Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 3969-3976, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mid2 Is a Putative Sensor for Cell Integrity
Signaling in Saccharomyces cerevisiae
Mathumathi
Rajavel,1
Bevin
Philip,1
Benjamin M.
Buehrer,2
Beverly
Errede,2 and
David E.
Levin1,*
Department of Biochemistry, School of Public
Health, The Johns Hopkins University, Baltimore, Maryland
21205,1 and Department of Biochemistry
and Biophysics, University of North Carolina, Chapel Hill, North
Carolina 275992
Received 19 January 1999/Returned for modification 10 February
1999/Accepted 4 March 1999
 |
ABSTRACT |
Hcs77 is a putative cell surface sensor for cell integrity
signaling in Saccharomyces cerevisiae. Its loss of function
results in cell lysis during growth at elevated temperatures (e.g.,
39°C) and impaired signaling to the Mpk1 mitogen-activated protein
kinase in response to mild heat shock. We isolated the MID2
gene as a dosage suppressor of the cell lysis defect of an
hcs77 null mutant. MID2 encodes a putative
membrane protein whose function is required for survival of pheromone
treatment. Mid2 possesses properties similar to those of Hcs77,
including a single transmembrane domain and a long region that is rich
in seryl and threonyl residues. We demonstrate that Mid2 is required
for cell integrity signaling in response to pheromone. Additionally, we
show that Mid2 and Hcs77 serve a redundant but essential function as
cell surface sensors for cell integrity signaling during vegetative
growth. Both proteins are uniformly distributed through the plasma
membrane and are highly O-mannosylated on their extracellular domains. Finally, we identified a yeast homolog of MID2, designated
MTL1, which provides a partially redundant function with
MID2 for cell integrity signaling during vegetative growth
at elevated temperature but not for survival of pheromone treatment. We
conclude that Hcs77 is dedicated to signaling cell wall stress during
vegetative growth and that Mid2 participates in this signaling, but its
primary role is in signaling wall stress during pheromone-induced morphogenesis.
 |
INTRODUCTION |
The cell wall of the budding yeast
Saccharomyces cerevisiae is required to maintain cell shape
and integrity (3, 20). The cell must remodel this rigid
structure during vegetative growth and during pheromone-induced
morphogenesis. Wall remodeling is monitored and regulated by the cell
integrity signaling pathway controlled by the Rho1 GTPase. Two
essential functions have been identified for Rho1. First, it serves as
an integral regulatory subunit of the 1,3-
-glucan synthase (GS)
complex that stimulates GS activity in a GTP-dependent manner (7,
32). A pair of closely related genes, FKS1 and
FKS2, encode alternative catalytic subunits of the GS
complex (6, 13, 28, 33) that are the presumed targets of
Rho1 activity.
A second essential function of Rho1 is to bind and activate protein
kinase C (19, 29), which is encoded by PKC1
(26, 39). Loss of PKC1 function, or of any of the
components of the mitogen-activated protein (MAP) kinase cascade under
its control (25), results in a cell lysis defect that is
attributable to a deficiency in cell wall construction (23, 24,
31). The MAP kinase cascade is a linear pathway comprised of a
MEK kinase (BCK1 [4, 22]), a pair of
redundant MEKs (MKK1/2 [14]), and a MAP
kinase (MPK1 [21]). One of the consequences
of signaling through the MAP kinase cascade is transcriptional
activation of FKS2 (41).
Cell integrity signaling is induced in response to several
environmental stimuli. First, signaling is activated persistently in
response to growth at elevated temperatures (e.g., 37 to 39°C [18]), consistent with the finding that null mutants
in many of the pathway components display cell lysis defects only when cultivated at high temperatures. Second, hypo-osmotic shock induces a
rapid but transient activation of signaling (5, 18).
Finally, treatment with mating pheromone stimulates signaling at a time that is coincident with the onset of morphogenesis (1, 8). Indeed, mutants defective in cell integrity signaling undergo cell
lysis during pheromone-induced morphogenesis (8).
The mechanism by which information regarding the state of the cell wall
is transmitted to the intracellular signaling apparatus remains an open
question. Recently, a gene encoding a putative cell surface sensor for
the activation of cell integrity signaling was described and variously
designated HCS77 (9), WSC1
(38), and SLG1 (16). Loss of function
of HCS77 results in a cell lysis defect that is less severe
than that observed for other components of the cell integrity signaling
pathway (9, 16, 38), suggesting that its function may be
partially redundant. Indeed, several HCS77 homologs
(WSC2, -3, and -4, exist in budding yeast.
WSC2 and WSC3 have been reported to contribute to
cell integrity signaling to a lesser degree than HCS77
(38). In our hands, mutants in these genes in combination
with hcs77 have only a modest effect on the severity of the
cell lysis defect. Moreover, residual signaling to the Mpk1 MAP kinase
is evident even in an hcs77 wsc2 wsc3 triple mutant
(38), indicating that these signaling components serve a
partially redundant function with another unidentified sensor. Here we
present evidence that the Mid2 protein is a cell surface sensor for
cell integrity signaling, which together with Hcs77 provides an
essential function during vegetative growth. Additionally, we
demonstrate that Mid2 is required for activation of this signaling pathway in response to pheromone-induced morphogenesis.
 |
MATERIALS AND METHODS |
Strains, growth conditions, and transformations.
The
S. cerevisiae strains used in this study are listed in Table
1. Yeast cultures were grown in YEPD (1%
Bacto Yeast Extract, 2% Bacto Peptone, 2% glucose). Synthetic minimal
(SD) medium (34) supplemented with the appropriate nutrients
was used to select for plasmid maintenance and gene replacement. Yeast
transformations were carried out by the lithium acetate method
(15). Escherichia coli DH5
was used for the
propagation of all plasmids. E. coli cells were cultured in
Luria broth medium (1% Bacto Tryptone, 0.5% Bacto Yeast Extract, 1%
NaCl) and transformed by standard methods (27).
Isolation of MID2 and MTL1.
S.
cerevisiae DL1987 (hcs77
) was transformed with a
plasmid library of genomic yeast DNA (from strain DL2040) in
centromeric vector pRS316 (35), constructed as described
previously (22). Transformants were grown at room
temperature and replicated onto YEPD at 38°C for 2 days. Plasmids
were rescued from colonies arising at the nonpermissive temperature.
Clone pRM5.2 contained an 8.4-kb insert that included three complete
open reading frames (ORFs). In this clone, the MID2 gene was
flanked by YLR331C and RPS31. A
BglII-BamHI subclone that possesses
MID2 and YLR331C was suppression competent. A 3' truncation
of MID2 (by SnaBI) eliminated the suppression activity of this clone.
The
MTL1 gene was amplified by PCR from wild-type (1783)
genomic DNA with 1.0 kb of 5' flanking sequence and 290 bp of 3'
flanking sequence and then cloned into the 2µm-based plasmid pRS424
(
35). The DNA sequence of the complete insert was
determined.
DNA sequence analysis was performed by the JHU Biosynthesis
and
Sequencing Facility, using oligonucleotides synthesized by the
Biochemistry Core Facility. PCRs for the purposes of cloning were
carried out with
Pfu polymerase (Stratagene);
Taq
polymerase (Perkin-Elmer)
was used for analytical purposes (see below).
The sequence of
MTL1 from strain 1783 contained 84 additional nucleotides compared
with the database sequence from S288C.
These residues result in
an in-frame insertion of 28 amino acid
residues (nearly all seryl)
at position 265, which is within the
Ser/Thr-rich region of this
protein (see Fig.
5).
Genomic deletions of MID2 and MTL1.
For construction of the mid2
allele, plasmid
pRS315[mid2
::URA3] (provided by H. Iida) was digested
with XhoI and SspI, and the resultant 1.6-kb
fragment was purified and used to transform yeast strains DL2256 and
DL2393. Transformants of DL2256 were sporulated, and tetrad analysis
was carried out on YEPD with or without 10% sorbitol. Deletion of
MID2 was confirmed by PCR in both strains.
To delete the genomic copy of
MTL1, a 900-bp fragment that
is immediately 5' to the
MTL1 coding sequence, amplified by
PCR
from genomic 1783 DNA, was first inserted into
pBluescript[
HIS4]
(gift of Susan Michaelis). Next, a
610-bp fragment that includes
320 bp of coding sequence and 290 bp
immediately 3' to the
MTL1 coding sequence was amplified and
inserted into the resultant
plasmid on the other end of
HIS4
in the same orientation as the
5' sequence. This construct, designated
p
mtl1
::HIS4, was digested
with
BssHII to
liberate a 6.4-kb fragment, which was used to transform
yeast strain
DL2337. Deletion of
MTL1 was confirmed by
PCR.
Pheromone-induced killing.
