INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Posttranslational regulation of transcription factors has been recognized as the central mechanism in the mammalian response to stress and damage (16). Activating transcription factor 2 (ATF2) is a member of the ATF/CREB protein family of basic region-leucine zipper (bZIP) proteins (13, 14, 23), which are involved in the response to stress (22, 37). Amino-terminal phosphorylation of ATF2 mediated by Jun N-terminal kinase (JNK) (11) and p38 MAP kinase (29, 30) in response to stress and inflammatory cytokines results in the transactivation of ATF2, leading to increased expression of target genes. Among the target genes thought to mediate ATF2 functions in cell growth, differentiation, immune response, and response to stress are the c-jun (36), tumor necrosis factor alpha (35), transforming growth factor  (17), cyclin A (32), E-selectin (30), and DNA polymerase  (26) genes. It is known that the products of ATF2 target genes are likely to contribute to the neoplastic process and inflammation, but the physiological role of ATF2 remains largely uncharacterized.

In the absence of extracellular stimulation, ATF2 exhibits very low levels of transactivation because of an intramolecular inhibitory interaction in which the DNA binding domain binds to the amino-terminal transactivation domain (18). Several viral proteins, including adenovirus E1A (20), protein X of hepatitis B virus (24), and human T-cell leukemia virus type 1 Tax (39), interact with ATF2 and stimulate its transcriptional activity.

Transcriptionally active ATF2 recognizes and binds specific ATF/CRE motifs as a homo- or heterodimer. ATF2 interacts with its heterodimerization partners (i.e., other bZIP proteins) via the leucine zipper (40). The nature of the dimerization partners depends on the cell type and determines the specificity and the extent of transactivation of target genes. For instance, in F9 teratocarcinoma cells, which express very low levels of c-Jun in the absence of differentiation stimuli (41), ATF2 upregulates the expression of c-jun. De novo-synthesized c-Jun is capable of heterodimerization with ATF2, resulting in the activation of its own promoter and the formation of a positive-feedback regulatory loop (36, 37). The mechanisms by which this response may be downregulated remain unclear.

ATF2 is degraded in vivo via the ubiquitin-proteasome pathway (5, 7). We found that the ubiquitination of ATF2 as well as of c-Jun, JunB, and p53 is targeted by association with JNK (6-8). Our previous data demonstrated that such targeting of c-Jun and ATF2 ubiquitination occurs in a phosphorylation-dependent manner. Interestingly, the association of ATF2 with JNK is necessary but not sufficient for the targeting of ATF2 ubiquitination in vitro (7). In the present study, we sought to further elucidate the regulation of ATF2 ubiquitination. We show that leucine zipper-based heterodimerization with c-Jun as one of the key ATF2 heterodimers is required for ATF2 ubiquitination and degradation. The possible implications of ubiquitin-dependent regulation of ATF2 stability are discussed.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Reagents. Okadaic acid and retinoic acid were purchased from Sigma Chemical Co. Anti-ATF2 monoclonal antibody, anti-Jun polyclonal antibody, anti-CREB polyclonal antibody, and anti-c-Fos antibody were purchased from Santa Cruz Biotechnology, and anti-hemagglutinin (HA) monoclonal antibody was purchased from BAbCo. Anti-ATF2 polyclonal antibody was a generous gift from N. Jones (Imperial Cancer Research Fund, London, England). Anti-JNK antibody was kindly provided by C. Monell (PharMingen). Proteasome inhibitor MG132 was purchased from Peptide International Co.

Expression plasmids. Bacterial expression constructs pET-15b-ATF2 and pET-15b-Ub-HA were previously described (7). Mammalian expression constructs pRSV-c-Jun, pRSV-JunB, and pRSV-JunD (4) were kindly provided by M. Karin. pCMV-c-Jun, pCMV-c-Jun-HA, pCMV-Ub-HA, and pCMV-c-Jun31-57 (34) were generous gifts from D. Bohmann. pCMV-c-Jun LZM was obtained from M. Birer, and 5xjun2-luc (38) was a gift from H. van Dam. The bacterial expression construct encoding bZIP of ATF2 was kindly provided by M. Green.

