Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 3969-3976, Vol. 19, No. 6
Department of Biochemistry, School of Public
Health, The Johns Hopkins University, Baltimore, Maryland
21205,1 and Department of Biochemistry
and Biophysics, University of North Carolina, Chapel Hill, North
Carolina 275992
Received 19 January 1999/Returned for modification 10 February
1999/Accepted 4 March 1999
Hcs77 is a putative cell surface sensor for cell integrity
signaling in Saccharomyces cerevisiae. Its loss of function
results in cell lysis during growth at elevated temperatures (e.g.,
39°C) and impaired signaling to the Mpk1 mitogen-activated protein
kinase in response to mild heat shock. We isolated the MID2
gene as a dosage suppressor of the cell lysis defect of an
hcs77 null mutant. MID2 encodes a putative
membrane protein whose function is required for survival of pheromone
treatment. Mid2 possesses properties similar to those of Hcs77,
including a single transmembrane domain and a long region that is rich
in seryl and threonyl residues. We demonstrate that Mid2 is required
for cell integrity signaling in response to pheromone. Additionally, we
show that Mid2 and Hcs77 serve a redundant but essential function as
cell surface sensors for cell integrity signaling during vegetative
growth. Both proteins are uniformly distributed through the plasma
membrane and are highly O-mannosylated on their extracellular domains. Finally, we identified a yeast homolog of MID2, designated
MTL1, which provides a partially redundant function with
MID2 for cell integrity signaling during vegetative growth
at elevated temperature but not for survival of pheromone treatment. We
conclude that Hcs77 is dedicated to signaling cell wall stress during
vegetative growth and that Mid2 participates in this signaling, but its
primary role is in signaling wall stress during pheromone-induced morphogenesis.
The cell wall of the budding yeast
Saccharomyces cerevisiae is required to maintain cell shape
and integrity (3, 20). The cell must remodel this rigid
structure during vegetative growth and during pheromone-induced
morphogenesis. Wall remodeling is monitored and regulated by the cell
integrity signaling pathway controlled by the Rho1 GTPase. Two
essential functions have been identified for Rho1. First, it serves as
an integral regulatory subunit of the 1,3- A second essential function of Rho1 is to bind and activate protein
kinase C (19, 29), which is encoded by PKC1
(26, 39). Loss of PKC1 function, or of any of the
components of the mitogen-activated protein (MAP) kinase cascade under
its control (25), results in a cell lysis defect that is
attributable to a deficiency in cell wall construction (23, 24,
31). The MAP kinase cascade is a linear pathway comprised of a
MEK kinase (BCK1 [4, 22]), a pair of
redundant MEKs (MKK1/2 [14]), and a MAP
kinase (MPK1 [21]). One of the consequences
of signaling through the MAP kinase cascade is transcriptional
activation of FKS2 (41).
Cell integrity signaling is induced in response to several
environmental stimuli. First, signaling is activated persistently in
response to growth at elevated temperatures (e.g., 37 to 39°C [18]), consistent with the finding that null mutants
in many of the pathway components display cell lysis defects only when cultivated at high temperatures. Second, hypo-osmotic shock induces a
rapid but transient activation of signaling (5, 18).
Finally, treatment with mating pheromone stimulates signaling at a time that is coincident with the onset of morphogenesis (1, 8). Indeed, mutants defective in cell integrity signaling undergo cell
lysis during pheromone-induced morphogenesis (8).
The mechanism by which information regarding the state of the cell wall
is transmitted to the intracellular signaling apparatus remains an open
question. Recently, a gene encoding a putative cell surface sensor for
the activation of cell integrity signaling was described and variously
designated HCS77 (9), WSC1
(38), and SLG1 (16). Loss of function
of HCS77 results in a cell lysis defect that is less severe
than that observed for other components of the cell integrity signaling
pathway (9, 16, 38), suggesting that its function may be
partially redundant. Indeed, several HCS77 homologs
(WSC2, -3, and -4, exist in budding yeast.
WSC2 and WSC3 have been reported to contribute to
cell integrity signaling to a lesser degree than HCS77
(38). In our hands, mutants in these genes in combination
with hcs77 have only a modest effect on the severity of the
cell lysis defect. Moreover, residual signaling to the Mpk1 MAP kinase
is evident even in an hcs77 wsc2 wsc3 triple mutant
(38), indicating that these signaling components serve a
partially redundant function with another unidentified sensor. Here we
present evidence that the Mid2 protein is a cell surface sensor for
cell integrity signaling, which together with Hcs77 provides an
essential function during vegetative growth. Additionally, we
demonstrate that Mid2 is required for activation of this signaling pathway in response to pheromone-induced morphogenesis.
Strains, growth conditions, and transformations.
The
S. cerevisiae strains used in this study are listed in Table
1. Yeast cultures were grown in YEPD (1%
Bacto Yeast Extract, 2% Bacto Peptone, 2% glucose). Synthetic minimal
(SD) medium (34) supplemented with the appropriate nutrients
was used to select for plasmid maintenance and gene replacement. Yeast
transformations were carried out by the lithium acetate method
(15). Escherichia coli DH5
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mid2 Is a Putative Sensor for Cell Integrity
Signaling in Saccharomyces cerevisiae
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-glucan synthase (GS)
complex that stimulates GS activity in a GTP-dependent manner (7,
32). A pair of closely related genes, FKS1 and
FKS2, encode alternative catalytic subunits of the GS
complex (6, 13, 28, 33) that are the presumed targets of
Rho1 activity.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
was used for the
propagation of all plasmids. E. coli cells were cultured in
Luria broth medium (1% Bacto Tryptone, 0.5% Bacto Yeast Extract, 1%
NaCl) and transformed by standard methods (27).
TABLE 1.
S. cerevisiae strains used
Isolation of MID2 and MTL1.
S.
cerevisiae DL1987 (hcs77
) was transformed with a
plasmid library of genomic yeast DNA (from strain DL2040) in
centromeric vector pRS316 (35), constructed as described
previously (22). Transformants were grown at room
temperature and replicated onto YEPD at 38°C for 2 days. Plasmids
were rescued from colonies arising at the nonpermissive temperature.
Clone pRM5.2 contained an 8.4-kb insert that included three complete
open reading frames (ORFs). In this clone, the MID2 gene was
flanked by YLR331C and RPS31. A
BglII-BamHI subclone that possesses
MID2 and YLR331C was suppression competent. A 3' truncation
of MID2 (by SnaBI) eliminated the suppression activity of this clone.
Genomic deletions of MID2 and MTL1.
For construction of the mid2 allele, plasmid
pRS315[mid2::URA3] (provided by H. Iida) was digested
with XhoI and SspI, and the resultant 1.6-kb
fragment was purified and used to transform yeast strains DL2256 and
DL2393. Transformants of DL2256 were sporulated, and tetrad analysis
was carried out on YEPD with or without 10% sorbitol. Deletion of
MID2 was confirmed by PCR in both strains.
::HIS4, was digested with BssHII to
liberate a 6.4-kb fragment, which was used to transform yeast strain
DL2337. Deletion of MTL1 was confirmed by PCR.
Pheromone-induced killing.
