Previous Article | Next Article 
Molecular and Cellular Biology, May 1999, p. 3360-3371, Vol. 19, No. 5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Induction by Aromatic Amino Acids
in Saccharomyces cerevisiae
Ismaïl
Iraqui,
Stéphan
Vissers,
Bruno
André, and
Antonio
Urrestarazu*
Laboratoire de Physiologie Cellulaire et de
Génétique des Levures, Université Libre de
Bruxelles
Campus Plaine CP244, B-1050 Brussels, Belgium
Received 20 July 1998/Returned for modification 30 September
1998/Accepted 15 February 1999
 |
ABSTRACT |
Aromatic aminotransferase II, product of the ARO9 gene,
catalyzes the first step of tryptophan, phenylalanine, and tyrosine catabolism in Saccharomyces cerevisiae. ARO9 expression is
under the dual control of specific induction and nitrogen source
regulation. We have here identified UASaro, a 36-bp
upstream element necessary and sufficient to promote transcriptional
induction of reporter gene expression in response to tryptophan,
phenylalanine, or tyrosine. We then isolated mutants in which
UASaro-mediated ARO9 transcription is
partially or totally impaired. Mutations abolishing
ARO9 induction affect a gene called ARO80
(YDR421w), coding for a
Zn2Cys6 family transcription factor. A sequence
highly similar to UASaro was found upstream from the
YDR380w gene encoding a homolog of bacterial indolepyruvate decarboxylase. In yeast, this enzyme is postulated to catalyze the second step of tryptophan catabolism to
tryptophol. We show that ARO9 and YDR380w
(named ARO10) have similar patterns of transcriptional
regulation and are both under the positive control of Aro80p. Nitrogen
regulation of ARO9 expression seems not directly to involve
the general factor Ure2p, Gln3p, Nil1p, Uga43p, or Gzf3p.
ARO9 expression appears, rather, to be mainly regulated by
inducer exclusion. Finally, we show that Gap1p, the general amino acid
permease, and Wap1p (Ycl025p), a newly discovered inducible amino
acid permease with broad specificity, are the main aromatic amino
acid transporters for catabolic purposes.
 |
INTRODUCTION |
The yeast Saccharomyces
cerevisiae can use tryptophan, phenylalanine, or tyrosine as the
only source of cellular nitrogen (11). The main products of
their catabolism are tryptophol, phenylethanol, and tyrosol,
respectively, constituents of the mixture of alcohols
collectively known as fusel oil in fermentations (41, 42, 66,
69). Fusel oil formation from amino acids is believed to
proceed through the so-called Ehrlich pathway involving three
enzymatic steps. A first transamination produces the
-keto-acid analog of the amino acid, a decarboxylation step yields an aldehyde, and a reduction step converts the aldehyde to a primary alcohol (79). Tryptophan is thus converted to tryptophol via the
metabolic intermediates indole-3-pyruvate and indole-3-aldehyde
(41, 69); tyrosine and phenylalanine are converted to
tyrosol and phenylethanol in a similar way (42, 66). Yet as
recently stressed for leucine catabolism by Dickinson et al.
(15), this general scheme of amino acid degradation stems
mainly from studies of metabolic intermediates and end product
formation. Too little is known about the specific permeases and
enzymes involved in aromatic amino acid utilization, their genetic
determinants, and their regulation. Aromatic aminotransferase
II, the product of the recently cloned ARO9 gene
(34), is the first characterized enzyme proposed to be
involved in the catabolism of aromatic amino acids. Specifically, (i)
ARO9 gene transcription is induced by the presence of
tryptophan, phenylalanine, or tyrosine in the growth medium and remains
at a very low level in their absence (34, 41, 77); (ii)
aromatic aminotransferase II catalyzes the first step of the catabolism of these amino acids (41, 77); (iii) the enzyme is
dispensable for growth on phenylalanine or tyrosine as the only source
of nitrogen, but aro9 mutants grow poorly on tryptophan or
kynurenine (77); and (iv) preliminary expression studies
(34) show that, in the presence of inducer, ARO9
expression levels are more than 10 times higher on urea medium than on
ammonia medium, indicating that ARO9 is subject to an
ammonia effect (80). Thus, as originally proposed by
Kradolfer et al. (41), the physiological function of
aromatic aminotransferase II is most likely to participate in the
catabolism of aromatic amino acids, mainly tryptophan.
Like many other nitrogen-catabolic genes, ARO9 appears to be
regulated in at least two complementary ways: by an induction mechanism, with aromatic amino acids acting as inducers, and by an
ammonia effect which modulates expression levels according to nitrogen
source quality.
In S. cerevisiae, the synthesis of permeases and enzymes of
many nitrogen-catabolic pathways is inducible. Examples include the
pathways of arginine, proline, urea, and allantoin (for reviews, see
references 47, 52, and 80) and
4-aminobutyrate (reference 76 and references
therein) and serine/threonine (31) utilization. Induction is
mediated in cis by a class of upstream activating sequences (UASs), specific to genes of a particular catabolic pathway. It has been demonstrated in several cases that these UASs are
binding sites for specific trans-acting factors that can
stimulate transcription of adjacent genes in response to inducer availability (31, 70). Many of these regulatory proteins, such as ArgRIIp (53), Uga3p (1), Put3p
(48), and Cha4p (31), belong to the
C6 zinc cluster family of fungal transcription factors,
whose prototypes are Gal4p (50, 60) and Prp1p
(51). As deduced from the analysis of the complete genome
sequence, the family comprises no less than 56 members in S. cerevisiae, most of them of unknown function (64).
Inducer availability is by no means sufficient to ensure high-level
transcription of the genes of a nitrogen catabolic pathway. S. cerevisiae can use some 30 different compounds as the sole source
of cellular nitrogen (11). Some nitrogen sources such as
glutamine and ammonia (good or preferred nitrogen sources) support
optimal growth, while others, such as proline and urea (poor or
secondary nitrogen sources), support slower growth. When a good
nitrogen source is present, utilization of the poorer nitrogen sources
is prevented. This general phenomenon, termed the ammonia effect
(80) or nitrogen regulation (47), is the result
of at least two distinct regulatory mechanisms: nitrogen catabolite repression (NCR), which affects the synthesis of enzymes and permeases responsible for the utilization of secondary nitrogen sources, and
nitrogen catabolite inactivation (NCI), which down-regulates the
activity of several permeases that import these substrates (24,
47, 80). NCR of susceptible genes is achieved through upstream
5'-GATA-3' sequences variously characterized as UASNTR (58, 59), UASN (55), or
UASGATA (4). Four distinct GATA factors can bind
to these UASs and affect transcription: activators Gln3p and
Nil1p/Gat1p and repressors Uga43p/Dal80p and Gzf3p/Nil2p/Deh1p (references 10, 62, and 71 and
references therein). In addition, nitrogen repression of most
NCR-sensitive genes is relieved by mutations in the
URE2/GDHCR/USU locus (16, 22, 25). Ure2p is not a
GATA factor, does not bind to DNA, and seems to act mainly by
inactivating Gln3p, the main activator of nitrogen regulation (47). Hence, nitrogen source repression involves negative
factors counteracting the function of positive factors when preferred nitrogen sources are available.
NCI, on the other hand, affects the activity of most permeases subject
to NCR, including Gap1p and the proline permease Put4p (24).
Addition of ammonium ions to cells growing on poor substrates such as
proline or urea triggers rapid and complete inactivation (23) and degradation (30) of Gap1p. This process
requires the Npi1p/Rsp5p ubiquitin ligase and the integrity of the
C-terminal region of the permease (29, 30, 72).
Ubiquitination is required for endocytic internalization of the
permease and its subsequent degradation in the vacuole (72).
In npi1 mutants, Gap1p ubiquitination is impaired and the
permease remains located in the plasma membrane and active (23,
72).
Here we have sought to identify regulatory elements involved in the
induction and nitrogen regulation of ARO9 expression. We
have identified two elements required for specific
induction of the ARO9 gene by aromatic amino acids: a UAS
(UASaro) and the transcriptional activator Aro80p. We
have further shown that the ARO10 (YDR380w) gene, encoding
a putative indole-3-pyruvate decarboxylase, possesses an
upstream sequence similar to UASaro and that this gene is also subject to Aro80p-dependent induction by tryptophan. Nitrogen control analyses indicate that the general factors of nitrogen
transcriptional regulation do not directly affect ARO9 expression. Transcription of this gene appears, rather, to be regulated
essentially through inducer exclusion. A preliminary report of this
work has already appeared (32).
 |
MATERIALS AND METHODS |
Strains, media, and methods.
The S. cerevisiae
strains used are listed in Table 1. All
are isogenic with wild-type strain
1278b (MAT
)
(6). The laboratory's standard minimal medium has been
described previously (36); the nitrogen source was either 10 mM ammonium sulfate or another nitrogenous compound at 1 g/liter; the
carbon source was 3% glucose. Inducing media were supplemented with
0.5 g of tryptophan, phenylalanine, or tyrosine per liter.
When needed, 50 µg of uracil or leucine per ml was added to
the medium. Complex medium 868 has been described previously
(17). Standard yeast genetic techniques were applied (68). Yeast cells were transformed by the lithium acetate
method (21, 35). The Escherichia coli strain used
in this work was JM109. All E. coli and DNA manipulations
were performed according to standard procedures (5, 63).
Formation of 5' and internal deletions in the ARO9
upstream region.