Cell cultures and transfections. NIH 3T3 mouse fibroblasts and 293T human embryo kidney cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% calf serum and antibiotics at 37°C in 5% CO₂. F9 teratocarcinoma cells were maintained in DMEM-F12 (1:1) medium supplemented with fetal calf serum, 10 µM -mercaptoethanol, and antibiotics. 293T cells were transfected by the CaPO₄ method. NIH 3T3 cells and F9 cells were transfected with DOTAP (Boehringer Mannheim Biochemicals) in accordance with the manufacturer's recommendations. The total amount of DNA within the experiments was kept constant by adding the respective empty vector plasmid DNA to the transfection mixtures.

Expression, purification, and identification of proteins. Histidine fusion proteins were expressed and purified as previously described (7) with the aid of nitrilotriacetic acid (NTA) resins (Qiagen). c-Jun was eluted under denaturing conditions and refolded by sequential dialysis. JNK2 purification, immunodepletion, and immunoblotting were performed as described elsewhere (7).

Ubiquitination assays. The in vitro ubiquitination assay is described in detail elsewhere (7). Briefly, 50 µg of whole-cell lysates or 0.5 µg of purified JNK was incubated on ice with bacterially expressed ATF2 proteins (2 µg) bound to nickel beads for 45 min. After extensive washes, the substrate-bound beads were ubiquitinated with rabbit reticulocyte lysate depleted of JNK for 5 min at 30°C. The reaction was stopped by the addition of 0.5 ml of 8 M urea in sodium phosphate buffer (pH 6.3) with 0.1% Nonidet P-40. The beads were washed three times with stop buffer (7) and once with phosphate-buffered saline supplemented with 0.5% Triton X-100, and the protein moiety was eluted with Laemmli sample buffer at 100°C. Samples were resolved by sodium dodecyl sulfate (SDS)-8% polyacrylamide gel electrophoresis (PAGE) and analyzed by immunoblotting with anti-HA antibody and chemiluminescence detection. The blots were stripped and reprobed with antibody against ATF2, followed by alkaline phosphatase detection to ensure equal loading of the substrate.

Electrophoretic mobility shift assay and calpain digestion. ATF2 proteins were translated in vitro with a T7-wheat germ extract-based transcription-translation kit (Promega) in accordance with the manufacturer's recommendations. For gel shift assays, equal amounts of ATF2 proteins (equilibrated to ~5 to 10 ng based on immunoblotting analysis) were incubated with bacterially expressed c-Jun (45 ng) for 1 h on ice. The proteins were reacted with the ³²P-labeled heteroduplex UV response element (URE) target sequence (ACTATGACAACAGCTTGACAACAGT; the actual URE sequence is underlined) in the presence of 10 mM HEPES (pH 7.6)-50 mM KCl-0.1 mM EGTA-0.1 mM dithiothreitol-4 mM MgCl₂-10% glycerol-50 ng of dI · dC for 30 min on ice prior to separation on a 7.5% polyacrylamide gel and autoradiography.

In vivo degradation assay. 293T cells were transfected with the pCMV-ATF2-HA (5 µg), pCMV-ATF2^150-248-HA (5 µg), and pRSV-c-Jun (2 µg) constructs. Twenty-four hours later, cells were incubated with methionine- and cysteine-free DMEM supplemented with 10% dialyzed calf serum for 1 h and then were metabolically labeled with 0.5 mCi of [³⁵S]methionine-[³⁵S]cysteine mix (PRO-MIX; Amersham) per ml. The label was chased with DEM plus 10% calf serum supplemented with 2 mM cold methionine and cysteine for various times. The cells were lysed as previously described (8), and equal amounts of trichloroacetic acid-insoluble material were analyzed by immunoprecipitation with anti-HA antibody. Immunopurified proteins were resolved by SDS-PAGE. The gels were fixed, impregnated with Amplify reagent (Amersham), and subjected to autoradiography. Quantification was performed with a GS363 phosphorimager (Bio-Rad).

