Previous Article | Next Article 
Molecular and Cellular Biology, May 1999, p. 3769-3778, Vol. 19, No. 5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
TAFII40 Protein Is Encoded by the
e(y)1 Gene: Biological Consequences of Mutations
Aleksei
Soldatov,1,2,3
Elena
Nabirochkina,1,3
Sofia
Georgieva,1,2,4
Tatiana
Belenkaja,1,2 and
Pavel
Georgiev1,3,*
Department of the Control of Genetic
Processes1 and Centre for Medical
Research of Oslo University,2 Institute of Gene
Biology, and Engelhardt Institute of Molecular
Biology,4 Russian Academy of Sciences,
Russia, and International Centre of Genetic Engineering and
Biotechnology, Trieste, Italy3
Received 1 December 1997/Returned for modification 20 January
1998/Accepted 13 January 1999
 |
ABSTRACT |
The enhancer of yellow 1 gene, e(y)1, of
Drosophila melanogaster has been cloned and demonstrated to
encode the TAFII40 protein. The e(y)1 gene is
expressed in females much more strongly than in males due to the
accumulation of e(y)1 mRNA in the ovaries. Two different
e(y)1 mutations have been obtained. The
e(y)1ul mutation, induced by the insertion of
Stalker into the coding region, leads to the replacement of
25 carboxy-terminal amino acids by 17 amino acids encoded by the
Stalker sequences and to a decrease of the
e(y)1 transcription level. The latter is the main cause of
dramatic underdevelopment of the ovaries and sterility of females
bearing the e(y)1 mutation. This follows from the
restoration of female fertility upon transformation of
e(y)1u1 flies with a construction synthesizing
the mutant protein. The e(y)1P1 mutation
induced by P element insertion into the transcribed nontranslated region of the gene has almost no influence on the phenotype of flies. However, in combination with the
phP1 mutation, which leads to a strong
P element-mediated suppression of e(y)1
transcription, this mutation is lethal. Genetic studies of the
e(y)1u1 mutation revealed a sensitivity of the
yellow and white expression to the
TAFII40/e(y)1 level. The su(Hw)-binding region,
Drosophila insulator, stabilizes the expression of the
white gene and makes it independent of the
e(y)1u1 mutation.
| |
INTRODUCTION |
Initiation of transcription by RNA
polymerase II requires an ordered assembly of a multiprotein
preinitiation complex at the core promoter of eucaryotic genes
(56, 58). TAFs (TATA-binding protein-associated factors),
which are highly conserved in all organisms from yeasts to mammals, are
the components of the TFIID complex of the basal transcription
machinery (11). TAFs are considered to perform important
functions both in transcription and in core promoter recognition
(46, 47). Some TAFs can function as coactivators and mediate
activation signals from enhancer-bound regulatory proteins (7, 8,
14, 15, 28, 33, 59).
While TFIID has been extensively studied in vitro, very little is known
about the function of individual TAFs in vivo. Studies with yeasts
demonstrated that the absence of several TAFs did not influence the
overall level of transcription but led to the death of cells,
associated with specific cell cycle arrest phenotypes (2, 40, 61,
63). It has been determined that transcription of some yeast
genes depends on TAFII145 (62). Results of
studies of higher-eucaryotic TAFs are consistent with these results.
Mutations in genes for two highly conserved TAFs, TAFII60
and TAFII110, reduced transcription of
Bicoid-dependent target genes in Drosophila embryos (52) and led to lethality at the embryonic stage.
TAFII40 of Drosophila melanogaster
(dTAFII40) is a member of the TAF family that has
homologues in other higher eucaryotes (28). Several studies
of the TAFII40 function in vitro were performed. A
protein-protein interaction assay revealed direct binding between
TAFII40 and the activation domains of VP16 (28) and p53 (57). A human homologue of dTAFII40,
hTAFII31, was also identified as a critical protein
required for p53 (38)- and VP16 (35)-dependent
activation of transcription. The TAFII40 protein was
postulated to mediate the activation by proteins with acidic domains.
TAFII40 and TAFII60 were shown to contain
histone folding motifs and to cocrystallize in a histone-like structure (30, 64). Although in vitro results suggest that
TAFII40 plays an important role in transcription, no
studies of TAFII40 function have been performed in vivo.
In our previous works, we identified mutations in the e(y)1,
e(y)2, and e(y)3 genes (19, 20) that
enhanced the phenotype of the y2 mutation. It
was suggested that the protein products of these genes performed
general and related functions in the regulation of transcription. They
are involved in the activation of several genes and cooperate with the
zeste protein in the control of white gene expression
(21). Combinations of weak mutations of these genes are lethal.
In this study, we have cloned the e(y)1 gene and found that
it encodes dTAFII40. Two e(y)1 mutations have
been described. TAFII40 has been demonstrated to be
indispensable. It accumulates in ovaries, and the inhibition of
e(y)1 transcription severely suppresses oogenesis. The
expression of at least a certain group of genes has been shown to be
sensitive to a partial inhibition of e(y)1 transcription.
| |
MATERIALS AND METHODS |
Genetic crosses.
Flies were cultured at 25°C in standard
Drosophila wheat meal-yeast-sugar-agar medium. All crosses
were performed in standard glass vials with 5 to 10 males and 10 to 15 females per vial. The origin of e(y)1u1 and
e(y)1P1 [e(y)4PI]
alleles, mutations and constructions used in this work were described
elsewhere (17, 19-21, 24-26, 37).
Strains with the SUPor-PM25 (also designated RR126) and RR97
constructions were obtained from P. Geyer's lab.
P(white) is the P-element
transformation vector CaSpeR3 (48, 49). This vector carries a mini-white gene containing approximately
300 bp of 5' and 630 bp of 3' flanking DNA, while a major portion of
the first intron is deleted (42).
Small-scale P-element mobilization experiments were carried
out as described elsewhere (48). The number of insertion
sites was determined by Southern blot analysis designed to identify the
flanking restriction fragments. For further analysis, only single
independent transpositions were selected. The CaSpeR3
transposon was mobilized in the same way as SUPor-P M25
(48).
Combinations of mutations located on the X chromosome (X*) and
constructions with the marker
white gene on an autosome were
obtained according to the following scheme:
X*/FM4 ×
P{
white}/
P{
white}(autosome)
or
P{
white}
2/+;
P{
white}
3/+, where
2 and
3 denote the
second
and third
chromosomes.
To combine the
phP1 mutation (1-0.5) with the
e(y)1P1 mutation,
y phP1
females were crossed to
f e(y)1P1 males. In
F
1,
y phP1/f e(y)1P1
females were crossed to
y f Bx2 males. In
F
2,
y phP1 f
e(y)1P1/y f Bx2 females were
selected and mated to
FM4 males. As a result, the
y
phP1 f e(y)1P1/FM4 strain was
obtained.
Compound strains with
su(Hw)2 and
su(Hw)v mutations were obtained as described
elsewhere (
18a).
Eye color analysis was performed under a dissecting microscope with
3-day-old flies developing at 25°C. In each case, from
50 to 100 flies were scored to determine the eye color phenotype.
Eye
pigmentation was evaluated on the basis of pigmentation of
the major
part of its area. Analysis of pigmentation of flies
with different
allelic combinations was done as described previously
(
4,
5).
Preparation of the P{w+,
e(y)1+} and P{w+,
e(y)1} constructions and P-element-mediated
transformation.
P{w+,
e(y)1+} was created by insertion of the
HindIII-XhoI region of e(y)1 into
the CaSpeR3 vector. P{w+,
e(y)1} is P{w+,
e(y)1+} in which 80 nucleotides of e(y)1
corresponding to amino acids 255 to 278 (GGAGGAGGATCATCTGGCGTTGGAGTGGCCGTCAAGCGGGAACGTGAGGAGGAGGAGTTTGAGTTTGTGACCAACTAGCG) were replaced by 91 nucleotides of the Stalker long
terminal repeat (LTR) starting from the 3'-terminal nucleotide of
Stalker and followed by 6 nucleotides of the
EcoRI site
(TG TAATAGATG TAATAGAT T TGC T T TCCGAGC TCAGAACC TC TGCTCTGTTTGAATC TCT T TAT TCGAATGATCAAAG TGTGC TGAAGT TGGAATTC).