Construction of the YCpARO9-lacZ
plasmid has been described previously (34). In the plasmid,
the upstream ARO9 DNA fragment is flanked at the 5' end by a
portion of the pFL38 polylinker. To isolate the 5' nested deletions of
the ARO9-lacZ reporter gene, the plasmid was cleaved at the
polylinker BamHI and SphI restriction sites,
treated with exonuclease III and S1 nuclease, and religated, as
instructed for the double-stranded nested deletion kit (Pharmacia LKB).
Plasmid pII472 is a derivative of YCp
ARO9-lacZ from which
the 36 bp of the UAS
aro element have been specifically
deleted.
The deletion, spanning positions

168 through

133 relative
to
the ATG of the open reading frame (Fig.
1), was introduced by
using the Altered
Sites in vitro mutagenesis system (Promega).
A 4.3-kb
EcoRI-
EcoRI fragment, comprising 1.3 kb of the
5'-flanking
region of
ARO9 and 3 kb of the 5' coding region
of the
lacZ gene,
was extracted from plasmid
YCp
ARO9-lacZ and inserted into the
EcoRI site of
the pALTER-1 phagemid. Single-stranded DNA was produced,
and the 36-bp
sequence was deleted by site-directed mutagenesis
with the appropriate
oligonucleotide. The accuracy of the deletion
was checked by
sequencing, and then the mutagenized
EcoRI-
EcoRI
fragment was reinserted into the
EcoRI-
EcoRI site
of plasmid YCpAJ153
(
3).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Sequence of the 5'-flanking region of the
ARO9 gene. The sequence includes the SPL2
(YHR136c) gene, recently shown to encode a novel inhibitor
of the Pho80p/Pho85p cyclin-dependent protein kinase (20).
Putative TATAAA sequences are underlined, GAT(A/T)(A/G) (75)
sequences are shaded, and the UASaro sequence is boxed. (B)
Sequence of the UASaro indispensable for ARO9
gene induction. The arrows indicate the CCG triplets. (C) Comparison of
UASaro and a similar sequence located upstream from the
ARO10 gene. The arrows indicate the direct repeats.
|
|
Plasmids carrying heterologous lacZ fusions.
Plasmid PAL1-15 carries a heterologous
UASaro-CYC1-lacZ fusion gene in which the TATA
box and transcriptional start site are provided by the CYC1
gene and the UAS is the UASaro element of the
ARO9 gene. Plasmid PAL1-15 was constructed by introducing UASaro at the XhoI restriction site position of
the CYC1 promoter in plasmid pLG670-Z (28). This
was done in several steps with the Altered Sites in vitro mutagenesis
system (Promega). First, a BamHI-SalI fragment of
the CYC1 promoter was isolated and inserted into the
pALTER-1 phagemid restricted with BamHI and SalI.
UASaro was then introduced into the CYC1
promoter by directed mutagenesis with an oligonucleotide comprising the
36-bp element flanked by targeting sequences of CYC1. The
correct insertion of UASaro into pALTER-1 was checked by
sequencing, and finally the BamHI-SalI fragment
containing the CYC1-UASaro-CYC1 construct was
isolated from pALTER-1 and inserted into plasmid pLG670-Z
(28), yielding plasmid PAL1-15. Using appropriate
oligonucleotides, we followed the same procedure to obtain the PAL
series of heterologous fusions carrying variously altered forms of the
36-bp sequence (PAL60, PAL50, PAL2-13, and PAL2-10). PAL1-31 and
PAL1-46 were fortuitously obtained in the course of PAL1-15
construction. All the constructs were sequenced on both strands.
Isolation of mutants affected in the ARO9 gene
induction.
Cells of the ura3 strain 30332d bearing
episomal plasmid PAL1-15 were mutagenized with ethane methylsulfonate
and plated on proline minimal medium supplemented with 500 µg of
tryptophan per ml and 40 µg of X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) per
ml, the medium being buffered at pH 7.0 (28). About 32,500 colonies were screened, white or pale blue colonies were restreaked, and 17 isolates were chosen for enzymatic tests.
Isolation, subcloning, and deletion of the WAP1
(YCL025c) gene.
S. cerevisiae 32102c, derived from
IHI611, carries mutations gap1-92 and ura3, plus
a mutation affecting an unknown locus (see Results). The strain is
unable to grow on minimal medium containing either tryptophan or
phenylalanine at a 500-µg/ml concentration as the only source of
nitrogen. The mutant was transformed with a genomic library from
wild-type strain
1278b (49), and transformants growing on
tryptophan or phenylalanine were selected. A second cycle of
transformation was carried out with purified plasmids, and the
extremities of the inserts were sequenced. From transformants selected
on tryptophan, only genomic fragments carrying the
GAP1 gene (38) were obtained (four different
complementing clones). From transformants selected on phenylalanine, 11 different genomic fragments were analyzed. Of these, one
carried the GAP1 gene. The 10 other genomic inserts
were partially overlapping fragments from a region of chromosome III
(56). YCL025c was the only open reading frame
common to all of them. YCL025c was isolated as a 3-kb
BsmI-BsmI subfragment and cloned into
vector pFL38 (8) at the SmaI restriction site.
The resulting pII406 plasmid, when introduced into cells of strain
32102c, restored their ability to grow on phenylalanine medium.
Chromosomal deletion of the
YCL025c gene was performed by
homology-directed gene replacement with PCR-based techniques described
by Wach et al. (
78) as described in reference
33. Correct
targeting of the
kanMX2
cassette into the
YCL025c gene was checked
by PCR. Further
work (see Results and reference
33) showed that
YCL025c encodes an inducible amino acid permease with broad
substrate
specificity.
YCL025c was consequently named
WAP1, for wide-specificity
amino acid
permease.
Isolation, subcloning, and deletion of the ARO80
(YDR421w) gene.
S. cerevisiae 32054d
(aro80-2 aro8
-1 ura3), auxotrophic for phenylalanine and
tyrosine, was transformed with a wild-type
1278b genomic library
(49), and prototrophic transformants were selected. Among
them, two different growth phenotypes were observed on aromatic amino
acid substrates because both aro80 ARO8 and ARO80
aro8 single mutant strains are prototrophs. Only transformants
displaying the Aro8
phenotype (77) were
further analyzed, yielding complementing plasmids pII242 and pII251.
Sequencing revealed that their inserts overlapped over almost their
entire length and came from a region of chromosome IV extending from bp
1305529 to bp 1316570 (37). This chromosomal region
comprises two internal open reading frames: YDR420w,
corresponding to the HKR1 gene, and YDR421w (see
Results). The function of the latter is unknown, but the deduced
polypeptide contains a Zn2Cys6 binuclear
cluster domain and other features characteristic of Gal4p family
transcriptional regulators (64). YDR421w was
cloned as a 5.6-kb BamHI-BamHI fragment extracted from plasmid pII242 and inserted into the BamHI restriction
site of centromeric plasmid pFL38 (8). The resulting pII270
plasmid complemented the auxotrophy of strain 32054d (aro80-2
aro8
-1 ura3) and the growth defects of the aro80
mutants on medium containing an aromatic amino acid as the sole source
of nitrogen.
Chromosomal deletion of the
ARO80 gene was also performed by
homology-directed gene replacement (
78). The primers used
for
the amplification
were 5'-TGTCTGCTAAGAAAAGGCCTTCGGGAAACGCAGCATTTGAGCGG
CCGCCAGCTGAAGCTTCGTACGC-3' and 5'-CGAATAGTGCGGTTG TCTTGGTTGATGACGTAATTCTTTGGCGGCCGCATAGGCCACTAGT
GGATCTG-3'.
Correct targeting of the cassette into the
ARO80 gene
was checked by
PCR.
Tryptophan uptake.
The time course of L-[side
chain-3-14C]tryptophan (specific radioactivity, 56 mCi/mmol; from DuPont NEN) uptake was determined as previously
described for 4-aminobutyric acid accumulation (27), with
radiolabeled amino acids at a 20 µM final concentration.
Enzyme assays.
Tryptophan-phenylpyruvate transamination
activity was assayed as described elsewhere (77).
-Galactosidase was assayed according to the method of Miller
(54); the unit used was nanomoles of o-nitrophenol formed per minute per milligram of protein.
Protein concentrations were determined according to the method of Lowry et al. (43) with bovine serum albumin as the standard.
RNA preparation and gene expression analysis by RT-PCR.
Cells were grown to a density of approximately 107 cells/ml
on minimal medium with the nitrogen source specified in the legends to
the figures. Total RNA was isolated as instructed for the RNeasy Mini
kit by the supplier (Qiagen); the final RNA concentration was
approximately 1 µg/µl. The purified RNA was treated with RNase-free DNase I (Boehringer Mannheim) to eliminate any trace of DNA. Reverse transcription-PCR (RT-PCR) was performed with approximately 10 ng of
RNA per reaction with the Titan One RT-PCR kit (Boehringer Mannheim)
and a Progene thermal cycler, from Techne (Cambridge) Ltd. The RT stage
was performed at 55°C for 30 min. After 1 min at 94°C to denature
the DNA, amplification was carried out as follows: (i) 10 cycles
of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C; (ii)
15 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at
72°C, the elongation time of each cycle being increased by 5 s;
and (iii) a final elongation step of 7 min at 72°C. The primers used
to amplify a 606-bp subfragment of the ARO9 gene situated 84 bp downstream from the start codon were
5'-CCGTTCAGTAGTCAGGTCGCT-3' and
5'-GGATCCCCCAGTGAGCTACCCATT-3'. For the ARO10
(YDR380w) gene, the 745-bp amplicon is located 60 bp
downstream from the start codon, and the primers used were
5'-CCATACCTATCAGTCAGTACGTCTCC-3' and
5'-CGATCAGCAACAATTCCGTTTGGTG-3'. The ACT1
amplicon was produced with the primers 5'-GACTCCTACGTTGGTGATGA-3'
and 5'-CTGGAGGAGCAATGATCTTG-3'.
 |
RESULTS |
Detection of a UAS element required for induction of the
ARO9 gene.
