Previous Article | Next Article 
Molecular and Cellular Biology, May 1999, p. 3848-3856, Vol. 19, No. 5
Department of Biology, Massachusetts
Institute of Technology, Cambridge, Massachusetts 02139
Received 16 December 1998/Returned for modification 29 January
1999/Accepted 24 February 1999
A cause of aging in Saccharomyces cerevisiae is the
accumulation of extrachromosomal ribosomal DNA circles (ERCs).
Introduction of an ERC into young mother cells shortens life span and
accelerates the onset of age-associated sterility. It is important
to understand the process by which ERCs are generated. Here, we
demonstrate that homologous recombination is necessary for ERC
formation. rad52 mutant cells, defective in DNA repair
through homologous recombination, do not accumulate ERCs with age, and
mutations in other genes of the RAD52 class have varying
effects on ERC formation. rad52 mutation leads to a
progressive delocalization of Sir3p from telomeres to other nuclear
sites with age and, surprisingly, shortens life span. We speculate that
spontaneous DNA damage, perhaps double-strand breaks, causes lethality
in mutants of the RAD52 class and may be an initial step of
aging in wild-type cells.
One of the hallmarks of aging in
most organisms is that mortality rate increases exponentially with age
(24). Because yeast cells divide asymmetrically, mother and
daughter cells can be separated microscopically at each cell division,
and such experiments reveal that mothers have a fixed division
capacity, called their life span. A number of morphological
changes occur as mother cells grow older: slowing of the cell
cycle, enlargement of cell size, loss of mating ability, and
accumulation of intracellular granules (64, 66, 87). The
daughter cells from old mothers have a reduced life span potential,
hinting that a dominant cytoplasmic senescence factor asymmetrically
accumulates in old mother cells and that this factor can leak to
daughter cells from old mothers (21, 44).
A genetic study has revealed that the allele of SIR4 affects
life span (45). Null alleles cause a shortened life span,
and a gain-of-function allele gives rise to an extended life span. The
SIR2/3/4 gene products are normally positioned at telomeres and HM loci, where they mediate transcriptional silencing
(35, 54). SIR2 also plays a role at the
nucleolus, the site of repeated copies of ribosomal DNA (rDNA), to
suppress recombination and mediate silencing (14, 32, 88).
In aging cells, the sir complex at telomeres and HM loci
relocates to the nucleolus (46). This relocalization is
mimicked constitutively by the gain-of-function allele of
SIR4 that extends life span (45). Thus, the
relocalization of the Sir complex to the nucleolus extends life span in
wild-type yeast cells.
Studies of the human WRN gene, recessive mutations in
which cause the disease Werner syndrome (99), further
support the close link between the nucleolus and aging.
Individuals with Werner syndrome show symptoms of accelerated aging,
including hair graying and loss, atherosclerosis, bilateral ocular
cataracts, diabetes, and osteoporosis (23, 76).
WRN has greatest homology with genes encoding DNA helicases
of the RecQ family, including Saccharomyces cerevisiae SGS1
(30), Escherichia coli recQ (50, 68),
Schizosaccharomyces pombe rqh1 (89),
Xenopus laevis FFA-1 (98), and human
BLM and RecQL (22, 73). The WRN
protein has been demonstrated previously to have ATP-dependent DNA
helicase activity and 3' The sgs1 mutation suppresses the slow growth and
hyperrecombination at the rDNA caused by a top3
mutation, and Sgs1p interacts with both Top2p and Top3p (30,
96). The sgs1 mutation also causes genomic
instabilities, including hyperrecombination at rDNA and other loci and
a reduction in fidelity of both mitotic and meiotic chromosome
segregation (30, 95, 96). Interestingly, like the
WRN mutation, the sgs1 mutation accelerates
aging: it decreases the average life span of yeast cells by 60% and
accelerates the onset of age-associated phenotypes, including
sterility and the redistribution of the Sir proteins from telomeres to
the nucleolus (86). Sgs1p, like WRN protein, is concentrated
in the nucleolus (86). In addition, expression of the WRN
protein in the sgs1 mutant suppresses the hyperrecombination
phenotype (97).
Microscopic analysis has revealed that the nucleolus in old mother
cells is enlarged and fragmented (86). These changes are
caused by the genomic instability in the tandem repeats of rDNA. Midway
in the life span of mother cells, an extrachromosomal rDNA circle (ERC)
is excised from the genome (85). Each ERC contains an
ARS sequence, and plasmids containing such sequences autonomously replicate and segregate asymmetrically in mother cells (67). Thus, mother cells build up ERCs to very high
levels, and daughters are ERC free (85). The release of a
single ERC in young cells is sufficient to shorten life span by 40%,
proving that ERC accumulation causes senescence. ERCs can leak
into daughters of very old mothers, consistent with the view that they
are the previously described senescence factor (21, 44).
Since the sgs1 mutant displays hyperrecombination at the
rDNA, it is possible that cellular recombination mechanisms lead to the
formation of ERCs. We thus sought to understand how ERCs were formed.
Here, we analyze the effects of mutations that cause a defect in
recombination on ERC formation and aging. Our findings show a link
between ERC formation and the RAD52 pathway of homologous recombination. Further, our results suggest that DNA breaks might be an
early event in the aging process, which then triggers the formation of
ERCs and the release of the Sir protein complex from telomeres in aging cells.
Yeast strains and media.
Yeast strains used in this study
are listed in Table 1. All strains are
isogenic. Strains were cultured at 30°C with standard media
(82). For isolation of old cells, yeast
extract-peptone-dextrose with 2.5% glucose was used as previous
described (85). PPY74 (RDN1::ADE2) was
constructed by transforming PSY316
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Effects of Mutations in DNA Repair Genes on
Formation of Ribosomal DNA Circles and Life Span in
Saccharomyces cerevisiae
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
5' exonuclease activity (33, 37,
81). Importantly, WRN protein is localized in the nucleolus
in human cells (34, 58), suggesting that its role in
promoting longevity may be linked to a nucleolar function.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
with pDS40 (85). PPY16
and PPY103 were constructed by transforming PSY316a and PPY74 with
pBS/SK-E1/E2-I3/I4-3ARU (a gift of A. Lau and S. Bell) cut with
KpnI/NotI. This transformation replaced the
region from the HMR-I to the HMR-E silencer with
the URA3 gene (hmr
1::URA3), which is
not silenced. PPY27 was constructed by transforming PPY16 with a
gel-purified, BamHI/PstI ADE2 fragment
from pURADE2 (85). PPY35 and PPY143 were made by
transforming PPY27 and PPY103 with pPP46 cut with
PshAI/AatII and uncut pRS315 (84). The
transformed cells were first grown on a Leu
plate to
select for cells that had acquired pRS315 and replica plated onto a
Leu 5-fluoroorotic acid plate to select for
Ura cells among the Leu+ cells.