Transcriptional analysis. Luciferase assays were performed with a kit from Promega and whole-cell extracts (WCE) prepared from cells transfected with the 5×jun2-driven luciferase gene.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

JNK is necessary but not sufficient for targeting of ATF2 ubiquitination in vitro. We have been studying the role of JNK in targeting the ubiquitination of stress-responsive transcription factors by using an in vitro ubiquitination assay (6, 7). In this assay, resin-bound substrates are first incubated with WCE. Unbound proteins are washed away, and the targeting activity of the substrate-bound proteins is monitored on the basis of the degree of substrate ubiquitination in the presence of a rabbit reticulocyte lysate depleted of JNK (7). We previously demonstrated that the inactive form of JNK targets its associated proteins c-Jun, JunB, ATF2, and p53 for ubiquitination (7, 8). In contrast to the situation for c-Jun, the binding of JNK is necessary but not sufficient for the targeting of ATF2 ubiquitination in vitro (Fig. 1A, compare lane 2 with lane 1). This observation suggested that other factors present in WCE are required for targeting. ATF2 interacts with a number of proteins via bZIP (14). JNK is known to associate with the amino-terminal region of ATF2 (11, 22). While deletion of the amino-terminal region impairs ATF2 ubiquitination in vitro (7), additional targeting factors may utilize other ATF2 domains, including bZIP.

View larger version (45K): [in this window] [in a new window]   FIG. 1.   JNK is necessary but not sufficient for the targeting of ATF2 ubiquitination in vitro. Purified JNK2 or NIH 3T3 WCE immunodepleted with NRS or anti-JNK antibody were used to target the in vitro ubiquitination of ATF2. Negative control ubiquitination of NTA resins without a substrate is shown in the rightmost lane. In vitro ubiquitination of ATF2 was analyzed by immunoblotting. The upper part of the blot was probed with anti-HA antibody to detect ubiquitin (Ub)-HA conjugates (upper panel). The lower part of the blot was probed with anti-ATF2 antibody (lower panel).

The leucine zipper is required for ubiquitination of ATF2 in vitro. To test the possible role of bZIP in the targeting of ATF2 ubiquitination, we depleted ATF2 bZIP binding proteins by passing WCE through an NTA column carrying bacterially expressed bZIP polypeptide derived from ATF2. Flowthrough fractions were incubated with full-length ATF2, and its ubiquitination was assessed. The ability of WCE depleted of bZIP binding proteins to target ATF2 ubiquitination was impaired compared with that of mock-depleted proteins (Fig. 2A). Immunoblotting analysis with antibodies against known ATF2 heterodimerization partners revealed that c-Jun, c-Fos, ATF2, and CREB are among the proteins bound to bZIP resins (data not shown).

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Additional factors targeting ATF2 ubiquitination in vitro require the bZIP region of ATF2. (A) Targeting activity of WCE is depleted after preincubation with the ATF2 bZIP polypeptide. NIH 3T3 WCE were passed through columns packed with empty NTA beads (NTA FT) or with beads bound to bacterially expressed ATF2 bZIP polypeptide (bZIP FT) and then were used for the targeting of ATF2 ubiquitination in vitro. The upper part of the blot was probed with anti-HA antibody to detect ubiquitin (Ub)-HA conjugates (upper panel). The lower part of the blot was probed with anti-ATF2 antibody (lower panel). (B) Basal and WCE-targeted ubiquitination of a dimerization-deficient mutant of ATF2 is impaired. Beads carrying wild-type ATF2 or mutant ATF2L408P were incubated with WCE, washed, and ubiquitinated in vitro. The upper part of the blot was probed with anti-HA antibody to detect ubiquitin (Ub)-HA conjugates (upper panel). The lower part of the blot was probed with anti-ATF2 antibody (lower panel).

c-Jun targets ATF2 ubiquitination in vitro. To identify prospective ATF2 heterodimerization partners which may participate in the targeting of ubiquitination, we immunodepleted WCE of c-Jun, c-Fos, or CREB by using respective antibodies. These extracts were analyzed by immunoblotting to confirm the depletion of the respective proteins (Fig. 3B). The targeting activities of the resulting extracts were compared with that of WCE treated with naive rabbit serum (NRS). Depletion of c-Jun reduced the degree of ATF2 ubiquitination (Fig. 3A, compare lane 2 with lane 3). The addition of recombinant c-Jun to the depleted extract restored the degree of ubiquitination. Targeting of ATF2 ubiquitination was also attenuated by depletion of c-Fos (Fig. 3A, lane 6). Although the analysis of WCE depleted with anti-Fos antibody by immunoblotting with anti-Jun antibody revealed that up to 80% of c-Jun was removed from the extract (Fig. 3B), we cannot rule out the contribution of Fos by itself in the targeting of ATF2 ubiquitination. Nevertheless, the addition of c-Jun to a Fos-free extract efficiently reconstituted the targeting of ATF2 ubiquitination (Fig. 3A, compare lane 6 with lane 7). Conversely, depletion of CREB did not affect the targeting activity of WCE. This result indicates that WCE depleted of CREB still contains factors sufficient to target ATF2 ubiquitination. It has been previously demonstrated that heterodimerization of CREB with ATF2 in vitro does not disrupt the intramolecular interaction of the ATF2 leucine zipper and its amino terminus (1). It is therefore possible that heterodimerization-dependent changes in ATF2 conformation promote the susceptibility of ATF2 to ubiquitination in vitro.

