Next Article 
Molecular and Cellular Biology, June 1999, p. 3931-3939, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Activity of Mammalian brm/SNF2
Is Dependent
on a High-Mobility-Group Protein I/Y-Like DNA Binding Domain
Brigitte
Bourachot,
Moshe
Yaniv,* and
Christian
Muchardt
Unité des Virus Oncogènes,
URA1644 du CNRS, Département des Biotechnologies, Institut
Pasteur, Paris, France
Received 2 December 1998/Returned for modification 13 January
1999/Accepted 26 February 1999
 |
ABSTRACT |
The mammalian SWI-SNF complex is a chromatin-remodelling machinery
involved in the modulation of gene expression. Its activity relies on
two closely related ATPases known as brm/SNF2
and BRG-1/SNF2
. These two proteins can cooperate with nuclear receptors for
transcriptional activation. In addition, they are involved in the
control of cell proliferation, most probably by facilitating
p105Rb repression of E2F transcriptional activity. In the
present study, we have examined the ability of various brm/SNF2
deletion mutants to reverse the transformed phenotype of
ras-transformed fibroblasts. Deletions within the
p105Rb LXCXE binding motif or the conserved bromodomain had
only a moderate effect. On the other hand, a 49-amino-acid segment,
rich in lysines and arginines and located immediately downstream of the
p105Rb interaction domain, appeared to be essential in this
assay. This region was also required for cooperation of brm/SNF2
with the glucocorticoid receptor in transfection experiments, but only in the context of a reporter construct integrated in the cellular genome. The region has homology to the AT hooks present in
high-mobility-group protein I/Y DNA binding domains and is required for
the tethering of brm/SNF2
to chromatin.
 |
INTRODUCTION |
The compaction of genomic DNA into
chromatin fibers forms a potent obstacle to transcription and
replication in eucaryotic cells. In recent years, the characterization
of several large multisubunit protein complexes which are able to
modify locally the structure of nucleosomes has shed light on how the
cell may regulate the accessibility of chromatin-embedded promoters.
These chromatin-remodelling complexes include the SWI-SNF complex
(18, 35), initially identified in yeast but also present in
Drosophila and in mammals; the RSC complex (6),
identified in yeast; the NURF (51, 52), CHRAC
(54), and ACF (21) complexes, characterized in
Drosophila; and finally the NRD-NuRD complexes (49, 55, 61), detected in Xenopus and mammals. While these
complexes differ in subunit composition, they all harbor one subunit
containing a helicase-like domain with DNA-dependent ATPase activity.
In each complex, this protein (SWI2-SNF2 in the SWI-SNF complex; STH1
in RSC; ISWI in NURF, CHRAC, and ACF; and CHD family members in
NRD-NuRD) is likely to be the subunit responsible for the actual nucleosome perturbation, powered by ATP hydrolysis (for reviews, see
references 5, 22, 24, 34, 53, and
58).
In the mammalian SWI-SNF complex, the ATPase activity is provided by
either brm or BRG-1. These two highly homologous proteins (more than
80% identical) are also known as SNF2
and SNF2
, respectively (8, 25, 33). Unlike other related proteins, the homology of
brm and BRG-1 to the yeast SWI2-SNF2 ATPase is not restricted to the
helicase-like domain, suggesting that they may be the functional counterparts of the yeast protein in higher eucaryotes. The two proteins have been extensively characterized in the last few years, both individually and in the context of the mammalian SWI-SNF complex.
The brm and BRG-1 proteins appear to be associated with the SWI-SNF
complex in a mutually exclusive manner. Purification of the complex
from tumor-derived cell lines failing to express the two proteins has
further shown that a partial SWI-SNF complex can still assemble in
their absence (57). During interphase, the brm and BRG-1
proteins are tightly associated with chromatin and a subfraction is
also bound to the nuclear matrix (39). At the
G2/M transition, the proteins are phosphorylated, leading first to decreased chromatin affinity and then to exclusion from the
condensed mitotic chromosomes (30, 42). Several functional assays to monitor brm and BRG-1 activity have been developed. In
transient-transfection assays, the two proteins can function as
coactivators for nuclear receptors (8, 33, 57), and a
ligand-dependent interaction between the estrogen receptor and the
mammalian SNF2 proteins has also been reported (20). The brm
or BRG-1 protein may also cooperate with members of the retinoblastoma (Rb) family of tumor suppressors to control cell growth. The
p105Rb, p107, and p130 pocket proteins all are able to
interact directly with brm or BRG-1 through an LXCXE sequence similar
to the Rb binding motif present in several viral oncogenes, including
papillomavirus E7, adenovirus E1a, and simian virus 40 large T antigen.
In addition, the brm and BRG-1 proteins, when transiently transfected
in SW13 cells, can cooperate with p105Rb to induce the
formation of flat, growth-arrested cells (12, 43, 47).
Cotransfection studies also show a cooperation between brm and
p105Rb for the repression of E2F-activated transcription
(50). Consistent with these observations, the brm protein
was found to accumulate in quiescent cells (27, 29). In
contrast, the level of this protein is down-regulated upon serum
stimulation or transformation by an activated ras oncogene.
Reexpression of brm in ras-transformed cells leads to a
partial reversion of the transformed phenotype (29).
A mutation in the ATP binding site of the helicase-like domain of brm
(ATPmut) strongly impairs the ability of the protein to revert the
phenotype of ras-transformed fibroblasts, and it is clear
that the helicase-like domain plays a central role in the activity of
brm. However, other protein motifs have been identified in brm,
including a bromodomain (16, 23) located in the C-terminal region. To determine if sequences outside the helicase-like domain were
important for brm to affect cell growth, we examined the growth
properties of ras-transformed NIH 3T3 cells expressing different mutant brm proteins. The mutations affected either the bromodomain, the LXCXE Rb binding sequence (referred to here as the E7
homology region), or a short C-terminal region characterized by a high
lysine and arginine content (hereafter called the KR region).
Surprisingly, this latter region appeared to be the most important for
the activity of brm in our assay. Transfection experiments with a cell
line carrying an integrated mouse mammary tumor virus (MMTV)
chloramphenicol acetyltransferase (CAT) reporter construct further
showed that in the context of chromatin, deletion of this region
prevented cooperative transcriptional activation by brm and the
glucocorticoid receptor (GR). Biochemical studies revealed that the KR
region had DNA binding activity and that deletion of this region
decreased the affinity of brm for chromatin.
 |
MATERIALS AND METHODS |
Cell culture and preparation of stable cell lines.
C33A, NIH
3T3, DT, and DT-derived cell lines were maintained at 37°C under 7%
CO2 in Dulbecco's modified Eagle's medium (Sigma) supplemented with 7% fetal calf serum unless otherwise indicated. Stable cell lines were established in DT or C33A cells as previously described (29, 36).
Plasmid constructs.
The T7-CMV-GR and the MMTV-CAT reporter
constructs have been described previously (7, 14). Wild-type
(WT) and mutant human brm (hbrm) constructs were inserted as
EcoRI fragments downstream of the Moloney murine leukemia
virus long terminal repeat (LTR) of pVLMPN1 (28) for stable
expression as hemagglutinin (HA)-tagged proteins. The WT, ATPmut, and
Cter(1337) hbrm inserts have been described previously (29, 31,
33). The
E7,
KR, and
Bromo expression constructs were
derived from WT hbrm and contain deletions from amino acids (aa) 1264 to 1337, 1342 to 1400, and 1401 to 1463, respectively. The
Cter(1393) construct carries an out-of-frame mutation in codon 1394. The WT glutathione S-transferase (GST)-hbrm fusion was
constructed by inserting a PCR fragment encoding the C-terminal end of
the protein starting from aa 1188 into pGEX2T (Pharmacia). The GST-hbrm
deletion mutants were generated in a similar way with the
above-described deletion mutants as templates for the PCRs. The DGD
point mutation was introduced into the GST-hbrm expression construct by
using the QuikChange site-directed mutagenesis kit from Stratagene. All
constructs containing PCR products were verified by DNA sequencing.