Ura Leu+ cells were screened by PCR to check
for the correct transformants (hmr2::ADH1-GFP).
PPY56 (sir3::URA3) was constructed by
transforming PPY35 with pDM42 (55). To construct PPY70
(sgs1::hisG), after transformation of PPY35
with pPP69 cut with NotI, a correct transformant was passed
over 5-fluoroorotic acid to eliminate the URA3 gene (10). PPY98 (rad52::LEU2) was
constructed by transforming PPY35 with pSM20 (D. Schild).
TABLE 1.
Yeast strains used in this study
, from +21 to
+1648 for rad7, from +49 to +3253 for rad26, from +165 to +3843 for rad50, from
+1 to +1196 for rad51, from +63 to +1488 for
rad52, from +43 to +1379 for rad57, and from +39 to +668 for rad59.
Plasmids.
pPP46 was constructed by the following procedures.
(i) pJR1426 (a gift of M. Foss and J. Rine) contains a 5.1-kb fragment of HMR in a pRS316 backbone (84). The
HMR fragment contains the a1 and a2
genes replaced with the 1 and 2 genes but
contains intact HMR-E and HMR-I silencers.
pJR1426 was first cut with SacI/SmaI, and the
ends were blunted with the Klenow fragment and ligated, resulting in
pPP21. These procedures removed the linker sequences, including the
XbaI site, between the two restriction sites that are
outside of the HMR fragment. (ii) pPP21 was digested with BclI/XbaI, which removed 1 and
2 genes, and ligated with polylinker insert cut with
BclI/XbaI, resulting in pPP33. This polylinker insert, containing many restriction sites, was created by annealing and
extending the following two oligonucleotides with Taq
DNA polymerase:
5'-GCGCGTCGGCCGCTGATCAGTCGACTCGCGATCGATCCTAGGCTAGCGAATTCAGATCTTCCGGA-3' and
5'-GCTGGC TCTAGAGCATGCGGCCGGTTAACCCGCGGTCCGGAAGATCTGAATT CGCTAGCCTAGGA-3'. (iii) pPP16 was constructed by inserting the
HindIII fragment containing the soluble
green fluorescent protein (GFP) (S65T and V163A mutant) gene amplified
by PCR from pJK19-1 (43) into pSP400. pSP400 was constructed
by moving the entire promoter and terminator of ADH1 in
pDB20 (9) into pRS306 (84). (iv) pPP46 was made by inserting the entire promoter and terminator of ADH1
including soluble GFP of pPP16 cut with SmaI/XbaI
into pPP33 cut with HpaI/XbaI.
Life span analysis. Life span analysis was performed by counting the number of daughter cells that bud off from a virgin mother cell before cessation of cell division, as previously described (44). The sample size for each life span analysis was 43 to 51 cells. Each life span analysis was carried out at least two independent times.
Isolation of old cells. Old cells were obtained as previously described (85), except that for some experiments Sulfosuccinimidyl-6-(biotinamido)-6-hexanimide hexanoate (Pierce, Rockford, Ill.) was used for biotinylation, instead of sulfosuccinimidyl-6-(biotinamido)hexanoate.They both gave a similar yield of old cells.
Immunofluorescence. Immunofluorescence experiments were performed as described elsewhere (31, 46), except that anti-Sir3p used in this study was generated by immunizing a rabbit with the full-length Sir3p (60a). Optical sections of images were obtained with the CELLscan system (Scanalytics, Billerica, Mass.) as previously described (46). Strains that do not contain the GFP gene at HMR were used for these studies.
One-dimensional gel analysis. DNA used for gel analysis was prepared as previously described (85), except that no phenol extraction was performed. Total DNA (5 µg) for each sample was electrophoresed without ethidium bromide at 1 V/cm for 24 to 30 h. Young cells used in this experiment were free cells that were removed when old cells were magnetically sorted.
FACS analysis. Young or old cells (about 2 × 106 cells) were resuspended in 1 ml of phosphate-buffered saline containing 5 µg of propidium iodide (PI) (Sigma, St. Louis, Mo.) per ml and sonicated briefly to separate the clumped cells. To ensure appropriate comparison with old cells, young cells were biotinylated and incubated with streptavidin-coated magnetic beads (PerSeptive Biosystems, Cambridge, Mass.). The only exception was sir3 cells that were from a log-phase culture. The magnetic beads present along with the cells did not interfere with the fluorescence-activated cell sorting (FACS) analysis; young cells with and without beads gave similar results. The level of green fluorescence of each cell was determined by using FACScan (Becton Dickinson, San Jose, Calif.). Dead cells were first excluded from the analysis by being stained with PI, which was measured with a 650 long-pass filter (15, 18). PI preferentially stains dead cells that have porous membranes and will not diffuse appreciably into intact cells. Then, the level of green fluorescence of 105 live cells was measured with a 530/30 band pass filter, and their fluorescence was displayed in a histogram with the CellQuest Analysis program (Becton Dickinson).
Statistical analysis. The significance of differences in mean life span between two strains was determined as previously described (45).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
RAD52 is required for ERC formation and longevity. To investigate the possibility that ERCs are excised from the rDNA locus through intrachromosomal homologous recombination, we tested whether ERC formation requires RAD52, a gene needed for most homologous recombinational events (71, 83). Age-matched wild-type and mutant cells that had divided on average seven to eight generations were magnetically sorted, and their DNA was analyzed by gel electrophoresis. While the old wild-type cells clearly accumulated ERC species, ERCs were undetectable in the old rad52 cells (Fig. 1A). A small amount of ERCs could have been present in the old rad52 cells and gone undetected. Thus, we also searched for ERCs in sgs1 rad52 double mutant cells. Although the old sgs1 cells accumulated slightly more ERCs than did the age-matched wild-type cells, the old sgs1 rad52 cells showed no detectable ERCs (Fig. 1A). Thus, the RAD52 gene and, presumably, homologous recombination are required for the formation of ERCs.
|
The rad52 mutant displays a premature loss of silencing at HMR. We then investigated whether other age-associated phenotypes are still present in cells that do not accumulate ERCs with age. One of the hallmarks of yeast aging is the gradual increase in the number of cells that lose silencing at the HM loci (87). We investigated the state of silencing in old rad52 cells. Because the previously used assay to determine age-specific phenotype of sterility is laborious (86, 87), we developed an assay to easily detect the state of silencing at the HM loci. We replaced the a1 and a2 genes at the HMR locus with the GFP gene driven by the constitutive ADH1 promoter (Fig. 2A). We postulated that in young cells GFP expression would be silenced, while in old cells GFP would be expressed, giving rise to green fluorescence.
