Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 1999, p. 3216-3223, Vol. 19, No. 4
Lineberger Comprehensive Cancer
Center,1 Department of
Medicine,2 and Department of
Microbiology and Immunology,3 University of
North Carolina, Chapel Hill, North Carolina 27599-7295
Received 23 July 1998/Returned for modification 19 October
1998/Accepted 14 January 1999
Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA-1) is the
essential protein for maintenance of the EBV episome and establishment of latency. The BamHI Q promoter (Qp) is used for the
transcription of EBNA-1 mRNA in type I and type II latency, which are
EBV infection states exemplified by Burkitt's lymphoma and
nasopharyngeal carcinoma. However, Qp is inactive in type III latency,
and other promoters (the BamHI C promoter and/or the
BamHI W promoter) are used for EBNA-1. The involvement of
interferon regulatory factors (IRFs) in the regulation of Qp is
suggested by the presence of an essential interferon-stimulated
response element (ISRE) in the promoter. In this work, expression of
IRF-2 is shown to be inversely associated with Qp status, i.e., IRF-2
levels are high in type III latency (when Qp is inactive) and low in
type I latency (when Qp is active). Also, IRF-2 is identified by
electrophoretic mobility shift assay as the major protein binding to
the Qp ISRE in type III latency. In transient transfection assays,
IRF-2 represses the activity of Qp-reporter constructs. Overexpression
of IRF-2 in a type I latency cell line did not activate the endogenous
Qp but marginally reduced the EBNA-1 mRNA level. Switching from type
III latency (Qp inactive) to type II latency (Qp active), as produced
by cell fusion, is directly associated with greatly reduced expression of IRF-2. These data strongly suggest that IRF-2 is a negative regulator of Qp and may contribute to the silencing of Qp in type III latency.
The biologic hallmark of
Epstein-Barr virus (EBV) and its usual interaction with B lymphocytes
is latency. Three types of latency, each having a distinct pattern of
gene expression, have been described. Type I latency is exemplified by
Burkitt's lymphoma (BL) tumors in vivo and earlier passages of
cultured cell lines derived from BL biopsy specimens. Only EBV nuclear
antigen 1 (EBNA-1) is expressed in this form of latency. Several
reports suggest that a type I-like form of latency exists in healthy
carriers of EBV (4, 29, 38, 53). Interestingly, cells in
type I latency can escape host immune surveillance because EBNA-1 can interfere with its peptide presentation on major histocompatibility complex class I molecules (25), which might explain the
lifelong reservoir of virus in immunocompetent, seropositive persons.
Type II latency is found in fusions between lymphoblastoid cell lines (LCLs) and epithelial cell lines, in nasopharyngeal carcinoma and in
Hodgkin's disease. EBNA-1, latent membrane protein 1 (LMP-1), LMP-2A,
and LMP-2B are expressed in type II latency. Type III latency is
represented by LCLs established after EBV infection of adult primary B
cells in vitro and by group III BL lines. Nine viral proteins are
expressed, including six nuclear proteins (EBNA-1, EBNA-2, EBNA-3A,
EBNA-3B, EBNA-3C, and EBNA-LP) and three integral membrane proteins
(LMP-1, LMP-2A, and LMP-2B) (reviewed in references 22 and 40).
EBNA-1 is the sole protein needed for the replication of the EBV
episome and maintenance of the latent infection state, events which are
essential for cell immortalization (reviewed in references 22 and 40). The promoter usage
for expression of EBNA-1 differs in different types of latency. In type
I and II latency, the BamHI Q promoter (Qp) is used for the
transcription of EBNA-1 mRNA. However, in type III latency Qp is
silent, and the BamHI C promoter and/or the BamHI
W promoter (C/Wp) are used (see Fig. 1A). The biological consequence of
the Qp-to-C/Wp switch and the conversion to type III latency is the
expression of the full spectrum of latency genes (reviewed in reference
40), which confer enhanced cell survival, growth,
and invasive potential (5, 12, 14, 19, 48, 54, 59).
Since Qp usage not only is essential for the survival of the virus in
an immunocompetent host but also is associated with several tumors,
understanding the regulation of Qp is essential for understanding the
viral program in EBV-associated tumors. Both EBNA-1 and host factors
are involved in the transcriptional regulation of Qp. The downstream
element of Qp, the Q locus (see Fig. 3A), contains two binding sites
for the EBNA-1 protein, which binds to them and acts in an
autoregulatory manner to repress Qp transcription (43, 50).
However, E2F-1 overcomes EBNA-1-mediated repression of Qp in transient
transfection assays, and E2F-1 binds to the Q locus and displaces the
binding of EBNA-1 (49), so that the promoter is regulated in
a cell cycle-dependent manner (8).
An interferon-stimulated response element (ISRE) has been discovered
and appears to be essential for the constitutive activity of Qp (see
Fig. 3A) (32, 44, 61). Interferon regulatory factors (IRFs),
which are a group of transcription factors with multiple functions
(reviewed in reference 30), could potentially bind
to the ISRE and regulate the activity of Qp. A newly identified IRF-7
has been implicated as a negative regulator of Qp (61). IRF-2, which is usually a repressor of transcription (3, 9, 11,
15, 17, 18, 20, 27, 28, 35), has been reported to be a major
positive regulator of Qp based on transient transfection assays in
IRF-2-null mouse embryonic fibroblasts (32, 44). The
cellular genes activated by IRF-2 that have been identified are the
histone H4 gene (55), as well as vascular cell adhesion molecule-1 (VCAM-1), which is highly cell specific (21).