To test for sensitivity to
killing by
-factor, MATa strains were grown in
synthetic minimal medium containing limiting calcium (100 µM
CaCl2) (12) for 24 h, subcultured in the
same medium, and grown to an A600 of 0.5 to 1.0 (5 × 106 to 1 × 107 cells/ml).
Cells were then treated with
-factor (8 µg/ml; Sigma), and
viability was measured over time by plating onto YEPD.
Construction of MID2 and HCS77 fusions to
green fluorescent protein (GFP) and the hemagglutinin (HA)
epitope.
Mid2 was tagged at its C terminus with a UV-optimized
variant of GFP, GFPuv. In the first of two steps, the GFPuv coding
sequence (711 bp, including the stop codon) was amplified by PCR from
pGFPuv (Clontech), with three additional guanosyl residues at the 5' end. This fragment was blunt-end inserted into the SmaI site
of pRS315 (35) so as to regenerate a single SmaI
site immediately 5' of the GFPuv sequence. Next, a 1.9-kb fragment
including MID2 with 760 bp of 5' noncoding sequence
(amplified from pRM5.2) but without its stop codon was blunt-end
inserted into the SmaI site of pRS315[GFPuv]. This
construct (pMID2-GFP) expressed GFPuv fused to the C
terminus of Mid2 with an additional glycyl residue at the fusion point.
Mid2 and Hcs77 were tagged at their C termini with the 3xHA
(three-repeat HA) epitope (
40). In the first of two steps,
the
3xHA sequence from
PKC1-HA (
39) was amplified
together with
250 bp of 3' noncoding sequence from the
PKC1
transcriptional
terminator and inserted into the
SmaI site
of YEp352 (
10) so
as to regenerate a single
SmaI
site immediately 5' to the epitope
sequence. Next,
MID2
(same fragment as above) and
HCS77 sequences
(including 600 bp 5' to the translational start site) were amplified
through the final
coding base (excluding the stop codon), and
blunt-end inserted into the
SmaI site of YEp352[3xHA]. The resultant
clones fused the
3xHA epitope, in frame with an additional glycine
residue, to the C
termini of Mid2 and
Hcs77.
Construction of N-glycosylation site mutants.
Hcs77-HA
N-glycosylation mutants N4Q and N65Q were constructed by site-directed
mutagenesis using the PCR overlap extension method (11).
Pairs of complementary mutagenic primers
(AAATAATGAGACCGCAAAAAACAAGTCTGC and its reverse complement
for the N4Q mutation; CTTTGCCCTTTATCAACATTCAGAATGTTA and its
reverse complement for the N65Q mutation) were used in separate PCRs
with primers either 5' or 3' to the coding sequence to generate
overlapping 5' and 3' regions of HCS77-HA, using
YEp352[HCS77-HA] as the template. The products of those reactions
were combined in a third reaction to amplify the full-length mutated
alleles, which were then digested with SacI and
XbaI and inserted into the cognate sites of YEp352.
Construction of the double mutant was done by generating the N65Q
mutation in the N4Q mutant.
Fluorescence microscopy of Mid2-GFP.
Haploid strain DL2277
expressing Mid2-GFP from pRS315 was grown in SD medium for 24 h,
subcultured in YEPD to an A600 of 0.5 to 1.0, and washed three times with phosphate-buffered saline (137 mM NaCl,
2.68 mM KCl, 10 mM Na2HPO4, 1.47 mM
KH2OPO4 [pH 7.4]). The cells were resuspended
in Vectashield mounting medium (Vector Laboratories, Inc.) with Hoechst
33342 (10 µg/ml). A Zeiss fluorescence microscope fitted with a
fluorescein isothiocyanate filter was used to visualize cells.
Activation of Mpk1-HA by temperature shift and pheromone
treatment.
Strains expressing Mpk1-HA were tested for thermal
activation (18) or pheromone-induced activation
(1) of this protein kinase by immunoprecipitation of the
fusion protein from cell extracts with monoclonal antibody 12CA5 (BabCo
and Boehringer Mannheim), followed by immunocomplex protein kinase
assays. Strains were tested for thermal activation of Mpk1-HA as
described previously (18). Strains tested for
pheromone-induced activation were grown to a density of ca.
107 cells/ml at room temperature in SD medium. Cells were
harvested and resuspended in prewarmed (to 37°C) YEPD containing 100 mM sorbitol. The cultures were incubated at this temperature for 1.5 to
2 h until the cells, which bear a temperature-sensitive cdc28 allele, accumulated at the G1 block as
large unbudded cells. At this time (t = 0), samples of
each culture were removed for preparation of protein extracts (50 ml),
mating pheromone was added to the remaining culture (50 nM
-factor),
and the cultures were incubated at 37°C. Samples (50 ml) were removed
at the indicated times following pheromone addition for preparation of
extracts. Extracts were prepared and protein concentrations were
determined as described previously (1). Immunocomplex
protein kinase assays were performed as described elsewhere
(18).
-Mannosidase treatment.
Mid2-HA and Hcs77-HA were
immunoprecipitated from cell extracts as described previously
(18) except that 100 µg of protein was used and the
immunoprecipitation buffer contained 1% Triton X-100 instead of
Nonidet P-40. Immunoprecipitates were washed twice with the mannosidase
assay buffer (100 mM sodium acetate [pH 5.0], 2 mM ZnCl2)
and resuspended in 15 µl of buffer.
-Mannosidase (5 µl of 0.1 U/µl) was added to the immunocomplexes and incubated for 3 h at
37°C. Controls were mock treated with assay buffer only under the
same conditions. Samples were analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on an 8%
polyacrylamide gel followed by immunoblotting as described previously
(18). Protein concentrations of cell extracts that contained
detergent were determined by using the bicinchoninic acid protein assay
reagent (Pierce).
Fractionation of Hcs77-HA and Mid2-HA.
Transformants of
yeast strain 1788 expressing either Mid2-HA or Hcs77-HA from YEp352
were grown in YEPD to an A600 of 1 to 1.2. Cells
were harvested from 400 ml, washed once with 10% sorbitol, and
resuspended in 6 ml of lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM
NaCl, 5 mM EDTA, 50 mM KF) with protease inhibitors (20 µg of
leupeptin, 20 µg of benzamidine, 10 µg of pepstatin, and 40 µg of
aprotinin per ml plus 1 mM phenylmethylsulfonyl fluoride). An equal
volume of glass beads (0.3-mm diameter) was added to the suspension,
and cells were broken by vigorous vortexing for 5 min at 4°C. The
beads and cell debris were removed by centrifugation at
13,000 × g. This crude extract was split, and part was
treated with Triton X-100 (1%) prior to centrifugation at
100,000 × g for 1 h at 4°C. The pellet was
resuspended in a volume of lysis buffer equal to that of the
supernatant, and both were analyzed by SDS-PAGE on an 8% gel.
 |
RESULTS |
The HCS77 gene encodes a predicted type 1 membrane
protein (9). Its most prominent features include a single
transmembrane domain near its C terminus, a long Ser/Thr-rich region
(ca. 145 residues), and a potential Cys-zinc finger near its N
terminus. Loss of HCS77 function results in a cell lysis
defect during growth at 37 to 39°C (9, 16, 38), depending
on the genetic background (unpublished results). This defect is
accompanied by a deficiency in the ability to activate the Mpk1 MAP
kinase in response to mild thermal stress (9). These
findings, together with the localization of Hcs77 to the cell periphery
(38), support a model in which Hcs77 functions as a sensor
for cell integrity signaling (9, 16, 38).
Isolation of MID2 as a dosage suppressor of the
hcs77
defect.
In the course of screening a
centromeric library constructed to isolate the gene encoding a
mutational suppressor of the hcs77
growth defect, we
isolated a plasmid that contains the wild-type MID2 gene. An
hcs77
strain (DL1987) was transformed with a genomic yeast library and screened for suppression of its cell lysis defect at
39°C. We isolated from this screen a single plasmid (pRM5.2) which
contains a region of chromosome 12 with three complete ORFs. One of
these is MID2 (YLR332W); the others were RPS31
and an uncharacterized ORF, designated YLR331C. Deletion analysis of
this plasmid revealed that MID2 (for mating-induced death)
was the gene responsible for suppression of hcs77
(data
not shown). A MID2 isolate from wild-type cells was able to
suppress hcs77
when cloned into a centromeric vector.