The
P{
w+, e(y)1+} or
P{
w+, e(y)1} construct and
p25.7wc (
34) were injected into
y ac
w67c preblastoderm embryos as described previously
(
50,
55). Chromosomal
insertion of
P{
w+, e(y)1+} or
P{
w+, e(y)1} was tested by the
reversion of the white phenotype,
and the number of copies was
determined by Southern blot analysis
using
P-element
sequences as a
probe.
Construction of libraries.
The cDNA library was constructed
in the Uni-ZAP XR vector (Stratagene). The genomic library was
constructed by cloning of DNA partially digested with endonuclease
Sau3A in the 
GEM11 vector. DNA and mRNA for the libraries
were prepared from Oregon R adult flies.
RNA isolation and Northern blot analysis.
Total cellular RNA
was isolated from Drosophila embryos, larvae, pupae, or
adult flies as described elsewhere (39).
Poly(A)+ RNA was selected on oligo(dT)-cellulose columns,
and 1.5 µg of poly(A)+ RNA was loaded per lane of agarose
gel. After electrophoresis, the RNA was transferred to Hybond-N
membranes (Amersham). Hybridization was performed at 50°C in
high-SDS-formamide buffer (7% sodium dodecyl sulfate [SDS], 50%
formamide, 5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate], 2% blocking reagent [Boehringer Mannheim], 50 mM sodium
phosphate [pH 7.0], 0.1% sarcosyl) overnight. 32P-labeled DNA probes were obtained in a random priming
reaction. The membranes were washed two times in 0.1% SDS-1× SSC at
room temperature for 10 min and for 20 min in 0.1% SDS-0.2× SSC at 65°C and then exposed to Kodak BioMax MS film with a Kodak BioMax MS
intensifying screen for 2 to 4 h. Precise quantitation of the RNA
in bands was done with a PhosphoImager (for Fig. 2) or with a
photodensitometer (for Fig. 3).
3'-RACE of e(y)1u1 mRNA.
For 3'-RACE
(rapid amplification of 3' cDNA ends), the first cDNA strand was
synthesized by using 0.5 µg of mRNA from
e(y)1u1 males with the
(GA)10ACTAGTCTCGAG(T)18 primer and Superscript II reverse transcriptase (GibcoBRL). The product was purified in an
agarose gel, and a two-step PCR was performed. For the first step, the
following primers were used: GAGAGAGAGAACTAGTCTCGA and ATCCTGAAGGAGCTGAATG [sequences from the first exon of
the e(y)1 gene (Fig. 2)]. Then, a nested PCR with the same
first primer and with the nested second primer CGTGGTCAACCAACTGCT
was performed (Fig. 2).
Protein expression and Western blot analysis.
The pQE-30
expression vector (Qiagen) and Escherichia coli XL1-Blue
were used for His-tagged production of e(y)1 and e(y)1u1
proteins. Affinity-purified rabbit polyclonal antibodies against the
His-tagged e(y)1 protein were used in immunoprecipitation, Western blot
analysis, and immunodetection experiments. These antibodies were tested
to give signals of the same rate on Western blots with the wild-type
and mutant proteins.
Protein extracts were obtained from nuclei isolated from adult flies as
described elsewhere (
6) and lysed in a buffer containing
50 mM Tris HCl (pH 8.8), 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40,
0.5%
sodium deoxycholate, aprotinin (0.02 mg/ml), and leupeptin
(0.1 mg/ml).
Immunoprecipitation was performed as described elsewhere
(
51); the protein samples were subjected to electrophoresis
in SDS-10% polyacrylamide gels (SDS-PAGE) and electroblotted to
nitrocellulose membranes (Amersham). Western blotting was performed
with an enhanced chemiluminescence system (Amersham) according
to the
manufacturer's
recommendations.
In situ hybridization to polytene chromosomes.
Drosophila polytene chromosome spreads were prepared from
salivary glands of the third-instar larvae grown at 17°C. Preparation of spreads, fixation, denaturation, and hybridization were done as
described in reference 16. Labeling was performed
with [
-3H]dATP and [-3H]dUTP in a
random priming reaction.
Immunostaining of polytene chromosomes.
Fixation and
squashing of salivary glands and antibody staining were performed as
originally described by Platero et al. (45). Antibodies to
TAFII40 were used at 1:10 dilution. Cy3-conjugated anti-rabbit antibodies (1:300; Sigma) were used as secondary antibodies.
In situ hybridization of tissue sections.
The flies were
fixed in Carnoy's solution for 1 h at room temperature. Paraffin
embedding of the material and preparation of 7-µm sections were
performed according to standard procedures (3). Digoxigenin
(DIG) labeling of sense and antisense RNA and hybridization were
performed according to the protocols for detection of mRNA with
DIG-labeled RNA probes (Boehringer Mannheim).
Immunostaining of tissue sections.
Paraffin embedding,
fixation, and sectioning were performed as described for in situ
hybridization. Incubation with primary antibodies was performed as
described for immunostaining of polytene chromosomes. Secondary
horseradish peroxidase-conjugated anti-rabbit antibodies (1:1,000;
Amersham) and diaminobenzidine (DAB) staining were used for
visualization. The sections were counterstained with fast green.
| |
RESULTS |
The e(y)1 gene encodes the TAFII40
protein.
The e(y)1u1 mutation was induced
by the insertion of the Stalker mobile element
(19). Stalker is present in more than 50 copies in most D. melanogaster strains (20). Therefore,
we have developed a special strategy based on preparing two sets of
strains with the same genetic background differing in the location of a
single Stalker copy responsible for the
e(y)1u1 mutation (54). A clone
containing Stalker and a flanking sequence of genomic DNA
was obtained. The latter was used as a probe for screening the
wild-type Oregon R library.
The 1.2-kb mRNA transcript changed in the
e(y)1u1 strain (Fig.
1) was detected by Northern blot
hybridization. A cDNA clone
was obtained and sequenced. The result of a
BLAST (
1) search
indicated that this sequence was identical
to that of the gene
encoding the TAF
II40 protein
(
28).
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Transcription of the e(y)1u1 and
e(y)1+ genes. (A) Northern blot hybridization of
the fragment of e(y)1/TAFII40 cDNA (Fig. 2A)
with mRNA from Oregon R males (lane 1), Oregon R embryos (lane 2),
e(y)1u1/Y males (lane 3),
e(y)1u1/e(y)1u1 females (lane 4),
e(y)1u1/e(y)1+ females (lane 5),
embryos from the e(y)1u1/e(y)1+ × e(y)1u1/Y cross (lane 6),
C(1)RM,1yf females (lane
7), and embryos from the C(1)RM,yf × e(y)1u1/Y cross (lane 8). (B) The same blot
hybridized with the Ras2 probe. (C) Relative level of
e(y)1/TAFII40 transcription. The Northern blot
was analyzed on a PhosphoImager; signals were normalized according to
the results of Ras2 hybridization. The level of transcription in
e(y)1u1/Y males was taken as 1.
|
|
To prove that the cloned gene was
e(y)1, the genomic region
of TAF
II40 localization (Fig.
2A) was inserted into the
CaSpeR3 vector and microinjected into embryos of the
C(1)RM,yf/y2w e(y)1u1/Y strain. A
complete reconstitution of the wild-type phenotype
took place in five
independent transgenic
y2w e(y)1u1
P{
w+, e(y)1+} lines of flies
(Table
1), confirming that the cloned
gene was
indeed
e(y)1. Thus, the
e(y)1 gene
encodes the TAF
II40 protein.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Structure of the e(y)1/TAFII40
gene. (A) Map of the e(y)1u1 mutation. Black
boxes, the coding regions of e(y)1; open boxes, transcribed,
nontranslated regions. The arrow indicates the direction of
transcription. H, HindIII; X, XhoI; G,
BglII. The region shown was used for wild-type phenotype
rescue. The upper line indicates the region from the cDNA clone, which
was used as a probe in Northern blot hybridization. The position of
primers for RACE is indicated by a triangle. (B) Amino acid sequence of
the carboxy terminus of wild-type (upper line) and mutant (lower line)
TAFII40 protein.
|
|
Expression of the e(y)1/TAFII40 gene during
development.