View larger version (37K): [in this window] [in a new window]   FIG. 3.   c-Jun present in WCE targets ATF2 for ubiquitination in vitro. (A) WCE were immunodepleted with NRS or with the indicated antibody and analyzed for their ability to target ATF2 ubiquitination in vitro. Bacterially expressed c-Jun (0.5 µg) was added to the WCE to reconstitute the targeting activity. The upper part of the blot was probed with anti-HA antibody to detect ubiquitin (Ub)-HA conjugates (upper panel). The lower part of the blot was probed with anti-ATF2 antibody (lower panel). (B) WCE (100 µg) immunodepleted with the indicated antibodies (ID) were analyzed for the levels of ATF2 heterodimerization partners via immunoblotting with the respective antibodies (IB). Arrowheads indicate the positions of the respective proteins. (C) NIH 3T3 and F9 cells were transfected with a pRSV-c-Jun construct or empty vector. WCE prepared from transfected cells were used to target ATF2 ubiquitination in vitro.

Overexpression of Jun proteins targets ATF2 ubiquitination in vivo. To evaluate the role of ATF2 dimerization in ATF2 ubiquitination in vivo, we transfected cells with constructs expressing six-histidine-tagged ATF2 proteins together with HA-tagged ubiquitin (34). Using nickel beads, we purified ATF2 under denaturing conditions and assessed the amount of HA-tagged polyubiquitin chains covalently linked to ATF2 by immunoblotting. Although the ubiquitination of endogenous ATF2 has been recently documented (5), the ubiquitination of exogenous ATF2 in MeWo and WM35 human melanoma cells, HeLa cells, and BALB/c/3T3 cells (data not shown) and in NIH 3T3 mouse fibroblasts (Fig. 4A) could not be detected even in the presence of proteasome inhibitors. Nevertheless, cotransfection of c-Jun led to noticeable ubiquitination of exogenous ATF2 in vivo (Fig. 4A).

View larger version (51K): [in this window] [in a new window]   FIG. 4.   C-Jun overexpression alleviates ubiquitination of ATF2 in vivo. (A) NIH 3T3 cells were transfected as indicated and treated with MG132 for 8 h before being harvested. ATF2 proteins were purified with NTA beads and analyzed by immunoblotting with anti-HA (upper panel) and anti-ATF2 (lower panel) antibodies. The anti-HA blot was overexposed to detect low levels of ATF2 ubiquitination. Ub, ubiquitin. (B) 293T cells were transfected as indicated; 1 µg of pRSV-JunD and 0.25 to 1.0 µg of pRSV-c-jun were used. In vivo ubiquitination of purified ATF2 proteins was assessed as described above. Immunoblots probed with anti-HA (upper panel) and anti-ATF2 (middle panel) antibodies are shown. The levels of Jun proteins expressed in 293T cells were analyzed with 100 µg of WCE by immunoblotting (lower panel) with an anti-Jun polyclonal antibody that recognizes both c-Jun and JunD (sc-44; Santa Cruz Biotechnology). (C) 293T cells were transfected as indicated; 1 µg of pCMV-c-Jun, pCMV-c-Jun31-57, and pCMV-c-Jun LZM was used. In vivo ubiquitination of purified ATF2 proteins was assessed as described above. Immunoblots probed with anti-HA (upper panel) and anti-ATF2 (middle panel) antibodies are shown. The levels of Jun proteins expressed in 293T cells were analyzed with 100 µg of WCE by immunoblotting (lower panel) with a mixture of anti-Jun polyclonal antibodies (sc-44 and sc-45; Santa Cruz Biotechnology).