Moreover, DNA sequence analysis of the plasmid-borne MID2
revealed no differences from the same region of DNA isolated by PCR
from the isogenic wild-type strain, indicating that MID2 acts as a dosage suppressor of the hcs77
defect, even
when expressed from a low-copy-number plasmid. This suppression was
more easily observed in an hcs77
wsc2
double mutant
(Fig. 1A), which has a growth defect
slightly more severe than that of the strain with hcs77
alone (38).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Overexpression of MID2 suppresses the cell
lysis defect of an hcs77 wsc2 mutant and a conditional
rho1 mutant. (A) Transformants of yeast strain DL2230
(hcs77 wsc2 ) harboring episomal vector (pRS424),
pRS424[MID2], or centromeric plasmid
pRS316[HCS77] were streaked onto a YEPD plate and
incubated at 38°C for 3 days. (B) Transformants of yeast strain
DL1235 (rho1-5) harboring episomal plasmid pRS424 or
pRS424[MID2] or centromeric plasmid pRS314[RHO1] or
pRS314[MID2] were streaked onto a YEPD plate and incubated at 37°C
for 3 days.
|
|
Because Hcs77 acts through the cell integrity signaling pathway, we
examined the ability of
MID2 overexpression to suppress
other mutant defects in signaling components thought to be under
the
control of Hcs77. Figure
1B shows that overexpression of
MID2 from a multicopy vector suppresses the growth defect of
the
rho1-5 mutant (DL1235), which lyses at the restrictive
temperature (
19).
This suppression was allele specific,
because
MID2 failed to suppress
the growth defects of
rho1-3 and
rho1-4 mutants (not shown), indicating
that
MID2 overexpression does not bypass the requirement for
RHO1.
Strains with mutations in other genes that function
downstream
of
RHO1 (e.g.,
PKC1,
BCK1,
and
MPK1) were not detectably suppressed
by
MID2 overexpression.
MID2 and HSC77 act in parallel to regulate
cell integrity signaling.
Three possibilities exist for the
organization of a pathway in which both Hcs77 and Mid2 function. Mid2
might be under the control of Hcs77 such that overexpression of Mid2
drives pathway activation sufficiently to allow survival of thermal
stress in the absence of signal from Hcs77. Alternatively, these
proteins might act in parallel to provide a partially redundant
function in the regulation of cell integrity signaling. Finally, Mid2
might positively regulate the expression of the
HCS77-related genes WSC2, WSC3, and
WSC4. However, steady-state mRNA levels from these genes
were found to be unaffected by either overexpression or deletion of
MID2 (data not shown), ruling out this last possibility.
To distinguish between the two remaining possibilities, we first tested
for suppression of the
mid2
defect by
HCS77
overexpression.
The
MID2 gene was isolated initially for its
null mutant phenotype,
which is failure to survive mating pheromone
treatment (
30).
Treatment of a
MATa mid2
mutant with

-factor resulted in 90%
cell death after 5 h (Fig.
2). Overexpression of either
HCS77 (Fig.
2) or
RHO1 (not shown) from episomal
plasmids partially
suppressed this defect. The absence of an epistatic
relationship,
demonstrated by the reciprocal suppression of
hcs77
by
MID2 and
mid2
by
HCS77, suggests that these genes function in parallel.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
Overexpression of HCS77 suppresses the
pheromone-induced death of a mid2 mutant. Yeast strain
DL2277 (MATa mid2 ) transformed with
centromeric vector pRS314, pRS314[MID2], or episomal
plasmid pRS424[HCS77] was grown in SD with limiting
calcium (100 µM CaCl2) at 30°C to an
A600 of 0.5 to 1.0. Mating pheromone
( -factor; 8 µg/ml) was added to the cultures, and samples were
tested hourly for viability by plating onto YEPD. Plates were scored
after 2 days at room temperature.
|
|
The possibility that Mid2 and Hcs77 share a redundant function is also
supported by structural similarities between these
proteins. The Mid2
polypeptide, like Hcs77, is predicted to be
a type 1 membrane protein
with its transmembrane region near the
C terminus. Additionally, it
possesses a long Ser/Thr-rich region
(ca. 185 residues) that is N
terminal to the transmembrane domain.
These features, together with the
ability of
MID2 to suppress
hcs77
, suggests
that these proteins might have overlapping functions,
although Hcs77
and Mid2 show no sequence similarity outside these
generally related
regions.
One prediction of a model in which Mid2 and Hcs77 share a function is
that the combined defect of mutations in both genes
should be more
severe than either defect alone. Therefore, we
tested the
mid2
and
hcs77
mutations for additivity of
growth
defects. Either mutation alone did not result in a growth defect
at temperatures as high as 37°C (not shown). In contrast, the
double
mutant was inviable even at room temperature (Fig.
3).
This growth defect was suppressed by
the addition of 10% sorbitol
to the growth medium for osmotic support
at temperatures as high
as 34°C. Removal of osmotic support resulted
in immediate cell
lysis, as judged microscopically by a high frequency
of nonrefractile
ghosts. The behavior of the
mid2
hcs77
mutant is characteristic
of other mutants in the cell
integrity signaling pathway.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
A mid2 hcs77 mutant displays a severe
cell lysis defect. Haploid yeast strains 1783 (wild type [WT]),
DL2277 (mid2 ), DL1985 (hcs77 ), and DL2282
(mid2 hcs77 ) were streaked onto YEPD and YEPD
supplemented with 10% sorbitol for osmotic support and then incubated
at room temperature for 2 days.
|
|
Mid2 and Hcs77 are plasma membrane-associated proteins.
Another prediction of a model in which Mid2 and Hcs77 function as
sensors for cell integrity signaling is that they should localize to
the plasma membrane. Hcs77 has been shown by fluorescence microscopy to
be distributed uniformly around the cell periphery (38). To
examine the intracellular localization of Mid2, we first fused GFP to
the C terminus of Mid2. This fusion protein was fully functional, as
judged by its ability to complement the pheromone sensitivity of the
mid2
mutant when expressed from a centromeric plasmid
(not shown). Fluorescence microscopy of cells expressing the Mid2-GFP
fusion from the same plasmid revealed that this protein localizes
uniformly around the cell periphery (Fig.
4A). By contrast, GFP alone, when
expressed in yeast, is cytoplasmic (38). No fluorescent
signal was detected from control cells (not shown). Treatment of cells
with mating pheromone for up to 6 h did not appear to alter the
localization of Mid2-GFP (not shown).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
Mid2 and Hcs77 localize to the plasma membrane. (A)
Mid2-GFP, expressed in yeast strain DL2277 from a centromeric plasmid
(pRS315[MID2-GFP]), was visualized with a fluorescein
isothiocyanate filter. (B and C). Mid2-HA (B) and Hcs77-HA (C) were
expressed from an episomal vector (YEp352) in yeast strain 1788. Crude
extracts were split and subjected to a 100,000 × g
centrifugation with or without 1% Triton X-100. Samples containing
protein from the total extract (T; 46 µg of the Mid2-HA extract and
25 µg of the Hcs77-HA extract), supernatant (S), and pellet (P) were
subjected to SDS-PAGE followed by immunoblot analysis. The control
(untagged) lane in panel B contains total extract from cells of strain
1788 without an epitope-tagged protein. Sizes are indicated in
kilodaltons.
|
|
To examine the intracellular localization of Mid2 and Hcs77
biochemically, we fused the 3xHA epitope to their C termini. These
fusions were fully functional, as judged by their ability to complement
the defects associated with their deletion mutations when expressed
from centromeric plasmids (not shown). Mid2-HA and Hcs77-HA were
overexpressed from multicopy plasmids for the purpose of
immunodetection.
Both proteins migrated on SDS-PAGE as diffuse bands of
much greater
apparent molecular mass than those predicted by their
amino acid
sequences, suggestive of modification (see below). Figure
4B
and
C show that both Mid2-HA and Hcs77-HA fractionated completely
with
the pellet from a 100,000 ×
g centrifugation in the
absence
of detergent. In contrast, both proteins were solubilized in
the
presence of the nonionic detergent Triton X-100 (1%), indicating
that they are associated with a membrane. Taken together with
the
peripheral localization observed for Hcs77-GFP and Mid2-GFP,
these
results indicate that both proteins are associated with
the plasma
membrane. This finding, combined with the strongly
additive growth
defect of the
mid2
hcs77
mutant and the reciprocal
suppression results described above, indicates that these genes
provide
an essential but redundant function in the maintenance
of cell
integrity during vegetative
growth.
Mid2 has a homolog, Mtl1.
A search of the yeast genome
database revealed that MID2 has a homolog on chromosome 7. This uncharacterized ORF (YGR023) shows 50% amino acid sequence
identity with Mid2 (Fig. 5). The gene was
therefore designated MTL1 (for MID2-like). We
constructed a genomic deletion of MTL1 (see Materials and
Methods). An mtl1
mutant displayed no growth defect at
temperatures up to 39°C, nor was it sensitive to pheromone-induced
death (data not shown). However, a mid2
mtl1
mutant
displayed an osmotic-remedial lysis defect when grown at 39°C (Fig.