Northern blot hybridization was performed with mRNA
isolated from the Oregon R strain at different developmental stages
(Fig. 3). The transcription of the
e(y)1 gene appeared to be stage dependent. An increased
level of transcription was detected at the pupal and embryonic stages,
but the highest level of e(y)1/TAFII40
mRNA
about five times higher than in adult maleswas detected in
adult females.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Transcription of the
e(y)1/TAFII40 gene at different stages of
development of D. melanogaster. (A) Northern blot
hybridization of a fragment of e(y)1/TAFII40
cDNA (Fig. 2A) with mRNA from the Oregon R strain. Samples are from
adult females (lane 1) and males (lane 2); late (lane 3), middle (lane
4), and early (lane 5) pupae; late third (lane 6)-, early third (lane
7)-, second (lane 8)-, and first (lane 9)-instar larvae; and embryos
(lane 10). (B) The same blot, hybridized with the Ras2 probe. (C)
Relative level of e(y)1/TAFII40 transcription.
Signals were normalized according to the results of Ras2 hybridization.
The level of e(y)1 transcription in males was taken as 1.
|
|
In situ hybridization on tissue sections of adult females demonstrated
that the
e(y)1/TAFII40 gene was highly expressed
in
trophocytes, follicular cells of gonads, and oocytes (Fig.
4A
and B). The level of expression in all
other tissues was much
lower and did not significantly differ between
tissues. Immunostaining
with antibodies to the TAF
II40
protein also showed a high content
of the protein in oocytes (Fig.
4C
and D). Thus, the high level
of
e(y)1/TAFII40
expression in ovaries explains the fivefold difference
in the mRNA
content between females and males.
View larger version (92K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of e(y)1 in different tissues of
Oregon R flies. (A and B) In situ hybridization of a frontal tissue
section of female abdomen with the DIG-labeled e(y)1
antisense (A) and sense (B) RNA probes. (C and D) Immunostaining of a
frontal tissue section of female abdomen with antibodies to e(y)1
protein. Horseradish peroxidase and DAB were used for visualization;
the tissue was counterstained with fast green. One can see a high level
of e(y)1 transcription and expression in ovaries: 1, in
trophocytes; 2, in primary oocytes; 3, in mature oocytes. Note that
while the level of e(y)1 mRNA content is high in trophocytes
and mature oocytes and low in primary oocytes, the TAFII40
protein is predominantly detected in oocytes rather than in trophocytes
(C). Magnification, ×130.
|
|
Molecular nature of the e(y)1u1 mutation:
structural change of TAFII40.
Sequencing of the
genomic copy of the e(y)1 gene showed that the latter
consisted of two exons. The Stalker element in the e(y)1u1 mutation is inserted at the second exon
in the direction opposite that of gene transcription (Fig. 2A). The
insertion was located at a position corresponding to the 25th amino
acid from the carboxy terminus of the protein (Fig. 2B). Therefore, the
mutant e(y)1 protein can be assumed to represent a chimeric protein
containing a foreign amino acid sequence at its carboxy terminus.
To check this,
e(y)1u1 mRNA was studied. On
Northern blots, it had an apparent size of ca. 1.4 kb, thus being about
0.2 kb longer
than the wild-type mRNA (Fig.
1). The 3' end of
e(y)1u1 mRNA was cloned by reverse
transcription-PCR with mRNA obtained
from the mutant strain. Its
sequence showed that
e(y)1 mRNA terminated
at different
closely spaced sites within the 3' LTR of
Stalker.
The
chimeric protein was expected to be 270 amino acids in length,
considering the location of the terminating codon within the
Stalker sequence in all mRNAs (Fig.
2B). Thus, in the
e(y)1u1 strain, 25 carboxy-terminal amino acids
of TAF
II40 are replaced
by 17 amino acids encoded by
Stalker sequence, and the change
in the molecular mass of
the protein should be 0.65
kDa.
On the other hand, the difference in molecular masses of normal and
mutated proteins detected by Western blot analysis was
5 kDa (Fig.
5). This discrepancy can be explained by
the anomalous
mobility of TAF
II40 in SDS-PAGE, because the
wild-type and mutated
proteins synthesized in the bacterial system had
a similar difference
in molecular mass (data not shown). Six glutamic
amino acids were
deleted in the e(y)1
u1 protein, which may
have greatly affected the mobility of the
protein.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Western blot analysis of e(y)1 expression.
Shown are results of immunoprecipitation of e(y)1 and
e(y)1u1 proteins from nuclear extracts from adult flies of
the Oregon R (lane 1), e(y)1u1 (lanes 2 to 4),
and e(y)1+ strains (lanes 5 to 7) and the
recombinant His-tagged protein (lane 8). The positions of e(y)1 and
e(y)1u1 proteins are shown on the left.
|
|
Loss of the carboxy terminus does not affect the ability of
TAF
II40 to bind to chromatin. TAF
II40 was
detected in numerous
sites on polytene chromosomes of the Oregon R
strain (Fig.
6).
The distribution of
TAF
II40 on chromosomes of the
e(y)1u1 mutant was the same as on the wild-type
chromosomes, although
the content was decreased. However, the latter
finding can be
explained by a lower level of polytenization.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
Immunostaining of polytene chromosomes from wild-type
Oregon R (A) and e(y)1u1 (B) larvae with
antibodies against e(y)1 and Cy3-conjugated secondary antibodies.
Original magnification, ×1,000.
|
|
Inhibition of e(y)1 transcription in the
e(y)1u1 flies.
The insertion of
Stalker also interferes with e(y)1 transcription,
possibly as a consequence of the activation of Stalker transcription from the 3' LTR in the direction opposite that of the
gene. A decrease of the e(y)1 mRNA content in mutated flies was detected at all stages of development (Fig. 1 and
7). In adult flies, the content of
e(y)1+ mRNA was four times higher than that of
e(y)1u1 mRNA in heterozygous
e(y)1u1/e(y)1+ females (Fig. 1, lane
5) and 2.5 times higher in e(y)1+ males than in
e(y)1u1 males (Fig. 1, lanes 1 and 3).
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of the e(y)1u1 mutation on
e(y)1 transcription. (A) Northern blot hybridization of the
fragment of e(y)1/TAFII40 cDNA (Fig. 2A) with
mRNA isolated at different stages of development of the progeny of the
C(1)RM, yf × e(y)1u1/Y cross: males (lane 1); late (lane 2),
middle (lane 3), and early (lane 4) pupae; third (lane 5)- and first
(lane 6)-instar larvae; embryos (lane 7); and adult females (lane 8).
Lane 9, mRNA from females of the Oregon R strain. (B) The same blot,
hybridized with the Ras2 probe.
|
|
The lowest ratio of
e(y)1u1 mRNA to
e(y)+ mRNA, equal to 1:9 to the progeny of the
cross of
C(1)RM,yf females to
e(y)1u1/Y males, was found in embryos (Fig.
1,
lane 8). This finding
is not surprising, as the eggs were laid by
females bearing only
the wild-type copy of the gene and according to in
situ hybridization,
they should contain a large amount of maternal mRNA
(see above).
The presence of a weak 1.4-kb band (Fig.
1, lane 8) should
represent
e(y)1u1 mRNA synthesized in embryos. A
more interesting finding was that
the ratio of
e(y)1u1 mRNA to
e(y)+
mRNA was almost equally low in embryos from the cross of
e(y)1u1/e(y)1+ females to
e(y)1u1/Y males (Fig.
1, lane 6), revealing
either the absence or an
extremely low content of
e(y)1u1 mRNA in the maternal mRNA of embryos.
This means that homozygous
e(y)1u1/e(y)u1 females may have
difficulty supplying their oocytes with
e(y)1u1
mRNA. On the other hand, immunohistochemistry detected the presence
of
the TAF
II40 protein in the residual ovaries of
e(y)1u1/e(y)1u1 homozygous females
(Fig.
8).
View larger version (82K):
[in this window]
[in a new window]
|
FIG. 8.
Ovaries from wild-type (A) and
e(y)1u1 (B) flies. Immunostaining of frontal
tissue section of female abdomen with antibodies to the e(y)1 protein.
Horseradish peroxidase and Sigma fast DAB with a metal enhancer were
used for visualization. Magnification, ×70.
|
|
The main biological effects of the e(y)1u1
mutation depend on partial inhibition of e(y)1
transcription.
The e(y)1u1 mutation did not
affect the viability of flies, and no visible morphological changes
were detectable in adult mutant flies. However, females homozygous for
the e(y)1u1 mutation were sterile. The ovaries
of mutant flies were found to be dramatically underdeveloped. They were
very small and did not contain mature oocytes (Fig. 8 and
9). Microinjection of a construction with
the e(y)1+ gene restored normal fertility and
ovary morphology in homozygous e(y)1u1 females,
confirming the dependence of ovary development on the e(y)1 phenotype.