ATF2 mutants that exhibit various levels of dimerization and transactivation differ in their degrees of ubiquitination. To confirm that the dimerization of ATF2 is required for the ubiquitination of ATF2, we designed mutant forms of ATF2 in which dimerization is affected. To create ATF2 with impaired dimerization ability, leucine at amino acid 408 was replaced with proline (ATF2^L408P), a substitution that was shown to abrogate the dimerization of ATF2 (1) and the targeting of ATF2 ubiquitination in vitro (Fig. 2B). In vivo interactions of this mutant with c-Jun were abrogated in 293T cells (Fig. 5A).

View larger version (24K): [in this window] [in a new window]   FIG. 5.   Characterization of dimerization and transactivation of mutant ATF2 proteins. (A) In vivo interaction of c-Jun with ATF2 proteins. 293T cells were transfected as indicated. The upper panel depicts the level of c-Jun-HA expression in 100 µg of WCE analyzed by anti-HA immunoblotting. ATF2 proteins were purified from 2 mg of WCE with NTA resins under native conditions and analyzed by immunoblotting with anti-HA (middle panel) and anti-ATF2 (lower panel) antibodies. (B) Transactivation of ATF2 proteins evaluated with the 5×jun2-driven luciferase reporter assay. HA-tagged ATF2 constructs (a, pCDNA3; b, ATF2150-248; c, ATF2L408P; d, wild-type (ATF2) were coexpressed with the 5×jun2-luc plasmid, and luciferase activity was analyzed with a Promega kit. The left panel depicts ATF2 transactivation in NIH 3T3 cells. The inset shows relative levels of ATF2 proteins analyzed by HA immunoprecipitation followed by immunoblotting with anti-ATF2 antibody. ATF2 transactivation in 293T cells is shown in the right panel. The data represent fold activation over the values for cells transfected with the reporter only. The average of three independent experiments (each in duplicate) is shown; error bars indicate standard deviations.

150-248

150-248

150-9248

150-248

150-248

150-248

150-248

150-248

150-248

150-248

View larger version (44K): [in this window] [in a new window]   FIG. 6.   In vivo ubiquitination of mutant ATF2 proteins. 293T cells were transfected as indicated (1 µg of pRSV-c-Jun was used) and treated with MG132 (40 µM) for 4 h before being harvested. The in vivo ubiquitination assay was performed as described above. Immunoblots probed with anti-HA (upper panel) and anti-ATF2 (lower panel) antibodies are shown. Ub, ubiquitin.

150-248

Dimerization modulates the conformation of ATF2. The ATF2 mutant with an enhanced ability to dimerize (ATF2^150-248) was subjected to more efficient ubiquitination than the wild-type protein (Fig. 6). This result may have been due to differences in conformation between ATF2 dimers and ATF2 monomers. To test this hypothesis, we analyzed the susceptibility of different in vitro-translated ATF2 forms to digestion by calcium-dependent calpain protease in vitro. As evident in Fig. 7, the appearance of lower-molecular-weight cleavage products was facilitated by preincubation of wild-type ATF2 with bacterially expressed c-Jun. Cleavage of ATF2^150-248 was very efficient even without c-Jun. Since an ATF2 mutant with impaired dimerization ability exhibited virtually no digestion by calpain (Fig. 7), we conclude that the observed partial cleavage of wild-type ATF2 occurs with dimerized forms of the protein. These results imply that the dimeric conformation of ATF2^150-248 may render this protein susceptible to ubiquitination and degradation independently of its interaction with c-Jun.

View larger version (55K): [in this window] [in a new window]   FIG. 7.   ATF2 dimerization affects ATF2 conformation. In vitro-translated 35S-methionine-labeled ATF2 proteins were preincubated with bacterially expressed c-Jun as indicated and subjected to digestion with calpain protease for 15 or 30 min at 37°C. The results of digestion were analyzed by electrophoresis and autoradiography. Arrows indicate cleavage products. The control reaction performed in the presence of 2 mM EDTA is marked by an asterisk.