6A), as evidenced by a high frequency of
nonrefractile ghosts in the absence of osmotic support at the restrictive temperature. Overexpression of HCS77 weakly
suppressed this growth defect (Fig. 6B), further supporting a model in
which these genes share a common function during vegetative growth. Loss of MTL1 did not enhance the sensitivity of a
mid2
mutant to pheromone-induced killing, nor did it
confer pheromone sensitivity to an hcs77
mutant (not
shown). However, overexpression of MTL1 partially suppressed
the pheromone sensitivity of mid2
. In contrast to
mid2
, the mtl1
mutation did not exacerbate
the cell lysis defect of an hcs77
mutant, nor did
overexpression of MTL1 suppress hcs77
. These
results, taken in the aggregate, indicate that MID2 plays a
more important role in both vegetative growth and pheromone sensitivity
than does MTL1.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
Sequence alignment of Mid2 and Mtl1. Identical residues
are in bold, similar residues are in shadow type. The underline
indicates a 28-residue insertion in the predicted Mtl1 sequence from
the EG123 background relative to the S288C sequence available through
the yeast genome database.
|
|

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 6.
A mid2 mtl1 mutant displays an
osmotic-remedial cell lysis defect and is deficient in activating the
Mpk1 MAP kinase. (A) Diploid yeast strains 1788 (wild type [WT]),
DL2394, DL2395, and DL2396 were streaked onto YEPD or YEPD supplemented
with 10% sorbitol and incubated at 39°C for 3 days. (B)
Transformants of a mid2 mtl1 mutant (DL2396) harboring
episomal plasmid pRS424, pRS424[HCS77], or centromeric
plasmid pRS314[MID2] were streaked onto a YEPD plate and
incubated at 39°C for 3 days. (C) The same yeast strains as in panel,
A but transformed with YEp351[MPK1-HA], were cultured to
mid-log phase at 23°C and shifted to 39°C for 1 h. Mpk1-HA was
immunoprecipitated from extracts with monoclonal antibody (Ab) 12CA5,
and the immunoprecipitates were subjected to protein kinase assays
using MBP as the substrate. The lower panel displays an immunoblot of
the Mpk1-HA immunoprecipitates.
|
|
Mild thermal stress is a condition known to activate the Mpk1 MAP
kinase in wild-type cells (
18). To examine the role of
Mid2
and Mtl1 in cell integrity signaling during vegetative growth,
we
compared the activities of Mpk1 in wild-type and mutant strains
in
response to shift from growth at room temperature to 39°C for
1 h. Mpk1 was strongly activated by this treatment in wild-type
cells
(Fig.
6C; compare lanes 1 and 2). Temperature-induced activation
of
this protein kinase in an assay with myelin basic protein (MBP)
as the
substrate was somewhat diminished in both a
mid2
mutant
and an
mtl1
mutant (compare lanes 4 and 5 and lanes 6 and
7,
respectively). Mpk1 activation was severely impaired in the
mid2
mtl1
mutant but not completely eliminated
(compare lanes 8 and
9), consistent with the weak cell lysis defect of
the double mutant.
It should be noted that the double mutant survived
this treatment
for the duration of the experiment (data not shown). An
hcs77
mutant, which is also markedly impaired for Mpk1
activation, also
retains some ability to stimulate this kinase. Because
an
hcs77
mid2
mutant is inviable in the absence of
osmotic support, and
high osmolarity prevents activation of Mpk1 in
response to thermal
stress (
18), we were unable to examine
Mpk1 activation in this
mutant.
MID2 is required for cell integrity signaling in
response to mating pheromone-induced morphogenesis.
Cell integrity
signaling is activated by pheromone treatment at a time that is
coincident with the onset of morphogenesis (8). Moreover,
like mid2 mutants, mutants that fail to activate cell
integrity signaling are killed by pheromone treatment (8). Therefore, we examined the ability of a mid2
mutant to
activate cell integrity signaling in response to treatment with mating pheromone. Cells that are synchronized at Start display a strong activation of the Mpk1 MAP kinase in response to
-factor treatment, which peaks approximately 1 h after exposure to the pheromone (1, 8) (Fig. 7). An isogenic
mid2
mutant was greatly impaired in this activation. It
should be noted that the mid2
mutant survived pheromone
treatment for the duration of this experiment (not shown). Interestingly, the pheromone-induced death of the mid2
mutant was not suppressed by osmotic support (1 M sorbitol), in
contrast to pheromone-induced death of an mpk1
mutant
(8). This finding suggests that Mid2 may serve an additional
function beyond regulation of cell integrity signaling.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Mid2 is required for pheromone-induced activation of
Mpk1. Cultures of a cdc28-13 mid2 strain (DL2435) and an
isogenic MID2 strain (DL2393), both expressing Mpk1-HA from
episomal plasmid pNC507 (1), were arrested in G1
at 37°C and treated with mating pheromone (50 nM -factor;
t = 0). Mpk1-HA was immunoprecipitated from extracts of
cultures taken at the indicated time points. Immunocomplex protein
kinase assays were conducted with MBP as the substrate. Values
represent 32P-labeled MBP quantified by phosphorimager at
each time point relative to that for the MID2 extract assay
at t = 0. Each value is the average of two independent
experiments. Immunoblots of Mpk1-HA indicated that the levels of this
protein did not change during the course of the experiment (not
shown).
|
|
Hcs77 and Mid2 are highly glycosylated proteins.
Hsc77-HA is
predicted to migrate on SDS-PAGE with a molecular mass of approximately
43 kDa. Instead, it migrated as a diffuse band with apparent molecular
mass of 85 to 90 kDa, suggesting that Hcs77 is a highly glycosylated
protein (Fig. 4B). This protein possesses two potential N-glycosylation
sites (AsnSer/Thr) at positions 4 and 65, as well as many potential
O-glycosylation sites in the Ser/Thr-rich region. To examine the
glycosylation state of this protein, we first eliminated the potential
N-glycosylation sites by mutating the acceptor Asn residues to Gln.
Figure 8A shows that neither of the
single mutants nor the double mutant had an altered mobility,
indicating that Hcs77 is not N-glycosylated. Additionally, these
mutants were fully functional for complementation of an
hcs77
mutant (not shown).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 8.
Mid2 and Hcs77 are O-mannosylated. (A) Extracts (50 µg
of protein) of yeast strain 1788 expressing Hcs77 (lane 1), Hcs77-HA
(lane 2), Hcs77N4Q-HA (lane 3), Hcs77N65Q-HA
(lane 4), or Hcs77N4Q,N65Q-HA (lane 5) from YEp352 were
subjected to SDS-PAGE followed by immunoblot analysis. (B) Mid2-HA
(lanes 1 and 2) and Hcs77-HA (lanes 3 and 4) were immunoprecipitated
from extracts (100 µg of protein) of yeast strain 1788. Immunoprecipitates were either treated with -mannosidase at 37°C
for 3 h (lanes 2 and 4) or mock treated with buffer only under the
same conditions (lanes 1 and 3). Immunoprecipitates were subjected to
SDS-PAGE and immunoblot analysis. Sizes are indicated in kilodaltons.
IgG, immunoglobulin G.
|
|
The Mid2-HA protein behaved similarly to Hcs77-HA, having a predicted
molecular mass of approximately 45 kDa, but migrating
on SDS-PAGE with
a much greater apparent molecular mass (160 to
180 kDa [Fig.
4C]). To
examine these proteins for O-glycosylation,
we immunoprecipitated them
from cell extracts and subjected the
immunocomplexes to

-mannosidase
treatment. This treatment hydrolyzes
the

-linkages between residues
of O-linked mannose chains.

-Mannosidase
can also hydrolyze mannosyl
residues present at the termini of
N-linked GlcNAc chains. Figure
8B
shows that mannosidase treatment
reduced Mid2-HA to a species of
apparent molecular mass of approximately
45 kDa and reduced Hcs77-HA to
a species of approximately 40 to
42 kDa. The observed values are nearly
identical to the predicted
masses of the unmodified proteins,
confirming that Hcs77 (and
strongly suggesting that Mid2) is
specifically O-mannosylated.
 |
DISCUSSION |
MID2 and HCS77 act in parallel to stimulate
cell integrity signaling.
The HCS77 gene is thought to
encode a cell surface sensor that detects cell wall weakness during
vegetative growth. We isolated MID2 as a low-copy-number
dosage suppressor of the growth defect of an hcs77
mutant
at 39°C. Several additional observations support a model in which
Hcs77 and Mid2 are redundant sensors for cell integrity signaling
during growth. First, an hcs77
mid2
double mutant
displayed an osmotic remedial cell lysis defect that was much more
severe than that of an hcs77
mutant, failing to grow at
any temperature in the absence of osmotic support. Second, although
loss of MID2 function alone does not result in a growth defect (30), deletion of the MTL1 gene, which
encodes a Mid2-like protein (see below), in a mid2
mutant
resulted in an osmotic remedial cell lysis defect at 39°C that was
suppressed by overexpression of HCS77. Third, the ability to
activate cell integrity signaling at elevated growth temperature, as
measured by stimulation of the Mpk1 MAP kinase, was partially impaired
by deletion of HCS77, MID2, or MTL1.