To test for sensitivity to
killing by -factor, MATa strains were grown in
synthetic minimal medium containing limiting calcium (100 µM
CaCl2) (12) for 24 h, subcultured in the
same medium, and grown to an A600 of 0.5 to 1.0 (5 × 106 to 1 × 107 cells/ml).
Cells were then treated with -factor (8 µg/ml; Sigma), and
viability was measured over time by plating onto YEPD.
Construction of MID2 and HCS77 fusions to green fluorescent protein (GFP) and the hemagglutinin (HA) epitope. Mid2 was tagged at its C terminus with a UV-optimized variant of GFP, GFPuv. In the first of two steps, the GFPuv coding sequence (711 bp, including the stop codon) was amplified by PCR from pGFPuv (Clontech), with three additional guanosyl residues at the 5' end. This fragment was blunt-end inserted into the SmaI site of pRS315 (35) so as to regenerate a single SmaI site immediately 5' of the GFPuv sequence. Next, a 1.9-kb fragment including MID2 with 760 bp of 5' noncoding sequence (amplified from pRM5.2) but without its stop codon was blunt-end inserted into the SmaI site of pRS315[GFPuv]. This construct (pMID2-GFP) expressed GFPuv fused to the C terminus of Mid2 with an additional glycyl residue at the fusion point.
Mid2 and Hcs77 were tagged at their C termini with the 3xHA (three-repeat HA) epitope (40). In the first of two steps, the 3xHA sequence from PKC1-HA (39) was amplified together with 250 bp of 3' noncoding sequence from the PKC1 transcriptional terminator and inserted into the SmaI site of YEp352 (10) so as to regenerate a single SmaI site immediately 5' to the epitope sequence. Next, MID2 (same fragment as above) and HCS77 sequences (including 600 bp 5' to the translational start site) were amplified through the final coding base (excluding the stop codon), and blunt-end inserted into the SmaI site of YEp352[3xHA]. The resultant clones fused the 3xHA epitope, in frame with an additional glycine residue, to the C termini of Mid2 and Hcs77.Construction of N-glycosylation site mutants. Hcs77-HA N-glycosylation mutants N4Q and N65Q were constructed by site-directed mutagenesis using the PCR overlap extension method (11). Pairs of complementary mutagenic primers (AAATAATGAGACCGCAAAAAACAAGTCTGC and its reverse complement for the N4Q mutation; CTTTGCCCTTTATCAACATTCAGAATGTTA and its reverse complement for the N65Q mutation) were used in separate PCRs with primers either 5' or 3' to the coding sequence to generate overlapping 5' and 3' regions of HCS77-HA, using YEp352[HCS77-HA] as the template. The products of those reactions were combined in a third reaction to amplify the full-length mutated alleles, which were then digested with SacI and XbaI and inserted into the cognate sites of YEp352. Construction of the double mutant was done by generating the N65Q mutation in the N4Q mutant.
Fluorescence microscopy of Mid2-GFP. Haploid strain DL2277 expressing Mid2-GFP from pRS315 was grown in SD medium for 24 h, subcultured in YEPD to an A600 of 0.5 to 1.0, and washed three times with phosphate-buffered saline (137 mM NaCl, 2.68 mM KCl, 10 mM Na2HPO4, 1.47 mM KH2OPO4 [pH 7.4]). The cells were resuspended in Vectashield mounting medium (Vector Laboratories, Inc.) with Hoechst 33342 (10 µg/ml). A Zeiss fluorescence microscope fitted with a fluorescein isothiocyanate filter was used to visualize cells.
Activation of Mpk1-HA by temperature shift and pheromone
treatment.
Strains expressing Mpk1-HA were tested for thermal
activation (18) or pheromone-induced activation
(1) of this protein kinase by immunoprecipitation of the
fusion protein from cell extracts with monoclonal antibody 12CA5 (BabCo
and Boehringer Mannheim), followed by immunocomplex protein kinase
assays. Strains were tested for thermal activation of Mpk1-HA as
described previously (18). Strains tested for
pheromone-induced activation were grown to a density of ca.
107 cells/ml at room temperature in SD medium. Cells were
harvested and resuspended in prewarmed (to 37°C) YEPD containing 100 mM sorbitol. The cultures were incubated at this temperature for 1.5 to
2 h until the cells, which bear a temperature-sensitive cdc28 allele, accumulated at the G1 block as
large unbudded cells. At this time (t = 0), samples of
each culture were removed for preparation of protein extracts (50 ml),
mating pheromone was added to the remaining culture (50 nM -factor),
and the cultures were incubated at 37°C. Samples (50 ml) were removed
at the indicated times following pheromone addition for preparation of
extracts. Extracts were prepared and protein concentrations were
determined as described previously (1). Immunocomplex
protein kinase assays were performed as described elsewhere
(18).
-Mannosidase treatment.
Mid2-HA and Hcs77-HA were
immunoprecipitated from cell extracts as described previously
(18) except that 100 µg of protein was used and the
immunoprecipitation buffer contained 1% Triton X-100 instead of
Nonidet P-40. Immunoprecipitates were washed twice with the mannosidase
assay buffer (100 mM sodium acetate [pH 5.0], 2 mM ZnCl2)
and resuspended in 15 µl of buffer. -Mannosidase (5 µl of 0.1 U/µl) was added to the immunocomplexes and incubated for 3 h at
37°C. Controls were mock treated with assay buffer only under the
same conditions. Samples were analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on an 8%
polyacrylamide gel followed by immunoblotting as described previously
(18). Protein concentrations of cell extracts that contained
detergent were determined by using the bicinchoninic acid protein assay
reagent (Pierce).
Fractionation of Hcs77-HA and Mid2-HA. Transformants of yeast strain 1788 expressing either Mid2-HA or Hcs77-HA from YEp352 were grown in YEPD to an A600 of 1 to 1.2. Cells were harvested from 400 ml, washed once with 10% sorbitol, and resuspended in 6 ml of lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM EDTA, 50 mM KF) with protease inhibitors (20 µg of leupeptin, 20 µg of benzamidine, 10 µg of pepstatin, and 40 µg of aprotinin per ml plus 1 mM phenylmethylsulfonyl fluoride). An equal volume of glass beads (0.3-mm diameter) was added to the suspension, and cells were broken by vigorous vortexing for 5 min at 4°C. The beads and cell debris were removed by centrifugation at 13,000 × g. This crude extract was split, and part was treated with Triton X-100 (1%) prior to centrifugation at 100,000 × g for 1 h at 4°C. The pellet was resuspended in a volume of lysis buffer equal to that of the supernatant, and both were analyzed by SDS-PAGE on an 8% gel.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The HCS77 gene encodes a predicted type 1 membrane protein (9). Its most prominent features include a single transmembrane domain near its C terminus, a long Ser/Thr-rich region (ca. 145 residues), and a potential Cys-zinc finger near its N terminus. Loss of HCS77 function results in a cell lysis defect during growth at 37 to 39°C (9, 16, 38), depending on the genetic background (unpublished results). This defect is accompanied by a deficiency in the ability to activate the Mpk1 MAP kinase in response to mild thermal stress (9). These findings, together with the localization of Hcs77 to the cell periphery (38), support a model in which Hcs77 functions as a sensor for cell integrity signaling (9, 16, 38).
Isolation of MID2 as a dosage suppressor of the
hcs77 defect.