Dimerization-dependent ATF2 ubiquitination leads to ATF2 degradation in vivo. Analysis of our in vivo ubiquitination assays repeatedly revealed an inverse correlation between the level of substrate expressed and the intensity of the ubiquitin-HA-reactive smear. For example, cotransfection of c-Jun coincided with a decrease in the ATF2 level and an increase in the amount of copurified ubiquitin chains (Fig. 4B). Deletion of residues 150 to 248 decreased the level of ATF2 mutant proteins and enhanced susceptibility to ubiquitination (Fig. 6). To confirm that the decrease in the ATF2 level is due to decreased stability, we used pulse-chase metabolic labeling. While the half-life of wild-type ATF2 expressed in 293T cells was estimated to be more than 2 h, elevated c-Jun expression shortened the half-life to less than 1 h (Fig. 8). Mutant ATF2^150-248 exhibited a shorter half-life (~40 min), reflecting its lower stability compared with that of its wild-type counterpart. The overexpression of c-Jun did not significantly affect the stability of mutant ATF2^150-248 (Fig. 8), which exists in the form of a dimer even in the absence of c-Jun (Fig. 5B and 7). The dimerization-deficient mutant ATF2^L408P was found to be a substantially more stable protein, and the coexpression of c-Jun did not lead to a significant acceleration of ATF2^L408P degradation (Fig. 8). These results are in agreement with our in vivo ubiquitination data (Fig. 6). Together with the latter data, these findings suggest that dimerization-dependent ubiquitination marks ATF2 for efficient degradation.

View larger version (33K): [in this window] [in a new window]   FIG. 8.   c-Jun affects in vivo stability of ATF2 proteins. (A) HA-tagged ATF2 constructs were expressed with or without pRSV-c-Jun in 293T cells. Cells metabolically labeled with 35S-methionine-35S-cysteine were chased for the times indicated, followed by immunopurification of ATF2 proteins under stringent conditions (0.5 M LiCl), separation by SDS-PAGE, and autoradiography. wt, wild type. (B) Quantitative analysis of the representative experiment shown in panel A.

Degradation of endogenous ATF2. To confirm that the rapid degradation of ATF2 forms which exhibit enhanced dimerization and transcriptional activity (10) also occurs for endogenous proteins in vivo, we monitored the accumulation of endogenous ATF2 in NIH 3T3 cells treated with the proteasome inhibitor MG132. The level of full-length mouse ATF2 (~68 kDa) remained unchanged for up to 6 h after the addition of MG132 to the medium (Fig. 9A). Conversely, proteasome inhibitor treatment led to a noticeable increase in the level of a protein with an apparent molecular mass of ~42 kDa (Fig. 9A); this protein corresponds to the in vitro-translated product of the transcriptionally active splicing form of ATF2 (10). These data suggest that the endogenous analogue of mutant ATF2^150-248 exhibits less stability than the full-length splicing counterpart and further support the notion that the ability of ATF2 to form dimers is correlated with the rate of ATF2 degradation in vivo.

View larger version (46K): [in this window] [in a new window]   FIG. 9.   Stability of endogenous ATF2. (A) Accumulation of endogenous ATF2 in NIH 3T3 cells after treatment with a proteasome inhibitor. The level of ATF2 proteins in WCE (100 µg) at the indicated times after treatment with MG132 (40 µM) was assessed by immunoblotting with an antibody against ATF2. (B) Degradation of endogenous ATF2 in F9 cells treated with retinoic acid (RA, 2 × 107 M) for 20 to 40 h and MG132 (40 µM) for 4 h before harvest as indicated. The levels of ATF2 (upper panel) and c-Jun (lower panel) were analyzed with nuclear extracts (50 µg). The double arrow marks the position of a putative ATFa protein.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

One of the key issues for understanding the cellular regulation of gene expression has to do with how cells restrict the duration and magnitude of transcription factor activities. ATF2 as well as the other members of the bZIP family require leucine zipper-dependent dimerization for transactivation. Using in vitro and in vivo ubiquitination and degradation assays, we have demonstrated that such heterodimerization with c-Jun contributes to the efficient ubiquitination of ATF2, which in turn results in the rapid degradation of ATF2. These data suggest that ubiquitination-dependent elimination of transcriptionally active ATF2 species is a putative mechanism by which ATF2 activity in cells may be regulated.