Transient-transfection assays.
Transient transfections were
performed as described previously (33), with 50 ng of the GR
expression vector and 3 µg of expression vector containing the
hbrm-derived constructs. When the GR expression vector was used, the
cells were treated with 10
6 M dexamethasone.
Cellular fractionation and immunoblotting.
Chromatin
fractionation and high-salt isolation of the nuclear matrix were
performed as described previously (39). The volume of each
fraction was adjusted to 300 µl, and an equal volume of each fraction
was used for analysis by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) (6% polyacrylamide). Immunoblotting was
carried out by standard procedures (39) with the purified polyclonal rabbit anti-hbrm or anti-BRG-1 antibodies (30).
Enhanced chemiluminescence reagents were used for detection.
Electrophoretic mobility shift assays (EMSAs).
GST fusion
proteins were expressed in Escherichia coli BL21 and
purified essentially as described previously (32), except that washes and elution were performed in A250 buffer (25 mM Tris [pH
7.5], 15 mM MgCl2, 15 mM EGTA, 10% glycerol, 0.3% Triton
X-100, 250 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride). Mobility shift assays were performed in binding buffer (25 mM HEPES [pH 7.9], 2 mM MgCl2, 0.1 mM ZnCl, 40 mM KCl, 1 mM dithiothreitol, 0.25% milk) in the presence of ~1 µg of fusion
protein and 100,000 cpm of 32P-labelled probe. The
337-nucleotide fragment of genomic Drosophila was amplified
from the SNR-1 gene with oligonucleotides
GCGGATCCTCGCTCGTCGACCAGGTC and
CAGAATTCAGTTGTGGTATTGGCCAGTC. The 0AT, 10AT, and 24AT
oligonucleotides had the sequences
GATCCGAGTCGCGCTGCAGCTCGCTCGTCGCA,
GATCCGAGTCGCATATATATATGCTCGTCGCA, and
GATCCATATATATATATATATATATATATGCA, respectively. When
indicated, distamycin A (2 µM) or double-stranded poly(dA-dT) or
poly(dG-dC) (300 ng) was added to the reaction mixtures. Samples were
loaded on a 5% polyacrylamide gel in 0.25× Tris-borate-EDTA (TBE).
 |
RESULTS |
The C-terminal region of brm is necessary for reversion of
ras transformation in mouse fibroblasts.
In a recent
study, we showed that NIH 3T3 cells express easily detectable levels of
both brm and BRG-1. On the other hand, NIH 3T3 cells transformed with
an activated Ki-ras gene (DT cells) contain normal levels of
BRG-1 but no detectable brm. Reintroduction of a cDNA encoding hbrm
into DT cell leads to partial reversion of the transformed phenotype
and prevents the cells from forming colonies in soft agar. A point
mutation in the ATP binding site of hbrm (ATPmut) (Fig.
1A, line 2) abolishes the effect of hbrm on DT cell growth (29). To allow comparison, these results
are included in Fig. 1D (compare the plating efficiencies of DT, DT21, A2, and A26). To investigate the role of regions other than the helicase-like domain, we transfected other mutant hbrm cDNAs into DT
cells and isolated clones stably expressing the encoded proteins. Like
WT hbrm, a protein deleted in the pRb binding LXCXE motif (
E7) (Fig.
1A, line 3, and Fig. 1B, lanes 2 and 3) led to decreased ability of DT
cells to grow in soft agar. However, the effect was not as pronounced
as in cells expressing the wild-type protein (Fig. 1D, compare DT21,
E4, and E7), indicating that the
E7 mutant was moderately impaired
in its ability to revert the transformed phenotype of DT cells.
Deletion of the last 232 aa of hbrm [
Cter(1337)] (Fig. 1A, line 4)
had a more drastic effect. Of the three tested cell lines expressing
this construct (Fig. 1C, lanes 3 to 5), two had plating efficiencies in
soft agar similar to that of the original DT cells (Fig. 1D, C15 and
C27). The third cell line was still eightfold more efficient in this
assay than was the cell line expressing WT hbrm (Fig. 1D, C37). The
expression level of the hbrm construct was higher in clones C15 and C27
than in clone C37. It was also moderately higher than in clones DT21
and A2, which express WT hbrm and ATPmut, respectively (Fig. 1C). Interestingly, the plating efficiencies for clones C15 and C27 were
higher than for clone C37, suggesting that expression of
Cter may
favor rather than inhibit colony formation (compare the expression
levels and plating efficiencies of C27 and C37 in Fig. 1C and D). An
hbrm-derived construct with a deletion in the N-terminal part (aa 69 to
686 deleted) was also transfected into DT cells. However, we were
unable to identify clones stably expressing this construct, suggesting
that it may be toxic for normal cell proliferation.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
The C-terminal region of brm is required for reversion
of the ras-induced transformed phenotype of DT cells. (A)
Schematic representation of the various hbrm-derived constructs
expressed in DT cells. The solid box represents the HA tag. (B and C)
Extracts from DT-derived cell lines expressing either E7 (clones E4
and E7) (B) or Cter(1337) (clones C15, C27, and C37) (C) were
resolved by SDS-PAGE and analyzed by Western blotting with anti-hbrm
antibodies. To allow comparison, panels B and C show levels of brm in
the parental DT cells as well as in DT21 and A2 cells, which express WT
hbrm and ATPmut, respectively. (D) Growth in soft agar. Parental DT
cells or DT cells expressing either WT hbrm, ATPmut, E7, or
Cter(1337) were plated in 60-mm dishes (102 or
103 cells per dish). The total number of visible colonies
was scored after 15 days in culture and compared to the total number of
cells initially seeded (plating efficiency, expressed as a percentage).
The results shown here are averages and standard deviations from three
independent experiments.
|
|
A region rich in arginine and lysine residues is required for hbrm
activity.
The observations described above indicate that the
C-terminal part of hbrm is critical for the activity of this protein.
The region deleted in the
Cter(1337) construct encompasses at least two sequences of potential interest: the bromodomain and a short sequence rich in arginines and lysines (the KR region), located between
the LXCXE motif and the bromodomain. To determine if either of these
two regions was responsible for the loss of activity observed upon
deletion of the C-terminal region of hbrm, we established two sets of
DT-derived clones, one expressing an hbrm protein with aa 1342 to 1400 deleted and missing the KR region and one expressing an hbrm protein
with aa 1401 to 1463 deleted and lacking helices A and B of the
canonical bromodomain (
KR and
Bromo respectively, Fig.