Perhaps the most intriguing aspect of Qp is how it is rendered inactive
selectively in type III latency. Since any IRF could potentially bind
to the Qp ISRE, the possibility that IRFs other than IRF-7 are involved
in the inactivation of Qp was raised. The data presented in this paper
suggest that IRF-2 acts as a constitutive repressor of Qp in type III latency.
Cell culture.
DG75 is an EBV-negative BL line
(2). Sav I and Sav III, and Kem I and Kem III, are paired
EBV-positive BL lines that differ only in their latent infection types
(33, 41). CB95, X50-7, SFC-4, and KR-4 are LCLs (23,
34, 57). Jijoye is an EBV-positive type III BL line, and Akata is
a type I BL line (51). FaDuHyg is a head-and-neck squamous
carcinoma line (39). All these lines were maintained in
RPMI-1640 plus 10% fetal bovine serum (FBS). KH-1 and KH-2 lines were
derived from fusion of KR-4 (LCL) and HeLa (cervical carcinoma) cells
(6). DKO is a mouse embryonic fibroblast line with targeted
disruption of both the IRF-1 and the IRF-2 gene (28). KH-1,
KH-2, HeLa, and DKO were maintained in Dulbecco's modified Eagle
medium (DMEM) plus 10% FBS.
Plasmids and antibodies.
IRF-2 and IRF-7A expression
plasmids and IRF-7 antibody have been described elsewhere (35,
61). pcDNA/CD4 is a human CD4 expression plasmid (a gift from J. Ting). The Transient transfection and isolation of transfected cells.
For DG75, Akata, and Jijoye cells, 107 cells in 0.5 ml of
medium were used for transfection with a Bio-Rad Gene Pulser (at 320 V
and 975 µF). For FaDuHyg cells, Superfect transfection reagents were
used according to the manufacturer's recommendations (Qiagen). For DKO
cells in 60-mm culture dishes with 40 to 60% confluence, 24 µg of
Lipofectamine reagents (GIBCO BRL) in 400 µl of serum-free Opti-MEM
(GIBCO BRL) was mixed gently with another 400 µl of Opti-MEM containing 7.5 µg of DNA. These mixtures were then gently shaken at
room temperature for 15 min, and 1 ml of serum-free medium was added
before application to DKO cells, which were rinsed once with serum-free
medium. After 2 h of incubation in a 37°C incubator, the cells
were rinsed again with complete DMEM. Two days after transfection,
cells were collected for chloramphenicol acetyltransferase (CAT) assay
or for isolation of transfected cells. The CAT and
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Interferon Regulatory Factor 2 Represses the
Epstein-Barr Virus BamHI Q Latency Promoter in Type
III Latency
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase expression plasmid, pCMV
(6177-1), was
purchased from Clontech, pQ1-CAT (
173 to +116 relative to the Qp
start site) was obtained by removal of a
HindIII-BamHI fragment from pF2-CAT
(49), while pQ2-CAT (
173 to +5) was made by cloning the
corresponding PCR fragment into pBS-CAT (10). The anti-IRF-1
(C-20) and anti-IRF-2 (C-19) antibodies were purchased from Santa Cruz
Biotechnology, Inc. The anti-
-tubulin antibody (T-6557) was from
Sigma. The Western blot analysis with enhanced chemiluminescence (ECL)
and protein assay were carried out essentially as described elsewhere (42, 61).
-galactosidase
assays were essentially the same as described elsewhere (24, 42,
61). The CAT assay results were analyzed on a Molecular Dynamics PhosphorImager.
RPA.
RNase protection assays (RPAs) were performed with
total RNA by use of the U.S. Biochemicals RPA kit. The hybridization
temperature was 37°C. The glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) probe was provided by U.S. Biochemicals, Inc. The EBNA-1 probe was generated by PCR with the Extend high-fidelity PCR system (Boehringer Mannheim) and specific primers. The sequence of primer A is
5'-GCTCTAGATAATACGACTCACTATAGGG CGACAGACCCAAGCTTGGTACCGAGCTCGGATCCTGTCATAACAAG GTCCTTAATCGCA-3',
and that of primer B is
5'-GCTCTAGAGACTACCGACGAAGGAACTTGG-3'. Primer A contains the
T7 RNA polymerase promoter sequence to allow the transcription of the
antisense EBNA-1 RNA probe and a spacer to provide separation between
the unprotected and protected regions of the probe in the RPA. The
protected region of EBNA-1 corresponds to nucleotides (nt) 109437 to
109704 of the EBV B95-8 strain. The purified PCR product was confirmed
by enzymatic digestion and used directly for RNA probe synthesis by use
of T7 RNA polymerase (Promega) and [
-32P]UTP
(Amersham). The H4 histone probe was also generated by PCR with
specific primers in a manner similar to that for EBNA-1. The sequences
of primers used are 5'-GCTCTAGATTAAGCGGATCTCTGGCCTCAT-3' and
5'-GCTCTAGAT AATACGACTCACTATAGGGCGACAGACCCAAGCCTTGGTACCGAGC TCGGATCCCTAGCCTCCGAAGCCGTAGAGGGTTCTC-3'.