That ATF2 is transcriptionally inactive as a result of intramolecular inhibition (18) has been documented. Biochemical evidence from in vitro experiments showed that the DNA binding domain of ATF2 is capable of intramolecular interaction with its amino terminus (1). This intramolecular inhibition is assumed to be disrupted and transcriptional activities are assumed to be restored when ATF2 interacts with other proteins, such as E1A (20, 21) and c-Jun (2). Phosphorylation of ATF2 by stress-activated protein kinases was also suggested to relieve intramolecular inhibition and induce leucine zipper-dependent homodimerization (1, 18). We previously showed that the binding of inactive JNK to the amino terminus of ATF2 targets the ubiquitination of ATF2 in vitro (7). Deletion of residues 40 to 66 within the JNK binding site abrogated ATF2 ubiquitination in vitro.

We propose that intramolecular interactions may hinder the association of ATF2 with JNK or/and other polypeptides which bind the amino terminus of ATF2 and target its ubiquitination (Fig. 10). In this model, the events which disrupt intramolecular inhibition (such as ATF2 association with E1A or c-Jun) and lead to increased ATF2 dimerization would result in conformational changes of the ATF2 molecule favoring its association with targeting proteins and subsequent ubiquitination. Our data partially support this hypothesis, since: (i) background in vivo ubiquitination was primarily observed in 293T cells which express E1A and was not seen in three or four other experimental cell lines which do not express E1A; (ii) overexpression of c-Jun increases ATF2 ubiquitination and degradation; (iii) dimerization of ATF2 leads to changes in its conformation, as assessed by calpain cleavage; (iv) ubiquitination of the dimerization-deficient ATF2^L408P mutant is impaired even in the presence of E1A and c-Jun; (v) the ATF2^150-248 mutant (which is constitutively active as a result of a lower degree of intramolecular inhibition) exhibits a distinctly different conformation, a higher level of basal ubiquitination, and a significantly shorter half-life; (vi) an increase in the level of endogenous ATF2 proteins in response to the proteasome inhibitor was primarily observed for the natural analogue ATF2^150-248; and (vii) induction of c-jun expression in F9 teratocarcinoma cells coincides with the degradation of endogenous ATF2. One cannot exclude the possibility that additional regulatory mechanisms (i.e., ATF2 phosphorylation) also control the relationship between ATF2 dimerization and transactivation and ATF2 ubiquitination and degradation. We also found that ATF2 dimers are more efficiently digested in vitro by calcium-dependent calpain protease compared with the monomeric form of ATF2 (Fig. 7). Therefore, we cannot rule out the possibility that in addition to the ubiquitin-proteasome pathway, the calpain pathway may participate in the elimination of active ATF2 species in vivo.

View larger version (17K): [in this window] [in a new window]   FIG. 10.   Proposed model for the regulation of ATF2 ubiquitination. Conversion of ATF2 monomers into ATF2 homo- or heterodimers, while enabling the transactivation of ATF2, leads to conformational changes which favor the binding of E3 ubiquitin ligase and the ubiquitination of ATF2. The association of ATF2 with proteins which do not disrupt intramolecular inhibition (i.e., CREB [1]) does not increase the degree of ATF2 ubiquitination. While ATF2 homodimerization or heterodimerization with JunD or c-Jun31-57 suffices for ATF2 presentation to ubiquitin (Ub) ligase, a further increase in ATF2 ubiquitination is provided in trans via factors brought to the complex through docking sites, such as the  domain on c-Jun, which further promotes targeting through JNK association.

An ATF2 molecule may form a homodimer with another ATF2 molecule, thereby exposing both to targeted ubiquitination. Similarly, members of the bZIP family which are capable of heterodimerization with ATF2 may contribute to the targeting of ATF2 ubiquitination as well (Fig. 10). Consistent with this idea, the effect of different ATF2 partners on the susceptibility of ATF2 to ubiquitination may vary depending on the specific conformation of dimerized ATF2. For instance, depletion of CREB did not affect WCE targeting activity (Fig. 3A). As CREB association with ATF2 does not disrupt ATF2 intramolecular inhibition (1), this result suggests that a dimerization-dependent conformational change is important for ubiquitination. Conversely, the heterodimer with c-Jun is susceptible to ubiquitination in vitro and in vivo (Fig. 3A and 4B). c-Jun LZM lacking the leucine zipper does not promote ATF2 ubiquitination. Moreover, expression of this mutant decreases ATF2 ubiquitination (Fig. 4C), probably due to titration of targeting molecules (i.e., JNK). A similar sequestering effect of c-Jun has been shown for the alteration of p53 degradation (8). c-Jun increases ATF2 ubiquitination more efficiently than JunD, which does not bind JNK (12, 15), or c-Jun31-57, which lacks the JNK binding domain (Fig. 4). These results imply that the presence of a JNK docking site may elicit trans-ubiquitination by facilitating the presentation of targeting molecules for the ubiquitination of heterodimerized ATF2 (Fig. 10).