|
GFP, 2.85; old
wild-type Sir3p is redistributed from telomeres to other sites in the nucleus in old rad52 cells. Loss of HM silencing in old wild-type cells is likely due to the redistribution of Sir3 proteins from the telomeres and HM loci to the nucleolus (46). Thus, we examined Sir3p localization in old rad52 cells by indirect immunofluorescence with anti-Sir3p antibody. The nucleus is stained with DAPI (blue) (4',6-diamidino-2-phenylindole), and the nucleolus is stained with anti-Nop1p (red) in this experiment. In young rad52 cells, Sir3p was found at three to seven bright perinuclear foci (green), characteristic of telomeres (Fig. 3). This pattern was indistinguishable from that observed for young wild-type cells. Old wild-type cells (about 18 generations old) showed a nucleolar relocalization of Sir3p (yellow in the merged image), as previously described (46). Distinct from the old wild-type cells, 20 to 30% of sorted, old rad52 cells (average, seven to eight generations old) showed a diffuse, nuclear pattern of Sir3p staining that included the nucleolus. About a third of the cells that displayed a diffuse, nuclear pattern showed many bright foci, some of which could be telomeric foci. The remaining cells showed a telomeric staining like young cells. We believe that those cells that showed a diffuse, nuclear pattern are cells that have reached the end of their life span. They are not likely to be dead cells because very old wild-type cells (18 generations old) did not give a similar staining. The pattern of nuclear staining is consistent with the movement of Sir3p away from telomeres and HM loci and could explain the premature loss of silencing seen at HMR (Fig. 2B). We speculate that the Sir proteins, which play a role in DNA repair through nonhomologous end joining (11, 93), leave the telomeres and HM loci to repair DNA damage, perhaps DSBs, that occur elsewhere in old rad52 cells.
|
Role of other genes in the RAD52 epistasis group for ERC formation and longevity. We then set out to determine if other genes important for homologous recombination played a role in ERC formation. RAD51 encodes a RecA homolog, and RAD57 shows RecA homology (42, 83, 90). Both display a partial defect in homologous recombination (2, 74). In contrast to the old rad52 cells, old rad51 and rad57 cells had a detectable level of ERCs, albeit lower than that of the age-matched wild-type cells (Fig. 4A). Also, both rad51 (average = 13.0 generations) and rad57 (average = 12.5 generations) mutations shortened life span by about 40% (Fig. 4B). The less severe shortening of life span seen for rad51 and rad57 mutants than for the rad52 mutant (70% shorter) (Fig. 1A) correlates with their lesser degree of deficiency in homologous recombination. FACS analysis of age-matched rad51 (average fluorescence = 20.30) and rad57 cells (average fluorescence = 19.56) showed a premature loss of silencing compared to the age-matched wild-type cells (Fig. 2B).
|
Effects of mutations in other DNA repair genes on longevity. We then investigated if the effect of mutations in DNA repair genes on longevity is restricted to mutants defective in homologous recombination. Another form of repair that applies to repeated DNA sequences is single-strand annealing (SSA) (36, 70). SSA occurs between homologous regions flanking a DSB, by annealing of complementary DNA after extensive 5'-to-3' degradation extending away from the break (8, 25). RAD1 encodes an endonuclease that can remove nonhomologous single-strand ends of a DSB, and it is required for SSA (39, 40). The rad1 mutation did not have a significant effect on life span (Fig. 5), indicating that SSA is not necessary for normal life span.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Effects of mutations in DNA repair genes on ERC formation and life span in mother cells. In this paper, we have determined the effects of mutations in various DNA repair genes on the formation of ERCs and life span. Interestingly, mutations in RAD52, RAD50, and RAD51 (or RAD57), all of which affect homologous recombination, gave a total, severe, or partial reduction, respectively, in the formation of ERCs. Thus, the formation of ERCs requires the activity of the RAD52-dependent pathway of homologous recombination. Surprisingly, these mutations did not extend the life span of mother cells but, rather, shortened their life span.
Since ERCs are a cause of aging in wild-type mother cells, how can we explain the shortened life spans of these mutants? For the rad52, rad51, and rad57 mutants, the degree of shortening correlates well with the severity in the reduction of homologous recombination in these mutants. In fact, it is this reduction in homologous recombination that governs the lower rate of generation of ERCs in these mutants. Surprisingly, the rad50 mutation, which has a modest effect or none on the intrachromosomal recombination rate (29, 36, 74), had a severe reduction in ERC accumulation. Heteroallelic interchromosomal recombination is increased by 10-fold in the rad50 mutant (56, 57). It is possible that RAD50, along with MRE11 and XRS2, regulates the balance of intrachromosomal and interchromosomal recombination events. In the absence of RAD50 function, the frequency of the interchromosomal events could increase at the expense of reduction in intrachromosomal events. If so, the severe reduction in ERC formation observed in the rad50 mutant may be due to such dysregulation. Since RAD50 also has roles in illegitimate recombination, telomeric maintenance, and checkpoint function (4, 11, 62, 69), it is possible that a disruption in these functions contributes to the reduction in ERC formation and shortening of life span, in addition to the disruption in homologous recombination. Since DNA lesions such as DSBs are not repaired efficiently in the mutants defective in homologous recombination, these mutants are likely to be dying prematurely due to unrepaired DSBs. Consistent with this idea, unlike wild-type cells, most of the rad52 cells ceased dividing as large budded cells (G2/M). The premature death of rad52 cells does not appear to be due to chromosome loss, since the rad52 haploid cells lived as long as did the rad52 diploid cells. Introduction of two unrepairable DSBs that cannot be repaired through homologous recombination in wild-type cells causes an adaptation failure and a permanent G2/M arrest (51). We speculate that old rad52 cells cease dividing and permanently arrest at G2/M because of multiple unrepaired DSBs. In wild-type cells, these DSBs and other lesions are repaired efficiently so that cells escape early death. However, as a by-product of those repair events, ERCs can be generated by homologous recombination in the rDNA, and these ERCs then carry out the proposed gradual aging program (Fig. 6). By this view, the generation of an ERC in a mother cell at once corrects the acute problem of a DNA break in the rDNA at the price of establishing the mortality of that mother cell lineage.
|
Redistribution of Sir3p away from telomeres in old rad mutant cells defective in homologous recombination. In wild-type cells, the Sir complex bound at telomeres is redistributed to the nucleolus approximately midway in the life span of mothers (46). This relocalization leads to the appearance of the sterile phenotype because of a loss of silencing at HML and HMR, from which the Sir complex has been removed (45). We have speculated that the generation or accumulation of ERCs is slowed down by the redirected Sir complex, explaining the life span extension (19, 85). In rad mutants defective in homologous recombination, immunostaining with anti-Sir3p antibodies showed that the Sir complex, in contrast with old wild-type cells, is present diffusely throughout the nucleus including the nucleolus. This relocalization is probably responsible for the loss of silencing with age, as determined by the expression of a GFP marker inserted at HMR (Fig. 2).