The protected region corresponds to nt 743 to 924 of the
published sequence (36).
EMSA. Cell lysates were made and an electrophoretic mobility shift assay (EMSA) was performed essentially as described elsewhere (26, 37, 61). When antiserum was needed, 1 µl was added to the reaction mixture. The Qp ISRE probe is the same as F7/8, which has a 21-bp region from Qp (61).
RT-PCR for detection of Qp and C/Wp. C/Wp and Qp activities were detected by reverse transcription-PCR (RT-PCR) with primer pairs which can distinguish the use of C/Wp from that of Qp (53). After RT-PCR, the products were separated on a 2% agarose gel, transferred to a nitrocellulose membrane, and probed with labeled primers for specific detection of either the C/Wp- or the Qp-derived PCR product. C/Wp activity was determined by the detection of both EBNA-2 and EBNA-1 (Y3/U/K spliced form) mRNAs. Qp activity was determined by detection of the Q/U/K spliced form of EBNA-1 mRNA. F promoter (Fp) activity was determined by detection of the F/U/K form of EBNA-1 mRNA (45) by use of induced Akata cDNA as a positive control. The F+9 oligonucleotide (5'-gctctagaGAGAGGAGGGGGATCCGGAG-3', corresponding to nt 62239 to 62258) was used as a primer for the BamHI F region. (The lowercase letters stand for the non-EBV sequences.) All the other primers and probes were the same as reported elsewhere (53). With reference to the B95-8 genomic sequence, the genome coordinates for these primers and probes are 62440 to 62457, 107986 to 107967, 14802 to 14822, 48583 to 48562, 67544 to 67563, 48397 to 48416, and 47855 to 47904 (53).
| |
RESULTS |
|---|
|
|
|---|
Expression of IRF-2 is associated with EBV type III latency. The association of IRF-7 with EBV type III latency has been established (61), and the levels of expression of other IRFs were investigated. Specifically, the expression of IRF-1 and IRF-2 was examined by Western blot analysis with specific antisera against IRF-1 or IRF-2 proteins. Sav I and Sav III, as well as Kem I and Kem III, are paired, genetically identical EBV-infected cell lines that differ only in their types of latency (33, 41). As shown in Fig. 1B, IRF-2 is expressed at much higher levels in type III latency (Fig. 1B, lanes 2 and 4) than in type I latency (lanes 1 and 3). IRF-2 is also expressed at higher levels in SFC-4, CB95, X50-7, and Jijoye cells (all type III) than in Akata cells (type I) (Fig. 1B, lanes 5 and 6; Fig. 3D, lanes 1 and 2; also data not shown) (34, 51). In contrast, the IRF-1 level is basically unchanged in type I and III cells. The types of latency were confirmed by detection of LMP-1, EBNA-1, and EBNA-2 proteins. In all the cell lines tested, the expression of IRF-2 is higher in type III cells than in type I cells. These data show that a high level of expression of IRF-2 is associated with type III latency and suggest that IRF-2 is a negative regulator of Qp because Qp is inactive in type III latency.
|
IRF-2 is the major protein binding to the Qp ISRE in type III latency. Since the Qp ISRE is essential for Qp activity (50, 61), the binding of various IRFs to Qp is likely to be informative about their relative contributions to the regulation of Qp. An EMSA was used to examine the protein-binding pattern generated with this element in type I and type III cell extracts. Lysates were prepared from Akata (type I) and CB95 (type III) cells, and equal amounts of protein were used with the Qp ISRE as the probe. There are clear differences in the protein-binding patterns with type I and III cell lysates (Fig. 2A). In CB95 lysates, a major band was detected that disappeared when the cold Qp ISRE competitor (100×) was used (Fig. 2A, lane 4) but not by competition with mutated or unrelated probes (data not shown). The protein in that band was identified as IRF-2 by supershifting produced with an IRF-2 antibody and not with IRF-7 or IRF-1 antibodies (Fig. 2A, lanes 5 to 8). Almost identical results could be obtained when SFC-4 (type III) lysate was used for supershift analysis. Under several EMSA conditions tested, IRF-2 was always the major binding protein. As expected, IRF-2 binding was barely detectable with the type I extracts (Fig. 2A, lanes 2 and 9); a large amount of protein from Akata cells was required to detect any binding (data not shown). Similar results were obtained with the paired cell lines, such as Sav I and Sav III (Fig. 2A, lanes 9 and 10). The clear difference in binding of IRF-2 produced with extracts from type I and III cells was consistent with the levels of IRF-2 detected in Western blot analysis (Fig. 1B).
|
Overexpression of IRF-2 represses activity of Qp-reporter constructs. The effect of IRF-2 on the activity of Qp was examined by use of Qp-reporter constructs in transient transfection assays. Since EBV can infect epithelial cells, the FaDuHyg epithelial line (39), which has low endogenous expression of both IRF-2 and IRF-7, was chosen for reporter assays. Cotransfection of an IRF-2 expression plasmid with pQ2-CAT, a Qp reporter construct containing the ISRE sequence (Fig. 3A), resulted in a decrease in the constitutive activity of Qp (~80% [Fig. 3B]). As expected, IRF-7 also repressed pQ2-CAT activity (Fig. 3B). Repression was also observed when pQ1-CAT (Fig. 3A) was used for this experiment (Fig. 3B). IRF-1 has little or no effect on these reporter constructs. No repression by IRF-2 was observed when pFe3M (50), which has point mutations in the ISRE that abolish binding of IRF-2, was used as a reporter. Also, no repression was observed when pBS-CAT was used as a reporter, and IRF-2 could weakly activate a histone H4 reporter construct in this cell line (55) (data not shown). The data here indicate that IRF-2, as well as IRF-7, represses Qp activity.