To roughly locate the cis-acting
sequences involved in ARO9 induction, we examined the
effects of a series of 5' deletions produced in the ARO9
promoter region (Fig. 2). The starting
plasmid was YCpARO9-lacZ, containing 1,231 bp of upstream
region and the first 11 codons of the ARO9 gene fused to a
promoterless lacZ gene (34). Our previous work
had shown that this fusion product responds to the same regulatory
signals as the chromosomal ARO9 gene. In particular, it is
very weakly expressed in the absence of inducer, induced by aromatic
amino acids, and subject to the ammonia effect (34). The
effect on induction of removing different promoter sequences was
monitored by measuring the
-galactosidase activity in
plasmid-bearing yeast strain 23346c (ura3) grown on minimal
urea medium in the presence or absence of inducer. Deletions extending
from
1231 through
255 had no major effect on gene induction.
Further removal of sequences up to
169 resulted in a two- to
threefold decrease in the level of induction, and no further change was
observed with deletions extending to
153. This segment of the
promoter thus seems to contribute modestly to activation. It contains
several sequences of potential interest: the sequence
234-TTGCCGCCGA-225 almost perfectly matches (9 of 10 nucleotides) the URS1 element (44), the binding site of
Car80p/Ume6p, a key regulator of nitrogen metabolism and early meiosis
gene expression (74). The imperfect palindrome
231-CCGCCGACGGCCG-219 overlaps with this element. Further
deletion of sequences up to
145 and beyond caused almost complete
loss of tryptophan-induced expression, indicating that an element
essential to activation is present in the promoter near position
145. This region contains, from
168 to
133, a remarkable
sequence consisting of four CCG repeats regularly spaced by 7 bp
(Fig. 1A and B). An internal deletion removing this 36-bp sequence was
produced in plasmid pII472. The deletion abolished induction of the
gene (Fig. 2), showing that this 36-bp promoter fragment is necessary
for ARO9 induction.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of 5'-nested deletions on induced
ARO9-lacZ expression. Strain 23346c (ura3)
transformed with a low-copy-number plasmid carrying the different
promoter deletion constructs was grown on minimal urea medium with (+ Trp) or without ( Trp) tryptophan at 500 µg/ml. -Galactosidase
activities, expressed in nanomoles per minute per milligram of protein,
are averages of two independent experiments. -Galactosidase activity
variations were 15%. The black box indicates the position of
UASaro. The grey box indicates the position of the sequence
similar to URS1. The hatched box represents the position of the
SPL2 (YHR136c) gene (20). Vertical
lines represent the positions of two TATA consensus sequences
(TATAAA).
|
|
We constructed a hybrid promoter (
28) to demonstrate that
the 36-bp fragment is also sufficient for specific transcriptional
activation. We used a heterologous
CYC1-lacZ gene, present
on
multicopy plasmid pLG670-Z (
28), possessing the
transcriptional
and translational start sites and TATA boxes of
CYC1 but lacking
its UAS elements. As expected, the
CYC1-lacZ fusion was very weakly
expressed and
did not respond to the presence of tryptophan in
the growth medium
(Fig.
3). In contrast, plasmid
PAL1-15 carrying
the putative UAS of
ARO9 in front of the
CYC1-lacZ gene displayed
high activation levels in response
to tryptophan (Fig.
3). Furthermore,
mutations introduced in vitro into
the 36-bp fragment severely
affected or abolished tryptophan-induced
expression (Fig.
3).
Induction was completely abolished by removal of
18 central bp
of the sequence in plasmid PAL1-31. It was fivefold
reduced by
single substitution of a T for a C in the second CCG triplet
(PAL1-46).
Derived constructs truncated at either the 3' or the 5' end
and
containing only three CCG triplets displayed high induction levels
(PAL50 and PAL60). Simultaneous elimination of both external CCG
triplets led to 20- to 30-fold-decreased induction but did not
totally
suppress induction (PAL2-13 and PAL2-10). Taken together,
these results
demonstrate that the 36-bp sequence contains a UAS
element necessary
and sufficient for induced expression of the
fusion gene in response to
tryptophan. The entire 36-bp sequence
will be called UAS
aro
throughout this work.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
UASaro renders the
UASaro-CYC1-lacZ gene inducible by aromatic
amino acids. Strain 23346c (ura3) transformed with a
high-copy-number plasmid carrying the wild-type form (PAL1-15) or a
mutated form of UASaro was grown on minimal urea medium
with (+ Trp) or without tryptophan at 500 µg/ml. -Galactosidase
activities, expressed in nanomoles per minute per milligram of protein,
are averages of two independent experiments. -Galactosidase activity
variations were 15%. The underlined lowercase "t" in the PAL1-46
plasmid indicates substitution of a thymine for a cytosine.
|
|
Isolation of mutants impaired in ARO9 induction.
Cells of strain 30332d (ura3) transformed by multicopy
plasmid PAL1-15 bearing the UASaro-CYC1-lacZ
fusion gene form blue colonies during growth on urea plus
tryptophan medium supplemented with X-Gal. To isolate mutants
affected in ARO9 induction through the UASaro
element, we mutagenized transformed 30332d cells and analyzed clones
forming white or pale blue colonies. Among 17 analyzed mutants, strains
IHI602, IHI606, and IHI614 displayed no induction of either
-galactosidase or tryptophan-phenylpyruvate aminotransferase
activity. Strain IHI611 was only partially deficient (Table
2). The same induction deficiencies were
observed in mutant cells cured of the plasmid and back-transformed with
PAL1-15 (data not shown). The mutants were defective in induction of
both the chromosomal ARO9 gene and the multiple
plasmid-borne copies of the
UASaro-CYC1-lacZ gene. The mutations most likely
affect trans-acting elements involved in
UASaro-mediated induction.
ARO9 induction is impaired in mutants lacking the Gap1p
and Wap1p permeases.
Mutant strain IHI611 failed to grow on
minimal medium containing tryptophan, phenylalanine, tyrosine, or
citrulline as the sole nitrogen source and grew at a very reduced rate
on isoleucine. Genetic analyses indicated that two mutations were
responsible for this growth phenotype (Table
3). One of them affected the GAP1 locus and was called gap1-92. The second
mutation did not by itself produce a particular phenotype, but in
double mutants it markedly worsened the growth deficiencies caused by
the gap1-92 mutation (Table 3). To identify the altered
genetic locus, we searched a wild-type genomic library for fragments
complementing the growth deficiencies of the double mutant strain
32102c (see Materials and Methods). Subsequent subcloning experiments
indicated that the second mutation affected the YCL025c gene
on chromosome III (56). On the basis of sequence
similarities, this gene had been postulated to encode an amino acid
permease (2, 56). We temporarily named the second mutation
ycl025-1 and constructed a ycl025
-1
deletion mutant strain. Growth phenotype analysis, complementation tests, and analysis of 21 tetrads derived from the
cross between strain IHI726 (gap1-92 ycl025
-1 ura3)
and strain 32102c (gap1-92 ycl025-1 ura3) showed that
the recessive mutations ycl025-1 and
ycl025
-1 are allelic.
The growth deficiencies of
gap1-92 ycl025-1 double mutants
suggested that aromatic amino acids are transported not only by
Gap1p
(
26) but also by the putative permease Ycl025p. We conducted
uptake experiments with
gap1 deletion mutants to avoid
massive
interference of the general permease with uptake. The cells
were
grown on urea medium to avoid both the NCR and NCI effects
produced
by preferred nitrogen sources on the synthesis and activity of
permeases (see the introduction). We added radiolabeled tryptophan
(final concentration, 20 µM) to cultures of exponentially growing
gap1
single mutants or
gap1
ycl025
-1
double mutants and measured
the rate at which the amino acid
accumulated in the cells (data
not shown). The two strains displayed
markedly different accumulation
profiles. In
gap1
ycl025
-1 cells, the import rate remained very
low
throughout the experiment. In
gap1
cells, uptake activity
gradually developed upon addition of the amino
acid, in a manner
reminiscent of

-aminobutyric acid
(GABA)-triggered induction
of the
UGA4 gene encoding
the high-affinity GABA permease (
3,
27). Similar results
have been obtained for the accumulation
of phenylalanine and tyrosine
(
33). Our interpretation is that
Ycl025p can indeed
transport aromatic amino acids and that these
act as inducers of
YCL025c gene expression. A detailed study of
YCL025c expression and of the properties of the
new permease is
presented elsewhere (
33), showing that
YCL025c does encode an
inducible amino acid permease with
broad substrate specificity.
Consequently
YCL025c was named
WAP1, for wide-specificity amino
acid permease. An
independent analysis of
YCL025c function has
also appeared
during the preparation of the manuscript (
65).
To
investigate the effects of the
gap1
and
wap1
mutations on
tryptophan-dependent
ARO9
induction, we determined steady-state
ARO9-lacZ expression
levels in cells grown in the presence or
absence of inducer at a high
concentration (500 µg/ml) (Table
4).
Elimination of both permeases did not significantly reduce
the level of
ARO9 expression on tryptophan-supplemented minimal
ammonia
medium. On tryptophan-supplemented urea medium, elimination
of
Gap1p or Wap1p did not decrease the level of expression, but
simultaneous loss of both permeases led to a 75% decline, similar
to
that observed with the original IHI611 mutant. This decline
probably
reflects poor inducer uptake, but the very low inducer
uptake rates
observed in the double mutant remain compatible with
a moderate level
of
ARO9 induction. Individual loss of Gap1p or
Wap1p led to
a twofold increase of
ARO9 expression, an aspect
which
remains unexplained. Overall, these results show that Gap1p
and Wap1p
are the main transporters involved in aromatic amino
acid utilization.