Certain evidence indicates that ATF2 homodimers can be bound to DNA target sequences before transactivation (37). Our studies did not address the possible role of ATF2 dimers that bind to specific target motifs in the regulation of ubiquitination and degradation. Nevertheless, the addition of oligonucleotides bearing the jun2 target sequence to an in vitro reaction did affect the degree of ATF2 ubiquitination (data not shown). It has also been suggested that heterodimers of ATF2 with newly synthesized c-Jun replace less transcriptionally potent ATF2 homodimers on the jun2 promoter, thus forming a positive-feedback loop (36). Our data showing that the expression of exogenous c-Jun in NIH 3T3 and 293T cells or the upregulation of endogenous c-Jun in F9 cells potentiates ATF2 ubiquitination and degradation provide a clue for understanding how the very same heterodimerization could eventually restrict the duration of transcriptional activity.

It appears from the data presented here and previously published findings that ATF2 transcriptional activity is very tightly regulated. Stable ATF2 protein species are transcriptionally inactive (18), and active ATF2 dimers are unstable (this study). These characteristics of ATF2 are expected to play important roles in limiting the response of cells to viral aggression, stress stimuli, or inflammatory cytokines, as well as in regulating the antigen receptor-mediated stimulation of T and B lymphocytes (17, 35). We recently obtained evidence that ATF2 plays an important role in the radiation resistance of human melanoma cells (31) as well as in the UV-induced apoptosis of human melanoma cells (14a). Indeed, while the introduction of ATF2 in 293T cells resulted in an increased frequency of apoptotic cells, transcriptionally active ATF2^150-248 was twice as active in the induction of apoptosis as the wild-type protein (data not shown).

Dimerization-dependent ubiquitination and degradation may constitute a general mechanism for limiting the transactivation of other bZIP family members. First, structural similarities between ATF2 and ATFa transcription factors make the latter a candidate for such regulation. ATFa is capable of dimerization and has been shown to bind JNK (3). We cannot exclude the possibility that ATFa also is degraded upon upregulation of c-Jun expression by retinoic acid in F9 cells (Fig. 9B). Second, some bZIP family members which cannot form homodimers are expected to be regulated through heterodimerization. Indeed, evidence indicates that the ubiquitination and degradation of c-Fos are dependent on its heterodimerization with c-Jun (27, 33). Heterodimerization would apparently be important for regulation of the ubiquitination and degradation of proteins which may not directly or efficiently associate with the ubiquitination-targeting proteins. For instance, JunD cannot associate directly with JNK (12, 15). Nevertheless, JunD, as part of the JunD-c-Jun heterodimer, can be still phosphorylated by activated JNK which is presented to the phosphoacceptor site of JunD by the JNK docking site on heterodimerized c-Jun (15). Therefore, it can be also assumed that in nonstressed cells, inactive JNK presented by c-Jun may target the trans-ubiquitination and degradation of JunD. Interestingly, an inverse correlation between the levels of expression of c-Jun and JunD proteins in mouse fibroblasts has been demonstrated (28). In addition, the dimerized conformation may favor the ubiquitination and degradation of bZIP transcription factors which can directly bind targeting molecules (ATF2 and c-Jun). Since the binding of JNK to c-Jun is a prerequisite for c-Jun phosphorylation and efficient c-Jun phosphorylation by JNK in vivo was shown to require dimerization (15), the targeting of c-Jun for ubiquitination by JNK (6) may also require c-Jun dimerization.

Negative regulation of signal transduction pathways via the ubiquitin-proteasome system has been documented so far for the JAK-STAT pathway, protein kinase C, and c-Kit (9). The preferential ubiquitination and degradation of transcriptionally active species of ATF2 and, perhaps, of some other bZIP transcription factors provide the underlying mechanism for regulating the duration and magnitude of transcriptional output.