|
-galactosidase expression plasmid. Akata and Jijoye lines were
chosen because they have similar transfection efficiencies, and
expression levels of both IRF-2 and IRF-7 are higher in Jijoye
than in Akata cells, as expected (Fig. 3D and data not shown). As shown
in Fig. 3C, the constitutive activities of Qp-reporter constructs are
lower in the Jijoye cell line than in Akata cells. The greater
difference in the activity levels of pQ1-CAT between type I and type
III latency cells is most likely due to the effect of the additional repressor, EBNA-1 (Fig. 3A) (43, 50). Although other factors may also contribute to the lower activity of Qp in type III cells, the
results suggest that physiological levels of IRF-2 and IRF-7 can repress Qp.
IRF-2 did not activate endogenous Qp. Next, the role of IRF-2 in the regulation of endogenous Qp was addressed by overexpression of IRF-2 in a type I line in an attempt to mimic the high expression of IRF-2 in type III cells. Several attempts to generate a cell line stably expressing IRF-2 failed, and a system that can enrich for transfected cells was used instead. By cotransfection of a CD4 expression plasmid, transfected cells were selected with the use of CD4 antibody-conjugated magnetic beads (see Materials and Methods for details). Akata cells were chosen because of their relatively higher transfection efficiency. Total RNA from vector and IRF-2-transfected cells was extracted, and RPAs were performed with an EBNA-1-specific probe. As shown in Fig. 4, IRF-2 did not activate Qp but marginally reduced the Qp-derived EBNA-1 mRNA (compare lanes 4 and 5). DG75 cells, an EBV-negative BL line, did not show an EBNA-1 RNA band (lane 2 and 3). Only low levels of EBNA-1 mRNA could be detected in type I cells (Fig. 4) (33), which is consistent with the low abundance of Qp-derived EBNA-1 mRNA in type I cells (8).
|
Qp reactivation is associated with down-regulation of IRF-2 and IRF-7. It has been clearly shown that fusion of a type III cell line with an epithelial cell line can force a switch from the type III to the type II latency phenotype (6). KR-4 (a type III LCL) and HeLa (EBV-negative cervical carcinoma cells) are parental lines for the KH-1 and KH-2 lines produced by cell fusion (Fig. 5A) (6). That KH-2 and KH-1 are type II latency cells was confirmed by the detection of EBNA-1 and LMP-1 but not EBNA-2 proteins (data not shown). The absence of C/Wp activity in KH-1 and KH-2 lines has previously been reported, but without addressing the Qp status (1). Here we show that Qp is reactivated and C/Wp is inactivated in both fusion cell lines, as expected in cells with a type II phenotype (40), in contrast to the parental KR-4 line, in which C/Wp is active and Qp is inactive (Fig. 5C). The lytic promoter, BamHI F (Fp [45]), is not active in these lines (see Materials and Methods for details). Finally, the percentage of cells containing EBV genomes was examined by using EBER staining followed by fluorescence-activated cell sorter analysis (7). The KH-2 and KR-4 lines have identical amounts of EBER-positive cells, while KH-1 has a relatively lower percentage (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
The switch from Qp to C/Wp, which allows transcription of all the other EBNA proteins (EBNA-2, -3A to -3C, and -LP), produces a phenotypic conversion to type III latency. We previously identified an ISRE in Qp and a novel protein, IRF-7, as a putative negative regulator for this promoter (61). In this work, IRF-2 was also found to be strongly associated with type III latency and to act as a negative regulator of Qp.
It is becoming clear that IRFs are involved in the regulation of Qp. Although IRF-2 is reported to be a transactivator that can activate the histone H4 gene and VCAM-1 (21, 55), IRF-2 is usually a transcriptional repressor and an antagonist to IRF-1 (3, 9, 11, 15, 17, 18, 20, 27, 28, 35). It is interesting that IRF-2 has been reported to be the major positive regulator of Qp in mouse fibroblasts (32, 44). However, the data presented here suggest strongly that IRF-2 is a negative regulator of Qp. First, IRF-2 expression is associated with EBV type III latency, where Qp is inactive (Fig. 1, 2, and 3D); second, overexpression of IRF-2 in a type I line did not activate Qp but marginally reduced the level of EBNA-1 mRNA derived from Qp (Fig. 4); third, IRF-2 is the major protein binding to Qp and appears to have a high affinity for its ISRE (Fig. 2); fourth, IRF-2 represses the activity of Qp-reporter constructs in transient transfection assays (Fig. 3); and fifth, Qp reactivation in type II cells converted by cell fusion from type III cells, in which Qp is inactive, is associated with a sharp reduction in the expression of IRF-2 (Fig. 5).