View larger version (140K):
[in this window]
[in a new window]
|
FIG. 9.
Ovaries from wild-type (A) and
e(y)1u1 (B and C) flies (total preparation).
Magnification, ×40.
|
|
There may be two possible explanations for female sterility. One is
that the normal level of
e(y)1 expression is important
for
oocyte development; the second is that the unchanged carboxy
terminus
of TAF
II40 is essential for the expression of some genes
involved in the maturation of oocytes. To test these two possibilities,
we made an attempt to rescue the wild-type phenotype by microinjection
of the
P{
w+, e(y)1}
construction, which expressed exactly the same mutant
TAF
II40 protein with
Stalker amino acids at the
end as
e(y)1u1 flies (Fig.
2). Five
w+ revertants bearing the construction in
different sites of autosomes
were obtained. In all cases, the fertility
of
e(y)1u1 females was restored. Thus, it is the
reduced transcription of
the
e(y)1 gene that leads to the
sterility of
e(y)1u1 females.
TAFII40 is indispensable.
We have also obtained
another mutation of the e(y)1 gene induced by insertion of
the P element. This allele was isolated in P-M
hybrid expression dysgenesis as the e(y)4P1
mutation and had a milder phenotype in comparison to
e(y)1u1: males had shortened and thin bristles,
while females were morphologically normal and fertile. The mutation was
genetically localized in approximately the same region of the X
chromosome as e(y)1u1 (19). Southern
blot analysis showed that insertion of the P element
occurred in the e(y)1 gene. The exact site of the insertion was cloned by PCR using the P-element and e(y)1
sequences as primers (Fig. 2). As it is located in the e(y)1
gene, the designation e(y)1P1 will be used hereafter.
The
e(y)1P1 mutation is induced by insertion of
the
P element into the transcribed noncoding 5' region of
the gene (Fig.
2).
Thus, the coding region of the gene is not damaged,
and we also
did not detect any changes in the level of
e(y)1
transcription
by Northern blot hybridization (data not
shown).
Recently we have developed a method to dramatically increase the effect
of the
P element on transcription of a target gene
by
introducing the
phP1 mutation (
5).
The latter was induced by
P-element insertion
in the
polyhomeotic (
ph) gene, resulting in expression
of the
chimeric P-Ph protein consisting of the DNA-binding domain of
P-element transposase and an almost complete Ph protein
sequence.
The P-Ph protein binds the
P-element sequences and
recruits to
this site other members of the Pc-repressive complex. This
leads
to blocking of transcription from promoters located in close
vicinity
to the
P-element insertion (
5).
The combination of the
e(y)1P1 mutation with
phP1 led to the lethal phenotype. The wild-type
phenotype could be restored by transformation
of
e(y)1P1 phP1 flies with the
P{
w+, e(y)1+} construction. To
detect the stage of death, we crossed
e(y)1P1
phP1/FM4 females to
e(y)1P1
males. We found that embryos died at the middle and late embryonic
stages (from stages 9 to 14). Thus, the TAF
II40 protein is
indispensable.
The e(y)1u1 mutation inhibits
yellow expression in bristles but not in the body and
wings.
The e(y)1u1 allele does not change
the viability and phenotype of flies, suggesting that the transcription
of most genes is not sensitive to a moderate decrease in the
concentration of truncated TAFII40. However, the
e(y)1u1 mutation was shown to inhibit the
expression of several genes in the case of their partial inactivation
as a result of insertion of foreign sequences, partial deletion of
enhancer, or a mutation in trans-regulatory gene (17,
19, 21). These events probably make transcription more sensitive
to the influence of e(y)1u1.
The
yellow and
white genes were further used to
study some features of TAF
II40 activity. The
yellow gene contains different
enhancers responsible for
yellow expression in the wings, body,
and bristles
(
22). The question was whether
yellow expression
driven by different enhancers was equally sensitive to
e(y)1u1. The previously used
y2 mutation was not suitable to clarify this
question as the body
and wing enhancers were blocked by an insulator,
gypsy su(Hw)-binding
region (
27). Therefore, we
checked the effect of the
e(y)1u1 mutation on
some other
yellow alleles (Fig.
10).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 10.
Genetic analysis of interaction of y alleles
with e(y)1u1 mutation. The schemes for
y alleles are not to scale. yellow transcripts
are shown by arrows; transcriptional enhancers are indicated by shaded
ovals. The enhancers that control yellow expression in the
wings and body cuticle are located in the 5'-upstream region of the
yellow gene, whereas enhancers controlling yellow
expression in the bristles reside in the intron of the gene
(22). The su(Hw)-binding region is indicated by empty boxes;
insertions found in the various alleles are represented by triangles.
The total number of circles in the phenotype column indicates the
levels of pigmentation of the body and wings (column 1), thoracic
bristles (column 2), leg bristles (column 3), and abdominal bristles
(column 4). The number of black circles shows the inhibitory effect of
the e(y)1u1 mutation on yellow
expression for different y alleles. Each circle represents
one point on the scale described in the footnote to Table 1.
|
|
The
e(y)1u1 mutation interfered with
yellow expression in revertants of
y2
flies associated with rearrangements of
gypsy but failed to
affect
the pigmentation of revertants which lacked the whole
gypsy insertion
except one LTR (
y+IMC,
y+3MC). The
e(y)1u1 mutation
had the strongest effect in combination with the
y+2MC revertant, which was induced by the
insertion of
jockey and a
deletion of the su(Hw)-binding
region of
gypsy (
17,
25).
y+2MCe(y)1u1 flies had the same
color of the bristles as flies lacking the
bristle enhancer, while the
body and wings remained normally pigmented
(Fig.
10). Similar results
were obtained in experiments with two
partial
y2
revertants (
24) which had the su(Hw)-binding region
disrupted
by the insertion of either
jockey
(
y2PR1) or
hobo
(
y2PR2). Flies from both strains have an
intermediate coloration of
the body and wings which was very sensitive
to any modification
of the transcription level. Again the
e(y)1u1 mutation reduced the pigmentation of
bristles in the same way
as in the original
y2
allele, but it did not change the level of body and wing pigmentation
(Fig.
10).
We also tested the
y76d28 mutation caused by the
insertion of the
P element into the 5'-transcribed,
untranslated portion of the
yellow gene (
26). The
color of all adult cuticular structures
is tan in
y76d28 flies, indicating that
yellow
gene expression decreases in all
cell types to a level intermediate
between that of wild-type flies
and that of flies carrying a deficiency
for the
yellow gene. As
in the previous cases, the
e(y)1u1 mutation reduced the pigmentation of
bristles but not of the
body and wings in
y76d28 flies.
Role of carboxy termini in TAFII40 protein
function.
As shown above, the P{w+,
e(y)1} construction expressing the truncated version of
TAFII40 protein restores the fertility of e(y)1u1 females. However, fertility is a
qualitative factor that does not allow for quantitative assessment of
the role of the carboxy terminus in the TAFII40 function.
Thus, it would be interesting to compare the effects of
P{w+, e(y)1} and
P{w+,
e(y)1+} constructions on the bristle
pigmentation of y2 w e(y)1u1 flies.
Five strains with a single P{w+,
e(y)1} construction and five strains with a single
P{w+, e(y)1+}
construction located on the second or third chromosome possessing orange or dark orange eyes were selected. The levels of
e(y)1 expression in the constructions were comparable, as
shown by Northern blot analysis of y2 w;
P{w+, e(y)1}, and y2 w
e(y)1u1;P{w+,
e(y)1+} males (not shown).
All five tested
P{
w+, e(y)1}
constructions in heterozygote (a single copy of the construction per
genome) only partially restored
the bristle pigmentation of
y2 w e(y)1u1 flies. On the other
hand, a single copy of any of five
P{
w+,
e(y)1+} constructions completely suppressed the
mutant phenotype of
the
e(y)1u1 allele (Table
1). Combination of two different
P{
w+,
e(y)1} constructions in heterozygote or in homozygote [two
copies of the same
P{
w+,
e(y)1} construction] led to a stronger suppression of mutant
bristle phenotype. This result suggests that more truncated protein
is
required for restoring the
yellow expression in
bristles.