In the course of screening a
centromeric library constructed to isolate the gene encoding a
mutational suppressor of the hcs77 growth defect, we
isolated a plasmid that contains the wild-type MID2 gene. An
hcs77 strain (DL1987) was transformed with a genomic yeast library and screened for suppression of its cell lysis defect at
39°C. We isolated from this screen a single plasmid (pRM5.2) which
contains a region of chromosome 12 with three complete ORFs. One of
these is MID2 (YLR332W); the others were RPS31
and an uncharacterized ORF, designated YLR331C. Deletion analysis of
this plasmid revealed that MID2 (for mating-induced death)
was the gene responsible for suppression of hcs77 (data
not shown). A MID2 isolate from wild-type cells was able to
suppress hcs77 when cloned into a centromeric vector.
Moreover, DNA sequence analysis of the plasmid-borne MID2
revealed no differences from the same region of DNA isolated by PCR
from the isogenic wild-type strain, indicating that MID2 acts as a dosage suppressor of the hcs77 defect, even
when expressed from a low-copy-number plasmid. This suppression was
more easily observed in an hcs77 wsc2 double mutant
(Fig. 1A), which has a growth defect
slightly more severe than that of the strain with hcs77
alone (38).
|
MID2 and HSC77 act in parallel to regulate cell integrity signaling. Three possibilities exist for the organization of a pathway in which both Hcs77 and Mid2 function. Mid2 might be under the control of Hcs77 such that overexpression of Mid2 drives pathway activation sufficiently to allow survival of thermal stress in the absence of signal from Hcs77. Alternatively, these proteins might act in parallel to provide a partially redundant function in the regulation of cell integrity signaling. Finally, Mid2 might positively regulate the expression of the HCS77-related genes WSC2, WSC3, and WSC4. However, steady-state mRNA levels from these genes were found to be unaffected by either overexpression or deletion of MID2 (data not shown), ruling out this last possibility.
To distinguish between the two remaining possibilities, we first tested for suppression of the mid2 defect by HCS77
overexpression. The MID2 gene was isolated initially for its
null mutant phenotype, which is failure to survive mating pheromone
treatment (30). Treatment of a MATa mid2
mutant with -factor resulted in 90% cell death after 5 h (Fig.
2). Overexpression of either
HCS77 (Fig. 2) or RHO1 (not shown) from episomal
plasmids partially suppressed this defect. The absence of an epistatic
relationship, demonstrated by the reciprocal suppression of
hcs77 by MID2 and mid2 by
HCS77, suggests that these genes function in parallel.
|
, suggests
that these proteins might have overlapping functions, although Hcs77
and Mid2 show no sequence similarity outside these generally related regions.
One prediction of a model in which Mid2 and Hcs77 share a function is
that the combined defect of mutations in both genes should be more
severe than either defect alone. Therefore, we tested the
mid2 and hcs77 mutations for additivity of
growth defects. Either mutation alone did not result in a growth defect at temperatures as high as 37°C (not shown). In contrast, the double
mutant was inviable even at room temperature (Fig.
3). This growth defect was suppressed by
the addition of 10% sorbitol to the growth medium for osmotic support
at temperatures as high as 34°C. Removal of osmotic support resulted
in immediate cell lysis, as judged microscopically by a high frequency
of nonrefractile ghosts. The behavior of the mid2
hcs77 mutant is characteristic of other mutants in the cell
integrity signaling pathway.
|
Mid2 and Hcs77 are plasma membrane-associated proteins.
Another prediction of a model in which Mid2 and Hcs77 function as
sensors for cell integrity signaling is that they should localize to
the plasma membrane. Hcs77 has been shown by fluorescence microscopy to
be distributed uniformly around the cell periphery (38). To
examine the intracellular localization of Mid2, we first fused GFP to
the C terminus of Mid2. This fusion protein was fully functional, as
judged by its ability to complement the pheromone sensitivity of the
mid2 mutant when expressed from a centromeric plasmid
(not shown). Fluorescence microscopy of cells expressing the Mid2-GFP
fusion from the same plasmid revealed that this protein localizes
uniformly around the cell periphery (Fig.
4A). By contrast, GFP alone, when
expressed in yeast, is cytoplasmic (38). No fluorescent
signal was detected from control cells (not shown). Treatment of cells
with mating pheromone for up to 6 h did not appear to alter the
localization of Mid2-GFP (not shown).
|
hcs77 mutant and the reciprocal suppression results described above, indicates that these genes provide
an essential but redundant function in the maintenance of cell
integrity during vegetative growth.
Mid2 has a homolog, Mtl1.
A search of the yeast genome
database revealed that MID2 has a homolog on chromosome 7. This uncharacterized ORF (YGR023) shows 50% amino acid sequence
identity with Mid2 (Fig. 5). The gene was
therefore designated MTL1 (for MID2-like). We
constructed a genomic deletion of MTL1 (see Materials and
Methods). An mtl1 mutant displayed no growth defect at
temperatures up to 39°C, nor was it sensitive to pheromone-induced
death (data not shown). However, a mid2 mtl1 mutant
displayed an osmotic-remedial lysis defect when grown at 39°C (Fig.
6A), as evidenced by a high frequency of
nonrefractile ghosts in the absence of osmotic support at the restrictive temperature. Overexpression of HCS77 weakly
suppressed this growth defect (Fig. 6B), further supporting a model in
which these genes share a common function during vegetative growth. Loss of MTL1 did not enhance the sensitivity of a
mid2 mutant to pheromone-induced killing, nor did it
confer pheromone sensitivity to an hcs77 mutant (not
shown). However, overexpression of MTL1 partially suppressed
the pheromone sensitivity of mid2. In contrast to
mid2, the mtl1 mutation did not exacerbate
the cell lysis defect of an hcs77 mutant, nor did
overexpression of MTL1 suppress hcs77. These
results, taken in the aggregate, indicate that MID2 plays a
more important role in both vegetative growth and pheromone sensitivity
than does MTL1.
|
|
mutant and an mtl1 mutant (compare lanes 4 and 5 and lanes 6 and
7, respectively). Mpk1 activation was severely impaired in the
mid2 mtl1 mutant but not completely eliminated
(compare lanes 8 and 9), consistent with the weak cell lysis defect of
the double mutant. It should be noted that the double mutant survived
this treatment for the duration of the experiment (data not shown). An
hcs77 mutant, which is also markedly impaired for Mpk1
activation, also retains some ability to stimulate this kinase. Because
an hcs77 mid2 mutant is inviable in the absence of
osmotic support, and high osmolarity prevents activation of Mpk1 in
response to thermal stress (18), we were unable to examine
Mpk1 activation in this mutant.
MID2 is required for cell integrity signaling in
response to mating pheromone-induced morphogenesis.