Fourth, the structural similarity between Hcs77 and Mid2, together with
their intracellular colocalization, also suggests redundancy in
function. Specifically, they are both uniformly distributed through the
plasma membrane, presumably by virtue of their single membrane-spanning
regions. Additionally, they were both shown to be highly O-mannosylated
through long Ser/Thr-rich regions that are predicted to reside extracellularly.
Overexpression of either
RHO1 or
PKC1 suppresses
the growth defect of
hcs77
cells (
9,
38),
suggesting that these components
of the cell integrity pathway function
downstream of
HCS77. Similarly,
we found that overexpression
of
RHO1 also suppresses a
mid2
mutant.
However, overexpression of
MID2 was capable of suppressing
the
growth defect of one
rho1 mutant (
rho1-5). We
interpret this allele-specific
suppression to indicate that
MID2 is not capable of bypassing
the requirement for
RHO1 (either by acting downstream of or parallel
to this G
protein) but instead suppresses the
rho1-5 defect by
acting
upstream of this allele. Therefore, we propose that both
Hcs77 and Mid2
contribute to Rho1
activation.
MID2 is required for cell integrity signaling in
response to mating pheromone treatment.
The MID2 gene
was isolated initially because its loss of function causes cell death
in response to treatment with mating pheromone (30). Mutants
in MID2 arrest growth in G1 and undergo
morphogenesis in response to pheromone but fail to recover from this
arrest. Activation of cell integrity signaling is a late response to
pheromone treatment that, like MID2, is essential for
survival of pheromone-induced morphogenesis (8). In addition
to the role that Mid2 plays in signaling cell wall stress during
vegetative growth, we demonstrated that it is also critical for cell
integrity signaling during pheromone-induced morphogenesis.
Interestingly, in contrast to the behavior of an mpk1
mutant in response to pheromone (8), the pheromone
sensitivity of a mid2
mutant is not suppressed by the
addition of osmotic support to the medium (to prevent cell lysis),
suggesting that Mid2 may have an additional function in the survival of
pheromone treatment. Intriguingly, MID2 was also isolated as
a dosage suppressor of a strain with a mutation of MPT5
(37), which has been proposed to act through the Cdc28
cyclin-dependent kinase to stimulate passage through G1 in
pheromone-arrested cells (2). Therefore, Mid2 may have a
cell cycle function that is independent of its role in cell integrity
signaling. In contrast to Mid2, Hcs77 appears to be dedicated to
signaling cell wall perturbation during vegetative growth and thermal
stress, because a null mutant did not display sensitivity to killing by
mating pheromone (32a).
Hcs77 and Mid2 as sensors of cell wall stress.
The predicted
topography of these plasma membrane proteins, based on the positions of
their signal sequences, indicates that they have short C-terminal
cytoplasmic domains and longer extracellular domains that are very rich
in seryl and threonyl residues. These domains are separated by a single
transmembrane sequence. The extracellular domains are highly
O-mannosylated. In yeast, this modification consists of several (four
or five) mannosyl residues in
-1,2 and 1,3 linkages (36).
When many such modifications are present in a stretch of seryl/threonyl
residues, as appears to be the case for both Hcs77 and Mid2, they
induce the polypeptide to adopt a stiff and extended conformation
(17). Therefore, Hcs77 and Mid2 may function as molecular
probes that span the periplasmic space to interact directly with the
cell wall. If these proteins are glycosylated throughout their
Ser/Thr-rich regions, the calculated extents of Mid2 (ca. 470 Å) and
Hcs77 (ca. 370 Å) are adequate to span the distance from the plasma membrane to the cell wall (ca. 200 to 300 Å).
Mid2 and Hcs77 are predicted to have overlapping intracellular targets.
Paradoxically, however, their predicted intracellular
domains are not
similar at the level of primary sequence. They
may interact with
different complexes that share common signaling
components, or they may
be linked to the cell integrity signaling
apparatus through different
adaptor
molecules.
The Mid2 homolog, Mtl1.
We isolated a gene predicted to encode
a polypeptide showing 50% amino acid sequence identity with Mid2. Loss
of MTL1 function did not result in any overt defects, either
during vegetative growth or in response to mating pheromone, nor did it
exacerbate either the pheromone sensitivity of a mid2
mutant or the cell lysis defect of an hcs77
mutant.
However, a mid2
mtl1
mutant displayed a weak cell
lysis defect when cultivated at high temperature and was more impaired
for thermal activation of the Mpk1 MAP kinase than was a
mid2
mutant. Therefore, MTL1 appears to play a
minor role in cell integrity signaling during vegetative growth.
 |
ACKNOWLEDGMENTS |
We thank H. Iida, J. Gray, and S. Michaelis for strains and plasmids.
This work was supported by grants from the NIH (GM48533 to D.E.L. and
GM39852 to B. E. and training grant 5T32CA09110) and the American
Cancer Society (Faculty Research Award 446 to D.E.L.) and by Center
Grant ES-03819 from the NIEHS.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, The Johns Hopkins University, School of Public Health, 615 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-9825. Fax:
(410) 955-2926. E-mail:
levin{at}welchlink.welch.jhu.edu.
 |
REFERENCES |
| 1.
|
Buehrer, B. M., and B. Errede.
1997.
Coordination of the mating and cell integrity mitogen-activated protein kinase pathways in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:6517-6525[Abstract].
|
| 2.
|
Chen, T., and J. Kurjan.
1997.
Saccharomyces cerevisiae Mpt5p interacts with Sst2p and plays a role in pheromone sensitivity and recovery from pheromone arrest.
Mol. Cell. Biol.
17:3429-3439[Abstract].
|
| 3.
|
Cid, V. J.,
A. Duran,
F. Rey,
M. P. Snyder,
C. Nombela, and M. Sanchez.
1995.
Molecular basis of cell integrity and morphogenesis in Saccharomyces cerevisiae.
Microbiol. Rev.
59:345-386[Abstract/Free Full Text].
|
| 4.
|
Costigan, C.,
S. Gehrung, and M. Snyder.
1992.
A synthetic lethal screen identifies SLK1, a novel protein kinase homolog implicated in yeast cell morphogenesis and cell growth.
Mol. Cell. Biol.
12:1162-1178[Abstract/Free Full Text].
|
| 5.
|
Davenport, K. R.,
M. Sohaskey,
Y. Kamada, and D. E. Levin.
1995.
A second osmosensing signal transduction pathway in yeast.
J. Biol. Chem.
270:30157-30161[Abstract/Free Full Text].
|
| 6.
|
Douglas, C. M.,
F. Foor,
J. A. Marrinan,
N. Morin,
J. B. Nielsen,
A. M. Dahl,
P. Mazur,
W. Baginsky,
W. Li,
M. El-Sherbeini,
J. A. Clemas,
S. M. Mandala,
B. R. Frommer, and M. B. Kurtz.
1994.
The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3- -D-glucan synthase.
Proc. Natl. Acad. Sci. USA
91:12907-12911[Abstract/Free Full Text].
|
| 7.
|
Drgonova, J.,
T. Drgon,
K. Tanaka,
R. Kollar,
G.-C. Chen,
R. A. Ford,
C. S. M. Chan,
Y. Takai, and E. Cabib.
1996.
Rho1p, a yeast protein at the interface between cell polarization and morphogenesis.
Science
272:277-279[Abstract].
|
| 8.
|
Errede, B.,
R. M. Cade,
B. M. Yashar,
Y. Kamada,
D. E. Levin,
K. Irie, and K. Matsomoto.
1995.
Dynamics and organization of MAP kinase signal pathways.
Mol. Reprod. Dev.
42:477-485[Medline].
|
| 9.
|
Gray, J. V.,
J. P. Ogas,
Y. Kamada,
M. Stone,
D. E. Levin, and I. Herskowitz.
1997.
A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator.
EMBO J.
16:4924-4937[Medline].
|
| 10.
|
Hill, J. E.,
A. M. Muers,
T. J. Koerner, and A. Tzagoloff.
1986.
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast
2:163-167[Medline].
|
| 11.
|
Ho, S.-N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 12.
|
Iida, H.,
H. Nakamura,
T. Ono,
M. S. Okumura, and Y. Anraku.
1994.
MID1, a novel Saccharomyces cerevisiae gene encoding a plasma membrane protein, is required for Ca2+ influx and mating.
Mol. Cell. Biol.