They suggest also that cellular inducer concentration
limits
ARO9 induction in
gap1 wap1 double mutant strains
grown
on urea plus tryptophan medium.
The ARO80 gene is essential to induced expression of
ARO9.
Mutant strains IHI602, IHI606, and IHI614 failed to
grow on minimal tryptophan medium; their growth rate was reduced on
minimal phenylalanine or tyrosine medium and unaffected on other
sources of nitrogen. Genetic analyses showed that all three mutations segregate 2:2; are recessive; complement the aro8,
aro9, gap1, and wap1 mutations; and
belong to the same complementation class, which we have named
ARO80. When an aro80 mutation was associated with
an aro8 mutation affecting aromatic aminotransferase I
(77), the aro80 aro8 double mutant cells grew
very slowly on ammonia medium unsupplemented with phenylalanine or
tyrosine. This confirmed the absence of inducible aromatic
aminotransferase II activity in the double mutants, our previous
studies having shown that the simultaneous absence of aromatic
aminotransferases I and II results in phenylalanine and tyrosine
auxotrophy (77).
The
ARO80 gene was isolated by seeking genomic fragments
complementing the double auxotrophy of strain 32054d
(
aro8
1-1 aro80-2 ura3) (see Materials and
Methods). Complementing fragments carried
the
YDR421w gene
(Fig.
4A and B) of chromosome IV
(
37).
YDR421w also complemented the growth
deficiencies of
aro80 single mutants
and was thus
postulated to be identical to the
ARO80 gene. To
confirm this, we deleted
YDR421w from the
chromosome of strain
IHI708
(
ydr421w
-1::Kan
r ura3). Growth
phenotype analyses, complementation tests, and
analysis of 28 tetrads from a cross between strains 32054b (
aro80-2 ura3)
and IHI708 (
ydr421w
-1::Kan
r
ura3) demonstrated that the
ydr421w
-1 and
aro80-2 mutations
are allelic. Deletion mutant
ydr421w
-1 was named
aro80
-1.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Map of chromosome IV region around the
ARO80 gene. (B) Schematic drawing of the DNA fragments that
complement the auxotrophy of the aro8 aro80-2 double
mutation. (C) Schematic diagram of predicted Aro80p domains: putative
bipartite nuclear targeting sequence
( ),
C6 zinc finger domain ( ), coiled-coil region ( ),
middle homology region
( ), and
acidic domain ( ). (D) Alignment of the C6 zinc finger
sequence of the ARO80 gene and the consensus sequence of the
domain (64).
|
|
To confirm the role of Aro80p in
ARO9 regulation,
we compared expression of the
ARO9 gene in the
wild-type and
aro80
genetic
backgrounds. Table
5 shows that tryptophan-dependent
induction
of both plasmid-borne
ARO9-lacZ and chromosomal
ARO9 was abolished
in extracts of the
aro80
deletion mutant. Table
5 further shows
that inducible aminotransferase
activity was restored in the mutant
after transformation with a
centromeric plasmid carrying the cloned
ARO80 gene.
Steady-state
ARO9 transcript levels were also measured
semiquantitatively by RT-PCR (Fig.
5). A
PCR product of the correct
size was obtained with
ARO9-specific primers and RNA prepared
from wild-type
cells grown on urea medium supplemented with tryptophan.
A much less
abundant amplification product was obtained with RNA
from wild-type
cells grown on tryptophan-supplemented ammonia
medium. No perceptible
ARO9 amplification signal was obtained
with RNA preparations
from wild-type cells grown on inducer-free
medium or from
aro80
cells grown on inducer-supplemented ammonia
or urea
medium. There is thus complete agreement among the regulation
pattern
of the native enzyme, the reporter gene expression data,
and the
results of RT-PCR transcript analysis. We conclude that
induction of
aromatic aminotransferase II results from Aro80p-dependent
transcriptional activation of the
ARO9 gene.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 5.
RT-PCR analysis of ARO9 and ARO10
transcripts. Strains 23346c (ura3), 30701a (aro80
ura3), and 30312d (aro9 ura3) were grown on minimal
medium containing the following nitrogen sources: urea (U), urea plus
tryptophan (U+T), ammonia (A), or ammonia plus tryptophan (A+T). Total
RNA was used to perform the analysis (see Materials and Methods). wt,
wild type.
|
|
Aro80p is a member of the Zn2Cys6
transcription factor family.
The ARO80 (YDR421w) open
reading frame encodes a 950-residue polypeptide with a calculated
molecular mass of 118 kDa. Its codon bias index is 0.022 (7), and its codon adaptation index is 0.12 (67),
both values being indicative of a low expression level, typical of
yeast transcriptional activators. Two poor matches to the TATA
consensus sequence lie at positions
49 and
72 from the putative
initiation codon. This upstream region also contains a cluster of three
5'-GATA-3' sequences from positions
137 to
114, raising the
possibility that GATA factors control ARO80 expression. The
deduced amino acid sequence of Aro80p contains several motifs (Fig. 4C
and D) that characterize the Gal4p class of transcription factors, as
already analyzed by Schjerling and Holmberg (64) in their
study of the 56 Gal4p family members present in the entire yeast
genome: the most salient feature is an N-terminal segment highly
similar to the consensus sequence of the
Zn2Cys6-type zinc finger motif (Fig. 4D), an
established DNA-binding domain (40). The Aro8p motif has all
the features found in the other cloverleaf-like
Zn2Cys6 binuclear clusters (57), but
the region of variable length linking the two cysteine-rich substructures comprises 12 amino acids instead of 6 to 9 as commonly found in other proteins of the family; it shares this property with the
putative yeast transcription factor Yml076p of unknown function;
several clusters of acidic residues are present in the predicted
Aro80p. The cluster with the highest negative charge (
9) is located
at the C-terminal end spanning positions 884 to 909. Similar C-terminal
acidic regions have been shown to mediate protein-protein interactions
and to contribute to the ability of the protein to activate
transcription (46). In Aro80p, this C-terminal acidic
segment is followed by an asparagine-rich region; several coiled-coil
structures with a potential to form heptad repeats of an amphipathic
-helix are predicted by the Pepcoil algorithm (45). It is
common for this family of factors to act as homodimers, and crystal
structures have revealed that coiled-coil structures mediate formation
of Gal4 and Ppr1 homodimers (50, 51). Other noteworthy
structural features of Aro80p have not been reported previously: (i) a
recognizable part of the middle homology region (64) spans
positions 370 to 412; (ii) a putative bipartite nuclear targeting
sequence (61) spans amino acids 5 to 20; (iii) an ATP-GTP
binding site spans residues 647 to 654; and (iv) a putative PEST region
extends from residue 836 to residue 854.
The ARO80 gene is also essential to induced expression
of the ARO10 (YDR380w) gene encoding a putative
indole-3-pyruvate decarboxylase.
On media containing tryptophan,
phenylalanine, or tyrosine as the sole nitrogen source, growth of the
aro80
mutant was clearly affected more strongly than that
of the aro9
mutant (Fig.
6). This indicates that Aro80p activates
other genes besides ARO9 in the aromatic amino acid
utilization pathway. Genes involved in aromatic amino acid transport
were obvious candidates for this regulation. Yet the tryptophan,
phenylalanine, and tyrosine uptake rates were unaffected by the
aro80
mutation, and the ARO80 gene proved not
to be involved in induction of the new Wap1p permease (data not shown).
We searched the genome for sequences similar to
UASaro. The pattern
5'-CCG(7X)CCG(7X)CCG(7X)CCG-3' was found, spanning bp
342 to
310 upstream from the open reading frame YDR380w.
The deduced Ydr380p sequence is highly similar to those of yeast
pyruvate decarboxylases Pdc6p, Pdc5p, and Pdc1p and to the recently
described
-ketoisocaproate decarboxylase Kid1p (15). It
is also highly similar to the three bacterial indolepyruvate decarboxylase sequences present in databases. In fact, together with
pyruvate decarboxylases and Kid1p, Ydr380p is the yeast protein most
similar to them, as established by sequence comparisons (data not
shown). Thus, Ydr380p may be the yeast indole-3-pyruvate decarboxylase catalyzing conversion of indole-3-pyruvic acid to
indole-3-acetaldehyde, the second reaction involved in tryptophan
degradation to tryptophol. In line with this hypothesis, we found the
YDR380w and ARO9 genes to be regulated in a very
similar manner. RT-PCR transcript analysis (Fig. 5) showed weak
expression of YDR380w on both urea and ammonia medium. On
both media, YDR380w transcription was induced upon cell
exposure to tryptophan, the activation level being markedly higher on
urea medium. In both cases, induction of transcription was abolished in
aro80
mutant cells, showing that ARO80 is also essential to YDR380w induction by tryptophan. These facts
highlight a second target of Aro80p and integrate the
YDR380w gene into tryptophan metabolism. We have thus given
YDR380w the name ARO10. Further characterization
of this gene is under way.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 6.
Growth phenotypes of strains 23346c (ura3),
30312d (aro9 ura3), and 30701a (aro80 ura3)
on minimal medium containing ammonia, phenylalanine, tyrosine, or
tryptophan as the nitrogen source. All media were supplemented by 50 µg of uracil per ml. wt, wild type.
|
|
Nitrogen regulation of ARO9 expression.