Previous reports that IRF-2 activates Qp may be due to the mouse fibroblast lines that were used (32, 44). Indeed, IRF-2 could activate our Qp-reporter constructs in a mouse IRF-2-null fibroblast line from the same source (Fig. 6). However, these results must be interpreted in relation to their biological relevance. Selection of an appropriate line is especially important for IRF-2 research because IRF-2 possesses both a transcriptional repression domain and a latent activation domain (58). If the repressor domain of IRF-2 is not active in a given cell line, the latent activation domain may be activated, and IRF-2 becomes an activator. This scenario is documented in muscle cells, where IRF-2 can activate the VCAM-1 promoter (21). Since EBV infects neither fibroblasts nor rodent cells, the conclusion based solely on reporter assays conducted in mouse fibroblasts raises questions about biological relevance. In contrast, our results were obtained with human cell lines latently infected or infectible with EBV.
|
Another explanation for the different results is that IRF-2 might have a dual function in the regulation of Qp, i.e., it might positively regulate Qp in type I cells when the IRF-2 level is low and negatively regulate Qp in type III cells when expression of IRF-2 is high. Data from transfections of Qp into an IRF-2-null line with high doses of IRF-2 may suggest such a tendency (Fig. 6). This possibility needs to be rigorously addressed. However, a dose-dependent repression of Qp by IRF-2 could be observed in biologically relevant lines, such as FaDuHyg and DG75 (data not shown).
Other than being a regulator of Qp, IRF-2 may also contribute to the transforming properties of EBV in type III latency. EBV can immortalize primary B cells and, at the same time, establish type III latency. IRF-2 has oncogenic potential based on transformation assays (16, 31). It would be interesting to examine EBV-associated immunoblastic lymphomas (type III latency) directly to see if IRF-2 levels are elevated in these malignancies.
The inducer(s) of IRF-2 in type III cells is still unclear, although LMP-1 can stimulate the expression of IRF-7 (62). Further work needs to be done to identify the inducer(s) of IRF-2 in type III latency. Other possibilities are that the type I latency cells, in which IRF-2 and IRF-7 levels are low, are selected by EBV for infection; or that establishment of type I latency itself involves the down-regulation of IRF-2 and IRF-7.
IRF-7 was cloned as a Qp-binding protein and subsequently inferred
to be a negative regulator of Qp (61). This function is
further supported by the fact that reactivation of Qp by fusion of type
III cells with epithelial cells to produce cells with a type II
phenotype is associated with a striking reduction in the
expression of IRF-7 (Fig. 5). Other than being a Qp repressor, an
additional role of IRF-7, namely, virus-induced activation of the
interferon-
gene, has just been reported (56).
It is interesting that both IRF-2 and IRF-7 are negative regulators of Qp. There was no apparent synergistic effect between these two factors in terms of Qp repression, and an additive effect was hard to detect when both were overexpressed (data not shown). Why would Qp use two repressors for a single ISRE site? One possible explanation is that IRF-2 and IRF-7 are apparently expressed at different times during the cell cycle (60). Therefore, IRF-2 and IRF-7 may functionally repress Qp in different phases of the cell cycle to keep Qp silenced throughout the cycle.
Apart from IRF-2 and IRF-7, viral proteins definitely play an important role in the silencing of Qp. EBNA-1 can directly repress Qp activity (43, 50), and the higher levels of the protein in type III latency may enhance its repressor effect (references 8, 13, and 47 and our unpublished results). EBNA-2, which is responsible for the increased expression of EBNA-1 in type III latency, could be considered an indirect regulator of Qp.
It is clear that Qp regulation is complicated and that multiple factors, both viral and cellular, are involved. With IRF-2, IRF-7, and EBNA-1 all expressed at higher levels in type III latency, it is reasonable to infer that Qp may be turned off by a combination of IRF-2, IRF-7, EBNA-1, and perhaps another repressor(s), i.e., IRF-2 and IRF-7 may repress Qp through its ISRE while EBNA-1 acts through the Q locus (Fig. 3A). In contrast, in type I latency, when Qp is active, all these factors are expressed at much lower levels. The major positive regulator(s) of Qp operating through the ISRE is unidentified but apparently is associated with type I latency. A band which seems to be specific for type I cells was detected by EMSA (Fig. 2) and was also noticed by other investigators (32); it might be a candidate for such an activator.
Thus, we show that IRF-2, probably acting with IRF-7, and perhaps EBNA-1 as well, silences the promoter used in the most-restricted form of EBV latency, type I, with the indirect consequence that the promoter for the least-restricted form of EBV latency, type III, is used. It is likely that several IRFs, both positive and negative regulators, that have different affinities for the type I promoter and are supplied at different times in the cell cycle, govern the activity of this key, tightly regulated EBV promoter.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jenny Ting, Maria Masucci, Wanla Kulwichit, Bernard Weissman, Patricia Vaughan, and Gary Stein for providing valuable reagents and/or help in this work. We thank T. Taniguchi for permission to use the IRF knockout cell line. We also thank Shannon Kenney and Nancy Raab-Traub for critical reading of the manuscript, Matt Davenport and Val Zacny for editorial help, and Cyd Johnson for technical help.