2A and B). These clones were assayed for
growth in soft agar. The
Bromo clones showed a plating efficiency
twofold higher than the reference clone expressing WT hbrm (Fig. 2C,
BR3 and BR4). The plating efficiencies of the
KR clones were five-
to eightfold higher than that of the reference clone but still did not
reach the plating efficiency of the original DT cells (Fig. 2C, KR13 and KR19). To allow comparison of the levels of expression of the
different mutant proteins, we included in the Western blot in Fig. 2B
three lanes previously shown in Fig. 1B or C. Taken together, the data
presented in Fig. 2C suggest that the function of the C-terminal region
of hbrm should be attributed to more than one protein domain. They also
define the KR region as a novel hbrm sequence necessary for reversion
of the transformed phenotype induced by ras.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Reversion of the ras-transformed phenotype by
exogenous hbrm is dependent on the KR region. (A) Schematic
representations of the C-terminal region of either WT hbrm (line 1),
KR (line 2), or Bromo (line 3). In all constructs, the N-terminal
region that is not shown is WT. (B) Extracts from DT-derived cell lines
expressing either Bromo or KR were resolved by SDS-PAGE and
analyzed by Western blotting with anti-hbrm antibodies. To allow
comparison, expression levels in NIH 3T3 cells as well as in A2, E4,
and C15 cells, expressing ATPmut, E7, and Cter(1337),
respectively, are also shown. (C) Growth in soft agar. Parental DT
cells or DT cells expressing either WT hbrm, Bromo, or KR were
plated in 60-mm dishes (102 or 103 cells per
dish). The total number of visible colonies was scored after 15 days in
culture and compared to the total number of cells initially seeded
(plating efficiency, expressed as a percentage). The results shown here
are averages and standard deviations from three independent
experiments.
|
|
The KR region is required for transcriptional synergy between hbrm
and GR in the context of chromatin.
In transient-transfection
assays, the hbrm protein can cooperate with the GR for transcriptional
activation of the MMTV LTR or synthetic promoters containing
GR-responsive elements. We therefore wished to investigate whether the
KR region defined above was also necessary for this activity of hbrm.
In an earlier study, we showed that a reporter construct cotransfected
with hbrm and GR expression vectors is activated at least as
efficiently by the
Cter(1337) mutant as by WT hbrm in the presence
of GR (33). The KR region that is absent in the
Cter(1337) mutant therefore appeared to be unnecessary for
cooperation between hbrm and GR. Several studies have, however, shown a
clear difference in the chromatin structure of the MMTV LTR reporter
constructs when transiently transfected into cells and when stably
integrated in the cellular genome (1, 26). We hypothesized
that the absent or poorly organized chromatin present on transfected
templates rendered the KR region dispensable in the cooperation between
hbrm and GR and that an effect of this region would be visible only on stably integrated nucleosomal templates. To test this hypothesis, we
prepared a C33A-derived cell line containing an integrated MMTV LTR
upstream of a CAT reporter gene. This cell line, which expresses no
endogenous hbrm and low levels of BRG-1, was used for cotransfection
assays with a GR expression vector and several constructs expressing
hbrm mutants. The stimulation of GR activation by hbrm was
significantly lower under these conditions than in transient
transfections, essentially because all the cells contained the reporter
construct and expressed CAT mRNA at a basal level whereas only 1 to 5%
of the transfected cells expressed the reporter gene at activated
levels. This situation resulted in a large increase in the background
CAT activity in the assays and led us to repeat all the transfections
at least four times to obtain reliable results. In the absence of hbrm,
GR activated the integrated MMTV promoter about fivefold (Fig.
3, line 2). This activation was further
stimulated threefold in the presence of WT hbrm (line 3). As in the
transient transfections, this stimulation of GR activity was almost
completely abolished by a mutation in the ATP binding site of hbrm
(ATPmut) (line 4). Interestingly, under these conditions, the
Cter(1337) mutant also had low activity (line 5). On the other hand,
an hbrm construct longer by 56 aa and containing the KR region regained its activity in this assay [
Cter(1393) mutant] (line 6). The
Bromo mutant was also fully active under these conditions (data not
shown). These experiments demonstrate that the KR region is required
for transcriptional stimulation by the hbrm protein, but only in the
context of chromatin.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
The KR region is required for transcriptional synergy
between hbrm and GR in the context of chromatin. A C33A-derived cell
line containing an integrated MMTV CAT reporter construct was
transfected with the vector without the insert (line 1) or with the GR
expression vector either in the absence (line 2) or in the presence of
an expression vector for WT hbrm (line 3), ATPmut (line 4),
Cter(1337) (line 5), or Cter(1393) (line 6). The cells were
harvested 36 h posttransfection, and CAT activity was measured.
The results are shown as fold activation above CAT activity obtained
with the vector without the insert and are compiled from seven
independent experiments.
|
|
The KR region can function as an NLS.
Examination of the
primary sequence of the KR region shows the presence of two clusters of
basic residues spaced by 14 aa (Fig. 4).
This motif is strongly reminiscent of a bipartite nuclear localization
signal (NLS) as initially defined in nucleoplasmin (Fig. 4B) (see
references 10 and 60 for
reviews). In transient-transfection assays, the KR region (aa 1336 to
1569) was sufficient to target a
-galactosidase (
-gal) fusion
protein to the nucleus, further suggesting that the hbrm protein may
rely on this region for its nuclear import. However, immunofluorescent
staining of the DT-derived cell lines used in this study showed that
all the hbrm mutants, including the
Cter(1337) and the
KR
mutants, had a strictly nuclear localization. In addition, we found
that another region rich in arginines and lysines, located between aa
541 and 564, was able to target a
-gal fusion protein to the
nucleus. Finally, a
-gal protein fused to the conserved helicase
domain (aa 740 to 1334) localized both in the cytoplasm and in the
nucleus (data not shown). These observations strongly suggested that
loss of activity of the
KR mutant is not a consequence of improper
cellular localization and that the hbrm protein contains several
signals allowing its nuclear import.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
Potential NLS and HMGI-like DNA binding domain within
the KR region. (A) Amino acid sequence of hbrm between positions 1336 and 1384 of the published sequence. The putative bipartite NLS is
underlined. The conserved motif found in the HMGI DNA binding domain is
boxed. (B) Alignment of the putative NLS present in the KR region with
the well-characterized NLS sequences from nucleoplasmin and N1
proteins. (C) Alignment of the KR region of hbrm with several proteins
known or predicted to contain an HMGI-like DNA binding domain, also
known as an AT hook.
|
|
The KR region harbors DNA binding activity.
Further
examination of the KR region as depicted in Fig. 4A (aa 1336 to 1384)
revealed homology to the DNA binding domains found in proteins such as
human High-Mobility-Group Protein I/Y (HMGI/Y) and HRX/ALL-1 or
Drosophila D1 (3, 15, 44). These domains, known
as AT hooks, bind the minor grove of DNA with a preference for AT-rich
sequences. The presence of an AT hook has been suggested previously for
the yeast SWI2-SNF2 protein in a region corresponding to the hbrm KR
sequence (19). This prompted us to test whether the KR
region could function as a DNA binding domain. To address this issue,
we constructed a series of plasmids bearing DNA encoding aa 1189 to
1569 of hbrm fused to GST. The constructs contained a WT hbrm sequence
or a sequence with deletion of either the E7 homology, KR, or
Bromodomain region (GST-hbrm WT, GST-
E7, GST-
KR, and
GST-
Bromo, respectively) (Fig. 5A). All the constructs were expressed in E. coli and used for
electrophoretic mobility shift assays (EMSA). WT GST-hbrm bound
efficiently to a 300-bp fragment of randomly chosen
Drosophila genomic DNA. This binding was not affected by
deletion of the E7 homology region but was completely abolished by
deletion of the KR region. Deletion of the bromodomain did not affect
the ability of the protein to bind DNA, but it modified its gel
mobility. This change in mobility may reflect a modified tertiary
structure of this mutant protein (Fig. 5B). The GST-hbrm fusion protein
also bound cruciform structures in EMSA, but with lower affinity than
to the double-stranded DNA fragment (data not shown). The
300-nucleotide DNA fragment used for binding assays contained several
stretches of four to five consecutive A · T base pairs, all
located at one end of the fragment. When the 300-nucleotide DNA
fragment was cleaved approximately in half by restriction digestion,
the portion containing the stretches of A · T base pairs was
bound as efficiently as the initial fragment. On the other hand, the
other portion was bound with lower affinity (data not shown). These
observations suggested that the binding of GST-hbrm was dependent on
the A+T content rather than on the length of the DNA fragment. To
further investigate this issue, we assayed the binding of WT GST-hbrm
to 32-mer oligonucleotides containing either 0, 10, or 24 A · T
base pairs. We observed a 10-fold increased binding to the 24AT
oligonucleotide compared to the 0AT nucleotide (Fig. 5C, compare lanes
4 and 6). In addition, binding to the 24AT oligonucleotide was competed
by a 100-fold excess of poly(dA-dT) but was partially resistant to the
same amount of poly(dG-dC) double-stranded DNA (lanes 9 and 15).