Like many
other nitrogen catabolic genes, ARO9 is subject to nitrogen
source regulation (see the introduction). A systematic study was
undertaken to discover the mechanisms underlying this control.
Wild-type and appropriate mutant strains transformed with the
ARO9-lacZ plasmid were grown under conditions favoring repression (ammonia medium) or derepression (urea medium) and in the
presence or absence of the inducer tryptophan. The transformed strains
each carried one or several mutations affecting factors involved in
either NCR or NCI.
-Galactosidase activity was taken as a measure of
ARO9 expression.
(i) Role of the NCR general negative factors.
In the absence
of inducer, wild-type cells grown on either ammonia or urea medium
displayed very low, similar levels of ARO9 expression;
hence, no ARO9 derepression was observed on urea medium (Table 6, row 1). In the absence of
inducer, likewise, we observed no increased expression of
ARO9 in cells harboring, separately or in combination, the
mutations ure2, uga43
, and gzf3
,
disabling factors that mediate nitrogen repression (Table 6, rows 2 to 8). This contrasts with the behavior of the inducible genes
CAR1, GDH2, DUR1, DUR2, and
DAL1 (47, 80); PUT1, PUT2,
and UGA1 (81); and UGA4
(4), whose basal expression in inducer-free media is
subject to nitrogen repression. Yet despite the apparent insensitivity of ARO9 to nitrogen repression, once
wild-type cells were exposed to the inducer, much higher levels of
ARO9 transcription were observed on urea medium than on
ammonia medium (Table 6, row 1). This ammonia effect can hardly be
attributed to nitrogen repression exerted by Ure2p, by GATA factor
Gzf3p or Uga43p, or by a combination of these, since expression
increased very little in NH4+-grown cells
lacking these factors (Table 6, rows 2 to 8). Furthermore, the
threefold increase observed in cells carrying the ure2
mutation, alone or associated with the gzf3
and
uga43
mutations (Table 6, rows 2, 5, and 7 and 8), was
lost in ure2 aro80
cells (Table 6, row 9), showing that
it is dependent on induction.
(ii) Role of the positive factors Gln3p and Nil1p.
Nitrogen-regulated genes are typically under the positive control of
the GATA family factors Gln3p and Nil1p (47, 52). On
tryptophan-supplemented urea medium, ARO9 transcription was unaffected in cells lacking one of these factors (Table 6, rows 10 and
11). Surprisingly, the activity in the gln3
mutant is higher than that in the wild-type strain after growth in minimal ammonia plus tryptophan (Table 6, rows 10 and 1; Table
7). This unexpected result has also been
observed in the case of the arginine induction of the CAR1
gene encoding arginase (18). ARO9
expression was greatly reduced upon elimination of both
activators (Table 6, row 12), indicating that they both can contribute
to the amplification of induction observed under conditions of nitrogen
derepression. Yet under conditions of nitrogen repression, elimination
of both activators had no depressing effect on ARO9
induction (Table 6, row 12), in contrast to what happens with
other nitrogen-regulated genes (9, 71, 73).
Furthermore, Gln3p and Nil1p activate expression of
nitrogen-sensitive genes via 5'-GATA-3' UASs. The ARO9
promoter contains several dispersed GATA motifs (Fig. 1A) but no
GATA element similar to either UASNTR (58,
59), UASN (55), or
UASGATA (4). Moreover, we failed to obtain
evidence that Gln3p and Nil1p exert their stimulatory effect at a site different from UASaro: none of our various ARO9
promoter constructs enabled us to distinguish Gln3p and Nil1p target
elements from the induction element UASaro. First, we
introduced the constructs obtained by exonuclease III treatment (Fig.
2) into wild-type and gln3
nil1
strains and
compared their expression in both genetic backgrounds. In the set
of deletion mutants, loss of induction closely paralleled loss of the
amplifying action of the two GATA activators (data not shown). Removal
of the sequence between
255 and
169 resulted in a two- to
threefold decrease in the level of induction in the double
gln3
nil1
mutant from in the wild-type strain. Next, we confirmed that the amplifying effect of Gln3p and
Nil1p requires the integrity of the UASaro element, as
judged from the effect of deleting the element in the
ARO9-lacZ fusion construct (Table 7). Finally, we observed
that UASaro alone suffices to drive a much higher
level of tryptophan-induced transcription on urea medium than on
ammonia and that this amplification is no longer observed in
gln3
nil1
double mutant cells (Table 7). Hence, Gln3p
and Nil1p appear to amplify induction of ARO9 mainly through UASaro. The low constitutive activity measured in
the gln3
nil1
double mutant (Table 6, row 12) is
possibly due to a particular phenomenon connected to its very low
growth in minimum medium.
(iii) Role of inducer exclusion.
The above results suggest
that NH4+ and the GATA factors Gln3p and Nil1p
may affect ARO9 induction indirectly, by inducer exclusion. Inducer uptake as a limiting step in ARO9 induction is
indeed consistent with the observation that ARO9 expression
is severely reduced in gap1 wap1 double mutants which take
up tryptophan at a very reduced rate (Table 4). To test this
hypothesis, we monitored induction of ARO9 in
gap1pgr and npi1 mutants grown on
ammonia medium. These strains are defective in NCI and incorporate
tryptophan faster than do wild-type cells on ammonia medium (see the
introduction). The gap1pgr mutation protects
only the Gap1p permease from inactivation, whereas the npi1
mutation prevents inactivation of other NCI-sensitive permeases as well
(23). On tryptophan-supplemented ammonia medium, gap1pgr mutant cells displayed four-times-higher
ARO9 expression levels than wild-type cells (Table 6, row
14). In npi1 cells grown on the same medium, ARO9
expression was increased more than 10-fold, reaching 80% of the level
found in wild-type cells grown on urea plus tryptophan (Table 6, row
15). ARO9 can thus be expressed to near-maximum levels under
conditions of nitrogen repression in mutants released from NCI.
Simultaneous release from NCR and NCI in a ure2 npi1 double
mutant caused but a slight further increase in expression compared to
the effect of the npi1 mutation alone (Table 6, row 16).
These results strongly indicate that the ammonium effect on
ARO9 expression is produced mainly by inducer exclusion through permease inactivation. The Gap1p permease is neither the only
nor the principal tryptophan permease involved in exclusion, since (i)
the ARO9 induction level was only slightly affected in
gap1
cells compared to that in wild-type cells (Table 6, row 13) and (ii) the npi1 gap1
strain (Table 6, row 17)
attains about 60% of the induction level reached by the
npi1 single mutant. The experiments for Table 6 were also
carried out with phenylalanine or tyrosine as an alternative
inducer, yielding very similar results (data not shown).
 |
DISCUSSION |
The ARO9 gene encodes aromatic aminotransferase II, the
enzyme catalyzing the first reaction of aromatic amino acid catabolism (34, 41, 77). Transcription of the ARO9 gene is
induced by aromatic amino acids and subject to nitrogen regulation. In this work, we have characterized cis- and
trans-acting elements mediating this induction. We have also
shown that nitrogen source regulation of ARO9 expression is
due mainly to inducer exclusion, in contrast to the situation observed
with many genes involved in secondary nitrogen source utilization. We
further show, in this report, that the two main uptake systems for
utilization of aromatic amino acids are Gap1p, the general amino acid
permease, and Wap1p, a newly discovered inducible amino acid permease
with wide substrate specificity. Finally, we present evidence that transcription of the ARO10 gene, which very likely encodes
the second enzyme of the aromatic catabolic pathway, indolepyruvate decarboxylase, is subject to the same new induction mechanism.
Induction-specific regulatory elements.
Induction of
ARO9 by aromatic amino acids requires UASaro, a
36-bp element, and the trans-acting factor Aro80p.
UASaro and Aro80p behave functionally like the
pathway-specific elements ArgRIIp (53), Put3p
(48), Uga3p (1), and Cha4p (31) and their cognate UASs, which control induction of the arginine,
proline, GABA, serine, and threonine catabolic pathways in yeast,
respectively. Like ArgRIIp, Put3p, Uga3p, and Cha4p, Aro80p is a member
of the Zn2Cys6 family of transcriptional
activators. Its deduced sequence displays all the features that
characterize this protein family. Aro80p is required for specific
induction of ARO9 expression, and its function depends
on sequences present in the UASaro element. This
36-bp element, on the other hand, is necessary and sufficient to
mediate transcriptional activation of a reporter gene in response to
aromatic amino acids. UASaro could thus be the DNA
element to which Aro80p binds. Its structural features support this
hypothesis: binding sites for Zn2Cys6 proteins
often comprise two symmetrically placed CGG elements, separated by a
characteristic spacing (64). UASaro
possesses one CGG triplet which could form an imperfect palindrome
with any of several CCG triplets in the element (Fig. 1B). The
CCGCGG core of one such palindrome, for example, is
identical to the core of the Pdr3p binding site (39). Yet
not all zinc cluster proteins bind to sites with inverted CGG repeats.
Hap1p binding sites, for instance, are composed of two direct CGG
repeats, and their spacer displays no symmetry (82). The
most obvious feature of the UASaro sequence is the
pattern of four regularly spaced direct CCG repeats. A similar pattern
was found in the ARO10 (YDR380w) promoter. When
the putative UAS of ARO10 is aligned with
UASaro, the consensus sequence of the motif is
extended to T(T/A)(G/A)CCG followed by four variable
nucleotides (Fig. 1C). ARO10 is also inducible by
tryptophan, and its transcriptional activation is Aro80p dependent. The
ARO9 and ARO10 genes are thus coregulated by
aromatic amino acids.
