iron, enhances apoptosis-inducing activity of antioxidants.
Anticancer Res.
17:2487-2490[Medline].
|
| 52.
|
Saurin, A. J.,
K. L. B. Border,
M. N. Boddy, and P. S. Freemont.
1996.
Does this have a familiar RING?
Trends Biochem. Sci.
21:208-214[Medline].
|
| 53.
|
Sawada, T.,
S. Hashimoto,
H. Furukawa,
S. Tohma,
T. Inoue, and K. Ito.
1997.
Generation of reactive oxygen species is required for bucillamine, a novel anti-rheumatic drug, to induce apoptosis in concert with copper.
Immunopharmacology
35:195-202[Medline].
|
| 54.
|
Schendel, S. L.,
Z. Xie,
M. O. Montal,
S. Matsuyama,
M. Montal, and J. C. Reed.
1997.
Channel formation by antiapoptotic protein Bcl-2.
Proc. Natl. Acad. Sci. USA
94:5113-5118[Abstract/Free Full Text].
|
| 55.
|
Shibanuma, M.,
T. Kuroki, and K. Nose.
1990.
Stimulation by hydrogen peroxide of DNA synthesis, competence family gene expression and phosphorylation of a specific protein in quiescent Balb/3T3 cells.
Oncogene
5:1025-1032[Medline].
|
| 56.
|
Sun, Y.
1990.
Free radicals, antioxidant enzymes, and carcinogenesis.
Free Radical Biol. Med.
8:583-599[Medline].
|
| 57.
|
Sun, Y.
1997.
Induction of glutathione synthetase by 1,10-phenanthroline.
FEBS Lett.
408:16-20[Medline].
|
| 58.
|
Sun, Y.,
J. Bian,
Y. Wang, and C. Jacobs.
1997.
Activation of p53 transcriptional activity by 1,10-phenanthroline, a metal chelator and redox sensitive compound.
Oncogene
14:385-393[Medline].
|
| 59.
|
Sun, Y.,
G. Hegamyer, and N. H. Colburn.
1994.
Molecular cloning of five messenger RNAs differentially expressed in preneoplastic or neoplastic JB6 mouse epidermal cells: one is homologous to human tissue inhibitor of metalloproteinases-3.
Cancer Res.
54:1139-1144[Abstract/Free Full Text].
|
| 59a.
|
Sun, Y.,
G. Hegamyer,
K. Nakamurra,
H. Kim,
L. W. Oberley, and N. H. Colburn.
1993.
Alterations of the p53 tumor-suppressor gene in transformed mouse liver cells.
Int. J. Cancer
55:952-956[Medline].
|
| 60.
|
Sun, Y.,
K. Nakamura,
G. A. Hegamyer,
Z. G. Dong, and N. H. Colburn.
1993.
No point mutation of H-ras or p53 genes expressed in preneoplastic-to neoplastic progression as modeled in mouse JB6 cell variants.
Mol. Carcinog.
8:49-57[Medline].
|
| 61.
|
Sun, Y., and L. W. Oberley.
1996.
Redox regulation of transcriptional activators.
Free Radical Biol. Med.
21:335-348[Medline].
|
| 62.
|
Sun, Y.,
Y. Pommier, and N. H. Colburn.
1992.
Acquisition of a growth-inhibitory response to phorbol ester involves DNA damage.
Cancer Res.
52:1907-1915[Abstract/Free Full Text].
|
| 63.
|
Takahashi, R.,
Q. Deveraux,
I. Tamm,
K. Welsh,
N. Assa-Munt,
G. S. Salvesen, and J. C. Reed.
1998.
A single BIR domain of XIAP sufficient for inhibiting caspases.
J. Biol. Chem.
273:7787-7790[Abstract/Free Full Text].
|
| 64.
|
Tan, S.,
Y. Sagara,
Y. Liu,
P. Maher, and D. Schubert.
1998.
The regulation of reactive oxygen species production during programmed cell death.