Similar results were obtained in experiments with the
e(y)1u1 e(y)3u1 combination of
mutations. By itself, the
e(y)3u1 mutation only
mildly decreased the viability of flies. However,
the combination of
the
e(y)1u1 mutation with
e(y)3u1 is lethal at the late larval and early
pupal stages of development
(
21). The viability and bristle
pigmentation of flies carrying
the
e(y)1u1
e(y)3u1 combination were completely restored in three
independent strains
with the
P{
w+,
e(y)1+} construction. The
P{
w+, e(y)1} constructions
only partially rescued the viability of
e(y)1u1
e(y)3u1 flies (Table
1).
Similarly, the surviving
y2 e(y)1u1
e(y)3u1;
P{
w+,
e(y)1}/+ flies still had a strong mutant bristle phenotype.
Combination of two
different
P{
w+,
e(y)1} constructions in heterozygote led to more prominent
suppression of mutant
phenotype.
Effect of the e(y)1u1 mutation on
white expression.
It was found previously that the
e(y)1u1 mutation suppressed the
enhancer-dependent transcription of the white gene in the
absence of the zeste protein (21). The white gene
has an enhancer element located in the 5'-upstream region (36, 44,
60). In the absence of the upstream enhancer, the eyes are
yellow. The combination of zv77h and
e(y)1u1 mutations, each of which does not
significantly affect white expression, strongly and
synergistically decreases the eye pigmentation almost to the level
typical of enhancerless flies (21).
To further study the role of the
e(y)1u1
mutation in activation of the
white promoter by enhancers,
we used the
y
acw1118
strain with a mini-
white CaSpeR3 construction which
contained
a mini-
white gene without an eye enhancer
(
42). In general,
yacw1118 CaSpeR3
flies have yellow eyes, the residual color being maintained
by the
promoter-dependent transcription. The mini-
white
construction
was mobilized by crosses with the
2-3(99B) strain, and
17 strains
with a single insertion of the mini-
white
construction on the
second or third chromosome that possessed eye color
from dark
orange to red were selected (Table
2). The activation of
white expression in enhancerless constructions may be explained by the
presence of a foreign enhancer element in the neighborhood of
the
white gene and by a local structure of chromatin. In 12 of
17 strains, the
e(y)1u1 mutation strongly or
moderately reduced the level of eye pigmentation
(Tabel 2). This result
suggests that
white expression is sensitive
to the
e(y)1u1 mutation.
Insulation by the su(Hw)-binding region makes white
transcription insensitive to the e(y)1u1
mutation.
The SUPor-P construction contains the
mini-white gene and its eye enhancer framed by two
su(Hw)-binding regions. The latter makes white transcription
independent of the genomic position (48, 49). We obtained
eight different strains carrying the SUPor-P construction in
different sites of the second chromosome. All of them had the wild-type
red-colored eyes (Table 2).
The combination of
SUPor-P constructions with
e(y)1u1 and
zv77h
mutations did not influence eye color. On the other hand, an additional
introduction of
su(Hw)2/su(Hw)v
mutations inactivating the
su(Hw) gene (
29,
41)
led to the
inhibition of
white expression in the presence of
e(y)1u1 and
zv77h
mutations (Table
2). In three cases,
su(Hw)2/su(Hw)v mutations alone
induced a slight inhibition of
white expression,
but it was
much
weaker.
To test the possibility that the su(Hw) protein itself can activate
white expression in the presence of
e(y)1u1 and
zv77h, we
used the RR97 construction, obtained from P. Geyer, where
the
su(Hw)-binding region was inserted between the eye enhancer
and the
white promoter (
49). Flies from three independent
strains
with a single insertion of RR97 had brown eyes. The
introduction
of
e(y)1u1 and
zv77h mutations enhanced the mutant
white phenotype (Table
2), indicating
that the su(Hw)
protein could not directly activate
white expression
in the
e(y)1u1 zv77h combination of
alleles.
| |
DISCUSSION |
The e(y)1 gene encodes a TAFII40
protein.
The main result obtained is that one of abundant TAFs,
i.e., dTAFII40, is encoded by the previously described
e(y)1 gene. On the basis of some genetic data, the latter
was suggested to be involved in the control of long-distance
interactions, in particular between yellow and
white enhancers and promoters (19, 21).
TAF
II40 is incorporated into the TFIID multiprotein complex
(
47,
59). It has been proposed that various classes of
gene-specific
activators interact with one or more TAFs in order to
provide
transcription of their target genes. In vitro protein-protein
interaction assay revealed a direct binding of dTAF
II40 or
its
human homologue hTAF
II31 with an activation domain of
several
transcription factors (
28,
35,
38,
57). It has been
postulated
that the TAF
II40 protein mediates the activation
by proteins with
acidic domains. Thus, TAF
II40 possesses
the features that can
be expected for the protein product of the
e(y)1 gene.
We have found that the wild-type TAF
II40 protein seems to
be involved in the organization of transcription from a large group
of
promoters, as it is present in practically every band of a
polytene
chromosome. In addition, TAF
II40 expression was detected
in
all organs of adult flies. An elevated level of expression
was detected
at the embryonic and pupal stages of development,
when the growth of
new tissues is
prominent.
A particularly high level of
TAFII40/e(y)1
expression was found in female gonads, which leads to an approximately
fivefold
difference in the
e(y)1 mRNA content between
females and males.
As a result, large amounts of mRNA and the protein
accumulate
in oocytes. This finding indicates that the
TAFII40/e(y)1 gene
may be a maternal gene and
suggests an important role of the TAF
II40
protein in gene
activation during early
embryogenesis.
In vivo consequences of e(y)1 mutations.
Here we
have described for the first time mutations of the gene encoding the
TAFII40 protein in higher eucaryotes. One of them, the
e(y)1P1 mutation, is induced by
P-element insertion and has almost no influence on
e(y)1 expression. However, its effect can be significantly enhanced in combination with the phP1 mutation,
known to repress transcription of genes with a P-element insertion in the neighborhood of the promoter element (5). The phP1 e(y)1P1 combination is
lethal at the middle embryonic stage of development, indicating that
TAFII40 is an indispensable protein.
Survival of embryos throughout stages 9 to 14 can be explained by a
high concentration of TAF
II40 in oocytes. Similar results
were obtained for TAF
II60 and TAF
II110
(
52). A large maternal
contribution of wild-type
TAF
II60 and TAF
II110 supported the first
15 to
16 stages of embryogenesis against the null-mutant
background.
Another mutation,
e(y)1u1, is induced by the
Stalker mobile element insertion into the coding sequence of
the
e(y)1 gene. This
insertion leads to two effects: (i)
truncation of TAF
II40 with
replacement of 25 carboxy-terminal amino acids by 17 foreign amino
acids and (ii) a
decrease of the level of
e(y)1 transcription.
The mutation
results in a dramatic underdevelopment of ovaries
leading to female
sterility and in a mild repression of transcription
of several
genes.
We found that female fertility could be restored by the synthesis of
truncated TAF
II40 protein and demonstrated that this
major
effect of
e(y)1u1 mutation depended on reduced
e(y)1 transcription rather than
on TAF
II40
structural changes. A specific effect on the development
of ovaries may
be explained either by a stronger inhibition of
e(y)1
transcription by
Stalker in ovaries or by a selective
sensitivity
of the expression of some genes critical for ovary
development.
TATA-less promoters are sensitive to weak mutation in the
TAFII40/e(y)1 gene.
It was found recently
that the dTAFII60-dTAFII40 heterotetramer bound
to the downstream promoter element (DPE), a distinct 7-nucleotide core
promoter element located about 30 nucleotides downstream of the
transcription start site of many TATA-box-deficient (TATA-less)
promoters in Drosophila (9, 10). It was
suggested that the dTAFII60-dTAFII40
heterotetramer plays a direct role in basal transcription of
TATA-less DPE-containing genes.
Expression of the
white gene was found to be sensitive to
the combination of
zv77h and
e(y)1u1 mutations (
21). Here we have
demonstrated that
white expression
is frequently and
strongly influenced by the
e(y)1u1 mutation
alone in enhancerless constructions putatively activated
by different
foreign enhancers. On the other hand, it is known
that the
white gene contains a TATA-less promoter with a DPE core
sequence. This agrees with a strong dependence of
white
expression
on the TAF
II40 protein
content.
Our data also demonstrate that the
e(y)1u1
mutation moderately reduced
yellow expression in the
bristles but not in the body
cuticle and wing blades. The
yellow gene has a typical TATA box.
However, we recently
found that deletion of the TATA promoter
affected only body and wing
pigmentation, not
yellow expression
in bristles in the
presence of a strong enhancer element (
18).