This work was supported in part by grants from the National Institute of Allergy and Infectious Diseases (AI 42372-01) and the National Cancer Institute (CA 19014). L.Z. was supported by an NIH Individual National Research Service Award (5F 32 CA67433).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Lineberger Comprehensive Cancer Center, University of North Carolina, Campus Box 7295, Chapel Hill, NC 27599. Phone: (919) 966-3036. Fax: (919) 966-9673. E-mail: luzhang{at}med.unc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altiok, E.,
J. Minarovits,
L. F. Hu,
B. Contreras-Brodin,
G. Klein, and I. Ernberg.
1992.
Host-cell-phenotype-dependent control of the BCR2/BWR1 promoter complex regulates the expression of Epstein-Barr virus nuclear antigens 2-6.
Proc. Natl. Acad. Sci. USA
89:905-909 |
| 2. | Ben-Bassat, H., N. Goldblum, S. Mitrani, T. Goldblum, J. M. Yoffey, M. M. Cohen, Z. Bentwith, B. Ramot, E. Klein, and G. Klein. 1977. Establishment in continuous culture of a new type of lymphocyte from a "Burkitt-like" malignant lymphoma (line D.G.-75). Int. J. Cancer 19:27-33[Medline]. |
| 3. |
Cha, Y., and A. B. Deisseroth.
1994.
Human interferon regulatory factor 2 gene. Intron-exon organization and functional analysis of 5'-flanking region.
J. Biol. Chem.
269:5279-5287 |
| 4. |
Chen, F.,
J.-Z. Zou,
L. di Renzo,
G. Winberg,
L.-F. Hu,
E. Klein,
G. Klein, and I. Ernberg.
1995.
A subpopulation of normal B cells latently infected with Epstein-Barr virus resembles Burkitt lymphoma cells in expressing EBNA-1 but not EBNA-2 or LMP1.
J. Virol.
69:3752-3758 |
| 5. | Cohen, J. I., F. Wang, J. Mannick, and E. Kieff. 1992. Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proc. Natl. Acad. Sci. USA 86:9558-9562. |
| 6. |
Contreras-Brodin, B. A.,
M. Anvret,
S. Imreh,
E. Altiok,
G. Klein, and M. G. Masucci.
1991.
B cell phenotype-dependent expression of the Epstein-Barr virus nuclear antigens EBNA-2 to EBNA-6: studies with somatic cell hybrids.
J. Gen. Virol.
72:3025-3033 |
| 7. | Crouch, J., D. Leitenberg, B. R. Smith, and J. G. Howe. 1997. Epstein-Barr virus suspension cell assay using in situ hybridization and flow cytometry. Cytometry 29:50-57[Medline]. |
| 8. | Davenport, M., and J. S. Pagano. Expression of EBNA-1 mRNA is regulated by cell-cycle during Epstein-Barr virus type I latency. J. Virol, in press. |
| 9. | Drew, P. D., G. Franzoso, L. M. Carlson, W. E. Biddison, U. Siebenlist, and K. Ozato. 1995. Interferon regulatory factor-2 physically interacts with NF-kappa B in vitro and inhibits NF-kappa B induction of major histocompatibility class I and beta 2 microglobulin gene expression in transfected human neuroblastoma cells. J. Neuroimmunol. 63:157-162[Medline]. |
| 10. |
Furnari, F. B.,
M. D. Adams, and J. S. Pagano.
1992.
Regulation of the Epstein-Barr virus DNA polymerase gene.
J. Virol.
66:2837-2845 |
| 11. |
Garoufalis, E.,
I. Kwan,
R. Lin,
A. Mustafa,
N. Pepin,
A. Roulston,
J. Lacoste, and J. Hiscott.
1994.
Viral induction of the human beta interferon promoter: modulation of transcription by NF- B/rel proteins and interferon regulatory factors.
J. Virol.
68:4707-4715 |
| 12. | Gregory, C. D., C. Dive, S. Henderson, C. A. Smith, G. T. Williams, J. Gordon, and A. B. Rickinson. 1991. Activation of Epstein-Barr virus latent genes protects human B cells from death by apoptosis. Nature 349:612-614[Medline]. |
| 13. |
Gregory, C. D.,
M. Rowe, and A. B. Rickinson.
1990.
Different Epstein-Barr virus (EBV)-B cell interactions in phenotypically distinct clones of a Burkitt's lymphoma cell line.
J. Gen. Virol.
71:1481-1495 |
| 14. | Hammerschmidt, W., and B. Sugden. 1989. Genetic analysis of immortalizing functions of Epstein-Barr virus in human B lymphocytes. Nature 340:393-397[Medline]. |
| 15. | Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, and T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729-739[Medline]. |
| 16. | Harada, H., M. Kitagawa, N. Tanaka, H. Yamamoto, K. Harada, M. Ishihara, and T. Taniguchi. 1993. Anti-oncogenic and oncogenic potentials of interferon regulatory factors-1 and -2. Science 259:971-974[Abstract]. |
| 17. |
Harada, H.,
E. Takahashi,
S. Itoh,
K. Harada,
T. A. Hori, and T. Taniguchi.
1994.
Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system.
Mol. Cell. Biol.