Why is there a redistribution of the Sir complex away from telomeres and HM loci with age in rad mutants? We infer that the relocalization of the Sir complex in rad mutant cells is caused by DSBs at the rDNA and elsewhere in the genome, most likely during DNA replication (Fig. 6) (59, 80, 100). The Sir proteins, along with Ku70/80, have been implicated in the repair of DSBs by an end-joining reaction in yeast (93). Recent findings show that the induction of DSBs by EcoRI endonuclease also elicits the movement of the Sir complex away from telomeres (61). We speculate that diffuse nuclear staining is not observed in the wild type because DSBs are repaired efficiently by homologous recombination between sister chromatids in the S or G2 phase of the cell cycle. The redistribution of the Sir complex to the nucleolus in wild-type cells may be triggered by DSBs that occur specifically in the rDNA. The recruitment of the Sir complex to the nucleolus in aging wild-type cells may be an attempt to employ end joining to supplement the repair of rDNA breaks by homologous recombination (Fig. 6). The repair of such damage by other repair pathways, including SSA and end-joining pathways, would avoid the possibility of generating ERCs by homologous recombination in the tandemly repeated rDNA. A DSB occurring at rDNA has been shown to be efficiently repaired in rad52 cells through the SSA pathway (70). The deletion of the RAD1 gene does not have a significant effect on life span (Fig. 5), suggesting either that the contribution of SSA in DSB repair in the rDNA is small or that RAD1 is not required for SSA in the rDNA. However, it is also possible that the redistributed Sir complex extends the life span of wild-type cells through other mechanisms (19): by bolstering Sir2p-mediated suppression of rDNA recombination and thus reducing ERC formation (26, 32), by slowing the replication of ERCs that have already formed, or by reducing the bias in the segregation of these plasmids for mother cells (5).DSBs in aging
a general mechanism?
Our results argue that DNA
damage, probably DSBs, occurs throughout the genome of a wild-type
yeast cell during its life span and is normally repaired efficiently
through homologous recombination. Two lines of evidence suggest that
yeast rDNA is particularly prone to DSBs. First, the continuous
activity of topoisomerases, perhaps along with Sgs1p, is required for
the transcription of rDNA (79), and for the maintenance of
stability of the rDNA repeats in the genome (16, 17, 30,
47). These findings suggest that a high rate of rDNA
transcription may pose unusual topological problems. Second, yeast
cells accumulate arrested replication forks at rDNA (12,
13), which in E. coli are known to generate DSBs
(59, 80). Concordantly, mutation in the FOB1 gene
(48, 49, 53), which is required for replication fork blocking and HOT1 recombination activities, extends the life span of
mother cells (20).
| |
ACKNOWLEDGMENTS |
|---|
P. U. Park and P.-A. Defossez contributed equally to this work.
We thank David Sinclair, Kevin Mills, Brad Johnson, David McNabb, and members of the Guarente laboratory for advice and stimulating discussions. Anna Lau, Steve Bell, David Sinclair, Jasper Rine, James Broach, Pam Silver, Sally Pak, and Mitch McVey generously provided plasmids. Many thanks go to Ed Hurt and Kevin Mills for antibodies. We also thank Glenn Paradis and Michael Jennings for technical assistance in FACS analysis and the Kaiser lab for the use of their Axioscope. P.U.P. thanks Y. S. Park for support. P.-A.D. thanks Guillaume Adelmant and Ezra Aksoy for advice and support.
P.U.P. is supported by the National Science Foundation Predoctoral Fellowship, and P.-A.D. is supported by INSERM. The Guarente lab is supported by National Institutes of Health grant AG11119.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology, Room 68-280, 77 Massachusetts Ave., Cambridge, MA 02139. Phone: (617) 253-0809. Fax: (617) 253-8699. E-mail: leng{at}mit.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Aboussekhra, A., and R. D. Wood. 1994. Repair of UV-damaged DNA by mammalian cells and Saccharomyces cerevisiae. Curr. Opin. Genet. Dev. 4:212-220[Medline]. |
| 2. | Aguilera, A. 1995. Genetic evidence for different RAD52-dependent intrachromosomal recombination pathways in Saccharomyces cerevisiae. Curr. Genet. 27:298-305[Medline]. |
| 3. |
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545 |
| 4. |
Allen, J. B.,
Z. Zhou,
W. Siede,
E. C. Friedberg, and S. J. Elledge.
1994.
The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast.
Genes Dev.
8:2401-2415 |
| 5. | Ansari, A., and M. R. Gartenberg. 1997. The yeast silent information regulator Sir4p anchors and partitions plasmids. Mol. Cell. Biol. 17:7061-7068[Abstract]. |
| 6. | Bai, Y., and L. S. Symington. 1996. A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 16:4832-4841. |
| 7. |
Baudin, A.,
O. Ozier-Kalogeropoulos,
A. Denouel,
F. Lacroute, and C. Cullin.
1993.
A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:3329-3330 |
| 8. | Baumann, P., and S. C. West. 1998. Role of the human RAD51 protein in homologous recombination and double-stranded-break repair. Trends Biochem. Sci. 23:247-251[Medline]. |
| 9. |
Becker, D. M.,
J. D. Fikes, and L. Guarente.
1991.
A cDNA encoding a human CCAAT-binding protein cloned by functional complementation in yeast.
Proc. Natl. Acad. Sci. USA
88:1968-1972 |
| 10. | Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline]. |
| 11. | Boulton, S. J., and S. P. Jackson. 1998. Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J. 17:1819-1828[Medline]. |
| 12. | Brewer, B. J., and W. L. Fangman. 1988. A replication fork barrier at the 3' end of yeast ribosomal RNA genes. Cell 55:637-643[Medline]. |
| 13. | Brewer, B. J., D. Lockshon, and W. L. Fangman. 1992. The arrest of replication forks in the rDNA of yeast occurs independently of transcription. Cell 71:267-276[Medline]. |
| 14. |
Bryk, M.,
M. Banerjee,
M. Murphy,
K. E. Knudsen,
D. J. Garfinkel, and M. J. Curcio.
1997.
Transcriptional silencing of Ty1 elements in the RDN1 locus of yeast.
Genes Dev.
11:255-269 |
| 15. | Carter, E. A., F. E. Paul, and P. A. Hunter. 1993. Cytometric evaluation of antifungal agents, p. 111-120. In D. Lloyd (ed.), Flow cytometry in microbiology. Springer-Verlag, London, United Kingdom. |
| 16. | Christman, M. F., F. S. Dietrich, and G. R. Fink. 1988. Mitotic recombination in the rDNA of S. cerevisiae is suppressed by the combined action of DNA topoisomerases I and II. Cell 55:413-425[Medline]. |
| 17. |
Christman, M. F.,
F. S. Dietrich,
N. A. Levin,
B. U. Sadoff, and G. R. Fink.
1993.