This finding
suggests the presence of an internal promoter element
interacting with
the bristle enhancer and activating
yellow expression
in
bristles. The sequence of the putative
yellow promoter
region
has no homology to the DPE-containing promoters (
9,
10),
but the canonic DPE sequence is present in only 20% of
TATA-less
promoters. Thus, in vivo TATA-less promoters represent a
group
of promoters that are most sensitive to the reduction of the
TAF
II40
content.
A possible role of the TAFII40 carboxy-terminal domain
in vivo.
As was shown, the mutant phenotype of the
e(y)1u1 allele could be at least partially
reversed by supplying an additional amount of truncated
e(y)1/TAFII40 protein, in agreement with the results of in
vitro experiments. It has been shown that 222 amino-terminal amino
acids of TAFII40 harbor domains for interactions with basic factors, activators, and other TAFs (28).
dTAFII40 and hTAFII31 have significant homology
only in their amino termini (28). The carboxy-terminal
portion of dTAFII40 bears similarity to many glycine-rich
proteins (28), but in vitro experiments reveal no function
of the carboxy terminus in protein-protein interactions.
However, any tested single copy of the
P{
w+, e(y)1} construction does
not completely compensate for the effect of the
e(y)1u1 mutation on the
y2 phenotype or the lethal phenotype of the
e(y)1u1 e(y)3u1 combination of
mutations. Even the presence of two doses of the
P{
w+, e(y)1} construction
fails to completely rescue the
y+ phenotype or
suppress the lethal phenotype of the
e(y)1u1
e(y)3u1 combination of mutations. On the other hand, a
single dose of
the
P{
w+,
e(y)1+} construction has a much stronger suppression
effect.
Thus, deletion of the carboxy-terminal amino acids seems to make
expression of tagged genes more sensitive to the concentration
of
TAF
II40 protein. We speculate that the carboxy-terminal
portion
of TAF
II40 promotes an effective binding of the
protein to the
DNA covered by nucleosomes. This may explain the
compensation
of its loss by an increase of the mutant protein
concentration.
It is worth noting that the deleted carboxy-terminal
part of TAF
II40
contains the only charged stretch of the
protein (total charge
is
6). As human TAF
II31 also has a
single charged stretch (total
charge is
13) located at its carboxy
terminus, this similarity
may reflect some special function of this
region. The negatively
charged carboxy terminus is a characteristic
feature of many transcription
factors as well as the HMG-1 and HMG-2
families (
12).
It is not clear why expression of the
white gene flanked by
the su(Hw)-binding regions is independent of the combination of
the
e(y)1u1 and
zv77h
mutations. The
e(y)1u1 mutation in combination
with the
zv77h-null allele strongly reduces
white expression (
21). However,
two
su(Hw)-binding sites flanking the
white gene stabilize
white expression, making it independent of the
e(y)1u1 and
zv77h
mutation combination. The su(Hw)-binding region in
gypsy
mobile
element has the properties of an insulator: it interferes with
expression of the gene in tissues where it is regulated by enhancers
located distally from the su(Hw)-binding site with respect to
the
promoter (
13,
23,
31,
32,
49,
53). Two su(Hw)-binding
regions flanking a construction make the expression of a gene
independent of the negative effect of a surrounding chromatin.
It may
be that su(Hw) insulators support an open chromatin structure
in the
promoter area of the mini-
white gene that facilitates
binding
of the truncated TAF
II40 protein to the
white promoter. However,
further experiments are necessary
to support this
proposition.
| |
ACKNOWLEDGMENTS |
We are greatly indebted to V. G. Corces and P. K. Geyer
for providing the fly strains, A. Vasiljev for participation in
antiserum purification, and S. Dzitoeva and Y. Schwartz for help with microinjections.
This work was supported by the Russian State Program "Frontiers in
Genetics," by the Russian Basic Research Fund, INTAS-94-3801 and HFSP
grants, and by an International Research Scholar's award from the
Howard Hughes Medical Institute to P.G. The work of A. Soldatov and S. Georgieva was supported by a grant from the Centre for Medical
Research, University of Oslo.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Gene Biology, Russian Academy of Sciences, 34/5 Vavilov St., Moscow
117334, Russia. Phone: 7-095-1359734. Fax: 7-095-1354105. E-mail:
pgeorg{at}biogen.msk.su.
| |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Apone, L. M.,
C.-M. A. Virbasius,
J. C. Reese, and M. R. Green.
1996.
Yeast TAFII90 is required for cell-cycle progression through G2/M but not for general transcription activation.
Genes Dev.
10:2368-2380[Abstract/Free Full Text].
|
| 3.
|
Ashburner, M.
1989.
Drosophila: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 4.
|
Belenkaya, T.,
K. Barseguyan,
H. Hovhannisayn,
I. Biryukova,
E. Z. Kochieva, and P. Georgiev.
1998.
P element sequences can compensate a deletion of the yellow regulatory region in Drosophila melanogaster.
Mol. Gen. Genet.
259:79-87[Medline].
|
| 5.
|
Belenkaya, T.,
A. Soldatov,
E. Nabirochkina,
I. Birjukova,
S. Georgieva, and P. Georgiev.
1998.
The allele of the polyhomeotic gene induced by P element insertion encodes a new chimeric protein, that negatively regulates the expression of P-induced alleles in the yellow locus of Drosophila melanogaster.
Genetics
150:687-697[Abstract/Free Full Text].
|
| 6.
|
Bickel, S., and V. Pirrotta.
1990.
Self-association of the Drosophila zeste protein is responsible for the transvection effects.
EMBO J.
9:2959-2967[Medline].
|
| 7.
|
Brou, C.,
S. Chaudhary,
I. Davidson,
Y. Lutz,
J. Wu,
J. M. Egly,
L. Tora, and P. Chambon.
1993.
Distinct TFIID complexes mediate the effect of different transcriptional activators.
EMBO J.
12:489-499[Medline].
|
| 8.
|
Brou, C.,
J. Wu,
S. Ali,
E. Scheer,
C. Lang,
I. Davidson,
P. Chambon, and L. Tora.
1993.
Different TBP-associated factors are required for mediating the stimulation of transcription in vitro by the acidic transactivator GAL-VP16 and the two nonacidic activation functions of the estrogen receptor.
Nucleic Acids Res.
21:5-12[Abstract/Free Full Text].
|
| 9.
|
Burke, T. W., and J. T. Kadonaga.
1996.
Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters.
Genes Dev.
10:711-724[Abstract/Free Full Text].
|
| 10.
|
Burke, T. W., and J. T. Kadonaga.
1997.
The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila.
Genes Dev.
11:3020-3031[Abstract/Free Full Text].
|
| 11.
|
Burley, S. K., and R. G. Roeder.
1996.
Biochemistry and structural biology of transcription factor IID (TFIID).
Annu. Rev. Biochem.
65:769-799[Medline].
|
| 12.
|
Bustin, M.,
D. A. Lehn, and D. Lendsman.
1990.
Structural features of the HMG chromosomal proteins and their genes.
Biochim. Biophys. Acta
1094:231-243.
|
| 13.
|
Cai, H., and M. Levine.
1995.
Modulation of enhancer-promoter interactions by insulators in the Drosophila embryo.
Nature
376:533-536[Medline].
|
| 14.
|
Chen, J.-L.,
L. D. Attardi,
C. P. Verrijzer,
K. Yokomori, and R. Tjian.
1994.
Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators.
Cell
79:93-105[Medline].
|
| 15.
|
Dubrovskaya, V.,
A.-C. Lavigne,
I. Davidson,
J. Acker,
A. Staub, and L. Tora.
1996.
Distinct domains of hTAFII100 are required for functional interaction with transcription factor TFIIFb (RAP30) and incorporation into the TFIID complex.
EMBO J.
15:3702-3712[Medline].
|
| 16.
|
Fauvarque, M.-O., and J.-M. Dura.
1993.
polyhomeotic regulatory sequences induce developmental regulator-dependent variegation and targeted P-element insertions in Drosophila.
Genes Dev.
7:1508-1520[Abstract/Free Full Text].
|
| 17.
|
Gause, M.,
S. Georgieva, and P. Georgiev.
1996.
Phenotypic reversion of the gypsy-induced mutation scD1 of Drosophila melanogaster by replicative transposition of a sc enhancer to the yellow gene and by mutations in the enhancer of yellow and zeste loci.
Mol. Gen. Genet.