14:1500-1509 |
| 18. | Harada, H., K. Willison, J. Sakakibara, M. Miyamoto, T. Fujita, and T. Taniguchi. 1990. Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and repressor (IRF-2) genes are developmentally regulated. Cell 63:303-312[Medline]. |
| 19. | Henderson, S., M. Rowe, C. Gregory, D. Croom-Carter, F. Wang, R. Longnecker, E. Kieff, and A. Rickinson. 1991. Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 65:1107-1115[Medline]. |
| 20. |
Horiuchi, M.,
G. Koike,
T. Yamada,
M. Mukoyama,
M. Nakajima, and V. J. Dzau.
1995.
The growth-dependent expression of angiotensin II type 2 receptor is regulated by transcription factors interferon regulatory factor-1 and -2.
J. Biol. Chem.
270:20225-20230 |
| 21. |
Jesse, T. L.,
R. LaChance,
M. F. Iademarco, and D. C. Dean.
1998.
Interferon regulatory factor-2 is a transcriptional activator in muscle where it regulates expression of vascular cell adhesion molecule-1.
J. Cell Biol.
140:1265-1276 |
| 22. | Kieff, E. 1995. Epstein-Barr virus and its replication, p. 2343-2396. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 23. |
Kozbor, D.,
A. E. Lagarde, and J. C. Roder.
1982.
Human hybridomas constructed with antigen-specific Epstein-Barr virus-transformed cell lines.
Proc. Natl. Acad. Sci. USA
79:6651-6655 |
| 24. |
Laimins, L. A.,
P. Gruss,
R. Pozzatti, and G. G. Khoury.
1984.
Characterization of enhancer elements in the long terminal repeat of Moloney murine sarcoma virus.
J. Virol.
49:183-189 |
| 25. | Levitskaya, J., M. Coram, V. Levitsky, S. Imreh, P. M. Steigerwald-Mullen, G. Klein, M. G. Kurilla, and M. G. Masucci. 1995. Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1. Nature 375:685-688[Medline]. |
| 26. |
Levy, D. E.,
D. S. Kessler,
R. Pine,
N. Reich, and J. E. J. Darnell.
1988.
Interferon-induced nuclear factors that bind a shared promoter element correlate with positive and negative transcriptional control.
Genes Dev.
2:383-393 |
| 27. |
Lin, R.,
A. Mustafa,
H. Nguyen,
D. Gewert, and J. Hiscott.
1994.
Mutational analysis of interferon (IFN) regulatory factors 1 and 2. Effects on the induction of IFN-beta gene expression.
J. Biol. Chem.
269:17542-17549 |
| 28. | Matsuyama, T., T. Kimura, M. Kitagawa, K. Pfeffer, T. Kawakami, N. Watanabe, T. M. Kundig, R. Amakawa, K. Kishihara, A. Wakeham, and T. Mak. 1993. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75:83-97[Medline]. |
| 29. | Miyashita, E. M., B. Yang, K. M. C. Lam, D. H. Crawford, and D. A. Thorley-Lawson. 1995. A novel form of Epstein-Barr virus latency in normal B cells in vivo. Cell 80:593-601[Medline]. |
| 30. | Nguyen, H., J. Hiscott, and P. M. Pitha. 1997. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev. 8:293-312[Medline]. |
| 31. | Nguyen, H., A. Mustafa, J. Hiscott, and R. Lin. 1995. Transcription factor IRF-2 exerts its oncogenic phenotype through the DNA binding/transcription repression domain. Oncogene 11:537-544[Medline]. |
| 32. |
Nonkwelo, C.,
I. K. Ruf, and J. Sample.
1997.
Interferon-independent and -induced regulation of Epstein-Barr virus EBNA-1 gene transcription in Burkitt lymphoma.
J. Virol.
71:6887-6897 |
| 33. |
Nonkwelo, C.,
J. Skinner,
A. Bell,
A. Rickinson, and J. Sample.
1996.
Transcription start sites downstream of the Epstein-Barr virus (EBV) Fp promoter in early-passage Burkitt lymphoma cells define a fourth promoter for expression of the EBV EBNA-1 protein.
J. Virol.
70:623-627 |
| 34. | Pagano, J. S., G. Jimenez, N. S. Sung, N. Raab-Traub, and J. C. Lin. 1992. Epstein-Barr viral latency and cell immortalization as targets for antisense oligomers. Ann. N. Y. Acad. Sci. 28:107-116. |
| 35. |
Palombella, V. J., and T. Maniatis.
1992.
Inducible processing of interferon regulatory factor-2.
Mol. Cell. Biol.
12:3325-3336 |
| 36. |
Pauli, U.,
S. Chrysogelos,
G. Stein,
J. Stein, and H. Nick.
1987.
Protein-DNA interactions in vivo upstream of a cell cycle-regulated human H4 histone gene.
Science
236:1308-1311 |
| 37. |
Pine, R.
1992.
Constitutive expression of an ISGF2/IRF1 transgene leads to interferon-independent activation of interferon-inducible genes and resistance to virus infection.
J. Virol.
66:4470-4478 |
| 38. |
Qu, L., and D. T. Rowe.
1992.
Epstein-Barr virus latent gene expression in uncultured peripheral blood lymphocytes.
J. Virol.
66:3715-3724 |
| 39. |
Reiss, M.,
T. Munoz-Antonia,
J. M. Cowan,
P. C. Wilkins,
Z. L. Zhou, and V. F. Vellucci.
1993.
Resistance of human squamous carcinoma cells to transforming growth factor beta 1 is a recessive trait.