14:8259-8271[Abstract/Free Full Text].
|
| 13.
|
Inoue, S. B.,
N. Takewaki,
T. Takasuka,
T. Mio,
M. Adachi,
Y. Fujii,
C. Miyamoto,
M. Arisawa,
Y. Furuichi, and T. Watanabe.
1995.
Characterization and gene cloning of 1,3- -D-glucan synthase from Saccharomyces cerevisiae.
Eur. J. Biochem.
231:845-854[Medline].
|
| 14.
|
Irie, K.,
M. Takase,
K. S. Lee,
D. E. Levin,
H. Araki,
K. Matsumoto, and Y. Oshima.
1993.
MKK1 and MKK2, which encode Saccharomyces cerevisiae mitogen-activated protein kinase-kinase homologs, function in the pathway mediated by protein kinase C.
Mol. Cell. Biol.
13:3076-3083[Abstract/Free Full Text].
|
| 15.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 16.
|
Jacoby, J. J.,
S. M. Nilius, and J. J. Heinisch.
1998.
A screen for upstream components of the yeast protein kinase C signal transduction pathway identifies the product of the SLG1 gene.
Mol. Gen. Genet.
258:148-155[Medline].
|
| 17.
|
Jentoft, N.
1990.
Why are proteins O-glycosylated.
Trends Biochem. Sci.
15:291-294[Medline].
|
| 18.
|
Kamada, Y.,
U. S. Jung,
J. Piotrowski, and D. E. Levin.
1995.
The protein kinase C-activated MAP kinase pathway of Saccharomyces cerevisiae mediates a novel aspect of the heat shock response.
Genes Dev.
9:1559-1571[Abstract/Free Full Text].
|
| 19.
|
Kamada, Y.,
H. Qadota,
C. P. Python,
Y. Anraku,
Y. Ohya, and D. E. Levin.
1996.
Activation of yeast protein kinase C by Rho1 GTPase.
J. Biol. Chem.
271:9193-9195[Abstract/Free Full Text].
|
| 20.
|
Klis, F. M.
1994.
Review: cell wall assembly in yeast.
Yeast
10:851-869[Medline].
|
| 21.
|
Lee, K. S.,
K. Irie,
Y. Gotoh,
Y. Watanabe,
H. Araki,
E. Nishida,
K. Matsumoto, and D. E. Levin.
1993.
A yeast mitogen-activated protein kinase homolog (Mpk1) mediates signaling by protein kinase C.
Mol. Cell. Biol.
13:3067-3075[Abstract/Free Full Text].
|
| 22.
|
Lee, K. S., and D. E. Levin.
1992.
Dominant mutations in a gene encoding a putative protein kinase (BCK1) bypass the requirement for a Saccharomyces cerevisiae protein kinase C homolog.
Mol. Cell. Biol.
12:172-182[Abstract/Free Full Text].
|
| 23.
|
Levin, D. E., and E. Bartlett-Heubusch.
1992.
Mutants in the S. cerevisiae PKC1 gene display a cell cycle-specific osmotic stability defect.
J. Cell Biol.
116:1221-1229[Abstract/Free Full Text].
|
| 24.
|
Levin, D. E.,
B. Bowers,
C. Chen,
Y. Kamada, and M. Watanabe.
1994.
Dissecting the protein kinase C/MAP kinase signalling pathway of Saccharomyces cerevisiae.
Cell. Mol. Biol. Res.
40:229-239[Medline].
|
| 25.
|
Levin, D. E., and B. Errede.
1995.
The proliferation of MAP kinase signaling pathways in yeast.
Curr. Opin. Cell Biol.
7:197-202[Medline].
|
| 26.
|
Levin, D. E.,
F. O. Fields,
R. Kunisawa,
J. M. Bishop, and J. Thorner.
1990.
A candidate protein kinase C gene PKC1, is required for the S. cerevisiae cell cycle.
Cell
62:213-224[Medline].
|
| 27.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 28.
|
Mazur, P.,
N. Morin,
W. Baginsky,
M. El-Sherbeini,
J. A. Clemas,
J. B. Nielsen, and F. Foor.
1995.
Differential expression and function of two homologous subunits of yeast 1,3- -D-glucan synthase.
Mol. Cell. Biol.
15:5671-5681[Abstract].
|
| 29.
|
Nonaka, H.,
K. Tanaka,
H. Hirano,
T. Fujiwara,
H. Kohno,
M. Umikawa,
A. Mino, and Y. Takai.
1995.
A downstream target of RHO1 small GTP-binding protein is PKC1, a homolog of protein kinase C, which leads to activation of the MAP kinase cascade in Saccharomyces cerevisiae.
EMBO J.
14:5931-5938[Medline].
|
| 30.
|
Ono, T.,
T. Suzuki,
Y. Anraku, and H. Iida.
1994.
The MID2 gene encodes a putative integral membrane protein with a Ca(2+)-binding domain and shows mating pheromone-stimulated expression in Saccharomyces cerevisiae.
Gene
151:203-208[Medline].
|
| 31.
|
Paravicini, G.,
M. Cooper,
L. Friedli,
D. J. Smith,
J.-L. Carpentier,
L. S. Klig, and M. A. Payton.
1992.
The osmotic integrity of the yeast cell requires a functional PKC1 gene product.
Mol. Cell Biol.
12:4896-4905[Abstract/Free Full Text].
|
| 32.
|
Qadota, H.,
C. P. Python,
S. B. Inoue,
M. Arisawa,
Y. Anraku,
Y. Zheng,
T. Watanabe,
D. E. Levin, and Y. Ohya.
1996.
Identification of yeast Rho1p GTPase as a regulatory subunit of 1,3- -glucan synthase.
Science
272:279-281[Abstract].
|
| 32a.
| Rajavel, M. Unpublished results.
|
| 33.
|
Ram, A. F. J.,
S. S. C. Brekelmans,
L. J. W. M. Oehlen, and F. M. Klis.
1995.
Identification of two cell cycle regulated genes affecting the -1,3-glucan content of cell wall in Saccharomyces cerevisiae.
FEBS Lett.
358:165-170[Medline].
|
| 34.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 35.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 36.
|
Strahl-Bolsinger, S.,
M. Gentzsch, and W. Tanner.
1999.
Protein O-mannosylation.
Biochim. Biophys. Acta
1426:297-307[Medline].
|
| 37.
|
Takeuchi, J.,
M. Okada,
A. Toh-e, and Y. Kikuchi.
1995.
The SMS1 gene encoding a serine-rich transmembrane protein suppresses the temperature sensitivity of the htr1 disruptant of Saccharomyces cerevisiae.
Biochim. Biophys. Acta
1260:94-96[Medline].
|
| 38.
|
Verna, J.,
A. Lodder,
K. Lee,
A. Vagts, and R. Ballester.
1997.
A family of genes required for the maintenance of cell wall integrity and for the stress response in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
94:13804-13809[Abstract/Free Full Text].
|
| 39.
|
Watanabe, M.,
C.-Y. Chen, and D. E. Levin.
1994.
Saccharomyces cerevisiae PKC1 encodes a protein kinase C (PKC) homolog with a substrate specificity similar to that of mammalian PKC.
J. Biol. Chem.
269:16829-16836[Abstract/Free Full Text].
|
| 40.
|
Wilson, I. A.,
H. L. Niman,
R. A. Houghten,
A. R. Cherenson,
M. L. Connolly, and R. A. Lerner.
1984.
The structure of an antigenic determinant in a protein.
Cell
37:767-778[Medline].
|
| 41.
|
Zhao, C.,
U. S. Jung,
P. Garrett-Engele,
T. Y. Roe,
M. S. Cyert, and D. E. Levin.
1998.
Temperature-induced expression of yeast FKS2 is under the dual control of protein kinase C and calcineurin.
Mol. Cell. Biol.
18:1013-1022[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 1999, p. 3969-3976, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Birkaya, B., Maddi, A., Joshi, J., Free, S. J., Cullen, P. J.
(2009). Role of the Cell Wall Integrity and Filamentous Growth Mitogen-Activated Protein Kinase Pathways in Cell Wall Remodeling during Filamentous Growth. Eukaryot Cell
8: 1118-1133
[Abstract]
[Full Text]
-
Zhang, L., Feng, D., Fang, W., Ouyang, H., Luo, Y., Du, T., Jin, C.
(2009). Comparative proteomic analysis of an Aspergillus fumigatus mutant deficient in glucosidase I (AfCwh41). Microbiology
155: 2157-2167
[Abstract]
[Full Text]
-
Garcia, R., Rodriguez-Pena, J. M., Bermejo, C., Nombela, C., Arroyo, J.
(2009). The High Osmotic Response and Cell Wall Integrity Pathways Cooperate to Regulate Transcriptional Responses to Zymolyase-induced Cell Wall Stress in Saccharomyces cerevisiae. J. Biol. Chem.