The rRNA-encoding DNA array has an altered structure in topoisomerase I mutants of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
90:7637-7641 |
| 18. | Deere, D., J. Shen, G. Vesey, P. Bell, P. Bissinger, and D. Veal. 1998. Flow cytometry and cell sorting for yeast viability assessment and cell selection. Yeast 14:147-160[Medline]. |
| 19. | Defossez, P.-A., P. U. Park, and L. Guarente. 1998. Vicious circles: a mechanism of yeast aging. Curr. Opin. Microbiol. 1:707-711. [Medline] |
| 20. | Defossez, P.-A., R. Prusty, S. Lin, M. Kaeberlein, R. Keil, and L. Guarente. Mol. Cell, in press. |
| 21. |
Egilmez, N. K., and S. M. Jazwinski.
1989.
Evidence for the involvement of a cytoplasmic factor in the aging of the yeast Saccharomyces cerevisiae.
J. Bacteriol.
171:37-42 |
| 22. | Ellis, N. A., J. Groden, T. Z. Ye, J. Straughen, D. J. Lennon, S. Ciocci, M. Proytcheva, and J. German. 1995. The Bloom's syndrome gene product is homologous to RecQ helicases. Cell 83:655-666[Medline]. |
| 23. | Epstein, C. J., G. M. Martin, A. L. Schultz, and A. G. Motulsky. 1966. Werner's syndrome: a review of its symptomatology, natural history, pathologic features, genetics and relationship to the natural aging process. Medicine 45:177-221[Medline]. |
| 24. | Finch, C. 1990. Longevity, senescence, and the genome. The University of Chicago Press, Chicago, Ill. |
| 25. |
Fishman-Lobell, J., and J. E. Haber.
1992.
Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.
Science
258:480-484 |
| 26. | Fritze, C. E., K. Verschueren, R. Strich, and R. E. Esposito. 1997. Direct evidence for SIR2 modulation of chromatin structure in yeast rDNA. EMBO J. 16:6495-6509[Medline]. |
| 27. |
Fukuchi, K.,
G. M. Martin, and R. J. Monnat, Jr.
1989.
Mutator phenotype of Werner syndrome is characterized by extensive deletions.
Proc. Natl. Acad. Sci. USA
86:5893-5897 |
| 28. | Fukuchi, K., K. Tanaka, Y. Kumahara, K. Marumo, M. B. Pride, G. M. Martin, and R. J. Monnat, Jr. 1990. Increased frequency of 6-thioguanine-resistant peripheral blood lymphocytes in Werner syndrome patients. Hum. Genet. 84:249-252[Medline]. |
| 29. | Game, J. C. 1993. DNA double-strand breaks and the RAD50-RAD57 genes in Saccharomyces. Semin. Cancer Biol. 4:73-83[Medline]. |
| 30. |
Gangloff, S.,
J. P. McDonald,
C. Bendixen,
L. Arthur, and R. Rothstein.
1994.
The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase.
Mol. Cell. Biol.
14:8391-8398 |
| 31. | Gotta, M., S. Strahl-Bolsinger, H. Renauld, T. Laroche, B. K. Kennedy, M. Grunstein, and S. M. Gasser. 1997. Localization of Sir2p: the nucleolus as a compartment for silent information regulators. EMBO J. 16:3243-3255[Medline]. |
| 32. | Gottlieb, S., and R. E. Esposito. 1989. A new role for a yeast transcriptional silencer gene, SIR2, in regulation of recombination in ribosomal DNA. Cell 56:771-776[Medline]. |
| 33. | Gray, M. D., J. C. Shen, A. S. Kamath-Loeb, A. Blank, B. L. Sopher, G. M. Martin, J. Oshima, and L. A. Loeb. 1997. The Werner syndrome protein is a DNA helicase. Nat. Genet. 17:100-103[Medline]. |
| 34. | Gray, M. D., L. Wang, H. Youssoufian, G. M. Martin, and J. Oshima. 1998. Werner helicase is localized to transcriptionally active nucleoli of cycling cells. Exp. Cell Res. 242:487-494[Medline]. |
| 35. | Grunstein, M. 1997. Molecular model for telomeric heterochromatin in yeast. Curr. Opin. Cell Biol. 9:383-387[Medline]. |
| 36. | Haber, J. E. 1995. In vivo biochemistry: physical monitoring of recombination induced by site-specific endonucleases. Bioessays 17:609-620[Medline]. |
| 37. |
Huang, S.,
L. Baomin,
M. D. Gray,
J. Oshima,
I. S. Mian, and J. Campisi.
1998.
The premature ageing syndrome protein, WRN, is a 3'5' exonuclease.
Nat. Genet.
20:114-116[Medline].
|
| 38. | Ichihara, Y., and Y. Kurosawa. 1993. Construction of new T vectors for direct cloning of PCR products. Gene 130:153-154[Medline]. |
| 39. | Ivanov, E. L., and J. E. Haber. 1995. RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:2245-2251[Abstract]. |
| 40. | Ivanov, E. L., N. Sugawara, J. Fishman-Lobell, and J. E. Haber. 1996. Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae. Genetics 142:693-704[Abstract]. |
| 41. |
Ivanov, E. L.,
N. Sugawara,
C. I. White,
F. Fabre, and J. E. Haber.
1994.
Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:3414-3425 |
| 42. | Johnson, R. D., and L. S. Symington. 1995. Functional differences and interactions among the putative RecA homologs Rad51, Rad55, and Rad57. Mol. Cell. Biol. 15:4843-4850[Abstract]. |
| 43. | Kahana, J. A., and P. A. Silver. 1996. Use of the A. victoria green fluorescent protein to study protein dynamics in vivo, p. 9.7.22-9.7.28. In F. M. Ausubel, R. Brent, R. E. Kingston, D. E. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 44. |
Kennedy, B. K.,
N. R. Austriaco, Jr., and L. Guarente.
1994.
Daughter cells of Saccharomyces cerevisiae from old mothers display a reduced life span.
J. Cell Biol.
127:1985-1993 |
| 45. | Kennedy, B. K., N. R. Austriaco, Jr., J. Zhang, and L. Guarente. 1995. Mutation in the silencing gene SIR4 can delay aging in S. cerevisiae. Cell 80:485-496[Medline]. |
| 46. | Kennedy, B. K., M. Gotta, D. A. Sinclair, K. Mills, D. S. McNabb, M. Murthy, S. M. Pak, T. Laroche, S. M. Gasser, and L. Guarente. 1997. Redistribution of silencing proteins from telomeres to the nucleolus is associated with extension of life span in S. cerevisiae. Cell 89:381-391[Medline]. |
| 47. | Kim, R. A., and J. C. Wang. 1989. A subthreshold level of DNA topoisomerases leads to the excision of yeast rDNA as extrachromosomal rings. Cell 57:975-985[Medline]. |
| 48. |
Kobayashi, T.,
D. J. Heck,
M. Nomura, and T. Horiuchi.
1998.