J. Cell Biol.
141:1423-1432[Abstract/Free Full Text].
|
| 65.
|
Tews, D. S.,
H. H. Goebel, and H. M. Meinck.
1997.
DNA-fragmentation and apoptosis-related proteins of muscle cells in motor neuron disorders.
J. Neuropathol. Exp. Neurol.
56:150-156[Medline].
|
| 66.
|
Thompson, C. B.
1995.
Apoptosis in the pathogenesis and treatment of disease.
Science
267:1456-1462[Abstract/Free Full Text].
|
| 67.
|
Tsang, S. Y.,
S. C. Tam,
I. Bremner, and M. J. Burkitt.
1995.
Copper-1,10-phenanthroline induces internucleosomal DNA fragmentation in HepG2 cells, resulting from direct oxidation by the hydroxyl radical.
Biochem. J.
317:13-16.
|
| 68.
|
Uren, A. G.,
M. Pakush,
C. J. Hawkins,
K. L. Puls, and D. L. Vaux.
1996.
Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.
Proc. Natl. Acad. Sci. USA
93:4974-4978[Abstract/Free Full Text].
|
| 69.
|
Vaux, D. L.,
I. L. Weissman, and S. K. Kim.
1992.
Prevention of programmed cell death in Caenorhabditis elegans by human bcl-2.
Science
258:1955-1957[Abstract/Free Full Text].
|
| 70.
|
Wang, T.-S.,
C.-F. Kuo,
K.-Y. Jan, and H. Huang.
1996.
Arsenite induces apoptosis in Chinese hamster ovary cells by generation of reactive oxygen species.
J. Cell. Physiol.
169:256-268[Medline].
|
| 71.
|
Wolfe, J. T.,
D. Ross, and G. M. Cohen.
1994.
A role for metals and free radicals in the induction of apoptosis in thymocytes.
FEBS Lett.
352:58-62[Medline].
|
| 72.
|
Witkowska, H. E.,
C. H. L. Shackleton,
K. Dahlman-Wright,
J. Y. Kim, and J.-A. Gustafsson.
1995.
Mass spectrometric analysis of a native zinc-finger structure: the glucocorticoid receptor DNA binding domain.
J. Am. Chem. Soc.
117:3319-3324.
|
| 73.
|
Wyllie, A. H.
1980.
Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation.
Nature
284:555-556[Medline].
|
| 74.
|
Yang, J.,
X. Liu,
K. Bhalla,
C. N. Kim,
A. M. Ibrado,
J. Cai,
T.-I. Peng,
D. P. Jones, and X. Wang.
1997.
Prevention of apoptosis by bcl-2: release of cytochrome c from mitochondria blocked.
Science
275:1129-1132[Abstract/Free Full Text].
|
| 75.
|
Zou, H.,
W. J. Henzel,
X. Liu,
A. Lutschg, and X. Wang.
1997.
Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3.
Cell
90:405-413[Medline].
|
Molecular and Cellular Biology, April 1999, p. 3145-3155, Vol. 19, No. 4
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tan, M., Davis, S. W., Saunders, T. L., Zhu, Y., Sun, Y.
(2009). RBX1/ROC1 disruption results in early embryonic lethality due to proliferation failure, partially rescued by simultaneous loss of p27. Proc. Natl. Acad. Sci. USA
106: 6203-6208
[Abstract]
[Full Text]
-
He, H., Gu, Q., Zheng, M., Normolle, D., Sun, Y.
(2008). SAG/ROC2/RBX2 E3 ligase promotes UVB-induced skin hyperplasia, but not skin tumors, by simultaneously targeting c-Jun/AP-1 and p27. Carcinogenesis
29: 858-865
[Abstract]
[Full Text]
-
Gu, Q., Bowden, G. T., Normolle, D., Sun, Y.
(2007). SAG/ROC2 E3 ligase regulates skin carcinogenesis by stage-dependent targeting of c-Jun/AP1 and I{kappa}B-{alpha}/NF-{kappa}B. JCB
178: 1009-1023
[Abstract]
[Full Text]
-
Gu, Q., Tan, M., Sun, Y.