Cell integrity
signaling is activated by pheromone treatment at a time that is
coincident with the onset of morphogenesis (8). Moreover,
like mid2 mutants, mutants that fail to activate cell
integrity signaling are killed by pheromone treatment (8). Therefore, we examined the ability of a mid2 mutant to
activate cell integrity signaling in response to treatment with mating pheromone. Cells that are synchronized at Start display a strong activation of the Mpk1 MAP kinase in response to -factor treatment, which peaks approximately 1 h after exposure to the pheromone (1, 8) (Fig. 7). An isogenic
mid2 mutant was greatly impaired in this activation. It
should be noted that the mid2 mutant survived pheromone
treatment for the duration of this experiment (not shown). Interestingly, the pheromone-induced death of the mid2
mutant was not suppressed by osmotic support (1 M sorbitol), in
contrast to pheromone-induced death of an mpk1 mutant
(8). This finding suggests that Mid2 may serve an additional
function beyond regulation of cell integrity signaling.
|
Hcs77 and Mid2 are highly glycosylated proteins.
Hsc77-HA is
predicted to migrate on SDS-PAGE with a molecular mass of approximately
43 kDa. Instead, it migrated as a diffuse band with apparent molecular
mass of 85 to 90 kDa, suggesting that Hcs77 is a highly glycosylated
protein (Fig. 4B). This protein possesses two potential N-glycosylation
sites (AsnSer/Thr) at positions 4 and 65, as well as many potential
O-glycosylation sites in the Ser/Thr-rich region. To examine the
glycosylation state of this protein, we first eliminated the potential
N-glycosylation sites by mutating the acceptor Asn residues to Gln.
Figure 8A shows that neither of the
single mutants nor the double mutant had an altered mobility,
indicating that Hcs77 is not N-glycosylated. Additionally, these
mutants were fully functional for complementation of an
hcs77 mutant (not shown).
|
-mannosidase
treatment. This treatment hydrolyzes the -linkages between residues
of O-linked mannose chains. -Mannosidase can also hydrolyze mannosyl
residues present at the termini of N-linked GlcNAc chains. Figure 8B
shows that mannosidase treatment reduced Mid2-HA to a species of
apparent molecular mass of approximately 45 kDa and reduced Hcs77-HA to
a species of approximately 40 to 42 kDa. The observed values are nearly
identical to the predicted masses of the unmodified proteins,
confirming that Hcs77 (and strongly suggesting that Mid2) is
specifically O-mannosylated.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
MID2 and HCS77 act in parallel to stimulate
cell integrity signaling.
The HCS77 gene is thought to
encode a cell surface sensor that detects cell wall weakness during
vegetative growth. We isolated MID2 as a low-copy-number
dosage suppressor of the growth defect of an hcs77 mutant
at 39°C. Several additional observations support a model in which
Hcs77 and Mid2 are redundant sensors for cell integrity signaling
during growth. First, an hcs77 mid2 double mutant
displayed an osmotic remedial cell lysis defect that was much more
severe than that of an hcs77 mutant, failing to grow at
any temperature in the absence of osmotic support. Second, although
loss of MID2 function alone does not result in a growth defect (30), deletion of the MTL1 gene, which
encodes a Mid2-like protein (see below), in a mid2 mutant
resulted in an osmotic remedial cell lysis defect at 39°C that was
suppressed by overexpression of HCS77. Third, the ability to
activate cell integrity signaling at elevated growth temperature, as
measured by stimulation of the Mpk1 MAP kinase, was partially impaired
by deletion of HCS77, MID2, or MTL1.
Fourth, the structural similarity between Hcs77 and Mid2, together with
their intracellular colocalization, also suggests redundancy in
function. Specifically, they are both uniformly distributed through the
plasma membrane, presumably by virtue of their single membrane-spanning
regions. Additionally, they were both shown to be highly O-mannosylated
through long Ser/Thr-rich regions that are predicted to reside extracellularly.
cells (9, 38),
suggesting that these components of the cell integrity pathway function
downstream of HCS77. Similarly, we found that overexpression
of RHO1 also suppresses a mid2 mutant. However, overexpression of MID2 was capable of suppressing
the growth defect of one rho1 mutant (rho1-5). We
interpret this allele-specific suppression to indicate that
MID2 is not capable of bypassing the requirement for
RHO1 (either by acting downstream of or parallel to this G
protein) but instead suppresses the rho1-5 defect by acting
upstream of this allele. Therefore, we propose that both Hcs77 and Mid2
contribute to Rho1 activation.
MID2 is required for cell integrity signaling in
response to mating pheromone treatment.
The MID2 gene
was isolated initially because its loss of function causes cell death
in response to treatment with mating pheromone (30). Mutants
in MID2 arrest growth in G1 and undergo
morphogenesis in response to pheromone but fail to recover from this
arrest. Activation of cell integrity signaling is a late response to
pheromone treatment that, like MID2, is essential for
survival of pheromone-induced morphogenesis (8). In addition
to the role that Mid2 plays in signaling cell wall stress during
vegetative growth, we demonstrated that it is also critical for cell
integrity signaling during pheromone-induced morphogenesis.
Interestingly, in contrast to the behavior of an mpk1
mutant in response to pheromone (8), the pheromone
sensitivity of a mid2 mutant is not suppressed by the
addition of osmotic support to the medium (to prevent cell lysis),
suggesting that Mid2 may have an additional function in the survival of
pheromone treatment. Intriguingly, MID2 was also isolated as
a dosage suppressor of a strain with a mutation of MPT5
(37), which has been proposed to act through the Cdc28
cyclin-dependent kinase to stimulate passage through G1 in
pheromone-arrested cells (2). Therefore, Mid2 may have a
cell cycle function that is independent of its role in cell integrity
signaling. In contrast to Mid2, Hcs77 appears to be dedicated to
signaling cell wall perturbation during vegetative growth and thermal
stress, because a null mutant did not display sensitivity to killing by
mating pheromone (32a).
Hcs77 and Mid2 as sensors of cell wall stress.
The predicted
topography of these plasma membrane proteins, based on the positions of
their signal sequences, indicates that they have short C-terminal
cytoplasmic domains and longer extracellular domains that are very rich
in seryl and threonyl residues. These domains are separated by a single
transmembrane sequence. The extracellular domains are highly
O-mannosylated. In yeast, this modification consists of several (four
or five) mannosyl residues in -1,2 and 1,3 linkages (36).
When many such modifications are present in a stretch of seryl/threonyl
residues, as appears to be the case for both Hcs77 and Mid2, they
induce the polypeptide to adopt a stiff and extended conformation
(17). Therefore, Hcs77 and Mid2 may function as molecular
probes that span the periplasmic space to interact directly with the
cell wall. If these proteins are glycosylated throughout their
Ser/Thr-rich regions, the calculated extents of Mid2 (ca. 470 Å) and
Hcs77 (ca. 370 Å) are adequate to span the distance from the plasma membrane to the cell wall (ca. 200 to 300 Å).
The Mid2 homolog, Mtl1.
We isolated a gene predicted to encode
a polypeptide showing 50% amino acid sequence identity with Mid2. Loss
of MTL1 function did not result in any overt defects, either
during vegetative growth or in response to mating pheromone, nor did it
exacerbate either the pheromone sensitivity of a mid2
mutant or the cell lysis defect of an hcs77 mutant.
However, a mid2 mtl1 mutant displayed a weak cell
lysis defect when cultivated at high temperature and was more impaired
for thermal activation of the Mpk1 MAP kinase than was a
mid2 mutant. Therefore, MTL1 appears to play a
minor role in cell integrity signaling during vegetative growth.
| |
ACKNOWLEDGMENTS |
|---|
We thank H. Iida, J. Gray, and S. Michaelis for strains and plasmids.