284: 10901-10911
[Abstract]
[Full Text]
-
Hasegawa, Y., Irie, K., Gerber, A. P.
(2008). Distinct roles for Khd1p in the localization and expression of bud-localized mRNAs in yeast. RNA
14: 2333-2347
[Abstract]
[Full Text]
-
Bermejo, C., Rodriguez, E., Garcia, R., Rodriguez-Pena, J. M., Rodriguez de la Concepcion, M. L., Rivas, C., Arias, P., Nombela, C., Posas, F., Arroyo, J.
(2008). The Sequential Activation of the Yeast HOG and SLT2 Pathways Is Required for Cell Survival to Cell Wall Stress. Mol. Biol. Cell
19: 1113-1124
[Abstract]
[Full Text]
-
Fujioka, T., Mizutani, O., Furukawa, K., Sato, N., Yoshimi, A., Yamagata, Y., Nakajima, T., Abe, K.
(2007). MpkA-Dependent and -Independent Cell Wall Integrity Signaling in Aspergillus nidulans. Eukaryot Cell
6: 1497-1510
[Abstract]
[Full Text]
-
Hutzler, J., Schmid, M., Bernard, T., Henrissat, B., Strahl, S.
(2007). Membrane association is a determinant for substrate recognition by PMT4 protein O-mannosyltransferases. Proc. Natl. Acad. Sci. USA
104: 7827-7832
[Abstract]
[Full Text]
-
Wright, C. M., Fewell, S. W., Sullivan, M. L., Pipas, J. M., Watkins, S. C., Brodsky, J. L.
(2007). The Hsp40 Molecular Chaperone Ydj1p, Along With the Protein Kinase C Pathway, Affects Cell-Wall Integrity in the Yeast Saccharomyces cerevisiae. Genetics
175: 1649-1664
[Abstract]
[Full Text]
-
Park, H.-O., Bi, E.
(2007). Central Roles of Small GTPases in the Development of Cell Polarity in Yeast and Beyond. Microbiol. Mol. Biol. Rev.
71: 48-96
[Abstract]
[Full Text]
-
Stewart, M. S., Krause, S. A., McGhie, J., Gray, J. V.
(2007). Mpt5p, a Stress Tolerance- and Lifespan-Promoting PUF Protein in Saccharomyces cerevisiae, Acts Upstream of the Cell Wall Integrity Pathway. Eukaryot Cell
6: 262-270
[Abstract]
[Full Text]
-
Piao, H. L., Machado, I. M.P., Payne, G. S.
(2007). NPFXD-mediated Endocytosis Is Required for Polarity and Function of a Yeast Cell Wall Stress Sensor. Mol. Biol. Cell
18: 57-65
[Abstract]
[Full Text]
-
Serrano, R., Martin, H., Casamayor, A., Arino, J.
(2006). Signaling Alkaline pH Stress in the Yeast Saccharomyces cerevisiae through the Wsc1 Cell Surface Sensor and the Slt2 MAPK Pathway. J. Biol. Chem.
281: 39785-39795
[Abstract]
[Full Text]
-
Lesage, G., Bussey, H.
(2006). Cell Wall Assembly in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
70: 317-343
[Abstract]
[Full Text]
-
Lottersberger, F., Panza, A., Lucchini, G., Piatti, S., Longhese, M. P.
(2006). The Saccharomyces cerevisiae 14-3-3 Proteins Are Required for the G1/S Transition, Actin Cytoskeleton Organization and Cell Wall Integrity. Genetics
173: 661-675
[Abstract]
[Full Text]
-
Fernandes, H., Roumanie, O., Claret, S., Gatti, X., Thoraval, D., Doignon, F., Crouzet, M.
(2006). The Rho3 and Rho4 small GTPases interact functionally with Wsc1p, a cell surface sensor of the protein kinase C cell-integrity pathway in Saccharomyces cerevisiae.. Microbiology
152: 695-708
[Abstract]
[Full Text]
-
Claret, S., Gatti, X., Doignon, F., Thoraval, D., Crouzet, M.
(2005). The Rgd1p Rho GTPase-Activating Protein and the Mid2p Cell Wall Sensor Are Required at Low pH for Protein Kinase C Pathway Activation and Cell Survival in Saccharomyces cerevisiae. Eukaryot Cell
4: 1375-1386
[Abstract]
[Full Text]
-
Levin, D. E.
(2005). Cell Wall Integrity Signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
69: 262-291
[Abstract]
[Full Text]
-
Imazu, H., Sakurai, H.
(2005). Saccharomyces cerevisiae Heat Shock Transcription Factor Regulates Cell Wall Remodeling in Response to Heat Shock. Eukaryot Cell
4: 1050-1056
[Abstract]
[Full Text]
-
Vilella, F., Herrero, E., Torres, J., de la Torre-Ruiz, M. A.
(2005). Pkc1 and the Upstream Elements of the Cell Integrity Pathway in Saccharomyces cerevisiae, Rom2 and Mtl1, Are Required for Cellular Responses to Oxidative Stress. J. Biol. Chem.
280: 9149-9159
[Abstract]
[Full Text]
-
Vay, H. A., Philip, B., Levin, D. E.
(2004). Mutational analysis of the cytoplasmic domain of the Wsc1 cell wall stress sensor. Microbiology
150: 3281-3288
[Abstract]
[Full Text]
-
Wang, K., Vavassori, S., Schweizer, L. M., Schweizer, M.
(2004). Impaired PRPP-synthesizing capacity compromises cell integrity signalling in Saccharomyces cerevisiae. Microbiology
150: 3327-3339
[Abstract]
[Full Text]
-
Gray, J. V., Petsko, G. A., Johnston, G. C., Ringe, D., Singer, R. A., Werner-Washburne, M.
(2004). "Sleeping Beauty": Quiescence in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
68: 187-206
[Abstract]
[Full Text]
-
Garcia, R., Bermejo, C., Grau, C., Perez, R., Rodriguez-Pena, J. M., Francois, J., Nombela, C., Arroyo, J.
(2004). The Global Transcriptional Response to Transient Cell Wall Damage in Saccharomyces cerevisiae and Its Regulation by the Cell Integrity Signaling Pathway. J. Biol. Chem.
279: 15183-15195
[Abstract]
[Full Text]
-
Proszynski, T. J., Simons, K., Bagnat, M.
(2004). O-Glycosylation as a Sorting Determinant for Cell Surface Delivery in Yeast. Mol. Biol. Cell
15: 1533-1543
[Abstract]
[Full Text]
-
Merchan, S., Bernal, D., Serrano, R., Yenush, L.
(2004). Response of the Saccharomyces cerevisiae Mpk1 Mitogen-Activated Protein Kinase Pathway to Increases in Internal Turgor Pressure Caused by Loss of Ppz Protein Phosphatases. Eukaryot Cell
3: 100-107
[Abstract]
[Full Text]
-
Lommel, M., Bagnat, M., Strahl, S.
(2004). Aberrant Processing of the WSC Family and Mid2p Cell Surface Sensors Results in Cell Death of Saccharomyces cerevisiae O-Mannosylation Mutants. Mol. Cell. Biol.
24: 46-57
[Abstract]
[Full Text]
-
Reinoso-Martin, C., Schuller, C., Schuetzer-Muehlbauer, M., Kuchler, K.
(2003). The Yeast Protein Kinase C Cell Integrity Pathway Mediates Tolerance to the Antifungal Drug Caspofungin through Activation of Slt2p Mitogen-Activated Protein Kinase Signaling. Eukaryot Cell
2: 1200-1210
[Abstract]
[Full Text]
-
deHart, A. K.A., Schnell, J. D., Allen, D. A., Tsai, J.-Y., Hicke, L.
(2003). Receptor Internalization in Yeast Requires the Tor2-Rho1 Signaling Pathway. Mol. Biol. Cell
14: 4676-4684
[Abstract]
[Full Text]
-
Bonilla, M., Cunningham, K. W.
(2003). Mitogen-activated Protein Kinase Stimulation of Ca2+ Signaling Is Required for Survival of Endoplasmic Reticulum Stress in Yeast. Mol. Biol. Cell
14: 4296-4305
[Abstract]
[Full Text]
-
Shepard, K. A., Gerber, A. P., Jambhekar, A., Takizawa, P. A., Brown, P. O., Herschlag, D., DeRisi, J. L., Vale, R. D.
(2003). Widespread cytoplasmic mRNA transport in yeast: Identification of 22 bud-localized transcripts using DNA microarray analysis. Proc. Natl. Acad. Sci. USA
100: 11429-11434
[Abstract]
[Full Text]
-
Valdivia, R. H., Schekman, R.