(2007). SAG/ROC2/Rbx2 Is a Novel Activator Protein-1 Target that Promotes c-Jun Degradation and Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Neoplastic Transformation. Cancer Res.
67: 3616-3625
[Abstract]
[Full Text]
-
Blackstone, N. W., Bridge, D. M.
(2005). Model Systems for Environmental Signaling. Integr. Comp. Biol.
45: 605-614
[Abstract]
[Full Text]
-
Furukawa, M., Xiong, Y.
(2005). BTB Protein Keap1 Targets Antioxidant Transcription Factor Nrf2 for Ubiquitination by the Cullin 3-Roc1 Ligase. Mol. Cell. Biol.
25: 162-171
[Abstract]
[Full Text]
-
Donaldson, T. D., Noureddine, M. A., Reynolds, P. J., Bradford, W., Duronio, R. J.
(2004). Targeted Disruption of Drosophila Roc1b Reveals Functional Differences in the Roc Subunit of Cullin-dependent E3 Ubiquitin Ligases. Mol. Biol. Cell
15: 4892-4903
[Abstract]
[Full Text]
-
Kim, Y.-S., Lee, J.-Y., Son, M.-Y., Park, W., Bae, Y.-S.
(2003). Phosphorylation of Threonine 10 on CKBBP1/SAG/ROC2/Rbx2 by Protein Kinase CKII Promotes the Degradation of I{kappa}B{alpha} and p27Kip1. J. Biol. Chem.
278: 28462-28469
[Abstract]
[Full Text]
-
Li, J., Jiang, P., Robinson, M., Lawrence, T. S., Sun, Y.
(2003). AMPK-{beta}1 subunit is a p53-independent stress responsive protein that inhibits tumor cell growth upon forced expression. Carcinogenesis
24: 827-834
[Abstract]
[Full Text]
-
Huang, Y., Tan, M., Gosink, M., Wang, K. K. W., Sun, Y.
(2002). Histone Deacetylase 5 Is Not a p53 Target Gene, But Its Overexpression Inhibits Tumor Cell Growth and Induces Apoptosis. Cancer Res.
62: 2913-2922
[Abstract]
[Full Text]
-
Cornu, T. I., de la Torre, J. C.
(2001). RING Finger Z Protein of Lymphocytic Choriomeningitis Virus (LCMV) Inhibits Transcription and RNA Replication of an LCMV S-Segment Minigenome. J. Virol.
75: 9415-9426
[Abstract]
[Full Text]
-
Tan, M., Bian, J., Guan, K., Sun, Y.
(2001). p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis
22: 295-300
[Abstract]
[Full Text]
-
Wu, K., Fuchs, S. Y., Chen, A., Tan, P., Gomez, C., Ronai, Z.'e., Pan, Z.-Q.
(2000). The SCFHOS/beta -TRCP-ROC1 E3 Ubiquitin Ligase Utilizes Two Distinct Domains within CUL1 for Substrate Targeting and Ubiquitin Ligation. Mol. Cell. Biol.
20: 1382-1393
[Abstract]
[Full Text]
-
Tan, M., Wang, Y., Guan, K., Sun, Y.
(2000). PTGF-beta , a type beta transforming growth factor (TGF-beta ) superfamily member, is a p53 target gene that inhibits tumor cell growth via TGF-beta signaling pathway. Proc. Natl. Acad. Sci. USA
97: 109-114
[Abstract]
[Full Text]
-
Sun, Y.
(1999). Alterations of SAG mRNA in human cancer cell lines: requirement for the RING finger domain for apoptosis protection. Carcinogenesis
20: 1899-1903
[Abstract]
[Full Text]
-
Chen, A., Wu, K., Fuchs, S. Y., Tan, P., Gomez, C., Pan, Z.-Q.
(2000). The Conserved RING-H2 Finger of ROC1 Is Required for Ubiquitin Ligation. J. Biol. Chem.
275: 15432-15439
[Abstract]
[Full Text]