This work was supported by grants from the NIH (GM48533 to D.E.L. and GM39852 to B. E. and training grant 5T32CA09110) and the American Cancer Society (Faculty Research Award 446 to D.E.L.) and by Center Grant ES-03819 from the NIEHS.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, The Johns Hopkins University, School of Public Health, 615 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-9825. Fax: (410) 955-2926. E-mail: levin{at}welchlink.welch.jhu.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Buehrer, B. M., and B. Errede.
1997.
Coordination of the mating and cell integrity mitogen-activated protein kinase pathways in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:6517-6525 |
| 2. |
Chen, T., and J. Kurjan.
1997.
Saccharomyces cerevisiae Mpt5p interacts with Sst2p and plays a role in pheromone sensitivity and recovery from pheromone arrest.
Mol. Cell. Biol.
17:3429-3439 |
| 3. |
Cid, V. J.,
A. Duran,
F. Rey,
M. P. Snyder,
C. Nombela, and M. Sanchez.
1995.
Molecular basis of cell integrity and morphogenesis in Saccharomyces cerevisiae.
Microbiol. Rev.
59:345-386 |
| 4. |
Costigan, C.,
S. Gehrung, and M. Snyder.
1992.
A synthetic lethal screen identifies SLK1, a novel protein kinase homolog implicated in yeast cell morphogenesis and cell growth.
Mol. Cell. Biol.
12:1162-1178 |
| 5. |
Davenport, K. R.,
M. Sohaskey,
Y. Kamada, and D. E. Levin.
1995.
A second osmosensing signal transduction pathway in yeast.
J. Biol. Chem.
270:30157-30161 |
| 6. |
Douglas, C. M.,
F. Foor,
J. A. Marrinan,
N. Morin,
J. B. Nielsen,
A. M. Dahl,
P. Mazur,
W. Baginsky,
W. Li,
M. El-Sherbeini,
J. A. Clemas,
S. M. Mandala,
B. R. Frommer, and M. B. Kurtz.
1994.
The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3--D-glucan synthase.
Proc. Natl. Acad. Sci. USA
91:12907-12911 |
| 7. | Drgonova, J., T. Drgon, K. Tanaka, R. Kollar, G.-C. Chen, R. A. Ford, C. S. M. Chan, Y. Takai, and E. Cabib. 1996. Rho1p, a yeast protein at the interface between cell polarization and morphogenesis. Science 272:277-279[Abstract]. |
| 8. | Errede, B., R. M. Cade, B. M. Yashar, Y. Kamada, D. E. Levin, K. Irie, and K. Matsomoto. 1995. Dynamics and organization of MAP kinase signal pathways. Mol. Reprod. Dev. 42:477-485[Medline]. |
| 9. | Gray, J. V., J. P. Ogas, Y. Kamada, M. Stone, D. E. Levin, and I. Herskowitz. 1997. A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator. EMBO J. 16:4924-4937[Medline]. |
| 10. | Hill, J. E., A. M. Muers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167[Medline]. |
| 11. | Ho, S.-N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59[Medline]. |
| 12. |
Iida, H.,
H. Nakamura,
T. Ono,
M. S. Okumura, and Y. Anraku.
1994.
MID1, a novel Saccharomyces cerevisiae gene encoding a plasma membrane protein, is required for Ca2+ influx and mating.
Mol. Cell. Biol.
14:8259-8271 |
| 13. |
Inoue, S. B.,
N. Takewaki,
T. Takasuka,
T. Mio,
M. Adachi,
Y. Fujii,
C. Miyamoto,
M. Arisawa,
Y. Furuichi, and T. Watanabe.
1995.
Characterization and gene cloning of 1,3--D-glucan synthase from Saccharomyces cerevisiae.
Eur. J. Biochem.
231:845-854[Medline].
|
| 14. |
Irie, K.,
M. Takase,
K. S. Lee,
D. E. Levin,
H. Araki,
K. Matsumoto, and Y. Oshima.
1993.
MKK1 and MKK2, which encode Saccharomyces cerevisiae mitogen-activated protein kinase-kinase homologs, function in the pathway mediated by protein kinase C.
Mol. Cell. Biol.
13:3076-3083 |
| 15. |
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168 |
| 16. | Jacoby, J. J., S. M. Nilius, and J. J. Heinisch. 1998. A screen for upstream components of the yeast protein kinase C signal transduction pathway identifies the product of the SLG1 gene. Mol. Gen. Genet. 258:148-155[Medline]. |
| 17. | Jentoft, N. 1990. Why are proteins O-glycosylated. Trends Biochem. Sci. 15:291-294[Medline]. |
| 18. |
Kamada, Y.,
U. S. Jung,
J. Piotrowski, and D. E. Levin.
1995.
The protein kinase C-activated MAP kinase pathway of Saccharomyces cerevisiae mediates a novel aspect of the heat shock response.
Genes Dev.
9:1559-1571 |
| 19. |
Kamada, Y.,
H. Qadota,
C. P. Python,
Y. Anraku,
Y. Ohya, and D. E. Levin.
1996.
Activation of yeast protein kinase C by Rho1 GTPase.
J. Biol. Chem.
271:9193-9195 |
| 20. | Klis, F. M. 1994. Review: cell wall assembly in yeast. Yeast 10:851-869[Medline]. |
| 21. |
Lee, K. S.,
K. Irie,
Y. Gotoh,
Y. Watanabe,
H. Araki,
E. Nishida,
K. Matsumoto, and D. E. Levin.
1993.
A yeast mitogen-activated protein kinase homolog (Mpk1) mediates signaling by protein kinase C.
Mol. Cell. Biol.
13:3067-3075 |
| 22. |
Lee, K. S., and D. E. Levin.
1992.
Dominant mutations in a gene encoding a putative protein kinase (BCK1) bypass the requirement for a Saccharomyces cerevisiae protein kinase C homolog.
Mol. Cell. Biol.
12:172-182 |
| 23. |
Levin, D. E., and E. Bartlett-Heubusch.
1992.
Mutants in the S. cerevisiae PKC1 gene display a cell cycle-specific osmotic stability defect.
J. Cell Biol.
116:1221-1229 |
| 24. | Levin, D. E., B. Bowers, C. Chen, Y. Kamada, and M. Watanabe. 1994. Dissecting the protein kinase C/MAP kinase signalling pathway of Saccharomyces cerevisiae. Cell. Mol. Biol. Res. 40:229-239[Medline]. |
| 25. | Levin, D. E., and B. Errede. 1995. The proliferation of MAP kinase signaling pathways in yeast. Curr. Opin. Cell Biol. 7:197-202[Medline]. |
| 26. | Levin, D. E., F. O. Fields, R. Kunisawa, J. M. Bishop, and J. Thorner. 1990. A candidate protein kinase C gene PKC1, is required for the S. cerevisiae cell cycle. Cell 62:213-224[Medline]. |
| 27. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 28. |
Mazur, P.,
N. Morin,
W. Baginsky,
M. El-Sherbeini,
J. A. Clemas,
J. B. Nielsen, and F. Foor.
1995.
Differential expression and function of two homologous subunits of yeast 1,3--D-glucan synthase.
Mol. Cell. Biol.