Furthermore, the binding to the 24AT oligonucleotide was inhibited in
the presence of distamycin, suggesting that, like HMGI/Y, hbrm binds to
the minor groove of DNA (lane 12). To confirm that the DNA binding of
hbrm was mediated by the putative AT hook, we expressed a GST-hbrm fusion with a double point mutation changing the conserved
arginine-glycine-arginine (RGR) motif (defined in Fig. 4C) into
aspartic acid-glycine-aspartic acid (DGD). This mutant fusion protein
was unable to bind any of the 32-mer oligonucleotides (Fig. 5D, lanes 6 to 8).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
The KR region mediates hbrm DNA binding. (A) Schematic
of the GST-hbrm fusion proteins used to assay the DNA binding
properties of the hbrm KR region. (B) EMSA was performed with a 337-bp
randomly chosen fragment of genomic Drosophila DNA and
either GST alone (lane 1), wild-type GST-hbrm (lane 2), GST- E7 (lane
3), GST- KR (lane 4), or GST- Bromo (lane 5). (C) As in panel B,
EMSA was performed with either GST alone (lanes 1 to 3) or WT GST-hbrm
(lanes 4 to 15) with a 32-mer double-stranded oligonucleotide
containing either 0, 10, or 24 A · T base pairs. When indicated,
300 ng of double-stranded poly(dG-dC) or poly(dA-dT) or 2 µM
distamycin A was added to the reaction mixtures. (D) EMSA with either
GST alone (lanes 1 and 2), WT GST-hbrm, or GST-hbrm DGD point mutant,
using 32-mer double-stranded oligonucleotides containing either 0, 10, or 24 A · T base pairs as indicated.
|
|
Deletion of the KR region modifies the affinity of hbrm for
chromatin fractions.
As described above, the KR region of hbrm is
able to bind DNA in vitro. To determine if this region is also able to
mediate the association with chromatin in vivo, we used a previously
described technique that divides the cellular components into four
fractions (40). In the first fractionation step, a detergent
treatment (0.3% Nonidet P-40) lyses the cytoplasmic membrane but
spares the nuclear envelope. The resulting fraction contains
cytoplasmic proteins and RNA (Fig. 6A,
lane 1) as well as nuclear proteins not attached to nuclear structures.
The second fraction (fraction S1) is obtained after mild digestion of
the nuclei by micrococcal nuclease. This releases DNA fragments
corresponding to mononucleosomes (lane 2). The fraction contains easily
accessible chromatin and factors attached thereto. The third fraction
(S2) is obtained after further subjecting the nuclei to osmotic shock.
This fraction contains larger DNA fragments corresponding to
dinucleosomes, trinucleosomes, etc. (lane 3), as well as proteins
attached to less accessible chromatin. The pellet remaining after this
treatment contains DNA fragments of heterogeneous sizes that remain
bound to the nuclear scaffold (insoluble chromatin, representing only a
minor fraction of the total DNA). In earlier studies, we showed that
hbrm is strongly attached to nuclear structures and cannot be extracted
from interphasic cells by treatment with nonionic detergents (30,
39). As expected, fractionation of DT cells stably expressing
exogenous WT hbrm showed that this protein was essentially present in
the S2 and insoluble fractions (Fig. 6D). In these cells, the
endogenous mBRG-1 was found in the same fractions as the reintroduced
hbrm protein (Fig. 6B). The distribution of the hbrm was somewhat
modified by a mutation in the E7 homology and bromodomain regions,
resulting mainly in a redistribution of some of the protein from the
insoluble fraction to the S1 fraction (Fig. 6H and L). On the other
hand, deletion of the KR region or the entire C-terminal region
resulted in an obvious decrease in the affinity for nuclear structures
and a large fraction of these mutant proteins were detected in the
soluble fraction (Fig. 6F and J, lanes 1). As mentioned above, deletion
of the KR region or the C-terminal region did not affect the nuclear
localization of the hbrm protein. To confirm the increased solubility
of the
Cter(1337) and
KR proteins, we fractionated the cells by
the standard method to obtain nuclear matrix (17). Using
this technique, we observed that WT hbrm was not extracted by the
initial 0.5% Triton X-100 treatment in isotonic buffer (soluble
fraction) but was essentially released after digestion with DNase I and
extraction with 1 M ammonium sulfate (chromatin fraction) (Fig. 6E).
Likewise, the
Bromo protein resisted the detergent extraction (Fig.
6M). In contrast, the
Cter(1337) and
KR proteins were partially
released in the Triton X-100-soluble fraction, confirming a decreased
affinity for nuclear structures of these hbrm-derived proteins (Fig. 6G and K, lanes 1). By this method, deletion of the E7 homology region results in some detergent extractability of the mutant protein (Fig.
6I, lane 1). This observation suggests that in vivo, sequences contained in the E7 region may complement the KR region for correct chromatin association of hbrm.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Deletion of the KR region of hbrm results in decreased
affinity for nuclear structures. DT-derived cell lines expressing
either WT hbrm, Cter(1337), E7, KR, or Bromo were
fractionated by two different methods. In method 1 (A, B, D, F, H, J,
and L), cells were lysed in a buffer containing 0.3% Nonidet P-40 and
separated into supernatant (Sol fraction) and pellet. The pellet was
treated with micrococcal nuclease and again centrifuged to separate
supernatant (S1 fraction) and pellet. This pellet was further extracted
with EDTA and centrifuged to yield supernatant (S2 fraction) and a
pellet. This pellet was finally solubilized in 8 M urea (Pel fraction).
One-tenth of each fraction was then extracted with phenol-chloroform
and analyzed on a 1% agarose gel (A) or resolved directly by SDS-PAGE.
For the latter, proteins were visualized by Western blotting with
either anti-BRG-1 (B) or anti-hbrm (D, F, H, J, and L) antibodies. In
method 2 (C, E, G, I, K, and M), nuclear matrix was prepared by the
high-salt method as described in Materials and Methods. Cells were
sequentially extracted with 0.5% Triton X-100 (Sol fraction), DNase I
and 0.25 M (NH4)2SO4 (CHR
fraction), and 2 M NaCl, and the remaining pellet was solubilized in 8 M urea (Pel fraction). As in method 1, 1/10 of each fraction was
subjected to SDS-PAGE and immunoblotted with anti-BRG-1 (C) or
anti-hbrm (E, G, I, K, and M) antibodies. EtBr, ethidium bromide.
|
|
 |
DISCUSSION |
Identification of a novel protein region required for the
growth-suppressive activity of brm.
In an earlier study, we showed
that expression of the brm protein is down-regulated in mouse
fibroblasts upon transformation by activated ras.