(2003). The yeasts Rho1p and Pkc1p regulate the transport of chitin synthase III (Chs3p) from internal stores to the plasma membrane. Proc. Natl. Acad. Sci. USA
100: 10287-10292
[Abstract]
[Full Text]
-
Green, R., Lesage, G., Sdicu, A.-M., Menard, P., Bussey, H.
(2003). A synthetic analysis of the Saccharomyces cerevisiae stress sensor Mid2p, and identification of a Mid2p-interacting protein, Zeo1p, that modulates the PKC1-MPK1 cell integrity pathway. Microbiology
149: 2487-2499
[Abstract]
[Full Text]
-
Lagorce, A., Hauser, N. C., Labourdette, D., Rodriguez, C., Martin-Yken, H., Arroyo, J., Hoheisel, J. D., Francois, J.
(2003). Genome-wide Analysis of the Response to Cell Wall Mutations in the Yeast Saccharomyces cerevisiae. J. Biol. Chem.
278: 20345-20357
[Abstract]
[Full Text]
-
Romeo, M. J., Angus-Hill, M. L., Sobering, A. K., Kamada, Y., Cairns, B. R., Levin, D. E.
(2002). HTL1 Encodes a Novel Factor That Interacts with the RSC Chromatin Remodeling Complex in Saccharomyces cerevisiae. Mol. Cell. Biol.
22: 8165-8174
[Abstract]
[Full Text]
-
Torres, J., Di Como, C. J., Herrero, E., de la Torre-Ruiz, M. A.
(2002). Regulation of the Cell Integrity Pathway by Rapamycin-sensitive TOR Function in Budding Yeast. J. Biol. Chem.
277: 43495-43504
[Abstract]
[Full Text]
-
Zhang, M., Bennett, D., Erdman, S. E.
(2002). Maintenance of Mating Cell Integrity Requires the Adhesin Fig2p. Eukaryot Cell
1: 811-822
[Abstract]
[Full Text]
-
Sekiya-Kawasaki, M., Abe, M., Saka, A., Watanabe, D., Kono, K., Minemura-Asakawa, M., Ishihara, S., Watanabe, T., Ohya, Y.
(2002). Dissection of Upstream Regulatory Components of the Rho1p Effector, 1,3-{beta}-Glucan Synthase, in Saccharomyces cerevisiae. Genetics
162: 663-676
[Abstract]
[Full Text]
-
Hahn, J.-S., Thiele, D. J.
(2002). Regulation of the Saccharomyces cerevisiae Slt2 Kinase Pathway by the Stress-inducible Sdp1 Dual Specificity Phosphatase. J. Biol. Chem.
277: 21278-21284
[Abstract]
[Full Text]
-
Hohmann, S.
(2002). Osmotic Stress Signaling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev.
66: 300-372
[Abstract]
[Full Text]
-
Chai, B., Hsu, J.-m., Du, J., Laurent, B. C.
(2002). Yeast RSC Function Is Required for Organization of the Cellular Cytoskeleton via an Alternative PKC1 Pathway. Genetics
161: 575-584
[Abstract]
[Full Text]
-
Sobering, A. K., Jung, U. S., Lee, K. S., Levin, D. E.
(2002). Yeast Rpi1 Is a Putative Transcriptional Regulator That Contributes to Preparation for Stationary Phase. Eukaryot Cell
1: 56-65
[Abstract]
[Full Text]
-
Schmitz, H.-P., Huppert, S., Lorberg, A., Heinisch, J. J.
(2002). Rho5p downregulates the yeast cell integrity pathway. J. Cell Sci.
115: 3139-3148
[Abstract]
[Full Text]
-
de Bettignies, G., Thoraval, D., Morel, C., Peypouquet, M. F., Crouzet, M.
(2001). Overactivation of the Protein Kinase C-Signaling Pathway Suppresses the Defects of Cells Lacking the Rho3/Rho4-GAP Rgd1p in Saccharomyces cerevisiae. Genetics
159: 1435-1448
[Abstract]
[Full Text]
-
Santos, J. L., Shiozaki, K.
(2001). Fungal Histidine Kinases. Sci Signal
2001: re1-re1
[Abstract]
[Full Text]
-
Trotter, E. W., Berenfeld, L., Krause, S. A., Petsko, G. A., Gray, J. V.
(2001). Protein misfolding and temperature up-shift cause G1 arrest via a common mechanism dependent on heat shock factor in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
98: 7313-7318
[Abstract]
[Full Text]
-
Smits, G. J., van den Ende, H., Klis, F. M.
(2001). Differential regulation of cell wall biogenesis during growth and development in yeast. Microbiology
147: 781-794
[Full Text]
-
Philip, B., Levin, D. E.
(2001). Wsc1 and Mid2 Are Cell Surface Sensors for Cell Wall Integrity Signaling That Act through Rom2, a Guanine Nucleotide Exchange Factor for Rho1. Mol. Cell. Biol.
21: 271-280
[Abstract]
[Full Text]
-
Marcoux, N., Cloutier, S., Zakrzewska, E., Charest, P.-M., Bourbonnais, Y., Pallotta, D.
(2000). Suppression of the Profilin-Deficient Phenotype by the RHO2 Signaling Pathway in Saccharomyces cerevisiae. Genetics
156: 579-592
[Abstract]
[Full Text]
-
de Nobel, H., Ruiz, C., Martin, H., Morris, W., Brul, S., Molina, M., Klis, F. M.
(2000). Cell wall perturbation in yeast results in dual phosphorylation of the Slt2/Mpk1 MAP kinase and in an Slt2-mediated increase in FKS2-lacZ expression, glucanase resistance and thermotolerance. Microbiology
146: 2121-2132
[Abstract]
[Full Text]
-
Li, Y., Moir, R. D., Sethy-Coraci, I. K., Warner, J. R., Willis, I. M.
(2000). Repression of Ribosome and tRNA Synthesis in Secretion-Defective Cells Is Signaled by a Novel Branch of the Cell Integrity Pathway. Mol. Cell. Biol.
20: 3843-3851
[Abstract]
[Full Text]
-
Turchini, A., Ferrario, L., Popolo, L.
(2000). Increase of External Osmolarity Reduces Morphogenetic Defects and Accumulation of Chitin in a gas1 Mutant of Saccharomyces cerevisiae. J. Bacteriol.
182: 1167-1171
[Abstract]
[Full Text]
-
Roberts, C. J., Nelson, B., Marton, M. J., Stoughton, R., Meyer, M. R., Bennett, H. A., He, Y. D., Dai, H., Walker, W. L., Hughes, T. R., Tyers, M., Boone, C., Friend, S. H.
(2000). Signaling and Circuitry of Multiple MAPK Pathways Revealed by a Matrix of Global Gene Expression Profiles. Science
287: 873-880
[Abstract]
[Full Text]
-
Martin, H., Rodriguez-Pachon, J. M., Ruiz, C., Nombela, C., Molina, M.
(2000). Regulatory Mechanisms for Modulation of Signaling through the Cell Integrity Slt2-mediated Pathway in Saccharomyces cerevisiae. J. Biol. Chem.
275: 1511-1519
[Abstract]
[Full Text]
-
Pruyne, D, Bretscher, A
(2000). Polarization of cell growth in yeast. I. Establishment and maintenance of polarity states. J. Cell Sci.
113: 365-375
[Abstract]
-
Andrews, P., Stark, M.
(2000). Type 1 protein phosphatase is required for maintenance of cell wall integrity, morphogenesis and cell cycle progression in Saccharomyces cerevisiae. J. Cell Sci.
113: 507-520
[Abstract]
-
Mattison, C. P., Spencer, S. S., Kresge, K. A., Lee, J., Ota, I. M.
(1999). Differential Regulation of the Cell Wall Integrity Mitogen-Activated Protein Kinase Pathway in Budding Yeast by the Protein Tyrosine Phosphatases Ptp2 and Ptp3. Mol. Cell. Biol.
19: 7651-7660
[Abstract]
[Full Text]
-
Delley, P.-A., Hall, M. N.
(1999). Cell Wall Stress Depolarizes Cell Growth via Hyperactivation of Rho1. JCB
147: 163-174
[Abstract]
[Full Text]
-
Atienza, J. M., Suh, M., Xenarios, I., Landgraf, R., Colicelli, J.
(2000). Human ERK1 Induces Filamentous Growth and Cell Wall Remodeling Pathways in Saccharomyces cerevisiae. J. Biol. Chem.
275: 20638-20646
[Abstract]
[Full Text]
-
Cabib, E., Roh, D.-H., Schmidt, M., Crotti, L. B., Varma, A.
(2001). The Yeast Cell Wall and Septum as Paradigms of Cell Growth and Morphogenesis. J. Biol. Chem.
276: 19679-19682
[Full Text]