253:370-376[Medline].
|
| 18.
| Georgiev, P., and T. Kahn. Unpublished data.
|
| 18a.
|
Georgiev, P., and M. Kozycina.
1996.
Interaction between mutations in the suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations.
Genetics
142:425-436[Abstract].
|
| 19.
|
Georgiev, P. G., and T. I. Gerasimova.
1989.
Novel genes influencing the expression of the yellow locus and mdg4 (gypsy) in Drosophila melanogaster.
Mol. Gen. Genet.
220:121-126[Medline].
|
| 20.
|
Georgiev, P. G.,
S. L. Kiselev,
O. B. Simonova, and T. I. Gerasimova.
1990.
A novel transposition system in Drosophila melanogaster depending on the Stalker mobile genetic element.
EMBO J.
9:2037-2044[Medline].
|
| 21.
|
Georgiev, P. G.
1994.
Identification of mutations in three genes that interact with zeste in the control of white gene expression in Drosophila melanogaster.
Genetics
138:733-739[Abstract].
|
| 22.
|
Geyer, P. K., and V. G. Corces.
1987.
Separate regulatory elements are responsible for the complex pattern of tissue-specific and developmental transcription of the yellow locus in Drosophila melanogaster.
Genes Dev.
1:996-1004[Abstract/Free Full Text].
|
| 23.
|
Geyer, P. K., and V. G. Corces.
1992.
DNA position-specific repression of transcription by a Drosophila zinc finger protein.
Genes Dev.
6:1865-1873[Abstract/Free Full Text].
|
| 24.
|
Geyer, P. K.,
M. M. Green, and V. G. Corces.
1988.
Mutant gene phenotypes mediated by a Drosophila melanogaster tetrotransposon require sequences homologous to mammalian enhancers.
Proc. Natl. Acad. Sci. USA
85:8593-8597[Abstract/Free Full Text].
|
| 25.
|
Geyer, P. K.,
M. M. Green, and V. G. Corces.
1998.
Reversion of a gypsy-induced mutation at the yellow (y) locus of Drosophila melanogaster is associated with the insertion of a newly defined transposable element.
Proc. Natl. Acad. Sci. USA
85:3938-3942.
|
| 26.
|
Geyer, P. K.,
K. L. Richardson,
V. G. Corces, and M. M. Green.
1988.
Genetic instability in Drosophila melanogaster: P-element mutagenesis by gene conversion.
Proc. Natl. Acad. Sci. USA
85:6455-6459[Abstract/Free Full Text].
|
| 27.
|
Geyer, P. K.,
C. Spana, and V. G. Corces.
1986.
On the molecular mechanism of gypsy-induced mutations at the yellow locus of Drosophila melanogaster.
EMBO J.
5:2657-2662[Medline].
|
| 28.
|
Goodrich, J. A.,
T. Hoey,
C. J. Thut,
A. Admon, and R. Tjian.
1993.
Drosophila TAFII40 interacts with both VP16 activation domain and the basal transcription factor TFIIB.
Cell
75:519-530[Medline].
|
| 29.
|
Harrison, D. A.,
D. A. Gdula,
R. S. Coyne, and V. G. Corces.
1993.
A leucine zipper domain of the suppressor of Hairy-wing protein mediates its repressive effect on enhancer function.
Genes Dev.
7:1966-1978[Abstract/Free Full Text].
|
| 30.
|
Hoffman, A.,
C.-M. Chiang,
T. Oelgeschlager,
X. Xie,
S. K. Burley,
Y. Nakatani, and R. G. Roeder.
1996.
A histone octamer-like structure within TFIID.
Nature
380:356-359[Medline].
|
| 31.
|
Holdridge, C., and D. Dorsett.
1991.
Repression of hsp70 heat shock gene transcription by the suppressor of Hairy-wing protein of Drosophila melanogaster.
Mol. Cell. Biol.
11:1894-1990[Abstract/Free Full Text].
|
| 32.
|
Jack, J.,
D. Dorsett,
Y. DeLotto, and S. Liu.
1991.
Expression of the cut locus in the Drosophila wing margin is required for cell type specification and is regulated by a distant enhancer.
Development
113:735-747[Abstract].
|
| 33.
|
Jacq, X.,
C. Brou,
Y. Lutz,
I. Davidson,
P. Chambon, and L. Tora.
1994.
Human TAFII30 is present in a distinct TFIID complex and is required for transcriptional activation by the estrogen receptor.
Cell
79:107-117[Medline].
|
| 34.
|
Kares, R. E., and G. M. Rubin.
1984.
Analysis of P transposable element functions in Drosophila.
Cell
38:135-146[Medline].
|
| 35.
|
Klemm, R. D.,
J. A. Goodrich,
S. Zhou, and R. Tjian.
1995.
Molecular cloning and expression of the 32-kDa subunit of human TFIID reveals interactions with Vp16 and TFIIB that mediate transcriptional activation.
Proc. Natl. Acad. Sci. USA
92:5788-5792[Abstract/Free Full Text].
|
| 36.
|
Levis, R.,
T. Hazelrigg, and G. M. Rubin.
1985.
Separable cis-acting control elements for expression of the white gene of Drosophila.
EMBO J.
4:3489-3499[Medline].
|
| 37.
|
Lindsley, D. L., and G. G. Zimm.
1992.
The genome of Drosophila melanogaster.
Academic Press, New York, N.Y.
|
| 38.
|
Lu, H., and A. Levine.
1995.
Human TAFII31 protein is a transcriptional coactivator of the p53 protein.
Proc. Natl. Acad. Sci. USA
92:5154-5158[Abstract/Free Full Text].
|
| 39.
|
Maes, M., and E. Messens.
1992.
Phenol as grinding material in RNA preparations.
Nucleic Acids Res.
20:4374[Free Full Text].
|
| 40.
|
Moqtaderi, Z.,
Y. Bai,
D. Poon,
P. A. Weil, and K. Struhl.
1996.
TBP-associated factors are not generally required for transcriptional activation.
Nature
382:188-191.
|
| 41.
|
Parkhurst, S. M.,
D. A. Harrison,
M. P. Remington,
C. Spane,
R. L. Kelley,
R. S. Coyne, and V. G. Corces.
1988.
The Drosophila su(Hw) gene, which controls the phenotypic effect of the gypsy transposable element, encodes a putative DNA-binding protein.
Genes Dev.
2:1205-1215[Abstract/Free Full Text].
|
| 42.
|
Pirrotta, V.
1988.
Vectors for P-mediated transformation in Drosophila, p. 437-445.
In
R. L. Rodriguez, and D. T. Denhardt (ed.), Vector: a survey of molecular cloning vectors and their uses. Butterworths, Boston, Mass.
|
| 43.
|
Pirrotta, V.,
E. Manet,
E. Harbon,
S. E. Bickel, and M. Benson.
1987.
Structure and sequence of the Drosophila zeste gene.
EMBO J.
6:791-799[Medline].
|
| 44.
|
Pirrotta, V.,
H. Steller, and M. P. Bozzetti.
1985.
Multiple upstream regulatory elements control the expression of the Drosophila white gene.
EMBO J.
4:3501-3508[Medline].
|
| 45.
|
Platero, J. S.,
E. J. Sharp,
P. N. Adler, and J. C. Eissenberg.
1996.
In vivo assay for protein-protein interactions using Drosophila chromosomes.
Chromosoma
104:393-404[Medline].
|
| 46.
|
Reese, J. C.,
L. Apone,
S. S. Walker,
L. A. Griffin, and M. R. Green.
1994.
Yeast TAFIIs in a multisubunit complex required for activated transcription.
Nature
371:523-527[Medline].
|
| 47.
|
Roeder, R.
1996.
The role of general initiation factors in transcription by RNA polymerase II.
Trends Biochem. Sci.
21:327-335[Medline].
|
| 48.
|
Roseman, R. R.,
E. A. Johnson,
C. K. Rodesch,
M. Bjerke,
R. N. Nagoshi, and P. K. Geyer.
1995.
A P element containing suppressor of Hairy-wing binding regions has novel properties for mutagenesis in Drosophila melanogaster.
Genetics
141:1061-1074[Abstract].
|
| 49.
|
Roseman, R. R.,
V. Pirrotta, and P. K. Geyer.
1993.
The su(Hw) protein insulates expression of the Drosophila melanogaster white gene from chromosomal position-effects.
EMBO J.
12:435-442[Medline].
|
| 50.
|
Rubin, G. M., and A. C. Spradling.