Reintroduction of a brm protein into these cells leads to partial
reversion of the ras-transformed phenotype. This reversion
could easily be estimated by assaying the ability of the cells
expressing exogenous brm to form colonies in soft agar. By this assay,
we showed that the ATPase domain of brm was essential for the reversion
(33). In the present study, we have used the same assay to
identify other regions of brm required for reversion of
ras transformation. Surprisingly, deletion of the LXCXE
motif, previously described as being required for interaction between brm and pocket proteins (Rb family members), had only a mild effect on
reversion. It is possible, as previously suggested, that Rb simultaneously contacts other regions of the brm protein
(50). Alternatively, the mammalian SWI-SNF complex may
control cell growth through several parallel pathways. For example, it
has recently been shown that hbrm and BRG-1 can associate with cyclin E
and that this cyclin can rescue BRG-1-induced growth arrest by a
mechanism that does not rely on the Rb protein (41).
Deletion of the entire C-terminal region of hbrm completely eliminates
the growth-inhibiting effect on DT cells. The deleted
region contains
two potential sequences of interest: the bromodomain
and a region rich
in lysines and arginines (the KR region) located
just upstream of the
bromodomain. Sequences downstream of the
bromodomain appear essentially
unstructured when analyzed with
a protein-structure prediction software
(PredictProtein/EMBL).
Deletion of the bromodomain had little effect on
the ability of
the hbrm protein to restrict DT cell growth. By
contrast, DT clones
expressing the

KR protein grew significantly
better in soft agar
than did clones expressing either the WT or

E7
hbrm constructs.
These observations define the KR region as a new
protein domain
necessary for the antitransforming activity of hbrm.
However,
clones expressing this mutant do not reach the plating
efficiency
of clones expressing the

Cter(1337) construct, and,
unlike the

Cter(1337) protein, expression of high levels of

KR
does not
favor colony formation in soft agar. This strongly suggests
that
C-terminal sequences other than the KR region are also involved
in
the effect of hbrm on DT cell growth. Alternatively, the large
C-terminal deletion could be deleterious for the overall tertiary
structure of hbrm, and this truncation may affect the activity
of other
important protein domains by a mechanism in
cis. Detailed
mutagenesis studies will be required to address this
issue.
The KR region contains an AT-hook-like DNA binding domain.
Gel
retardation assays with a C-terminal fragment of hbrm fused to GST
showed that the KR region could function as a DNA binding domain. DNA
binding activity has been ascribed previously to both the yeast and
human SWI-SNF complexes, although the subunits responsible for this
binding were not identified (37, 56). The yeast complex was
found to bind only some promoter fragments, suggesting at least a
moderate sequence specificity. It also showed high affinity for
synthetic four-way-junction DNA. These properties are very similar to
the DNA binding properties of HMG proteins, which interact with the
minor groove of the DNA with low sequence specificity. A member of the
HMG family of proteins (BAF57) has been found associated with the
mammalian SWI-SNF complex (56). However, complexes
containing a BAF57 protein mutated in the HMG domain are still able to
bind DNA, suggesting a redundancy of HMG-like binding activities within
the complex. Binding assays with GST-hbrm fusion proteins showed that
the KR region has affinity for double-stranded DNA, with a preference
for AT-rich sequences. The KR region is strongly basic and shows some
homology to the DNA binding domains of the chromosomal protein HMGI/Y.
This protein belongs to a family of HMG proteins that do not contain an
HMG domain but contact DNA through sequences known as AT hooks.
Interestingly, HMGI/Y is required for the assembly of higher-order
transcription enhancer complexes, most probably by modifying the
structure of the promoter DNA (4, 11, 13, 48).
The KR region is a potential chromatin interaction domain.
Our
in vitro DNA binding data is highly suggestive of direct contact
between the KR region of hbrm and chromatin. A role for this region in
chromatin interaction is also suggested by our transfection
experiments. We found that the KR region is dispensable for hbrm
cooperation with the GR when the promoter construct is cotransfected
with the hbrm and GR expression vectors (33). On the other
hand, the KR region is required when the promoter is integrated into
the cellular genome. A transfected promoter construct is unlikely to
present positioned nucleosomes, whereas an integrated promoter will be
fully organized into chromatin. Our observation therefore implies that
a chromatin-embedded MMTV promoter becomes less accessible for the
activating protagonists in the absence of the KR DNA binding domain.
Using two similar but distinct methods, we showed that WT hbrm is
retained in the chromatin fractions whereas the

KR mutant
is
partially detergent extractable. This observation further suggests
that
the KR region is involved in the tethering of the hbrm protein
to its
target chromatin. In addition, the binding of the KR region
to DNA or
chromatin may be required for proper activation of the
DNA-dependent
ATPase activity of hbrm. Interestingly, the coupling
of an ATPase
domain to a DNA binding domain is reminiscent of
the structure of
another chromatin-bound mammalian SWI2-SNF2 homologue,
known as CHD-1
(
9,
45,
46,
59). Like the KR region, the
DNA binding domain
of this protein contains a potential AT hook
surrounded by basic amino
acids. We speculate that the DNA binding
activities may be involved in
similar mechanisms in the two
proteins.
A target specificity for brm and BRG-1?
Our recent study on
inactivation of the mouse brm (mbrm) gene by homologous recombination
has shown that down-regulation of mbrm protein levels leads to
accumulation of increased levels of mBRG-1. This new pool of mBRG-1
protein is able to associate with the complexes left vacant by the
absent mbrm. The functional compensation of mbrm by mBRG-1 is reflected
by the fairly mild phenotype of the mbrm
/
mice.
Nonetheless, these mice are 10 to 15% heavier than their WT litermates
and show obvious deregulations of the cell cycle checkpoints
(38). These observations demonstrate that mBRG-1 and mbrm
exhibit distinct functional properties. The DNA binding domain
identified in hbrm is most probably also present in BRG-1 (the DNA
binding motif is fully conserved). The presence of these DNA binding
activities raises the possibility that the two proteins are targeted to
specific chromatin regions and that these regions are not identical for
brm and BRG. Immunofluorescent staining with brm and BRG-1 antibodies
show that the two proteins have a nuclear-diffuse distribution but are
also concentrated in spots, giving a microspeckled staining pattern.
Interestingly, the brm spots never overlap with the BRG-1 spots
(33a). Furthermore, an important region of sequence
divergence between the hbrm and the BRG-1 proteins is located just
upstream of the KR region, and transcripts with alternative splicing in
the E7 and KR regions have been identified for both hbrm and BRG-1
(8, 33a, 47). If target specificity exists for hbrm and
BRG-1, it might be determined by this region. The recent identification
of a bona fide target gene for the mammalian SWI-SNF complex may allow
us to address this issue (2).
 |
ACKNOWLEDGMENTS |
We are grateful to M. Noda and B. Wasylyk for the gift of DT
cells and to J. Rouvière-Yaniv for four-way junction probes. We
also thank J.-C. Reyes, A. Yeivin, and S. Schaper for valuable discussion. Special thanks also go to J. Weitzman and J. Seeler for
critical reading of the manuscript.
This work was supported by l'Association pour la Recherche sur le
Cancer, La Ligue Nationale Française Contre le Cancer, and the
ACC program of the French Ministry of Science.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité des
Virus Oncogènes, Département des Biotechnologies, Institut
Pasteur, 25, rue du Docteur Roux, 75724 Paris Cedex 15, France. Phone:
33 (0)1 45 68 8513. Fax: 33 (0)1 45 68 8790. E-mail:
yaniv{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Archer, T. K.,
P. Lefebvre,
R. G. Wolford, and G. L. Hager.
1992.
Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation.
Science
255:1573-1576[Abstract/Free Full Text].
|
| 2.
|
Armstrong, J. A.,
J. J. Bieker, and B. M. Emerson.
1998.
A Swi/Snf-related chromatin remodeling complex, E-Rc1, is required for tissue-specific transcriptional regulation by Eklf in vitro.
Cell
95:93-104[Medline].
|
| 3.
|
Ashley, C. T.,
C. G. Pendleton,
W. W. Jennings,
A. Saxena, and C. V. Glover.
1989.
Isolation and sequencing of cDNA clones encoding Drosophila chromosomal protein D1. A repeating motif in proteins which recognize at DNA.
J. Biol. Chem.
264:8394-8401[Abstract/Free Full Text].
|
| 4.
|
Bustin, M., and R. Reeves.
1996.
High-mobility-group chromosomal proteins: architectural components that facilitate chromatin function.
Prog. Nucleic Acid Res. Mol. Biol.
54:35-100[Medline].
|
| 5.
|
Cairns, B. R.
1998.
Chromatin remodeling machines: similar motors, ulterior motives.
Trends Biochem. Sci.
23:20-25[Medline].
|
| 6.
|
Cairns, B. R.,
Y. Lorch,
Y. Li,
M. Zhang,
L. Lacomis,
H. Erdjument-Bromage,
P. Tempst,
J. Du,
B. Laurent, and R. D. Kornberg.
1996.
RSC, an essential, abundant chromatin-remodeling complex.
Cell
87:1249-1260[Medline].
|
| 7.
|
Cato, A. C.,
P. Skroch,
J. Weinmann,
P. Butkeraitis, and H. Ponta.
1988.
DNA sequences outside the receptor-binding sites differently modulate the responsiveness of the mouse mammary tumour virus promoter to various steroid hormones.
EMBO J.
7:1403-1410[Medline].
|
| 8.
|
Chiba, H.,
M. Muramatsu,
A. Nomoto, and H. Kato.
1994.
Two human homologues of Saccharomyces cerevisiae SWI2/SNF2 and Drosophila brahma are transcriptional coactivators cooperating with the estrogen receptor and the retinoic acid receptor.
Nucleic Acids Res.
22:1815-1820[Abstract/Free Full Text].
|
| 9.
|
Delmas, V.,
D. G. Stokes, and R. P. Perry.
1993.
A mammalian DNA-binding protein that contains a chromodomain and an SNF2/SWI2-like helicase domain.
Proc. Natl. Acad. Sci. USA
90:2414-2418[Abstract/Free Full Text].
|
| 10.
|
Dingwall, C., and R. A. Laskey.
1991.
Nuclear targeting sequences a consensus?
Trends Biochem. Sci.
16:478-481[Medline].
|
| 11.
|
Du, W.,
D. Thanos, and T. Maniatis.
1993.
Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements.
Cell
74:887-898[Medline].
|
| 12.
|
Dunaief, J. L.,
B. E. Strober,
S. Guha,
P. A. Khavari,
K. Ålin,
J. Luban,
M. Begemann,
G. R. Crabtree, and S. P. Goff.
1994.
The retinoblastoma protein and BRG1 form a complex and cooperate to induce cell cycle arrest.
Cell
79:119-130[Medline].
|
| 13.
|
Falvo, J. V.,
D. Thanos, and T. Maniatis.
1995.
Reversal of intrinsic DNA bends in the IFN beta gene enhancer by transcription factors and the architectural protein HMG I(Y).
Cell
83:1101-1111[Medline].
|
| 14.
|
Godowski, P. J.,
S. Rusconi,
R. Miesfeld, and K. R. Yamamoto.
1987.
Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement.
Nature
325:365-368[Medline].
|
| 15.
|
Grosschedl, R.,
K. Giese, and J. Pagel.
1994.
HMG domain proteins: architectural elements in the assembly of nucleoprotein structures.
Trends Genet.
10:94-100[Medline].
|
| 16.
|
Haynes, S. R.,
C. Dollard,
F. Winston,
S. Beck,
J. Trowsdale, and I. B. Dawid.
1992.
The bromodomain: a conserved sequence found in human, Drosophila and yeast proteins.
Nucleic Acids Res.
20:2603[Free Full Text].
|
| 17.
|
He, D. C.,
J. A. Nickerson, and S. Penman.
1990.
Core filaments of the nuclear matrix.
J. Cell Biol.
110:569-580[Abstract/Free Full Text].
|
| 18.
|
Hirschhorn, J. N.,
S. A. Brown,
C. D. Clark, and F. Winston.
1992.
Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure.
Genes Dev.
6:2288-2298[Abstract/Free Full Text].
|
| 19.
|
Huth, J. R.,
C. A. Bewley,
M. S. Nissen,
J. N. Evans,
R. Reeves,
A. M. Gronenborn, and G. M. Clore.
1997.
The solution structure of an HMG-I(Y)-DNA complex defines a new architectural minor groove binding motif.
Nat. Struct. Biol.
4:657-665[Medline].
|
| 20.
|
Ichinose, H.,
J. M. Garnier,
P. Chambon, and R. Losson.
1997.
Ligand-dependent interaction between the estrogen receptor and the human homologues of SWI2/SNF2.
Gene
188:95-100[Medline].
|
| 21.
|
Ito, T.,
M. Bulger,
M. J. Pazin,
R. Kobayashi, and J. T. Kadonaga.
1997.
ACF, an ISWI-containing and ATP-utilizing chromatin assembly and remodeling factor.
Cell
90:145-155[Medline].
|
| 22.
|
Ito, T.,
J. K. Tyler, and J. T. Kadonaga.
1997.
Chromatin assembly factors: a dual function in nucleosome formation and mobilization?
Genes Cells
2:593-600[Abstract].
|
| 23.
|
Jeanmougin, F.,
J. M. Wurtz,
B. Le Douarin,
P. Chambon, and R. Losson.
1997.
The bromodomain revisited.
Trends Biochem. Sci.
22:151-153[Medline].
|
| 24.
|
Kadonaga, J. T.
1998.
Eukaryotic transcription: an interlaced network of transcription factors and chromatin-modifying machines.
Cell
92:307-313[Medline].
|
| 25.
|
Khavari, P. A.,
C. L. Peterson,
J. W. Tamkun,
D. B. Mendel, and G. R. Crabtree.
1993.
BRG1 contains a conserved domain of the SWI2/SNF2 family necessary for normal mitotic growth and transcription.
Nature
366:170-174[Medline].
|
| 26.
|
Lee, H. L., and T. K. Archer.
1994.
Nucleosome-mediated disruption of transcription factor-chromatin initiation complexes at the mouse mammary tumor virus long terminal repeat in vivo.
Mol. Cell. Biol.
14:32-41[Abstract/Free Full Text].
|
| 27.
|
LeGouy, E.,
E. M. Thompson,
C. Muchardt, and J. P. Renard.
1998.
Differential preimplantation regulation of two mouse homologues of the yeast SWI2 protein.
Dev. Dyn.
212:38-48[Medline].
|
| 28.
|
Marty, L.,
P. Roux,
M. Royer, and M. Piechaczyk.
1990.
MoMuLV-derived self-inactivating retroviral vectors possessing multiple cloning sites and expressing the resistance to either G418 or hygromycin B.
Biochimie
72:885-887[Medline].
|
| 29.
|
Muchardt, C.,
B. Bourachot,
J.-C. Reyes, and M. Yaniv.