15:5671-5681 |
| 29. | Nonaka, H., K. Tanaka, H. Hirano, T. Fujiwara, H. Kohno, M. Umikawa, A. Mino, and Y. Takai. 1995. A downstream target of RHO1 small GTP-binding protein is PKC1, a homolog of protein kinase C, which leads to activation of the MAP kinase cascade in Saccharomyces cerevisiae. EMBO J. 14:5931-5938[Medline]. |
| 30. | Ono, T., T. Suzuki, Y. Anraku, and H. Iida. 1994. The MID2 gene encodes a putative integral membrane protein with a Ca(2+)-binding domain and shows mating pheromone-stimulated expression in Saccharomyces cerevisiae. Gene 151:203-208[Medline]. |
| 31. |
Paravicini, G.,
M. Cooper,
L. Friedli,
D. J. Smith,
J.-L. Carpentier,
L. S. Klig, and M. A. Payton.
1992.
The osmotic integrity of the yeast cell requires a functional PKC1 gene product.
Mol. Cell Biol.
12:4896-4905 |
| 32. |
Qadota, H.,
C. P. Python,
S. B. Inoue,
M. Arisawa,
Y. Anraku,
Y. Zheng,
T. Watanabe,
D. E. Levin, and Y. Ohya.
1996.
Identification of yeast Rho1p GTPase as a regulatory subunit of 1,3--glucan synthase.
Science
272:279-281[Abstract].
|
| 32a. | Rajavel, M. Unpublished results. |
| 33. |
Ram, A. F. J.,
S. S. C. Brekelmans,
L. J. W. M. Oehlen, and F. M. Klis.
1995.
Identification of two cell cycle regulated genes affecting the -1,3-glucan content of cell wall in Saccharomyces cerevisiae.
FEBS Lett.
358:165-170[Medline].
|
| 34. | Rose, M. D., F. Winston, and P. Hieter. 1990. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 36. | Strahl-Bolsinger, S., M. Gentzsch, and W. Tanner. 1999. Protein O-mannosylation. Biochim. Biophys. Acta 1426:297-307[Medline]. |
| 37. | Takeuchi, J., M. Okada, A. Toh-e, and Y. Kikuchi. 1995. The SMS1 gene encoding a serine-rich transmembrane protein suppresses the temperature sensitivity of the htr1 disruptant of Saccharomyces cerevisiae. Biochim. Biophys. Acta 1260:94-96[Medline]. |
| 38. |
Verna, J.,
A. Lodder,
K. Lee,
A. Vagts, and R. Ballester.
1997.
A family of genes required for the maintenance of cell wall integrity and for the stress response in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
94:13804-13809 |
| 39. |
Watanabe, M.,
C.-Y. Chen, and D. E. Levin.
1994.
Saccharomyces cerevisiae PKC1 encodes a protein kinase C (PKC) homolog with a substrate specificity similar to that of mammalian PKC.
J. Biol. Chem.
269:16829-16836 |
| 40. | Wilson, I. A., H. L. Niman, R. A. Houghten, A. R. Cherenson, M. L. Connolly, and R. A. Lerner. 1984. The structure of an antigenic determinant in a protein. Cell 37:767-778[Medline]. |
| 41. |
Zhao, C.,
U. S. Jung,
P. Garrett-Engele,
T. Y. Roe,
M. S. Cyert, and D. E. Levin.
1998.
Temperature-induced expression of yeast FKS2 is under the dual control of protein kinase C and calcineurin.
Mol. Cell. Biol.
18:1013-1022 |
Molecular and Cellular Biology, June 1999, p. 3969-3976, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Birkaya, B., Maddi, A., Joshi, J., Free, S. J., Cullen, P. J.
(2009). Role of the Cell Wall Integrity and Filamentous Growth Mitogen-Activated Protein Kinase Pathways in Cell Wall Remodeling during Filamentous Growth. Eukaryot Cell
8: 1118-1133
[Abstract] [Full Text] -
Zhang, L., Feng, D., Fang, W., Ouyang, H., Luo, Y., Du, T., Jin, C.
(2009). Comparative proteomic analysis of an Aspergillus fumigatus mutant deficient in glucosidase I (AfCwh41). Microbiology
155: 2157-2167
[Abstract] [Full Text] -
Garcia, R., Rodriguez-Pena, J. M., Bermejo, C., Nombela, C., Arroyo, J.
(2009). The High Osmotic Response and Cell Wall Integrity Pathways Cooperate to Regulate Transcriptional Responses to Zymolyase-induced Cell Wall Stress in Saccharomyces cerevisiae. J. Biol. Chem.
284: 10901-10911
[Abstract] [Full Text] -
Hasegawa, Y., Irie, K., Gerber, A. P.
(2008). Distinct roles for Khd1p in the localization and expression of bud-localized mRNAs in yeast. RNA
14: 2333-2347
[Abstract] [Full Text] -
Bermejo, C., Rodriguez, E., Garcia, R., Rodriguez-Pena, J. M., Rodriguez de la Concepcion, M. L., Rivas, C., Arias, P., Nombela, C., Posas, F., Arroyo, J.
(2008). The Sequential Activation of the Yeast HOG and SLT2 Pathways Is Required for Cell Survival to Cell Wall Stress. Mol. Biol. Cell
19: 1113-1124
[Abstract] [Full Text] -
Fujioka, T., Mizutani, O., Furukawa, K., Sato, N., Yoshimi, A., Yamagata, Y., Nakajima, T., Abe, K.
(2007). MpkA-Dependent and -Independent Cell Wall Integrity Signaling in Aspergillus nidulans. Eukaryot Cell
6: 1497-1510
[Abstract] [Full Text] -
Hutzler, J., Schmid, M., Bernard, T., Henrissat, B., Strahl, S.
(2007). Membrane association is a determinant for substrate recognition by PMT4 protein O-mannosyltransferases. Proc. Natl. Acad. Sci. USA
104: 7827-7832
[Abstract] [Full Text] -
Wright, C. M., Fewell, S. W., Sullivan, M. L., Pipas, J. M., Watkins, S. C., Brodsky, J. L.
(2007). The Hsp40 Molecular Chaperone Ydj1p, Along With the Protein Kinase C Pathway, Affects Cell-Wall Integrity in the Yeast Saccharomyces cerevisiae. Genetics
175: 1649-1664
[Abstract] [Full Text] -
Park, H.-O., Bi, E.
(2007). Central Roles of Small GTPases in the Development of Cell Polarity in Yeast and Beyond. Microbiol. Mol. Biol. Rev.
71: 48-96
[Abstract] [Full Text] -
Stewart, M. S., Krause, S. A., McGhie, J., Gray, J. V.
(2007). Mpt5p, a Stress Tolerance- and Lifespan-Promoting PUF Protein in Saccharomyces cerevisiae, Acts Upstream of the Cell Wall Integrity Pathway. Eukaryot Cell
6: 262-270
[Abstract] [Full Text] -
Piao, H. L., Machado, I. M.P., Payne, G. S.
(2007). NPFXD-mediated Endocytosis Is Required for Polarity and Function of a Yeast Cell Wall Stress Sensor. Mol. Biol. Cell
18: 57-65
[Abstract] [Full Text] -
Serrano, R., Martin, H., Casamayor, A., Arino, J.