1982.
Genetic transformation of Drosophila with transposable element vectors.
Science
218:348-353[Abstract/Free Full Text].
|
| 51.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 52.
|
Sauer, F.,
D. A. Wassarman,
J. M. Rubin, and R. Tijan.
1996.
TAFIIs mediate activation of transcription in the Drosophila embryo.
Cell
87:1271-1284[Medline].
|
| 53.
|
Scott, K. S., and P. K. Geyer.
1995.
Effects of the su(Hw) insulator protein on the expression of the divergently transcribed Drosophila yolk protein genes.
EMBO J.
14:6258-6279[Medline].
|
| 54.
|
Soldatov, A. V., and E. N. Nabirochkina.
1996.
A new method for cloning Drosophila melanogaster genes marked with highly copied mobile genetic element.
Russ. J. Genet.
32:1497-1500.
|
| 55.
|
Spradling, A. C., and G. M. Rubin.
1982.
Transposition of cloned P elements into germlike chromosomes.
Science
218:341-347[Abstract/Free Full Text].
|
| 56.
|
Tansey, W. P., and W. Herr.
1997.
TAFs: guilt by association.
Cell
88:729-732[Medline].
|
| 57.
|
Thut, C. J.,
J. L. Chen,
R. Klemm, and R. Tjian.
1995.
p53 transcriptional activation mediated by coactivators TAFII40 and TAFII60.
Science
267:100-104[Abstract/Free Full Text].
|
| 58.
|
Tjian, R., and T. Maniatis.
1994.
Transcriptional activation: a complex puzzle with few easy pieces.
Cell
77:5-8[Medline].
|
| 59.
|
Verrijzer, C. P., and R. Tjian.
1996.
TAFs mediate transcriptional activation and promoter selectivity.
Trends Biochem. Sci.
21:338-342[Medline].
|
| 60.
|
Qian, S.,
B. Varjavand, and V. Pirrotta.
1992.
Molecular analysis of the zeste-white interaction reveals a promoter-proximal element essential for distant enhancer-promoter communication.
Genetics
131:79-90[Abstract].
|
| 61.
|
Walker, S. S.,
J. C. Reese,
L. M. Apone, and M. R. Green.
1996.
Transcription activation in cells lacking TAFIIs.
Nature
382:185-188.
|
| 62.
|
Walker, S. S,
W.-C. Shen,
J. C. Reese,
L. M. Apone, and M. R. Green.
1997.
Yeast TAFII145 required for transcription of G1/S cyclin genes and regulated by the cellular growth state.
Cell
90:607-614[Medline].
|
| 63.
|
Wang, E. H., and R. Tjian.
1994.
Promoter-selective transcriptional defect in cell cycle mutant ts13 rescued by hTAFII250.
Science
263:811-814[Abstract/Free Full Text].
|
| 64.
|
Xie, X.,
T. Kokubo,
S. L. Cohen,
U. A. Mirza,
A. Hoffmann,
B. T. Chait,
R. G. Roeder,
Y. Nakatani, and S. K. Burley.
1996.
Structural similarity between TAFs and the heterotetrameric core of the histone octamer.
Nature
380:316-322[Medline].
|
Molecular and Cellular Biology, May 1999, p. 3769-3778, Vol. 19, No. 5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deato, M.D.E., Tjian, R.
(2008). An Unexpected Role of TAFs and TRFs in Skeletal Muscle Differentiation: Switching Core Promoter Complexes. Cold Spring Harb Symp Quant Biol
0: sqb.2008.73.028v1-sqb.2008.73.028
[Abstract]
-
Kopytova, D. V., Krasnov, A. N., Kopantceva, M. R., Nabirochkina, E. N., Nikolenko, J. V., Maksimenko, O., Kurshakova, M. M., Lebedeva, L. A., Yerokhin, M. M., Simonova, O. B., Korochkin, L. I., Tora, L., Georgiev, P. G., Georgieva, S. G.
(2006). Two Isoforms of Drosophila TRF2 Are Involved in Embryonic Development, Premeiotic Chromatin Condensation, and Proper Differentiation of Germ Cells of Both Sexes.. Mol. Cell. Biol.
26: 7492-7505
[Abstract]
[Full Text]
-
Lebedeva, L. A., Nabirochkina, E. N., Kurshakova, M. M., Robert, F., Krasnov, A. N., Evgen'ev, M. B., Kadonaga, J. T., Georgieva, S. G., Tora, L.
(2005). Occupancy of the Drosophila hsp70 promoter by a subset of basal transcription factors diminishes upon transcriptional activation. Proc. Natl. Acad. Sci. USA
102: 18087-18092
[Abstract]
[Full Text]
-
Krasnov, A. N., Kurshakova, M. M., Ramensky, V. E., Mardanov, P. V., Nabirochkina, E. N., Georgieva, S. G.
(2005). A retrocopy of a gene can functionally displace the source gene in evolution. Nucleic Acids Res
33: 6654-6661
[Abstract]
[Full Text]
-
Chen, Z., Manley, J. L.
(2003). Core Promoter Elements and TAFs Contribute to the Diversity of Transcriptional Activation in Vertebrates. Mol. Cell. Biol.
23: 7350-7362
[Abstract]
[Full Text]
-
Muratoglu, S., Georgieva, S., Papai, G., Scheer, E., Enunlu, I., Komonyi, O., Cserpan, I., Lebedeva, L., Nabirochkina, E., Udvardy, A., Tora, L., Boros, I.
(2003). Two Different Drosophila ADA2 Homologues Are Present in Distinct GCN5 Histone Acetyltransferase-Containing Complexes. Mol. Cell. Biol.
23: 306-321
[Abstract]
[Full Text]
-
Thuault, S., Gangloff, Y.-G., Kirchner, J., Sanders, S., Werten, S., Romier, C., Weil, P. A., Davidson, I.
(2002). Functional Analysis of the TFIID-specific Yeast TAF4 (yTAFII48) Reveals an Unexpected Organization of Its Histone-fold Domain. J. Biol. Chem.
277: 45510-45517
[Abstract]
[Full Text]
-
Butler, J. E.F., Kadonaga, J. T.
(2002). The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev.
16: 2583-2592
[Full Text]
-
Aoyagi, N., Wassarman, D. A.
(2001). Developmental and Transcriptional Consequences of Mutations in Drosophila TAFII60. Mol. Cell. Biol.
21: 6808-6819
[Abstract]
[Full Text]
-
Georgieva, S., Nabirochkina, E., Dilworth, F. J., Eickhoff, H., Becker, P., Tora, L., Georgiev, P., Soldatov, A.
(2001). The Novel Transcription Factor e(y)2 Interacts with TAFII40 and Potentiates Transcription Activation on Chromatin Templates. Mol. Cell. Biol.
21: 5223-5231
[Abstract]
[Full Text]
-
Chen, Z., Manley, J. L.
(2000). Robust mRNA Transcription in Chicken DT40 Cells Depleted of TAFII31 Suggests Both Functional Degeneracy and Evolutionary Divergence. Mol. Cell. Biol.
20: 5064-5076
[Abstract]
[Full Text]
-
Georgieva, S., Kirschner, D. B., Jagla, T., Nabirochkina, E., Hanke, S., Schenkel, H., de Lorenzo, C., Sinha, P., Jagla, K., Mechler, B., Tora, L.
(2000). Two Novel Drosophila TAFIIs Have Homology with Human TAFII30 and Are Differentially Regulated during Development. Mol. Cell. Biol.
20: 1639-1648
[Abstract]
[Full Text]
-
Wassarman, D. A., Aoyagi, N., Pile, L. A., Schlag, E. M.
(2000). TAF250 is required for multiple developmental events in Drosophila. Proc. Natl. Acad. Sci. USA
97: 1154-1159
[Abstract]
[Full Text]
-
Komarnitsky, P. B., Michel, B., Buratowski, S.
(1999). TFIID-specific yeast TAF40 is essential for the majority of RNA polymerase II-mediated transcription in vivo. Genes Dev.
13: 2484-2489
[Abstract]
[Full Text]
-
Biryukova, I., Belenkaya, T., Hovannisian, H., Kochieva, E., Georgiev, P.
(1999). The P-Ph Protein-Mediated Repression of yellow Expression Depends on Different cis- and trans-Factors in Drosophila melanogaster. Genetics
152: 1641-1652
[Abstract]
[Full Text]
Top
Abstract
Introduction