Expansion and contraction of ribosomal DNA repeats in Saccharomyces cerevisiae: requirement of replication fork blocking (Fob1) protein and the role of RNA polymerase I.
Genes Dev.
12:3821-3830 |
| 49. | Kobayashi, T., and T. Horiuchi. 1996. A yeast gene product, Fob1 protein, required for both replication fork blocking and recombinational hotspot activities. Genes Cells 1:465-474[Abstract]. |
| 50. |
Kowalczykowski, S. C.,
D. A. Dixon,
A. K. Eggleston,
S. D. Lauder, and W. M. Rehrauer.
1994.
Biochemistry of homologous recombination in Escherichia coli.
Microbiol. Rev.
58:401-465 |
| 51. | Lee, S. E., J. K. Moore, A. Holmes, K. Umezu, R. D. Kolodner, and J. E. Haber. 1998. Saccharomyces Ku70, mre11/rad50 and RPA proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94:399-409[Medline]. |
| 52. |
Liang, F.,
M. Han,
P. J. Romanienko, and M. Jasin.
1998.
Homology-directed repair is a major double-strand break repair pathway in mammalian cells.
Proc. Natl. Acad. Sci. USA
95:5172-5177 |
| 53. | Lin, Y. H., and R. L. Keil. 1991. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast. Genetics 127:31-38[Abstract]. |
| 54. | Loo, S., and J. Rine. 1995. Silencing and heritable domains of gene expression. Annu. Rev. Cell Dev. Biol. 11:519-548[Medline]. |
| 55. |
Mahoney, D. J., and J. R. Broach.
1989.
The HML mating-type cassette of Saccharomyces cerevisiae is regulated by two separate but functionally equivalent silencers.
Mol. Cell. Biol.
9:4621-4630 |
| 56. |
Malone, R. E., and R. E. Esposito.
1981.
Recombinationless meiosis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
1:891-901 |
| 57. | Malone, R. E., T. Ward, S. Lin, and J. Waring. 1990. The RAD50 gene, a member of the double strand break repair epistasis group, is not required for spontaneous mitotic recombination in yeast. Curr. Genet. 18:111-116[Medline]. |
| 58. |
Marciniak, R. A.,
D. B. Lombard,
F. B. Johnson, and L. Guarente.
1998.
Nucleolar localization of the Werner syndrome protein in human cells.
Proc. Natl. Acad. Sci. USA
95:6887-6892 |
| 59. | Michel, B., S. D. Ehrlich, and M. Uzest. 1997. DNA double-strand breaks caused by replication arrest. EMBO J. 16:430-438[Medline]. |
| 60. | Miller, R. D., L. Prakash, and S. Prakash. 1982. Defective excision of pyrimidine dimers and interstrand DNA crosslinks in rad7 and rad23 mutants of Saccharomyces cerevisiae. Mol. Gen. Genet. 188:235-239[Medline]. |
| 60a. | Mills, K., and L. Guarente. Unpublished reagent. |
| 61. | Mills, K., D. A. Sinclair, and L. Guarente. Unpublished data. |
| 62. |
Moore, J. K., and J. E. Haber.
1996.
Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.
Genes Dev.
10:1310-1326 |
| 63. |
Mortimer, R. K.,
R. Contopoulou, and D. Schild.
1981.
Mitotic chromosome loss in a radiation-sensitive strain of the yeast Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
78:5778-5782 |
| 64. | Mortimer, R. K., and J. R. Johnston. 1959. Life span of individual yeast cells. Nature 183:1751-1752[Medline]. |
| 65. | Müller, I. 1971. Experiments on ageing in single cells of Saccharomyces cerevisiae. Arch. Mikrobiol. 77:20-25[Medline]. |
| 66. | Müller, I. 1985. Parental age and the life-span of zygotes of Saccharomyces cerevisiae. Antonie Leeuwenhoek 51:1-10[Medline]. |
| 67. | Murray, A. W., and J. W. Szostak. 1983. Pedigree analysis of plasmid segregation in yeast. Cell 34:961-970[Medline]. |
| 68. | Nakayama, K., N. Irino, and H. Nakayama. 1985. The recQ gene of Escherichia coli K12: molecular cloning and isolation of insertion mutants. Mol. Gen. Genet. 200:266-271[Medline]. |
| 69. | Nugent, C. I., G. Bosco, L. O. Ross, S. K. Evans, A. P. Salinger, J. K. Moore, J. E. Haber, and V. Lundblad. 1998. Telomere maintenance is dependent on activities required for end repair of double-strand breaks. Curr. Biol. 8:657-660[Medline]. |
| 70. |
Ozenberger, B. A., and G. S. Roeder.
1991.
A unique pathway of double-strand break repair operates in tandemly repeated genes.
Mol. Cell. Biol.
11:1222-1231 |
| 71. | Petes, T. D., R. E. Malone, and L. S. Symington. 1991. Recombination in yeast, p. 407-521. In J. Broach, J. Pringle, and E. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces, vol. 1. Genome dynamics, protein synthesis and energetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 72. | Prakash, S., P. Sung, and L. Prakash. 1993. DNA repair genes and proteins of Saccharomyces cerevisiae. Annu. Rev. Genet. 27:33-70[Medline]. |
| 73. |
Puranam, K. L., and P. J. Blackshear.
1994.
Cloning and characterization of RECQL, a potential human homologue of the Escherichia coli DNA helicase RecQ.
J. Biol. Chem.
269:29838-29845 |
| 74. | Rattray, A. J., and L. S. Symington. 1995. Multiple pathways for homologous recombination in Saccharomyces cerevisiae. Genetics 139:57-66[Abstract]. |
| 75. | Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-301[Medline]. |
| 76. | Salk, D. 1982. Werner's syndrome: a review of recent research with an analysis of connective tissue metabolism, growth control of cultured cells, and chromosomal aberrations. Hum. Genet. 62:1-5[Medline]. |
| 77. | Sandell, L. L., and V. A. Zakian. 1993. Loss of a yeast telomere: arrest, recovery, and chromosome loss. Cell 75:729-739[Medline]. |
| 78. | Sargent, R. G., M. A. Brenneman, and J. H. Wilson. 1997. Repair of site-specific double-strand breaks in a mammalian chromosome by homologous and illegitimate recombination. Mol. Cell. Biol. 17:267-277[Abstract]. |
| 79. |
Schultz, M. C.,
S. J. Brill,
Q. Ju,
R. Sternglanz, and R. H. Reeder.
1992.