Our data clearly show that Aro80p is essential to
UAS
aro-mediated induction by tryptophan,
phenylalanine, and tyrosine. Although
aro80 cells are
unable to grow on tryptophan medium, their growth
is slowed down only
on medium containing tyrosine or phenylalanine
as the sole nitrogen
source (Fig.
6). Similarly,
aro9 cells are
unable to grow on
tryptophan but grow normally on phenylalanine
or tyrosine
(
77). Thus,
ARO9,
ARO80, and
UAS
aro are essential
to utilization of tryptophan as a
nitrogen source. The growth
phenotype of
aro80 cells
suggests that other genes involved in
phenylalanine and tyrosine
catabolism and their regulatory elements
remain to be
discovered.
Nitrogen regulation of ARO9 is exerted mainly through
inducer exclusion.
ARO9 is less actively transcribed in
ammonia-grown than in urea-grown cells, indicating that the gene
is subject to nitrogen source regulation. Nitrogen catabolic
genes are commonly regulated by nitrogen repression, i.e., by the
competitive action at upstream 5'-GATA-3' elements of positive and
negative GATA family factors and by the inhibition exerted by Ure2p on
Gln3p (47, 52). Our results strongly suggest that
ARO9 is an exception. Nitrogen regulation of ARO9
transcription would appear to be achieved mainly or even
exclusively by inducer exclusion, via regulation of permease synthesis and activity. This conclusion is based on the fact
that mutations relieving nitrogen repression only slightly affect
ARO9 expression, compared with mutations relieving NCI of
permeases. After growth on ammonia medium containing tryptophan (or
phenylalanine or tyrosine), npi1 cells display a high level
of ARO9 transcription, reaching 80% of the level displayed
by wild-type cells grown on tryptophan-supplemented urea medium. Under
growth conditions promoting nitrogen repression, ARO9
expression can thus reach near-maximum levels provided that permease
inactivation is prevented. The CAR2 gene encoding ornithine
aminotransferase in the arginine catabolic pathway (14) is
likewise subject to an ammonia effect but apparently insensitive to
nitrogen repression. In this case, it was possible to correlate closely
the amount of enzyme synthesized with the cellular pool of arginine,
the inducer (14). The hypothesis that the nitrogen source
regulates ARO9 expression principally by modulating inducer
availability is consistent with other observations presented here,
notably the fact that ARO9 expression is induction dependent
under all examined conditions. The very low level of ARO9
expression in cells grown on inducer-free medium is in line with the
very small cellular pools of aromatic amino acids (13, 19,
41). The negative effect of the gln3 nil1 double
mutation can also be attributed to reduced inducer uptake. We have
shown that Gap1p and Wap1p are the main transporters of aromatic amino acids and that gap1 wap1 cells display severely reduced
levels of ARO9 expression on tryptophan-supplemented urea
medium. It is known that the GAP1 transcription level is
very low in gln3 nil1 cells (71, 73). We show
elsewhere (33) that WAP1 responds in a very
similar manner, a result also published recently by another group
(65). Thus, the marked negative effect of the double
gln3 nil1 mutation is most likely a consequence of poor permease synthesis. The inducer exclusion hypothesis also seems to best
explain why the gln3 nil1 double mutation does not affect induced ARO9 expression under conditions of nitrogen
repression. Analysis of the npi1 mutant has indeed shown
that permease inactivation, and not permease synthesis, limits inducer
availability under these growth conditions.
In a separate paper (
33), we show that induction of
WAP1 and other amino acid permease genes is controlled by
Apf7p, a sensor
of external amino acids and the likely head of a new
signaling
pathway in which Grr1p and Uga35p also intervene. An
interesting
corollary is that external amino acids also influence
ARO9 expression
via the control exerted on
WAP1
and possibly other aromatic amino
acid permease
genes.
 |
ACKNOWLEDGMENTS |
We are grateful to S. Soussi-Boudekou for the gift of
strains prior to publication, to K. Broman for help in writing the
manuscript, and to the members of the laboratory for fruitful discussions.
This work was supported by Medical Scientific Research Fund grant
3.4602.94 (FRSM, Belgium) and by a research grant from the Université Libre de Bruxelles. During this work, I.I. was the recipient of a predoctoral fellowship from the Communauté
Française de Belgique and then from the Fondation
Universitaire David et Alice Van Buuren.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Physiologie Cellulaire et de Génétique des Levures,
Université de Bruxelles
Campus Plaine CP244, Bd du Triomphe,
B-1050 Brussels, Belgium. Phone: 32-2-650-5428. Fax: 32-2-650-5421. E-mail: laurrest{at}ulb.ac.be.
 |
REFERENCES |
| 1.
|
André, B.
1990.
The UGA3 gene regulating the GABA catabolic pathway in Saccharomyces cerevisiae codes for a putative zinc-finger protein acting on RNA amount.
Mol. Gen. Genet.
220:269-276[Medline].
|
| 2.
|
André, B.
1995.
An overview of membrane transport proteins in Saccharomyces cerevisiae.
Yeast
11:1575-1611[Medline].
|
| 3.
|
André, B.,
C. Hein,
M. Grenson, and J. C. Jauniaux.
1993.
Cloning and expression of the UGA4 gene coding for the inducible GABA-specific transport protein of Saccharomyces cerevisiae.
Mol. Gen. Genet.
237:17-25[Medline].
|
| 4.
|
André, B.,
D. Talibi,
S. Soussi Boudekou,
C. Hein,
S. Vissers, and D. Coornaert.
1995.
Two mutually exclusive regulatory systems inhibit UASGATA, a cluster of 5'-GAT(A/T)A-3' upstream from the UGA4 gene of Saccharomyces cerevisiae.
Nucleic Acids Res.
23:558-564[Abstract/Free Full Text].
|
| 5.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1995.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 6.
|
Béchet, J.,
M. Grenson, and J. M. Wiame.
1970.
Mutations affecting the repressibility of arginine biosynthetic enzymes in Saccharomyces cerevisiae.
Eur. J. Biochem.
12:31-39[Medline].
|
| 7.
|
Bennetzen, J. L., and B. D. Hall.
1982.
Codon selection in yeast.
J. Biol. Chem.
257:3026-3031[Abstract/Free Full Text].
|
| 8.
|
Bonneaud, N.,
O. Ozier-Kalogeropoulos,
G. Y. Li,
M. Labouesse,
L. Minvielle-Sebastia, and F. Lacroute.
1991.
A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors.
Yeast
7:609-615[Medline].
|
| 9.
|
Coffman, J. A.,
R. Rai,
T. Cunningham,
V. Svetlov, and T. G. Cooper.
1996.
Gat1p, a GATA family protein whose production is sensitive to nitrogen catabolite repression, participates in transcriptional activation of nitrogen-catabolic genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:847-858[Abstract].
|
| 10.
|
Coffman, J. A.,
R. Rai,
D. M. Loprete,
T. Cunningham,
V. Svetlov, and T. G. Cooper.
1997.
Cross regulation of four GATA factors that control nitrogen catabolic gene expression in Saccharomyces cerevisiae.
J. Bacteriol.
179:3416-3429[Abstract/Free Full Text].
|
| 11.
|
Cooper, T. G.
1981.
Nitrogen metabolism in Saccharomyces cerevisiae, p. 39-99.
In
J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces cerevisiae. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 12.
|
Coornaert, D.,
S. Vissers,
B. André, and M. Grenson.
1992.
The UGA43 negative regulatory gene of Saccharomyces cerevisiae contains both a GATA-1 type zinc finger and a putative leucine zipper.
Curr. Genet.
21:301-307[Medline].
|
| 13.
|
Delforge, J.,
F. Messenguy, and J. M. Wiame.
1975.
The regulation of arginine biosynthesis in Saccharomyces cerevisiae. The specificity of argR mutations and the general control of amino-acid biosynthesis.
Eur. J. Biochem.
57:231-239[Medline].
|
| 14.
|
Deschamps, J.,
E. Dubois, and J. M. Wiame.
1979.
L-Ornithine transaminase synthesis in Saccharomyces cerevisiae: regulation by inducer exclusion.
Mol. Gen. Genet.
174:225-232[Medline].
|
| 15.
|
Dickinson, J. R.,
M. M. Lanterman,
D. J. Danner,
B. M. Pearson,
P. Sanz,
S. J. Harrison, and M. J. Hewlins.
1997.
A 13C nuclear magnetic resonance investigation of the metabolism of leucine to isoamyl alcohol in Saccharomyces cerevisiae.
J. Biol. Chem.
272:26871-26878[Abstract/Free Full Text].
|
| 16.
|
Drillien, R., and F. Lacroute.
1972.
Ureidosuccinic acid uptake in yeast and some aspects of its regulation.
J. Bacteriol.
109:203-208[Abstract/Free Full Text].
|
| 17.
|
Dubois, E.,
M. Grenson, and J. M. Wiame.
1974.
The participation of the anabolic glutamate dehydrogenase in the nitrogen catabolite repression of arginase in Saccharomyces cerevisiae.
Eur. J. Biochem.
48:603-616[Medline].
|
| 18.
|
Dubois, E., and F. Messenguy.
1997.
Integration of the multiple controls regulating the expression of the arginase gene CAR1 of Saccharomyces cerevisiae in response to different nitrogen signals: role of Gln3p, ArgRp-Mcm1p, and Ume6p.
Mol. Gen. Genet.
253:568-580[Medline].
|
| 19.
|
Fantes, P. A.,
L. M. Roberts, and R. Huetter.
1976.
Free tryptophan pool and tryptophan biosynthetic enzymes in Saccharomyces cerevisiae.
Arch. Microbiol.