1998.
ras transformation is associated with decreased expression of the brm/SNF2alpha ATPase from the mammalian SWI-SNF complex.
EMBO J.
17:223-231[Medline].
|
| 30.
|
Muchardt, C.,
J. C. Reyes,
B. Bourachot,
E. Legouy, and M. Yaniv.
1996.
The hbrm and BRG-1 proteins, components of the human SNF/SWI complex, are phosphorylated and excluded from the condensed chromosomes during mitosis.
EMBO J.
15:3394-3402[Medline].
|
| 31.
|
Muchardt, C.,
C. Sardet,
B. Bourachot,
C. Onufryk, and M. Yaniv.
1995.
A human protein with homology to S. cerevisiae SNF5 interacts with the potential helicase hbrm.
Nucleic Acids Res.
23:1127-1132[Abstract/Free Full Text].
|
| 32.
|
Muchardt, C.,
J. S. Seeler, and R. B. Gaynor.
1992.
Regulation of HTLV-I gene expression by tax and AP-2.
New Biol.
4:541-550[Medline].
|
| 33.
|
Muchardt, C., and M. Yaniv.
1993.
A human homologue of Saccharomyces cerevisiae SNF2/SWI2 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor.
EMBO J.
12:4279-4290[Medline].
|
| 33a.
| Muchardt, C. Unpublished data.
|
| 34.
|
Pazin, M. J., and J. T. Kadonaga.
1997.
SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions?
Cell
88:737-740[Medline].
|
| 35.
|
Peterson, C. L., and I. Herskowitz.
1992.
Characterization of the yeast SWI1, SWI2, and SWI3 genes, which encode a global activator of transcription.
Cell
68:573-583[Medline].
|
| 36.
|
Pfarr, C. M.,
F. Mechta,
G. Spyrou,
D. Lallemand,
S. Carillo, and M. Yaniv.
1994.
Mouse JunD negatively regulates fibroblast growth and antagonizes transformation by ras.
Cell
76:747-760[Medline].
|
| 37.
|
Quinn, J.,
A. M. Fyrberg,
R. W. Ganster,
M. C. Schmidt, and C. L. Peterson.
1996.
DNA-binding properties of the yeast SWI/SNF complex.
Nature
379:844-847[Medline].
|
| 38.
|
Reyes, J. C.,
J. Barra,
C. Muchardt,
A. Camus,
C. Babinet, and M. Yaniv.
1998.
Altered control of cellular proliferation in the absence of mammalian brahma (SNF2 ).
EMBO J.
17:6979-6991[Medline].
|
| 39.
|
Reyes, J. C.,
C. Muchardt, and M. Yaniv.
1997.
Components of the human SWI/SNF complex are enriched in active chromatin and are associated with the nuclear matrix.
J. Cell Biol.
137:263-274[Abstract/Free Full Text].
|
| 40.
|
Rose, S. M., and W. T. Garrard.
1984.
Differentiation-dependent chromatin alterations precede and accompany transcription of immunoglobulin light chain genes.
J. Biol. Chem.
259:8534-8544[Abstract/Free Full Text].
|
| 41.
|
Shanahan, F.,
W. Seghezzi,
D. Parry,
D. Mahony, and E. Lees.
1999.
Cyclin E associates with BAF155 and BRG1, components of the mammalian SWI-SNF complex, and alters the ability of BRG1 to induce growth arrest.
Mol. Cell. Biol.
19:1460-1469[Abstract/Free Full Text].
|
| 42.
|
Sif, S.,
P. T. Stukenberg,
M. W. Kirschner, and R. E. Kingston.
1998.
Mitotic inactivation of a human SWI/SNF chromatin remodeling complex.
Genes Dev.
12:2842-2851[Abstract/Free Full Text].
|
| 43.
|
Singh, P.,
J. Coe, and W. Hong.
1995.
A role for retinoblastoma protein in potentiating transcriptional activation by the glucocorticoid receptor.
Nature
374:562-565[Medline].
|
| 44.
|
Slany, R. K.,
C. Lavau, and M. L. Cleary.
1998.
The oncogenic capacity of HRX-ENL requires the transcriptional transactivation activity of ENL and the DNA binding motifs of HRX.
Mol. Cell. Biol.
18:122-129[Abstract/Free Full Text].
|
| 45.
|
Stokes, D. G., and R. P. Perry.
1995.
DNA-binding and chromatin localization properties of CHD1.
Mol. Cell. Biol.
15:2745-2753[Abstract].
|
| 46.
|
Stokes, D. G.,
K. D. Tartof, and R. P. Perry.
1996.
CHD1 is concentrated in interbands and puffed regions of Drosophila polytene chromosomes.
Proc. Natl. Acad. Sci. USA
93:7137-7142[Abstract/Free Full Text].
|
| 47.
|
Strober, B. E.,
J. L. Dunaief,
S. Guha, and S. P. Goff.
1996.
Functional interaction between the hBRM/hBRG-1 transcriptional activators and the pRB family of proteins.
Mol. Cell. Biol.
16:1576-1583[Abstract].
|
| 48.
|
Thanos, D., and T. Maniatis.
1992.
The high mobility group protein HMG I(Y) is required for NF-kappa B-dependent virus induction of the human IFN-beta gene.
Cell
71:777-789[Medline].
|
| 49.
|
Tong, J. K.,
C. A. Hassig,
G. R. Schnitzler,
R. E. Kingston, and S. L. Schreiber.
1998.
Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex.
Nature
395:917-921[Medline].
|
| 50.
|
Trouche, D.,
C. Le Chalony,
C. Muchardt,
M. Yaniv, and T. Kouzarides.
1997.
Rb and hbrm co-operate to repress the activation functions of E2F1.
Proc. Natl. Acad. Sci. USA
94:11268-11273[Abstract/Free Full Text].
|
| 51.
|
Tsukiyama, T.,
C. Daniel,
J. Tamkun, and C. Wu.
1995.
ISWI, a member of the SWI2/SNF2 ATPase family, encodes the 140 kDa subunit of the nucleosome remodeling factor.
Cell
83:1021-1026[Medline].
|
| 52.
|
Tsukiyama, T., and C. Wu.
1995.
Purification and properties of an ATP-dependent nucleosome remodeling factor.
Cell
83:1011-1020[Medline].
|
| 53.
|
Varga-Weisz, P. D., and P. B. Becker.
1998.
Chromatin-remodeling factors: machines that regulate?
Curr. Opin. Cell Biol.
10:346-353[Medline].
|
| 54.
|
Varga-Weisz, P. D.,
M. Wilm,
E. Bonte,
K. Dumas,
M. Mann, and P. B. Becker.
1997.
Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase.
Nature
388:598-602[Medline].
|
| 55.
|
Wade, P. A.,
P. L. Jones,
D. Vermaak, and A. P. Wolffe.
1998.
A multiple subunit Mi-2 histone deacetylase from Xenopus laevis cofractionates with an associated Snf2 superfamily ATPase.
Curr. Biol.
8:843-846[Medline].
|
| 56.
|
Wang, W.,
T. Chi,
Y. Xue,
S. Zhou,
A. Kuo, and G. R. Crabtree.
1998.
Architectural DNA binding by a high-mobility-group/kinesin-like subunit in mammalian SWI/SNF-related complexes.
Proc. Natl. Acad. Sci. USA
95:492-498[Abstract/Free Full Text].
|
| 57.
|
Wang, W.,
J. Cote,
Y. Xue,
S. Zhou,
P. A. Khavari,
S. R. Biggar,
C. Muchardt,
G. V. Kalpana,
S. P. Goff,
M. Yaniv,
J. L. Workman, and G. R. Crabtree.
1996.