Topoisomerases and yeast rRNA transcription: negative supercoiling stimulates initiation and topoisomerase activity is required for elongation.
Genes Dev.
6:1332-1341 |
| 80. | Seigneur, M., V. Bidnenko, S. D. Ehrlich, and B. Michel. 1998. RuvAB acts at arrested replication forks. Cell 95:419-430[Medline]. |
| 81. |
Shen, J. C.,
M. D. Gray,
J. Oshima, and L. A. Loeb.
1998.
Characterization of Werner syndrome protein DNA helicase activity: directionality, substrate dependence and stimulation by replication protein A.
Nucleic Acids Res.
26:2879-2885 |
| 82. | Sherman, F., G. Fink, and J. Hicks. 1986. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 83. | Shinohara, A., and T. Ogawa. 1995. Homologous recombination and the roles of double-strand breaks. Trends Biochem. Sci. 20:387-391[Medline]. |
| 84. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 85. |
Sinclair, D. A., and L. Guarente.
1997.
Extrachromosomal rDNA circlesa cause of aging in yeast.
Cell
91:1033-1042[Medline].
|
| 86. |
Sinclair, D. A.,
K. Mills, and L. Guarente.
1997.
Accelerated aging and nucleolar fragmentation in yeast sgs1 mutants.
Science
277:1313-1316 |
| 87. | Smeal, T., J. Claus, B. Kennedy, F. Cole, and L. Guarente. 1996. Loss of transcriptional silencing causes sterility in old mother cells of S. cerevisiae. Cell 84:633-642[Medline]. |
| 88. |
Smith, J. S., and J. D. Boeke.
1997.
An unusual form of transcriptional silencing in yeast ribosomal DNA.
Genes Dev.
11:241-254 |
| 89. | Stewart, E., C. R. Chapman, F. Al-Khodairy, A. M. Carr, and T. Enoch. 1997. rqh1+, a fission yeast gene related to the Bloom's and Werner's syndrome genes, is required for reversible S phase arrest. EMBO J. 16:2682-2692[Medline]. |
| 90. |
Sung, P.
1997.
Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase.
Genes Dev.
11:1111-1121 |
| 91. | Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl. 1983. The double-strand-break repair model for recombination. Cell 33:25-35[Medline]. |
| 92. | Takata, M., M. S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, and S. Takeda. 1998. Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J. 17:5497-5508[Medline]. |
| 93. | Tsukamoto, Y., J. Kato, and H. Ikeda. 1997. Silencing factors participate in DNA repair and recombination in Saccharomyces cerevisiae. Nature 388:900-903[Medline]. |
| 94. | van Gool, A. J., R. Verhage, S. M. Swagemakers, P. van de Putte, J. Brouwer, C. Troelstra, D. Bootsma, and J. H. Hoeijmakers. 1994. RAD26, the functional S. cerevisiae homolog of the Cockayne syndrome B gene ERCC6. EMBO J. 13:5361-5369[Medline]. |
| 95. | Watt, P. M., I. D. Hickson, R. H. Borts, and E. J. Louis. 1996. SGS1, a homologue of the Bloom's and Werner's syndrome genes, is required for maintenance of genome stability in Saccharomyces cerevisiae. Genetics 144:935-945[Abstract]. |
| 96. | Watt, P. M., E. J. Louis, R. H. Borts, and I. D. Hickson. 1995. Sgs1: a eukaryotic homolog of E. coli RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation. Cell 81:253-260[Medline]. |
| 97. |
Yamagata, K.,
J. Kato,
A. Shimamoto,
M. Goto,
Y. Furuichi, and H. Ikeda.
1998.
Bloom's and Werner's syndrome genes suppress hyperrecombination in yeast sgs1 mutant: implication for genomic instability in human diseases.
Proc. Natl. Acad. Sci. USA
95:8733-8738 |
| 98. | Yan, H., C. Y. Chen, R. Kobayashi, and J. Newport. 1998. Replication focus-forming activity 1 and the Werner syndrome gene product. Nat. Genet. 19:375-378[Medline]. |
| 99. | Yu, C. E., J. Oshima, Y. H. Fu, E. M. Wijsman, F. Hisama, R. Alisch, S. Matthews, J. Nakura, T. Miki, S. Ouais, G. M. Martin, J. Mulligan, and G. D. Schellenberg. 1996. Positional cloning of the Werner's syndrome gene. Science 272:258-262[Abstract]. |
| 100. | Zou, H., and R. Rothstein. 1997. Holliday junctions accumulate in replication mutants via a RecA homolog-independent mechanism. Cell 90:87-96[Medline]. |
Molecular and Cellular Biology, May 1999, p. 3848-3856, Vol. 19, No. 5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tsang, C. K., Zheng, X. F. S.
(2009). Opposing Role of Condensin and Radiation-sensitive Gene RAD52 in Ribosomal DNA Stability Regulation. J. Biol. Chem.
284: 21908-21919
[Abstract] [Full Text] -
Richard, G.-F., Kerrest, A., Dujon, B.
(2008). Comparative Genomics and Molecular Dynamics of DNA Repeats in Eukaryotes. Microbiol. Mol. Biol. Rev.
72: 686-727
[Abstract] [Full Text] -
Laun, P., Bruschi, C. V., Richard Dickinson, J., Rinnerthaler, M., Heeren, G., Schwimbersky, R., Rid, R., Breitenbach, M.
(2007). Yeast mother cell-specific ageing, genetic (in)stability, and the somatic mutation theory of ageing. Nucleic Acids Res
0: gkm919v2-gkm919
[Abstract] [Full Text] -
Grenetier, S., Bouchoux, C., Goguel, V.
(2006). CTD kinase I is required for the integrity of the rDNA tandem array. Nucleic Acids Res
34: 4996-5006
[Abstract] [Full Text] -
Coulon, S., Noguchi, E., Noguchi, C., Du, L.-L., Nakamura, T. M., Russell, P.
(2006). Rad22Rad52-dependent Repair of Ribosomal DNA Repeats Cleaved by Slx1-Slx4 Endonuclease. Mol. Biol. Cell
17: 2081-2090
[Abstract] [Full Text] -
Azam, M., Lee, J. Y., Abraham, V., Chanoux, R., Schoenly, K. A., Johnson, F. B.
(2006). Evidence that the S.cerevisiae Sgs1 protein facilitates recombinational repair of telomeres during senescence. Nucleic Acids Res
34: 506-516
[Abstract] [Full Text] -
Calzada, A., Hodgson, B., Kanemaki, M., Bueno, A., Labib, K.
(2005). Molecular anatomy and regulation of a stable replisome at a paused eukaryotic DNA replication fork. Genes Dev.
19: 1905-1919
[Abstract] [Full Text] -
Michel, A. H., Kornmann, B., Dubrana, K., Shore, D.