(2006). Signaling Alkaline pH Stress in the Yeast Saccharomyces cerevisiae through the Wsc1 Cell Surface Sensor and the Slt2 MAPK Pathway. J. Biol. Chem.
281: 39785-39795
[Abstract] [Full Text] -
Lesage, G., Bussey, H.
(2006). Cell Wall Assembly in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
70: 317-343
[Abstract] [Full Text] -
Lottersberger, F., Panza, A., Lucchini, G., Piatti, S., Longhese, M. P.
(2006). The Saccharomyces cerevisiae 14-3-3 Proteins Are Required for the G1/S Transition, Actin Cytoskeleton Organization and Cell Wall Integrity. Genetics
173: 661-675
[Abstract] [Full Text] -
Fernandes, H., Roumanie, O., Claret, S., Gatti, X., Thoraval, D., Doignon, F., Crouzet, M.
(2006). The Rho3 and Rho4 small GTPases interact functionally with Wsc1p, a cell surface sensor of the protein kinase C cell-integrity pathway in Saccharomyces cerevisiae.. Microbiology
152: 695-708
[Abstract] [Full Text] -
Claret, S., Gatti, X., Doignon, F., Thoraval, D., Crouzet, M.
(2005). The Rgd1p Rho GTPase-Activating Protein and the Mid2p Cell Wall Sensor Are Required at Low pH for Protein Kinase C Pathway Activation and Cell Survival in Saccharomyces cerevisiae. Eukaryot Cell
4: 1375-1386
[Abstract] [Full Text] -
Levin, D. E.
(2005). Cell Wall Integrity Signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
69: 262-291
[Abstract] [Full Text] -
Imazu, H., Sakurai, H.
(2005). Saccharomyces cerevisiae Heat Shock Transcription Factor Regulates Cell Wall Remodeling in Response to Heat Shock. Eukaryot Cell
4: 1050-1056
[Abstract] [Full Text] -
Vilella, F., Herrero, E., Torres, J., de la Torre-Ruiz, M. A.
(2005). Pkc1 and the Upstream Elements of the Cell Integrity Pathway in Saccharomyces cerevisiae, Rom2 and Mtl1, Are Required for Cellular Responses to Oxidative Stress. J. Biol. Chem.
280: 9149-9159
[Abstract] [Full Text] -
Vay, H. A., Philip, B., Levin, D. E.
(2004). Mutational analysis of the cytoplasmic domain of the Wsc1 cell wall stress sensor. Microbiology
150: 3281-3288
[Abstract] [Full Text] -
Wang, K., Vavassori, S., Schweizer, L. M., Schweizer, M.
(2004). Impaired PRPP-synthesizing capacity compromises cell integrity signalling in Saccharomyces cerevisiae. Microbiology
150: 3327-3339
[Abstract] [Full Text] -
Gray, J. V., Petsko, G. A., Johnston, G. C., Ringe, D., Singer, R. A., Werner-Washburne, M.
(2004). "Sleeping Beauty": Quiescence in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
68: 187-206
[Abstract] [Full Text] -
Garcia, R., Bermejo, C., Grau, C., Perez, R., Rodriguez-Pena, J. M., Francois, J., Nombela, C., Arroyo, J.
(2004). The Global Transcriptional Response to Transient Cell Wall Damage in Saccharomyces cerevisiae and Its Regulation by the Cell Integrity Signaling Pathway. J. Biol. Chem.
279: 15183-15195
[Abstract] [Full Text] -
Proszynski, T. J., Simons, K., Bagnat, M.
(2004). O-Glycosylation as a Sorting Determinant for Cell Surface Delivery in Yeast. Mol. Biol. Cell
15: 1533-1543
[Abstract] [Full Text] -
Merchan, S., Bernal, D., Serrano, R., Yenush, L.
(2004). Response of the Saccharomyces cerevisiae Mpk1 Mitogen-Activated Protein Kinase Pathway to Increases in Internal Turgor Pressure Caused by Loss of Ppz Protein Phosphatases. Eukaryot Cell
3: 100-107
[Abstract] [Full Text] -
Lommel, M., Bagnat, M., Strahl, S.
(2004). Aberrant Processing of the WSC Family and Mid2p Cell Surface Sensors Results in Cell Death of Saccharomyces cerevisiae O-Mannosylation Mutants. Mol. Cell. Biol.
24: 46-57
[Abstract] [Full Text] -
Reinoso-Martin, C., Schuller, C., Schuetzer-Muehlbauer, M., Kuchler, K.
(2003). The Yeast Protein Kinase C Cell Integrity Pathway Mediates Tolerance to the Antifungal Drug Caspofungin through Activation of Slt2p Mitogen-Activated Protein Kinase Signaling. Eukaryot Cell
2: 1200-1210
[Abstract] [Full Text] -
deHart, A. K.A., Schnell, J. D., Allen, D. A., Tsai, J.-Y., Hicke, L.
(2003). Receptor Internalization in Yeast Requires the Tor2-Rho1 Signaling Pathway. Mol. Biol. Cell
14: 4676-4684
[Abstract] [Full Text] -
Bonilla, M., Cunningham, K. W.
(2003). Mitogen-activated Protein Kinase Stimulation of Ca2+ Signaling Is Required for Survival of Endoplasmic Reticulum Stress in Yeast. Mol. Biol. Cell
14: 4296-4305
[Abstract] [Full Text] -
Shepard, K. A., Gerber, A. P., Jambhekar, A., Takizawa, P. A., Brown, P. O., Herschlag, D., DeRisi, J. L., Vale, R. D.
(2003). Widespread cytoplasmic mRNA transport in yeast: Identification of 22 bud-localized transcripts using DNA microarray analysis. Proc. Natl. Acad. Sci. USA
100: 11429-11434
[Abstract] [Full Text] -
Valdivia, R. H., Schekman, R.
(2003). The yeasts Rho1p and Pkc1p regulate the transport of chitin synthase III (Chs3p) from internal stores to the plasma membrane. Proc. Natl. Acad. Sci. USA
100: 10287-10292
[Abstract] [Full Text] -
Green, R., Lesage, G., Sdicu, A.-M., Menard, P., Bussey, H.
(2003). A synthetic analysis of the Saccharomyces cerevisiae stress sensor Mid2p, and identification of a Mid2p-interacting protein, Zeo1p, that modulates the PKC1-MPK1 cell integrity pathway. Microbiology
149: 2487-2499
[Abstract] [Full Text] -
Lagorce, A., Hauser, N. C., Labourdette, D., Rodriguez, C., Martin-Yken, H., Arroyo, J., Hoheisel, J. D., Francois, J.
(2003). Genome-wide Analysis of the Response to Cell Wall Mutations in the Yeast Saccharomyces cerevisiae. J. Biol. Chem.
278: 20345-20357
[Abstract] [Full Text] -
Romeo, M. J., Angus-Hill, M. L., Sobering, A. K., Kamada, Y., Cairns, B. R., Levin, D. E.
(2002). HTL1 Encodes a Novel Factor That Interacts with the RSC Chromatin Remodeling Complex in Saccharomyces cerevisiae. Mol. Cell. Biol.
22: 8165-8174
[Abstract] [Full Text] -
Torres, J., Di Como, C. J., Herrero, E., de la Torre-Ruiz, M. A.