Purification and biochemical heterogeneity of the mammalian SWI-SNF complex.
EMBO J.
15:5370-5382[Medline].
|
| 58.
|
Wolffe, A. P.,
J. Wong, and D. Pruss.
1997.
Activators and repressors: making use of chromatin to regulate transcription.
Genes Cells
2:291-302[Abstract].
|
| 59.
|
Woodage, T.,
M. A. Basrai,
A. D. Baxevanis,
P. Hieter, and F. S. Collins.
1997.
Characterization of the CHD family of proteins.
Proc. Natl. Acad. Sci. USA
94:11472-11477[Abstract/Free Full Text].
|
| 60.
|
Yoneda, Y.
1997.
How proteins are transported from cytoplasm to the nucleus.
J. Biochem.
121:811-817[Abstract/Free Full Text].
|
| 61.
|
Zhang, Y.,
G. LeRoy,
H. P. Seelig,
W. S. Lane, and D. Reinberg.
1998.
The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities.
Cell
95:279-289[Medline].
|
Molecular and Cellular Biology, June 1999, p. 3931-3939, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhou, J., Zhang, M., Fang, H., El-Mounayri, O., Rodenberg, J. M., Imbalzano, A. N., Herring, B. P.
(2009). The SWI/SNF Chromatin Remodeling Complex Regulates Myocardin-Induced Smooth Muscle-Specific Gene Expression. Arterioscler. Thromb. Vasc. Bio.
29: 921-928
[Abstract]
[Full Text]
-
Jani, A., Wan, M., Zhang, J., Cui, K., Wu, J., Preston-Hurlburt, P., Khatri, R., Zhao, K., Chi, T.
(2008). A novel genetic strategy reveals unexpected roles of the Swi-Snf-like chromatin-remodeling BAF complex in thymocyte development. JEM
205: 2813-2825
[Abstract]
[Full Text]
-
Lange, M., Kaynak, B., Forster, U. B., Tonjes, M., Fischer, J. J., Grimm, C., Schlesinger, J., Just, S., Dunkel, I., Krueger, T., Mebus, S., Lehrach, H., Lurz, R., Gobom, J., Rottbauer, W., Abdelilah-Seyfried, S., Sperling, S.
(2008). Regulation of muscle development by DPF3, a novel histone acetylation and methylation reader of the BAF chromatin remodeling complex. Genes Dev.
22: 2370-2384
[Abstract]
[Full Text]
-
Klokk, T. I., Kurys, P., Elbi, C., Nagaich, A. K., Hendarwanto, A., Slagsvold, T., Chang, C.-Y., Hager, G. L., Saatcioglu, F.
(2007). Ligand-Specific Dynamics of the Androgen Receptor at Its Response Element in Living Cells. Mol. Cell. Biol.
27: 1823-1843
[Abstract]
[Full Text]
-
Inayoshi, Y., Miyake, K., Machida, Y., Kaneoka, H., Terajima, M., Dohda, T., Takahashi, M., Iijima, S.
(2006). Mammalian Chromatin Remodeling Complex SWI/SNF Is Essential for Enhanced Expression of the Albumin Gene during Liver Development. J Biochem
139: 177-188
[Abstract]
[Full Text]
-
Rayasam, G. V., Elbi, C., Walker, D. A., Wolford, R., Fletcher, T. M., Edwards, D. P., Hager, G. L.
(2005). Ligand-Specific Dynamics of the Progesterone Receptor in Living Cells and during Chromatin Remodeling In Vitro. Mol. Cell. Biol.
25: 2406-2418
[Abstract]
[Full Text]
-
Kondo, T., Raff, M.
(2004). Chromatin remodeling and histone modification in the conversion of oligodendrocyte precursors to neural stem cells. Genes Dev.
18: 2963-2972
[Abstract]
[Full Text]
-
Farrona, S., Hurtado, L., Bowman, J. L., Reyes, J. C.
(2004). The Arabidopsis thaliana SNF2 homolog AtBRM controls shoot development and flowering. Development
131: 4965-4975
[Abstract]
[Full Text]
-
Henderson, A., Holloway, A., Reeves, R., Tremethick, D. J.
(2004). Recruitment of SWI/SNF to the Human Immunodeficiency Virus Type 1 Promoter. Mol. Cell. Biol.
24: 389-397
[Abstract]
[Full Text]
-
Marshall, T. W., Link, K. A., Petre-Draviam, C. E., Knudsen, K. E.
(2003). Differential Requirement of SWI/SNF for Androgen Receptor Activity. J. Biol. Chem.
278: 30605-30613
[Abstract]
[Full Text]
-
Fyodorov, D. V., Kadonaga, J. T.
(2002). Binding of Acf1 to DNA Involves a WAC Motif and Is Important for ACF-Mediated Chromatin Assembly. Mol. Cell. Biol.
22: 6344-6353
[Abstract]
[Full Text]
-
Fletcher, T. M., Xiao, N., Mautino, G., Baumann, C. T., Wolford, R., Warren, B. S., Hager, G. L.
(2002). ATP-Dependent Mobilization of the Glucocorticoid Receptor during Chromatin Remodeling. Mol. Cell. Biol.
22: 3255-3263
[Abstract]
[Full Text]
-
Aulner, N., Monod, C., Mandicourt, G., Jullien, D., Cuvier, O., Sall, A., Janssen, S., Laemmli, U. K., Kas, E.
(2002). The AT-Hook Protein D1 Is Essential for Drosophila melanogaster Development and Is Implicated in Position-Effect Variegation. Mol. Cell. Biol.
22: 1218-1232
[Abstract]
[Full Text]
-
Papoulas, O., Daubresse, G., Armstrong, J. A., Jin, J., Scott, M. P., Tamkun, J. W.
(2001). The HMG-domain protein BAP111 is important for the function of the BRM chromatin-remodeling complex invivo. Proc. Natl. Acad. Sci. USA
10.1073/pnas.091533398v1
[Abstract]
[Full Text]
-
Nie, Z., Xue, Y., Yang, D., Zhou, S., Deroo, B. J., Archer, T. K., Wang, W.
(2000). A Specificity and Targeting Subunit of a Human SWI/SNF Family-Related Chromatin-Remodeling Complex. Mol. Cell. Biol.
20: 8879-8888
[Abstract]
[Full Text]
-
Denis, G. V., Vaziri, C., Guo, N., Faller, D. V.
(2000). RING3 Kinase Transactivates Promoters of Cell Cycle Regulatory Genes through E2F. Cell Growth Differ.
11: 417-424
[Abstract]
[Full Text]
-
Carr, A., Biggin, M. D.
(2000). Accessibility of transcriptionally inactive genes is specifically reduced at homeoprotein-DNA binding sites in Drosophila. Nucleic Acids Res
28: 2839-2846
[Abstract]
[Full Text]
-
Reeves, R., Leonard, W. J., Nissen, M. S.
(2000). Binding of HMG-I(Y) Imparts Architectural Specificity to a Positioned Nucleosome on the Promoter of the Human Interleukin-2 Receptor alpha Gene. Mol. Cell. Biol.
20: 4666-4679
[Abstract]
[Full Text]
-
Papoulas, O., Daubresse, G., Armstrong, J. A., Jin, J., Scott, M. P., Tamkun, J. W.
(2001). The HMG-domain protein BAP111 is important for the function of the BRM chromatin-remodeling complex invivo. Proc. Natl. Acad. Sci. USA
98: 5728-5733
[Abstract]
[Full Text]