107:207-214[Medline].
|
| 20.
|
Flick, J. S., and J. Thorner.
1998.
An essential function of a phosphoinositide-specific phospholipase C is relieved by inhibition of a cyclin-dependent protein kinase in the yeast Saccharomyces cerevisiae.
Genetics
148:33-47[Abstract/Free Full Text].
|
| 21.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 22.
|
Grenson, M.
1969.
The utilization of exogenous pyrimidines and the recycling of uridine-5'-phosphate derivatives in Saccharomyces cerevisiae, as studied by means of mutants affected in pyrimidine uptake and metabolism.
Eur. J. Biochem.
11:249-260[Medline].
|
| 23.
|
Grenson, M.
1983.
Inactivation-reactivation process and repression of permease formation regulate several ammonia-sensitive permeases in the yeast Saccharomyces cerevisiae.
Eur. J. Biochem.
133:135-139[Medline].
|
| 24.
|
Grenson, M.
1992.
Amino acid transporters in yeast: structure, function and regulation, p. 219-245.
In
J. J. L. L. M. De Pont (ed.), Molecular aspects of transport proteins. Elsevier Science, Amsterdam, The Netherlands.
|
| 25.
|
Grenson, M.,
E. Dubois,
M. Piotrowska,
R. Drillien, and M. Aigle.
1974.
Ammonia assimilation in Saccharomyces cerevisiae as mediated by the two glutamate dehydrogenases. Evidence for the gdhA locus being a structural gene for the NADP-dependent glutamate dehydrogenase.
Mol. Gen. Genet.
128:73-85[Medline].
|
| 26.
|
Grenson, M.,
C. Hou, and M. Crabeel.
1970.
Multiplicity of the amino acid permeases in Saccharomyces cerevisiae. IV. Evidence for a general amino acid permease.
J. Bacteriol.
103:770-777[Abstract/Free Full Text].
|
| 27.
|
Grenson, M.,
F. Muyldermans,
K. Broman, and S. Vissers.
1987.
4-Aminobutyric acid (GABA) uptake in baker's yeast Saccharomyces cerevisiae is mediated by the general amino acid permease, the proline permease and a GABA-specific permease integrated into the GABA-catabolic pathway.
Life Sci. Adv. Ser. C
6:35-39.
|
| 28.
|
Guarente, L.
1983.
Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast.
Methods Enzymol.
101:181-191[Medline].
|
| 29.
|
Hein, C., and B. André.
1997.
A C-terminal di-leucine motif and nearby sequences are required for NH4+-induced inactivation and degradation of the general amino acid permease, Gap1p, of Saccharomyces cerevisiae.
Mol. Microbiol.
24:607-616[Medline].
|
| 30.
|
Hein, C.,
J. Y. Springael,
C. Volland,
R. Haguenauer-Tsapis, and B. André.
1995.
NPI1, an essential yeast gene involved in induced degradation of Gap1 and Fur4 permeases, encodes the Rsp5 ubiquitin-protein ligase.
Mol. Microbiol.
18:77-87[Medline].
|
| 31.
|
Holmberg, S., and P. Schjerling.
1996.
Cha4p of Saccharomyces cerevisiae activates transcription via serine/threonine response elements.
Genetics
144:467-478[Abstract].
|
| 32.
|
Iraqui, I.,
S. Vissers,
B. André, and A. Urrestarazu.
1998.
Characterization of cis- and trans-acting elements responsible for transcriptional induction of the ARO9 gene encoding aromatic aminotransferase II in Saccharomyces cerevisiae.
Arch. Physiol. Biochem.
106:B8.
|
| 33.
|
Iraqui, I.,
S. Vissers,
F. Bernard,
J.-O. De Craene,
E. Boles,
A. Urrestarazu, and B. André.
1999.
Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease.
Mol. Cell. Biol.
19:989-1001[Abstract/Free Full Text].
|
| 34.
|
Iraqui, I.,
S. Vissers,
M. Cartiaux, and A. Urrestarazu.
1998.
Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily.
Mol. Gen. Genet.
257:238-248[Medline].
|
| 35.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 36.
|
Jacobs, P.,
J. C. Jauniaux, and M. Grenson.
1980.
A cis-dominant regulatory mutation linked to the argB-argC gene cluster in Saccharomyces cerevisiae.
J. Mol. Biol.
139:691-704[Medline].
|
| 37.
|
Jacq, C., et al.
1997.
The nucleotide sequence of Saccharomyces cerevisiae chromosome IV.
Nature
387:75-78[Medline].
|
| 38.
|
Jauniaux, J. C., and M. Grenson.
1990.
GAP1, the general amino acid permease gene of Saccharomyces cerevisiae. Nucleotide sequence, protein similarity with the other baker's yeast amino acid permeases, and nitrogen catabolite repression.
Eur. J. Biochem.
190:39-44[Medline].
|
| 39.
|
Katzmann, D. J.,
P. E. Burnett,
J. Golin,
Y. Mahe, and W. S. Moye-Rowley.
1994.
Transcriptional control of the yeast PDR5 gene by the PDR3 gene product.
Mol. Cell. Biol.
14:4653-4661[Abstract/Free Full Text].
|
| 40.
|
Keegan, L.,
G. Gill, and M. Ptashne.
1986.
Separation of DNA binding from the transcription-activating function of a eukaryotic regulatory protein.
Science
231:699-704[Abstract/Free Full Text].
|
| 41.
|
Kradolfer, P.,
P. Niederberger, and R. Hütter.
1982.
Tryptophan degradation in Saccharomyces cerevisiae: characterization of two aromatic aminotransferases.
Arch. Microbiol.
133:242-248[Medline].
|
| 42.
|
Lingens, F.,
W. Goebel, and H. Uesseler.
1967.
Regulation of the biosynthesis of aromatic amino acids in Saccharomyces cerevisiae. 2. Repression, induction and activation.
Eur. J. Biochem.
1:363-374[Medline].
|
| 43.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 44.
|
Luche, R. M.,
R. Sumrada, and T. G. Cooper.
1990.
A cis-acting element present in multiple genes serves as a repressor protein binding site for the yeast CAR1 gene.
Mol. Cell. Biol.
10:3884-3895[Abstract/Free Full Text].
|
| 45.
|
Lupas, A.,
M. Van Dyke, and J. Stock.
1991.
Predicting coiled coils from protein sequences.
Science
252:1162-1164[Free Full Text].
|
| 46.
|
Ma, J., and M. Ptashne.
1987.
Deletion analysis of GAL4 defines two transcriptional activating segments.
Cell
48:847-853[Medline].
|
| 47.
|
Magasanik, B.
1992.
Regulation of nitrogen utilization, p. 283-317.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces cerevisiae. Gene expression. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 48.
|
Marczak, J. E., and M. C. Brandriss.
1991.
Analysis of constitutive and noninducible mutations of the PUT3 transcriptional activator.
Mol. Cell. Biol.
11:2609-2619[Abstract/Free Full Text].
|
| 49.
|
Marini, A. M.,
S. Vissers,
A. Urrestarazu, and B. André.
1994.
Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae.
EMBO J.
13:3456-3463[Medline].
|
| 50.
|
Marmorstein, R.,
M. Carey,
M. Ptashne, and S. C. Harrison.
1992.
DNA recognition by GAL4: structure of a protein-DNA complex.
Nature
356:408-414[Medline].
|
| 51.
|
Marmorstein, R., and S. C. Harrison.
1994.
Crystal structure of a PPR1-DNA complex: DNA recognition by proteins containing a Zn2Cys6 binuclear cluster.
Genes Dev.
8:2504-2512[Abstract/Free Full Text].
|
| 52.
|
Marzluf, G. A.
1997.
Genetic regulation of nitrogen metabolism in the fungi.
Microbiol. Mol. Biol. Rev.
61:17-32[Abstract].
|
| 53.
|
Messenguy, F., and E. Dubois.
1988.
The yeast ARGRII regulatory protein has homology with various RNases and DNA binding proteins.
Mol. Gen. Genet.
211:102-105[Medline].
|
| 54.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 55.
|
Miller, S. M., and B. Magasanik.
1991.
Role of the complex upstream region of the GDH2 gene in nitrogen regulation of the NAD-linked glutamate dehydrogenase in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:6229-6247[Abstract/Free Full Text].
|
| 56.
|
Oliver, S. G., et al.
1992.
The complete DNA sequence of yeast chromosome III.
Nature
357:38-46[Medline].
|
| 57.
|
Pan, T., and J. E. Coleman.
1990.
GAL4 transcription factor is not a "zinc finger" but forms a Zn(II)2Cys6 binuclear cluster.
Proc. Natl. Acad. Sci. USA
87:2077-2081[Abstract/Free Full Text].
|
| 58.
|
Rai, R.,
J. R. Daugherty, and T. G. Cooper.
1995.
UASNTR functioning in combination with other UAS elements underlies exceptional patterns of nitrogen regulation in Saccharomyces cerevisiae.
Yeast
11:247-260[Medline].
|
| 59.
|
Rai, R.,
F. S. Genbauffe,
R. A. Sumrada, and T. G. Cooper.
1989.
Identification of sequences responsible for transcriptional activation of the allantoate permease gene in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:602-608[Abstract/Free Full Text].
|
| 60.
|
Reece, R. J., and M. Ptashne.
1993.
Determinants of binding-site specificity among yeast C6 zinc cluster proteins.
Science
261:909-911[Abstract/Free Full Text].
|
| 61.
|
Robbins, J.,
S. M. Dilworth,
R. A. Laskey, and C. Dingwall.
1991.
Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence.