(2002). Regulation of the Cell Integrity Pathway by Rapamycin-sensitive TOR Function in Budding Yeast. J. Biol. Chem.
277: 43495-43504
[Abstract] [Full Text] -
Zhang, M., Bennett, D., Erdman, S. E.
(2002). Maintenance of Mating Cell Integrity Requires the Adhesin Fig2p. Eukaryot Cell
1: 811-822
[Abstract] [Full Text] -
Sekiya-Kawasaki, M., Abe, M., Saka, A., Watanabe, D., Kono, K., Minemura-Asakawa, M., Ishihara, S., Watanabe, T., Ohya, Y.
(2002). Dissection of Upstream Regulatory Components of the Rho1p Effector, 1,3-{beta}-Glucan Synthase, in Saccharomyces cerevisiae. Genetics
162: 663-676
[Abstract] [Full Text] -
Hahn, J.-S., Thiele, D. J.
(2002). Regulation of the Saccharomyces cerevisiae Slt2 Kinase Pathway by the Stress-inducible Sdp1 Dual Specificity Phosphatase. J. Biol. Chem.
277: 21278-21284
[Abstract] [Full Text] -
Hohmann, S.
(2002). Osmotic Stress Signaling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev.
66: 300-372
[Abstract] [Full Text] -
Chai, B., Hsu, J.-m., Du, J., Laurent, B. C.
(2002). Yeast RSC Function Is Required for Organization of the Cellular Cytoskeleton via an Alternative PKC1 Pathway. Genetics
161: 575-584
[Abstract] [Full Text] -
Sobering, A. K., Jung, U. S., Lee, K. S., Levin, D. E.
(2002). Yeast Rpi1 Is a Putative Transcriptional Regulator That Contributes to Preparation for Stationary Phase. Eukaryot Cell
1: 56-65
[Abstract] [Full Text] -
Schmitz, H.-P., Huppert, S., Lorberg, A., Heinisch, J. J.
(2002). Rho5p downregulates the yeast cell integrity pathway. J. Cell Sci.
115: 3139-3148
[Abstract] [Full Text] -
de Bettignies, G., Thoraval, D., Morel, C., Peypouquet, M. F., Crouzet, M.
(2001). Overactivation of the Protein Kinase C-Signaling Pathway Suppresses the Defects of Cells Lacking the Rho3/Rho4-GAP Rgd1p in Saccharomyces cerevisiae. Genetics
159: 1435-1448
[Abstract] [Full Text] -
Santos, J. L., Shiozaki, K.
(2001). Fungal Histidine Kinases. Sci Signal
2001: re1-re1
[Abstract] [Full Text] -
Trotter, E. W., Berenfeld, L., Krause, S. A., Petsko, G. A., Gray, J. V.
(2001). Protein misfolding and temperature up-shift cause G1 arrest via a common mechanism dependent on heat shock factor in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
98: 7313-7318
[Abstract] [Full Text] -
Smits, G. J., van den Ende, H., Klis, F. M.
(2001). Differential regulation of cell wall biogenesis during growth and development in yeast. Microbiology
147: 781-794
[Full Text] -
Philip, B., Levin, D. E.
(2001). Wsc1 and Mid2 Are Cell Surface Sensors for Cell Wall Integrity Signaling That Act through Rom2, a Guanine Nucleotide Exchange Factor for Rho1. Mol. Cell. Biol.
21: 271-280
[Abstract] [Full Text] -
Marcoux, N., Cloutier, S., Zakrzewska, E., Charest, P.-M., Bourbonnais, Y., Pallotta, D.
(2000). Suppression of the Profilin-Deficient Phenotype by the RHO2 Signaling Pathway in Saccharomyces cerevisiae. Genetics
156: 579-592
[Abstract] [Full Text] -
de Nobel, H., Ruiz, C., Martin, H., Morris, W., Brul, S., Molina, M., Klis, F. M.
(2000). Cell wall perturbation in yeast results in dual phosphorylation of the Slt2/Mpk1 MAP kinase and in an Slt2-mediated increase in FKS2-lacZ expression, glucanase resistance and thermotolerance. Microbiology
146: 2121-2132
[Abstract] [Full Text] -
Li, Y., Moir, R. D., Sethy-Coraci, I. K., Warner, J. R., Willis, I. M.
(2000). Repression of Ribosome and tRNA Synthesis in Secretion-Defective Cells Is Signaled by a Novel Branch of the Cell Integrity Pathway. Mol. Cell. Biol.
20: 3843-3851
[Abstract] [Full Text] -
Turchini, A., Ferrario, L., Popolo, L.
(2000). Increase of External Osmolarity Reduces Morphogenetic Defects and Accumulation of Chitin in a gas1 Mutant of Saccharomyces cerevisiae. J. Bacteriol.
182: 1167-1171
[Abstract] [Full Text] -
Roberts, C. J., Nelson, B., Marton, M. J., Stoughton, R., Meyer, M. R., Bennett, H. A., He, Y. D., Dai, H., Walker, W. L., Hughes, T. R., Tyers, M., Boone, C., Friend, S. H.
(2000). Signaling and Circuitry of Multiple MAPK Pathways Revealed by a Matrix of Global Gene Expression Profiles. Science
287: 873-880
[Abstract] [Full Text] -
Martin, H., Rodriguez-Pachon, J. M., Ruiz, C., Nombela, C., Molina, M.
(2000). Regulatory Mechanisms for Modulation of Signaling through the Cell Integrity Slt2-mediated Pathway in Saccharomyces cerevisiae. J. Biol. Chem.
275: 1511-1519
[Abstract] [Full Text] -
Pruyne, D, Bretscher, A
(2000). Polarization of cell growth in yeast. I. Establishment and maintenance of polarity states. J. Cell Sci.
113: 365-375
[Abstract] -
Andrews, P., Stark, M.
(2000). Type 1 protein phosphatase is required for maintenance of cell wall integrity, morphogenesis and cell cycle progression in Saccharomyces cerevisiae. J. Cell Sci.
113: 507-520
[Abstract] -
Mattison, C. P., Spencer, S. S., Kresge, K. A., Lee, J., Ota, I. M.
(1999). Differential Regulation of the Cell Wall Integrity Mitogen-Activated Protein Kinase Pathway in Budding Yeast by the Protein Tyrosine Phosphatases Ptp2 and Ptp3. Mol. Cell. Biol.
19: 7651-7660
[Abstract] [Full Text] -
Delley, P.-A., Hall, M. N.
(1999). Cell Wall Stress Depolarizes Cell Growth via Hyperactivation of Rho1. JCB
147: 163-174
[Abstract] [Full Text] -
Atienza, J. M., Suh, M., Xenarios, I., Landgraf, R., Colicelli, J.
(2000). Human ERK1 Induces Filamentous Growth and Cell Wall Remodeling Pathways in Saccharomyces cerevisiae. J. Biol. Chem.
275: 20638-20646
[Abstract] [Full Text] -
Cabib, E., Roh, D.-H., Schmidt, M., Crotti, L. B., Varma, A.
(2001). The Yeast Cell Wall and Septum as Paradigms of Cell Growth and Morphogenesis. J. Biol. Chem.
276: 19679-19682
[Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»