(2005). Spontaneous rDNA copy number variation modulates Sir2 levels and epigenetic gene silencing. Genes Dev.
19: 1199-1210
[Abstract] [Full Text] -
Kaeberlein, M., McDonagh, T., Heltweg, B., Hixon, J., Westman, E. A., Caldwell, S. D., Napper, A., Curtis, R., DiStefano, P. S., Fields, S., Bedalov, A., Kennedy, B. K.
(2005). Substrate-specific Activation of Sirtuins by Resveratrol. J. Biol. Chem.
280: 17038-17045
[Abstract] [Full Text] -
Kaeberlein, M., Andalis, A. A., Liszt, G. B., Fink, G. R., Guarente, L.
(2004). Saccharomyces cerevisiae SSD1-V Confers Longevity by a Sir2p-Independent Mechanism. Genetics
166: 1661-1672
[Abstract] [Full Text] -
Torres, J. Z., Bessler, J. B., Zakian, V. A.
(2004). Local chromatin structure at the ribosomal DNA causes replication fork pausing and genome instability in the absence of the S. cerevisiae DNA helicase Rrm3p. Genes Dev.
18: 498-503
[Abstract] [Full Text] -
Borghouts, C., Benguria, A., Wawryn, J., Jazwinski, S. M.
(2004). Rtg2 Protein Links Metabolism and Genome Stability in Yeast Longevity. Genetics
166: 765-777
[Abstract] [Full Text] -
Lin, S.-J., Ford, E., Haigis, M., Liszt, G., Guarente, L.
(2004). Calorie restriction extends yeast life span by lowering the level of NADH. Genes Dev.
18: 12-16
[Abstract] [Full Text] -
Coulon, S., Gaillard, P.-H. L., Chahwan, C., McDonald, W. H., Yates, J. R. III, Russell, P.
(2004). Slx1-Slx4 Are Subunits of a Structure-specific Endonuclease That Maintains Ribosomal DNA in Fission Yeast. Mol. Biol. Cell
15: 71-80
[Abstract] [Full Text] -
Falcon, A. A., Aris, J. P.
(2003). Plasmid Accumulation Reduces Life Span in Saccharomyces cerevisiae. J. Biol. Chem.
278: 41607-41617
[Abstract] [Full Text] -
Bitterman, K. J., Medvedik, O., Sinclair, D. A.
(2003). Longevity Regulation in Saccharomyces cerevisiae: Linking Metabolism, Genome Stability, and Heterochromatin. Microbiol. Mol. Biol. Rev.
67: 376-399
[Abstract] [Full Text] -
Cohen, S., Yacobi, K., Segal, D.
(2003). Extrachromosomal Circular DNA of Tandemly Repeated Genomic Sequences in Drosophila. Genome Res
13: 1133-1145
[Abstract] [Full Text] -
Ayyadevara, S., Ayyadevara, R., Vertino, A., Galecki, A., Thaden, J. J., Reis, R. J. S.
(2003). Genetic Loci Modulating Fitness and Life Span in Caenorhabditis elegans: Categorical Trait Interval Mapping in CL2a x Bergerac-BO Recombinant-Inbred Worms. Genetics
163: 557-570
[Abstract] [Full Text] -
Kaeberlein, M., Andalis, A. A., Fink, G. R., Guarente, L.
(2002). High Osmolarity Extends Life Span in Saccharomyces cerevisiae by a Mechanism Related to Calorie Restriction. Mol. Cell. Biol.
22: 8056-8066
[Abstract] [Full Text] -
Bitterman, K. J., Anderson, R. M., Cohen, H. Y., Latorre-Esteves, M., Sinclair, D. A.
(2002). Inhibition of Silencing and Accelerated Aging by Nicotinamide, a Putative Negative Regulator of Yeast Sir2 and Human SIRT1. J. Biol. Chem.
277: 45099-45107
[Abstract] [Full Text] -
Ohya, T., Kawasaki, Y., Hiraga, S.-I., Kanbara, S., Nakajo, K., Nakashima, N., Suzuki, A., Sugino, A.
(2002). The DNA Polymerase Domain of polepsilon Is Required for Rapid, Efficient, and Highly Accurate Chromosomal DNA Replication, Telomere Length Maintenance, and Normal Cell Senescence in Saccharomyces cerevisiae. J. Biol. Chem.
277: 28099-28108
[Abstract] [Full Text] -
Hoopes, L. L. M., Budd, M., Choe, W., Weitao, T., Campbell, J. L.
(2002). Mutations in DNA Replication Genes Reduce Yeast Life Span. Mol. Cell. Biol.
22: 4136-4146
[Abstract] [Full Text] -
Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., Cohen, H., Lin, S. S., Manchester, J. K., Gordon, J. I., Sinclair, D. A.
(2002). Manipulation of a Nuclear NAD+ Salvage Pathway Delays Aging without Altering Steady-state NAD+ Levels. J. Biol. Chem.
277: 18881-18890
[Abstract] [Full Text] -
Lewis, L. K., Karthikeyan, G., Westmoreland, J. W., Resnick, M. A.
(2002). Differential Suppression of DNA Repair Deficiencies of Yeast rad50, mre11 and xrs2 Mutants by EXO1 and TLC1 (the RNA Component of Telomerase). Genetics
160: 49-62
[Abstract] [Full Text] -
Wai, H., Johzuka, K., Vu, L., Eliason, K., Kobayashi, T., Horiuchi, T., Nomura, M.
(2001). Yeast RNA Polymerase I Enhancer Is Dispensable for Transcription of the Chromosomal rRNA Gene and Cell Growth, and Its Apparent Transcription Enhancement from Ectopic Promoters Requires Fob1 Protein. Mol. Cell. Biol.
21: 5541-5553
[Abstract] [Full Text] -
Cohen, S., Mechali, M.
(2001). A novel cell-free system reveals a mechanism of circular DNA formation from tandem repeats. Nucleic Acids Res
29: 2542-2548
[Abstract] [Full Text] -
McVey, M., Kaeberlein, M., Tissenbaum, H. A., Guarente, L.
(2001). The Short Life Span of Saccharomyces cerevisiae sgs1 and srs2 Mutants Is a Composite of Normal Aging Processes and Mitotic Arrest Due to Defective Recombination. Genetics
157: 1531-1542
[Abstract] [Full Text] -
Tomaska, L., Nosek, J., Makhov, A. M., Pastorakova, A., Griffith, J. D.
(2000). Extragenomic double-stranded DNA circles in yeast with linear mitochondrial genomes: potential involvement in telomere maintenance. Nucleic Acids Res
28: 4479-4487
[Abstract] [Full Text] -
Kaeberlein, M., McVey, M., Guarente, L.
(1999). The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev.
13: 2570-2580
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»