Cell
64:615-623[Medline].
|
| 62.
|
Rowen, D. W.,
N. Esiobu, and B. Magasanik.
1997.
Role of GATA factor Nil2p in nitrogen regulation of gene expression in Saccharomyces cerevisiae.
J. Bacteriol.
179:3761-3766[Abstract/Free Full Text].
|
| 63.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 64.
|
Schjerling, P., and S. Holmberg.
1996.
Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators.
Nucleic Acids Res.
24:4599-4607[Abstract/Free Full Text].
|
| 65.
|
Schreve, J. L.,
J. K. Sin, and J. M. Garrett.
1998.
The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine.
J. Bacteriol.
180:2556-2559[Abstract/Free Full Text].
|
| 66.
|
SentheShanmuganathan, S.
1960.
The mechanism of the formation of higher alcohols from amino acids by Saccharomyces cerevisiae.
Biochem. J.
74:568-576[Medline].
|
| 67.
|
Sharp, P. M., and W. H. Li.
1987.
The codon adaptation index a measure of directional synonymous codon usage bias, and its potential applications.
Nucleic Acids Res.
15:1281-1295[Abstract/Free Full Text].
|
| 68.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 69.
|
Shin, M.,
T. Shinguu,
K. Sano, and C. Umezawa.
1991.
Metabolic fates of L-tryptophan in Saccharomyces uvarum (Saccharomyces carlsbergensis).
Chem. Pharm. Bull. (Tokyo)
39:1792-1795[Medline].
|
| 70.
|
Siddiqui, A. H., and M. C. Brandriss.
1989.
The Saccharomyces cerevisiae PUT3 activator protein associates with proline-specific upstream activation sequences.
Mol. Cell. Biol.
9:4706-4712[Abstract/Free Full Text].
|
| 71.
|
Soussi-Boudekou, S.,
S. Vissers,
A. Urrestarazu,
J. C. Jauniaux, and B. André.
1997.
Gzf3p, a fourth GATA factor involved in nitrogen-regulated transcription in Saccharomyces cerevisiae.
Mol. Microbiol.
23:1157-1168[Medline].
|
| 71a.
| Soussi-Boudekou, S., and B. André.
Unpublished data.
|
| 72.
|
Springael, J. Y., and B. André.
1998.
Nitrogen-regulated ubiquitination of the Gap1 permease of Saccharomyces cerevisiae.
Mol. Biol. Cell
9:1253-1263[Abstract/Free Full Text].
|
| 73.
|
Stanbrough, M.,
D. W. Rowen, and B. Magasanik.
1995.
Role of the GATA factors Gln3p and Nil1p of Saccharomyces cerevisiae in the expression of nitrogen-regulated genes.
Proc. Natl. Acad. Sci. USA
92:9450-9454[Abstract/Free Full Text].
|
| 74.
|
Strich, R.,
R. T. Surosky,
C. Steber,
E. Dubois,
F. Messenguy, and R. E. Esposito.
1994.
UME6 is a key regulator of nitrogen repression and meiotic development.
Genes Dev.
8:796-810[Abstract/Free Full Text].
|
| 75.
|
Svetlov, V. V., and T. G. Cooper.
1995.
Review: compilation and characteristics of dedicated transcription factors in Saccharomyces cerevisiae.
Yeast
11:1439-1484[Medline].
|
| 76.
|
Talibi, D.,
M. Grenson, and B. André.
1995.
Cis- and trans-acting elements determining induction of the genes of the gamma-aminobutyrate (GABA) utilization pathway in Saccharomyces cerevisiae.
Nucleic Acids Res.
23:550-557[Abstract/Free Full Text].
|
| 77.
|
Urrestarazu, A.,
S. Vissers,
I. Iraqui, and M. Grenson.
1998.
Phenylalanine- and tyrosine-auxotrophic mutants of Saccharomyces cerevisiae impaired in transamination.
Mol. Gen. Genet.
257:230-237[Medline].
|
| 78.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[Medline].
|
| 79.
|
Webb, A. D., and J. L. Ingraham.
1963.
Fusel oil.
Adv. Appl. Microbiol.
5:317-353.
|
| 80.
|
Wiame, J. M.,
M. Grenson, and H. N. J. Arst.
1985.
Nitrogen catabolite repression in yeasts and filamentous fungi.
Adv. Microbiol. Physiol.
26:1-87[Medline].
|
| 81.
|
Xu, S.,
D. A. Falvey, and M. C. Brandriss.
1995.
Roles of URE2 and GLN3 in the proline utilization pathway in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:2321-2330[Abstract].
|
| 82.
|
Zhang, L., and L. Guarente.
1994.
The yeast activator HAP1 a GAL4 family member binds DNA in a directly repeated orientation.
Genes Dev.
8:2110-2119[Abstract/Free Full Text].
|
Molecular and Cellular Biology, May 1999, p. 3360-3371, Vol. 19, No. 5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Moxley, J. F., Jewett, M. C., Antoniewicz, M. R., Villas-Boas, S. G., Alper, H., Wheeler, R. T., Tong, L., Hinnebusch, A. G., Ideker, T., Nielsen, J., Stephanopoulos, G.
(2009). From the Cover: Complex Systems: From Chemistry to Systems Biology Special Feature: Linking high-resolution metabolic flux phenotypes and transcriptional regulation in yeast modulated by the global regulator Gcn4p. Proc. Natl. Acad. Sci. USA
106: 6477-6482
[Abstract]
[Full Text]
-
Naar, A. M., Thakur, J. K.
(2009). Nuclear receptor-like transcription factors in fungi. Genes Dev.
23: 419-432
[Abstract]
[Full Text]
-
Moriyoshi, K.
(2009). pBT, a novel vector for tetracycline-regulated yeast three-hybrid assay. Nucleic Acids Res
37: e11-e11
[Abstract]
[Full Text]
-
Ghosh, S., Kebaara, B. W., Atkin, A. L., Nickerson, K. W.
(2008). Regulation of Aromatic Alcohol Production in Candida albicans. Appl. Environ. Microbiol.
74: 7211-7218
[Abstract]
[Full Text]
-
Mansour, S., Beckerich, J. M., Bonnarme, P.
(2008). Lactate and Amino Acid Catabolism in the Cheese-Ripening Yeast Yarrowia lipolytica. Appl. Environ. Microbiol.
74: 6505-6512
[Abstract]
[Full Text]
-
Hazelwood, L. A., Daran, J.-M., van Maris, A. J. A., Pronk, J. T., Dickinson, J. R.
(2008). The Ehrlich Pathway for Fusel Alcohol Production: a Century of Research on Saccharomyces cerevisiae Metabolism. Appl. Environ. Microbiol.
74: 2259-2266
[Full Text]
-
Godard, P., Urrestarazu, A., Vissers, S., Kontos, K., Bontempi, G., van Helden, J., Andre, B.
(2007). Effect of 21 Different Nitrogen Sources on Global Gene Expression in the Yeast Saccharomyces cerevisiae. Mol. Cell. Biol.
27: 3065-3086
[Abstract]
[Full Text]
-
MacPherson, S., Larochelle, M., Turcotte, B.
(2006). A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins. Microbiol. Mol. Biol. Rev.
70: 583-604
[Abstract]
[Full Text]
-
Vuralhan, Z., Luttik, M. A. H., Tai, S. L., Boer, V. M., Morais, M. A., Schipper, D., Almering, M. J. H., Kotter, P., Dickinson, J. R., Daran, J.-M., Pronk, J. T.
(2005). Physiological Characterization of the ARO10-Dependent, Broad-Substrate-Specificity 2-Oxo Acid Decarboxylase Activity of Saccharomyces cerevisiae. Appl. Environ. Microbiol.
71: 3276-3284
[Abstract]
[Full Text]
-
Kanazawa, T., Taneike, I., Akaishi, R., Yoshizawa, F., Furuya, N., Fujimura, S., Kadowaki, M.
(2004). Amino Acids and Insulin Control Autophagic Proteolysis through Different Signaling Pathways in Relation to mTOR in Isolated Rat Hepatocytes. J. Biol. Chem.
279: 8452-8459
[Abstract]
[Full Text]
-
Vuralhan, Z., Morais, M. A., Tai, S.-L., Piper, M. D. W., Pronk, J. T.
(2003). Identification and Characterization of Phenylpyruvate Decarboxylase Genes in Saccharomyces cerevisiae. Appl. Environ. Microbiol.
69: 4534-4541
[Abstract]
[Full Text]
-
Dickinson, J. R., Salgado, L. E. J., Hewlins, M. J. E.
(2003). The Catabolism of Amino Acids to Long Chain and Complex Alcohols in Saccharomyces cerevisiae. J. Biol. Chem.
278: 8028-8034
[Abstract]
[Full Text]
-
Akache, B., Turcotte, B.
(2002). New Regulators of Drug Sensitivity in the Family of Yeast Zinc Cluster Proteins. J. Biol. Chem.
277: 21254-21260
[Abstract]
[Full Text]
-
Natarajan, K., Meyer, M. R., Jackson, B. M., Slade, D., Roberts, C., Hinnebusch, A. G., Marton, M. J.
(2001). Transcriptional Profiling Shows that Gcn4p Is a Master Regulator of Gene Expression during Amino Acid Starvation in Yeast. Mol. Cell. Biol.
21: 4347-4368
[Abstract]
[Full Text]
-
Dickinson, J. R., Harrison, S. J., Dickinson, J. A., Hewlins, M. J. E.
(2000). An Investigation of the Metabolism of Isoleucine to Active Amyl Alcohol in Saccharomyces cerevisiae. J. Biol. Chem.
275: 10937-10942
[Abstract]
[Full Text]