Proc. Natl. Acad. Sci. USA
90:6280-6284 |
| 40. | Rickinson, A. B., and E. Kieff. 1995. Epstein-Barr virus, p. 2397-2446. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 41. | Rowe, M., R. Khanna, C. A. Jacob, V. Argaet, A. Kelly, S. Powis, M. Belich, D. Croom-Carter, S. Lee, S. R. Burrows, J. Trowsdale, D. J. Moss, and A. B. Rickinson. 1995. Restoration of endogenous antigen processing in Burkitt's lymphoma cells by Epstein-Barr virus latent membrane protein-1: coordinate up-regulation of peptide transporters and HLA-class I antigen expression. Eur. J. Immunol. 25:1374-1384[Medline]. |
| 42. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 43. |
Sample, J.,
E. Henson, and C. Sample.
1992.
The Epstein-Barr virus nuclear protein 1 promoter active in type I latency is autoregulated.
J. Virol.
66:4654-4661 |
| 44. |
Schaefer, B. C.,
E. Paulson,
J. L. Strominger, and S. H. Speck.
1997.
Constitutive activation of Epstein-Barr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and IRF2 during restricted EBV latency.
Mol. Cell. Biol.
17:873-886 |
| 45. |
Schaefer, B. C.,
J. L. Strominger, and S. H. Speck.
1995.
The Epstein-Barr virus BamHI F promoter is an early lytic promoter: lack of correlation with EBNA 1 gene transcription in group 1 Burkitt's lymphoma cell lines.
J. Virol.
69:5039-5047 |
| 46. |
Schaefer, B. C.,
J. L. Strominger, and S. H. Speck.
1995.
Redefining the Epstein-Barr virus-encoded nuclear antigen EBNA-1 gene promoter and transcription initiation site in group I Burkitt lymphoma cell lines.
Proc. Natl. Acad. Sci. USA
92:10565-10569 |
| 47. |
Schaefer, B. C.,
J. L. Strominger, and S. H. Speck.
1997.
Host-cell-determined methylation of specific Epstein-Barr virus promoters regulates the choice between distinct viral latency programs.
Mol. Cell. Biol.
17:364-377 |
| 48. | Sinclair, A. J., I. Palmero, G. Peters, and P. J. Farrell. 1994. EBNA-2 and EBNA-LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein-Barr virus. EMBO J. 13:3321-3328[Medline]. |
| 49. |
Sung, N. S.,
J. Wilson,
M. Davenport,
N. D. Sista, and J. S. Pagano.
1994.
Reciprocal regulation of the Epstein-Barr virus BamHI-F promoter by EBNA-1 and an E2F transcription factor.
Mol. Cell. Biol.
14:7144-7152 |
| 50. | Sung, N. S., J. Wilson, and J. S. Pagano. 1993. Characterization of cis-acting elements of the BamHI-F promoter of EBV, p. 239-242. In T. Tursz, et al. (ed.), The Epstein-Barr virus and associated diseases. INSERM/John Libbey Eurotext Limited, London, United Kingdom. |
| 51. | Takada, K. 1984. Cross-linking of cell surface immunoglobulins induces Epstein-Barr virus in Burkitt's lymphoma lines. Int. J. Cancer 33:27-32[Medline]. |
| 52. |
Tanaka, N.,
T. Kawakami, and T. Taniguchi.
1993.
Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system.
Mol. Cell. Biol.
13:4531-4538 |
| 53. |
Tierney, R.,
N. Steven,
L. Young, and A. Rickinson.
1994.
Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state.
J. Virol.
68:7374-7378 |
| 54. |
Tomkinson, B.,
E. Robertson, and E. Kieff.
1993.
Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation.
J. Virol.
67:2014-2025 |
| 55. | Vaughan, P. S., F. Aziz, A. J. van Wijnen, S. Wu, H. Harada, T. Taniguchi, K. J. Soprano, J. L. Stein, and G. S. Stein. 1995. Activation of a cell-cycle-regulated histone gene by the oncogenic transcription factor IRF-2. Nature 377:362-365[Medline]. |
| 56. | Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vivo. Mol. Cell 1:507-518[Medline]. |
| 57. | Wilson, G., and G. Miller. 1979. Recovery of Epstein-Barr virus from nonproducer neonatal human lymphoid cell transformants. Virology 95:351-358[Medline]. |
| 58. | Yamamoto, H., M. S. Lamphier, T. Fujita, T. Taniguchi, and H. Harada. 1994. The oncogenic transcription factor IRF-2 possesses a transcriptional repression and a latent activation domain. Oncogene 9:1423-1428[Medline]. |
| 59. |
Yoshizaki, T.,
H. Sato,
M. Furukawa, and J. S. Pagano.
1998.
The expression of matrix metalloproteinase 9 is enhanced by Epstein-Barr virus latent membrane protein 1.
Proc. Natl. Acad. Sci. USA
95:3621-3626 |
| 60. | Zhang, L., M. Davenport, and J. S. Pagano. Unpublished data. |
| 61. |
Zhang, L., and J. S. Pagano.
1997.
IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency.
Mol. Cell. Biol.
17:5748-5757 |
| 62. | Zhang, L., and J. S. Pagano. Stimulation of the expression of interferon regulatory factor 7 by Epstein-Barr virus latent membrane protein 1. Submitted for publication. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»